Post-Synaptic Density Proteins in Oligodendrocytes are Required for Activity-Dependent Myelin Sheath Growth

Post-Synaptic Density Proteins in Oligodendrocytes are Required for Activity-Dependent Myelin Sheath Growth | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Post-Synaptic Density Proteins in Oligodendrocytes are Required for Activity-Dependent Myelin Sheath Growth View ORCID Profile MA Masson , M Graciarena , M Porte , View ORCID Profile B Nait Oumesmar doi: https://doi.org/10.1101/2025.02.10.637467 MA Masson 1 Paris Brain Institute - ICM, Sorbonne Université , Inserm U1127, CNRS UMR 7225, Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for MA Masson M Graciarena 1 Paris Brain Institute - ICM, Sorbonne Université , Inserm U1127, CNRS UMR 7225, Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site M Porte 1 Paris Brain Institute - ICM, Sorbonne Université , Inserm U1127, CNRS UMR 7225, Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site B Nait Oumesmar 1 Paris Brain Institute - ICM, Sorbonne Université , Inserm U1127, CNRS UMR 7225, Paris, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for B Nait Oumesmar For correspondence: brahim.naitoumesmar{at}icm-institute.org Abstract Full Text Info/History Metrics Supplementary material Preview PDF SUMMARY Compelling evidence demonstrates a functional link between neuronal activity and myelination, highlighting the vital importance of axon-oligodendrocyte crosstalk in myelin physiology and function. However, how neuronal activity is relayed to oligodendroglia to regulate myelin formation remains not fully understood. Here, we aimed to characterize how that myelination is regulated by glutamate vesicular release in zebrafish spinal cord. We compared oligodendrocyte precursor cells (OPCs) and myelinating oligodendrocytes (mOLs) for their close apposition with pre-synaptic boutons and found that these are increased in number on mOLs during myelin internode elongation. Consistently, mOLs show more pre-synaptic boutons during myelin internode elongation compared to OPCs. In addition, we also found that oligodendroglial cells express the post-synaptic density protein 95 (PSD-95) along punctated domains, regardless of their differentiation stage. Genetically targeted PSD-95-GFP expression in oligodendroglia revealed post-synaptic-like domains along their processes and sheaths, which are contacted by axonal pre-synaptic varicosities. These contacts are increased in mOLs. Importantly, CRISPR-Cas9 mediated deletion of dlg4 in oligodendroglia impairs myelin sheath growth , in vivo . Overall, our data indicate that PSD-95 is a key component of axons to oligodendrocytes neurotransmission that regulates myelin sheath growth. HIGHLIGHTS Glutamate vesicular release is required for myelination Axon-oligodendroglia connectivity increases with oligodendrocyte maturation Oligodendrocytes express the post-synaptic density protein 95 Dlg4 loss-of-function in oligodendroglia impedes myelin sheath growth Download figure Open in new tab Introduction Myelin is a multilamellar lipid rich structure insulating axons and allowing the saltatory conduction of action potentials. In the central nervous system (CNS), oligodendrocytes (OLs) preferentially myelinate electrically active axons 1 – 5 , supporting the notion that neuronal activity regulates myelination. In turn, adult myelination regulates complex behaviors 6 – 8 . Therefore, changes in myelin microstructure sense and affect the functional connectivity of neural circuits, underlying vital neurological functions. OLs derive from oligodendrocyte precursor cells (OPCs), which constitute the major cellular source for myelin regeneration 9 . OPCs receive AMPA- and NMDA-mediated synaptic inputs from neuronal fibers throughout the CNS ( 10 – 12 and others), with AMPA receptors exerting a positive role on myelination 13 . NMDA receptors are also expressed in oligodendroglial cells including myelinating oligodendrocytes (mOLs) 14 , 15 but their role in myelination is still controversial 16 – 19 . Importantly, these synapses are generally thought to be restricted to the OPC stage and rapidly lost upon differentiation into mOLs 20 , 21 . However, recent evidence indicates that glutamate induces calcium transients in myelin sheaths 22 – 24 . In addition, electrical activity affects myelin retraction and stabilization in nascent sheaths rather than myelination onset 4 , 5 , 24 . The nature and extent of connectivity between axons and oligodendroglial cells during lineage progression and myelination remain poorly characterized. Here, we show that vesicular release of glutamate plays a key role in myelin sheath growth in zebrafish larvae. Among oligodendroglial cells, mOLs undergoing sheath extension bear the highest extent of pre-synaptic vesicle appositions. Interestingly, we showed that PSD-95, a major scaffolding PDZ protein of glutamatergic post-synaptic densities in neurons, is expressed by oligodendroglia at all differentiation stages. However, PSD-95 clusters, as a counterpart of pre-synaptic boutons, are highest in mOLs undergoing sheath extension. Remarkably, oligodendroglia cell-specific knock-out (KO) of dlg4 showed impaired myelin sheath elongation. Taken together, our data reveal an increasing connectivity throughout oligodendroglial lineage progression, highlighting mOLs as a cellular target for neuronal activity. Results Myelinating oligodendrocytes establish synaptic-like connectivity with axons Broad evidence showed that electrical activity regulates myelination, though synaptic vesicular release of neurotransmitters along axons 2 , 25 . However, the mode of communication and the extent of connectivity of mOLs with axons remain still poorly understood. To decipher the modes of interaction between OLs and axons, we assessed the impact of glutamate vesicular release on myelination in vivo . To do so, we generated the Tg(vGlut2a:Gal4;UAS:BnTx/LC:GFP::sox10:mRFP) 26 , 27 zebrafish line, where glutamatergic neurons visualized with GFP have their vesicular release impaired by botulinum toxin (BnTx), while sox10-mRFP labels the oligodendroglial population ( Figure 1A ). At 5 days post-fertilization (dpf), we observed a marked decrease of mRFP-positive myelin area in BnTx-expressing larvae ( Figure 1C, D ) with respect to controls ( Figure 1B ). Myelination impairment in BnTx-expressing larvae was further confirmed by electron microscopy (EM) ( Figure 1E, F ) and quantification of myelinated axons in the ventral spinal cord, which was significantly reduced in BnTx-expressing zebrafish larvae ( Figure 1G ). To exclude any potential effects of BnTx on neuronal and oligodendroglial cell proliferation or death, we also quantified these cell types in control and BnTx-expressing larvae, at 5 dpf. The number of HuC-positive neurons and Olig2-DsRed oligodendroglial cells did not reveal any significant changes in BnTx-expressing zebrafish, indicating that myelination impairment was not accounted to axonal loss nor to oligodendroglial cell death (data not shown). Download figure Open in new tab Figure 1: Myelinating oligodendrocytes establish synaptic-like connectivity with axons A. Labelling pattern of zebrafish vGlut:Gal4; UAS:BnTx-GFP::sox10:mRFP reporter line. Scale bar: 20 µm. B-C. Comparative view of sox10 labeling in control (B) and BnTx-positive (C) zebrafish in the larval spinal cord at 5 dpf. D. Percentage of myelinated axons in the ventral region of hemispinal cords. Student’s t test; N= 14 controls vs 15 BnTx larvae. E-F. Electron microscopy analysis of myelination in control (E) and BnTx-positive (F) zebrafish. Myelinated axons are highlighted with yellow stars. Scale bar: 2 µm. Inset: 1 µm. G. Myelinated axon number in the ventral region of hemispinal cords. Student’s t test. H. Analysis of synaptic vesicle juxtaposition to mOL. Insets show axon-OL contacts with pre-synaptic vesicles. Scale bars: 10 µm. Insets: 2 µm. I. Number of synaptic-like boutons on OPCs and mOLs. Student’s t test; N= 16 vs N=24 cells respectively. J. Number of contacts on mOL that bear 0-5 sheaths and >5 sheaths. Mann-Whitney test; N= 8 versus 12 cells. K-L. Still pictures of live imaging in (K) an OPC and (L) a mOL showing calcium transients in processes and myelin. M. Pattern of spontaneous calcium transients in OPCs and mOLs. Analyzed regions are shown in white in (K) and (L). Scale bars: 10 µm. Next, we investigated at which stage of differentiation are oligodendroglial cells most receptive to neuronal activity. We analyzed synaptic vesicle-mediated apposition between axons and oligodendroglial cells by generating Tg(Huc:Gal4; UAS:synaptophysin:GFP::sox10:mRFP) 27 , 28 zebrafish, where pre-synaptic vesicles were visualized by GFP, and subsequently chimera fish generated by cell transplantation from the sox10:mRFP line into the Huc:Gal4; UAS:synaptophysin:GFP line. We observed synaptic vesicles closely apposed to oligodendroglial cells based on the partial overlap between synaptophysin:GFP and sox10:mRFP fluorescence ( Figure 1H ). Quantification of pre-synaptic inputs onto OPCs and mOLs revealed a higher number of pre-synaptic boutons on mOLs ( Figure 1I ). Among mOLs, it is noteworthy that the number of pre-synaptic boutons has a wider range of distribution, suggesting that this might be correlated to different stages of the myelination process. In the zebrafish, OLs take up to 5 hours to establish new myelin sheaths and mostly sheath elongation occurs after this time window 29 . The final number of sheaths per OL is typically between 5 and 15 30 . Based on these data, we classified mOLs according to their sheath number: mOLs with less than 5 sheaths that should be undergoing new sheaths generation and mOLs with more than 5 sheaths, that are mostly undergoing myelin sheath elongation. When comparing the number of pre-synaptic boutons, mOLs with more 5 sheaths had significantly more pre-synaptic inputs ( Figure 1J ). Overall, our data indicate mOLs are contacted by axons through synaptic-like communications, which increase in number during myelin sheath elongation. For a functional correlate of pre-synaptic inputs on oligodendroglial cells, we tested OPCs and mOLs for spontaneous calcium transients by injecting a sox10:GCaMP6 construct into wild type one-cell stage embryos and recorded calcium transients in 3 dpf larva spinal cords. As previously reported, both OPCs and mOLs display calcium transients ( Figure 1K, L ; Videos S1 and S2) in their processes and sheaths 23 , 24 . Consistent with their higher number of pre-synaptic inputs, mOLs display calcium transients with a higher frequency and amplitude with respect to those of OPCs ( Figure 1M ). Thus, the extent of axonal communications with oligodendroglial cells is highest during the active period of myelination. PSD-95 post-synaptic densities increase in myelinating oligodendrocytes One of main structural feature of chemical synapses is the presence of a post-synaptic density (PSD). Hence, we searched for the expression of the post-synaptic density-95 (PSD-95) in oligodendroglial cells, PSD-95 is a major scaffolding protein that has been mainly described at the post-synaptic density of glutamatergic synapses in neurons 31 . However, PSD-95 expression in glia has been poorly studied. Interestingly, we found punctuated PSD-95 expression along Tg(Olig1:KalTA4, UAS:mCherry) zebrafish spinal cord, at 5 dpf. Olig1-expressing OPCs and OLs expressed PSD-95 on their cell soma and processes as shown by immunohistochemistry (data not shown). As expected, it is worth noting that PSD-95 was also broadly expressed in neurons. Using IMARIS 3D reconstruction of Olig1-expressing cells and PSD-95 puncta, we selected PSD-95 puncta located on oligodendroglia soma and processes ( Figure 2A, B ). To determine whether oligodendroglial PSD-95 is targeted to specific contact sites with axons, we generated a tol2-flanked sox10:PSD-95-GFP expression vector and injected it into one-cell stage eggs of the Tg(vGlut:Gal4;UAS:mRFP) 26 line. This resulted in mosaic oligodendroglial cells labeled with PSD-95-GFP fusion protein at their target sites on glutamatergic axons stained with mRFP ( Figure 2C ). Using in vivo live imaging in the larval zebrafish spinal cord, we quantified the number of juxtapositions between glutamatergic axonal varicosities and PSD-95-GFP domains on oligodendroglial cells, at 3dpf ( Figure 2C , insets). Additionally, we corroborated that axonal varicosities in vGlut:Gal4;UAS:mRFP line reliably represent sites of pre-synaptic vesicle accumulation, as they co-localize with synaptophysin-GFP puncta ( Figure 2D ). Importantly, we found that the number of glutamatergic communications increased on mOLs ( Figure 2E ). We next categorized mOLs according to their sheath number, as described previously 29 , and compared the number of glutamatergic contacts onto mOLs that had less or more than 5 sheaths. Consistent with the pre-synaptic bouton analysis, we found that post-synaptic densities increased significantly on mOLs with more than 5 sheaths, mostly undergoing myelin internode elongation ( Figure 2F ). Altogether, our findings clearly demonstrate that glutamatergic synaptic-like communications are maintained throughout the oligodendroglial lineage and increase in number at the myelinating stage. As myelination is actively shaped by glutamate vesicular release, our results point to mOLs as the main cell target of neuronal activity. Download figure Open in new tab Figure 2: PSD-95 post-synaptic densities in oligodendroglia increase during active myelination A. PSD-95+ puncta (blue) located on Olig1+ oligodendroglia soma and processes (red) in the zebrafish spinal cord at 5 dpf. Cell surfaces and puncta were reconstructed with IMARIS. Scale bar: 7 µm. B. Inset of the oligodendroglial process in (A). Scale bar: 1 µm. C. Targeted expression of PSD-95-GFP in OPCs (left panel) and mOLs (right panel) of the zebrafish spinal cord. Insets show the contacts based on partial overlapping fluorescence. Scale bars: 10 µm. Insets: 2 µm. D. Co-localization between varicosities of glutamatergic axons (vGlut:Gal4;UAS:mRFP) and pre-synaptic vesicles ( HuC:Gal4;UAS:synaptophysin-GFP , arrowheads). Scale bar: 2 µm. E. Quantification of synaptic-like contacts in OPCs and mOLs. Mann-Whitney test; N=16 cells for each group. F. Number of synaptic contacts in mOLs that bear 0 to 5 sheaths and >5 sheaths. Student’s t test; N=10 versus 5 cells, respectively. PSD-95 loss-of-function in oligodendroglia impairs myelin sheath elongation In zebrafish, the dlg4 gene, encoding for PSD-95, is duplicated in two isoforms dlg4a and dlg4b , both expressed in oligodendroglial cells 32 . To determine the functional role of PSD-95 in oligodendroglia, we used a cell-specific CRISPR-Cas9 mediated loss-of-function approach, based on the Gal4-UAS system and generated a Tol2 expression vector encoding a specific dlg4a single guide RNA (sgRNA) under the control of the U6 promotor, the Cas9 endonuclease and the mCherry fluorescent reporter under the control of UAS cassette ( Figure 3A ). As the dlg4a gene possesses four variants, we targeted the first common exon – the exon 5 – of these variants. Using the CRISPR tool, we based our sgRNA selection choice on two algorithms: the MIT specificity score (>90) 33 and Cas9 predicted efficiency (>50) 34 . We also considered the number of off-targets that must be null or minimal. We selected sgRNA that have no potential off-targets for sequences with less than three base pairs mismatches. Download figure Open in new tab Figure 3: CRISPR-mediated PSD-95 loss-of-function in oligodendroglia impairs myelin sheath elongation A. Representation of the plasmid micro-injected into one-cell stage of Tg(s1020t:Gal4) (B, C), Tg(Olig1:KalTA4) (D, E) or Tg(Mbp:Gal4) (F-I) to induce cell-specific dlg4a loss-of-function with the Cas9 endonuclease. B-C. Quantitative RT-PCR, on 1020+ mCherry+ whole larvae, of (B) dlg4a and (C) dlg4b gene expression at 5dpf. Student’s t test; N=4 versus 7 groups of animals, each group containing RNA from 20 dissociated fish. Data are represented as mean ± SD. D. Olig1+ cells in control and dlg4 KO spinal cords at 5 dpf exhibit distinct morphologies. In dlg4a KO, Olig1+ cells are more ramified than in the control. Mature myelinating OLs were mainly observed in control animals. E. Quantification of the oligodendroglial cell surface in control and dlg4a KO animals with IMARIS. Mann-Whitney test; N=117 vs 162 cells, respectively in control and KO fish. F. MBP+ cells with myelin segments in control and KO spinal cords at 5 dpf. G. Quantification of the number of myelin segments / cell. Mann-Whitney test; N=20 vs 30 cells, respectively. H. Quantification the internode length. Mann-Whitney test; N=107 vs 165 internodes. I. Quantification of the internode length per cell. Mann-Whitney test; N=36 vs 41 cells. We next validated our sgRNA and construct under the s1020t:Gal4 promoter 35 , as it is strongly expressed as soon as 1 dpf. In mCherry+ whole larvae, we observed a 57% decrease in the dlg4a relative expression by RT-qPCR ( Figure 3B ) and no change in dlg4b relative expression ( Figure 3C ). The construct was then microinjected into Tg(Olig1:KalTA4) 32 zebrafish eggs and recombined fish were selected based on the expression of the mCherry fluorescence. At 5 dpf, we observed that dlg4a knock-out (KO) cells exhibit more ramifications than control cells ( Figure 3D , Videos S3 and S4) and display the morphology of immature OLs. Using 3D reconstruction of mCherry-expressing oligodendroglial cells, we demonstrated that dlg4a KO cells had a larger cell surface than controls ( Figure 3E ), indicating that PSD-95 loss-of-function in oligodendroglia impedes myelination. We next assessed the myelination capacity of dlg4a KO cells using the Tg(Mbp:Gal4) 30 line for a specific deletion of PSD-95 in mature OLs and quantified the number of internodes per cells and the internode length. A 5 dpf, during the active period of myelination, Mbp+ mOLs in both control and dlg4a KO animals had the same number of myelin segments per cell ( Figure 3F, G ). However, in dlg4a KO, myelin internodes were significantly shorter ( Figure 3H, I ), demonstrating that oligodendroglial PSD-95 plays a critical role in myelin internode growth. Discussion In the present study, we showed that inhibition of glutamate vesicular release hampers CNS myelination. In line with this, electrical activity is known to bias OL preference for actively electrically axons 4 and affects myelin sheath number of single OLs 5 . Recently, it has been shown that glutamate vesicular release occurs at heminodes of myelin segments, where vGlut1 and neurofascin proteins also co-localized, and reinforces nascent sheaths elongation 25 . Moreover, translation of mRNA encoding myelin proteins is regulated by NMDA receptors on oligodendroglial cell processes 2 , 36 . Thus, silent glutamatergic axons might be selectively unmyelinated in the BnTx-expressing fish due to a failure in myelin mRNA translation at specific ensheathment sites. Interestingly, specific subpopulations among glutamatergic neurons exhibit diversity in their dependence on synaptic vesicle release for myelination 25 , 37 . As the overall reduction of myelination upon inhibition of synaptic glutamate vesicular release is broad enough, one could speculate that neuronal activity shapes myelin formation preferentially on glutamatergic axons; this hypothesis awaits further exploration. We also found that the number of pre-synaptic boutons is higher once myelination has started. Consistently, both OPCs and mOLs display spontaneous calcium currents 15 , 23 , 24 , 38 , with increased frequency and amplitude in mOLs. Thus, axonal signaling to oligodendroglial cells may be more prominent during active myelination. In agreement with this hypothesis, synaptic vesicles accumulate at myelin ensheathment sites 4 , 39 . However, in our study, we also observed axonal connectivity on OPCs that is supported by broad evidence on axon-OPC synapses 10 , 11 , 40 . mOLs composed of more than 5 myelin sheaths, which are mainly undoing myelin sheath elongation, bared a higher number of contacts with axons at specific sites of synaptic vesicle accumulation. Hence, the highest extent of synaptic vesicle mediated communications between axons and mOLs may occur preferentially during myelin sheath growth. A comprehensive analysis of how pre-synaptic vesicles are transported to and accumulate at restricted axoplasm domains during myelin sheath formation could greatly improve our understanding of activity-dependent myelin formation. In line with this, by using the genetically encoded sensor of vesicle exocytosis, SypHy 41 , a recent study showed that glutamate vesicular release on axons starts with myelination onset and occurs at specific heminodal regions coinciding to sites of myelin sheath growth 25 . Functional axonal neurotransmission on oligodendroglia would imply the presence of PSD at specific sites along the oligodendroglial cell membrane. PSD are electron dense regions with a high density of neurotransmitter receptors 31 that can be visualized at ultrastructural level. We thus searched for the expression of PSD in oligodendroglia, and especially of PSD-95, one of the major canonical scaffolding components of neuronal glutamatergic synapses. OPCs receive glutamatergic-mediated synaptic inputs and express both NMDA and AMPA receptors 10 , 11 , 19 , 21 and interestingly, expression of PSD-95 in oligodendroglia was previously reported in OPCs and mOLs in several transcriptomic studies 32 , 42 – 44 . PSD-95 was also detected at the protein level in OPCs 39 and along myelin sheath internodes, where it accumulates in paranodal regions 45 . Herein, we showed that PSD-95 is located in discrete clusters along OPC and mOL membranes. The level and pattern of expression was maintained throughout differentiation, indicating that axon-OL synaptic like interactions are maintained beyond the OPC stage. Strikingly in the zebrafish larva, we found that oligodendroglial PSD-95 clusters are closely apposed to axonal domains, coinciding to sites of glutamatergic synaptic vesicles accumulation. Overall, our data indicate that fundamental structural components of synapses are maintained between axons and mOLs and even increased in number during myelin sheath elongation. To decipher the role of PSD-95 in oligodendroglia, we generated a cell-specific Gal4 mediated CRISPR-Cas9 knock-out of dlg4 in the zebrafish and assessed its impact on myelination. As PSD-95 is highly expressed in neurons and other CNS cell types 32 , 39 , 44 , 45 , CRISPR-Cas9 mediated deletion of dlg4 allowed us to assess accurately the function of this protein in oligodendroglia, thus avoiding potential confounding effects of this deletion in other cells. We demonstrated that OPC-specific loss-of-function of dlg4a , using the Tg(Olig1:KalTA4) 32 driver line, impacted severely OL maturation, as Olig1-expressing cells exhibited a ramified immature OL morphology in dlg4 KO with respect to control. As the Tg(Olig1:KalTA4) line does not allow the fate mapping of dlg4 KO cells past the OPC stage, we thus expressed our dlg4 CRISPR construct in the Tg(mbp:Gal4) 30 strain to target PSD-95 deletion in mOLs. Importantly, PSD-95 loss-of-function in mOLs leads to shorter myelin internodes, without affecting the number of internodes per cells. Interestingly, our data, in agreement with the recent study of Li and colleagues 39 , demonstrate that oligodendroglia PSD-95 is required for axon-mOL neurotransmission that regulates oligodendrocyte maturation and myelination in an activity-dependent manner. While Li et al. 39 generated a double dlg4a/b KO, in our present study, we found that dlg4a loss-of-function alone in oligodendroglia impedes myelin sheath growth. PSD-95 clusters and anchors ions channels, glutamatergic receptors and trans-synaptic adhesion proteins at excitatory neuronal synapses 31 . One could postulate that PSD-95 has the same binding partners in oligodendroglia, as RNA-sequencing data also revealed the expression of PSD-95 binding partners in OPCs and mOLs 43 , 44 . PSD-95 is closely opposed to pre-synaptic proteins, such as synapsin and synaptophysin 39 , and recent in vivo studies in zebrafish showed the presence of active axonal vesicular release 25 at the elongation sites of myelin internodes. PSD proteins, like gephyrin which is specific of inhibitory synapses, were also observed at calcium activity hotspots in oligodendroglia 39 , indicating that activity-dependent vesicular release of neurotransmitters increases calcium transients in oligodendroglia 23 . These calcium transients play a key role in myelin sheath elongation, stability and retraction 23 , 24 . Based on these findings, PSD-95 downstream signaling pathways may regulate calcium signaling that mediates the local translation of mbp transcripts 2 , 36 , and thus timely and spatially restricted myelin sheath growth along electrically active axons. Our data also support the idea that electrical activity could continuously shape myelin microstructure and remodeling, that could have profound impacts on neuronal circuit functions 5 , 46 . There has been considerable progress during the last decades in unraveling functional roles of myelin in neuronal circuits that allow complex behaviors 6 – 8 or that even play a role in their dysregulation 47 . However, the mechanisms by which electrical activity shapes myelination remain so far largely unexplored. Our study will hopefully contribute to better insights into the mechanisms of activity-mediated myelination that has broad implications in neurological diseases. Limitations of the study OLs sense neuronal activity through axon-glial interactions, comprising both functional synapses 1 , 2 and extra-synaptic modes of communications 48 , 50 . However, the functional role of axon to oligodendroglial neurotransmission is still poorly understood. Here, we demonstrated that oligodendroglial cells express post-synaptic density proteins and establish synaptic-like microdomains of communications with electrically active axons, which are required for myelin sheath growth. Our study provides deeper insights into mechanisms mediating neuronal activity dependent myelin formation and plasticity. While we provided strong evidence indicating that OLs express PSD-95, the ultrastructure localization of this protein in myelin internodes remain to define accurately. Moreover, PSD-95 binding partners, such neuroligin and AMPA and NMDA receptors were not examined in our study. Further analysis should help to determine whether PSD-95 partners are also necessary for myelin sheath formation and growth. It also remains to elucidate if oligodendroglia PSD-95 function in myelination is required only for myelination of glutamatergic neurons or has a broader role in CNS myelination. To assess whether PSD-95 microdomains are local hotspots of crosstalk signaling between axons and OLs, electrophysiological recordings of mOLs are required. However, these experiments are technically challenging, due the low capacitance and resistance of myelin sheaths 52 . These experiments would also require recordings of nanoscale currents in restricted subdomains of mOLs. Recordings of local calcium transients in mOLs, at specific contact sites with axons, could be a valuable proxy to decipher whether PSD-95 microdomains elicit intracellular signals in OLs and how those regulate myelin gene expression. Author contributions B.N.O. supervised the study, designed experiments, and prepared the manuscript. M.A.M. and M.G. designed experiments, generated reporter constructs and lines, performed experiments and prepared the manuscript. M.P. carried out experiments. Declaration of Interests The authors declare no competing interests. Supplemental figures and legends Video S1. Calcium transients in OPCs, related to Figure 1K . Video S2. Calcium transients mOL exhibits, related to Figure 1L . Video S3. Olig1+ cells in control spinal cord at 5 dpf, related to Figure 3D . Video S4. Olig1+ cells in dlg4a KO spinal cord at 5 dpf, related to Figure 3D . STAR★Methods Key resources table View this table: View inline View popup Resource availability Lead contact Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Brahim Nait-Oumesmar ( brahim.naitoumesmar{at}icm-institute.org ). Materials availability Zebrafish transgenic lines and plasmids generated in this study are available upon request directed to the lead contact, Brahim Nait-Oumesmar ( brahim.naitoumesmar{at}icm-institute.org ). Data and code availability Microscopy data reported in this paper will be shared by the lead contact upon request. This paper does not report original code. Any additional information required for the analysis of data reported in this work paper is available from the lead contact upon request. Experimental models and study participant details Zebrafish lines and maintenance Zebrafish ( Danio rerio ) were maintained on a 14/10h light cycle and water was regulated at 28.5°C, conductivity at 500 μS and pH at 7.4 (Westerfield, 2000). Tg(sox10:mRFP) 27 line were provided by Dr. Bruce Appel, University of Colorado, USA. Tg(mbp:EGFP) and Tg(mbp:Gal4) 30 were provided by Pr. David Lyons, Centre for Discovery Brain Sciences University of Edinburgh, UK. Tg(UAS:BnTx L/C:GFP) was provided by Dr. Max Suster, University of Bergen, Norway. Tg(vGlut2a:Gal4) 26 was provided by Dr. Joe Fetcho, Cornell University, USA. Tg(Huc:Gal4-VP16) 28 was obtained from Dr. Shin-ichi Higashijima, National Institute for Physiological Sciences, Japan. Tg(s1020t:Gal4) 35 was provided by Dr. Claire Wyart, Paris Brain Institute, France. Tg(Olig1:KalTA4) 32 was provided by Pr. Tim Czopka, Center for Clinical Brain Sciences, University of Edinburgh, UK. Tg(UAS:synaptophysin-GFP) and Tg(UAS:Cas9-P2A-mCherry; U6-dlg4; U6-dlg4) were generated as described below. Embryos were staged according to Kimmel et al. 54 . Ages are expressed as day post-fertilization (dpf). Animal and cell numbers are indicated in figure legends. All procedures were approved by the Institutional Ethics Committee of the Institut du Cerveau - ICM, Paris, France. Method details Generation of expression plasmid constructs To generate the UAS:synaptophysin-GFP tol2-flanked plasmid, UAS:synaptophysin-GFP construct (kindly provided by Dr James D. Jontes; Ohio State University, USA) was subcloned into a Gateway pEntry1A vector and recombined with 5’ (p5E-MCS, Tol2kit, Dr Chien laboratory, University of Utah, USA) and 3’ (p3E-polyA, Tol2kit) entry vectors together with a destination vector containing Tol2 flanking sites (pDestTol2pA2, Dr. Kawakami’s laboratory, Mishima, Japan) using LR clonase (Kwan et al., 2007). To generate the sox10:PSD-95-GFP tol2-flanked plasmid, the UAS:PSD-95-GFP construct (Niell et al., 2004; provided by Dr. Martin Meyer, King’s College London, UK) was subcloned into a pEntry1A vector and recombined with the p5E-p7.2sox10:Gal4 (Dr. Thomas Carney, Institute of Molecular and Cell Biology, Singapore) and p3E-polyA vectors, together with the pDestTol2pA2 vector. To generate UAS:Cas9-P2A-mCherry; U6-dlg4; U6-dlg4 tol2-flanked cell-specific CRISPR-Cas9 plasmid, we started from the commercially available plasmid pUAS:Cas9-T2A-GFP ; U6-sgRNA1; U6-sgRNA2 (Cat #74009, Addgene) generated by Dr F. Del Bene 55 . T2A-GFP was then replaced by P2A-mCherry-CAAX sequence (Cat #74794, Addgene) using AgeI and XbaI restriction enzymes and the Gibson assembly system. CRISPOR.org 56 web tool ( http://crispor.tefor.net/ , developed by tefor infrastructure) was used to identify our dlg4a single-guide RNA (sgRNA). As dlg4a genes has five variants in zebrafish, we decided to target exon 5, the first common exon of all isoforms, with sgRNA 5’ – AGTGGTAAATACAGACACGC TGG – 3’. The selection of sgRNA was based on the MIT specificity score (>90) 33 and Cas9 predicted efficiency (>50) 34 . We also choose sgRNA with a minimum number of off-targets. BsaI and BsmBI restriction enzymes were used to insert twice our selected dlg4a sgRNA in UAS:Cas9-P2A-mCherry; U6-sgRNA1; U6-sgRNA2 Tol2 expression plasmid. Micro-injections One-cell stage embryos were collected and injected with 1 nL of the injection solution containing 25 ng/µL of DNA, 50 ng/µL of Tol2 mRNA transposase (mMESSAGE mMACHINE Sp6 kit, AM1340, ThermoFisher), 2.5 M KCl (60135, Supelco) and 0.02% Phenol Red (114529, Sigma) in MilliQ water. Embryos were maintained at 28.5°C and screened as soon as 2/3 dpf for transgene expression under a Leica fluorescent stereomicroscope. The UAS:synaptophysin-GFP positive embryos in a Tg(HuC:gal4) background, and the UAS:Cas9-P2A-mCherry; U6-dlg4; U6-dlg4 positive embryos in Tg (s1020t:Gal4); Tg(Olig1:KalTA4) or Tg(mbp:Gal4) were raised until adulthood to establish stable lines. F1 progenies were then screened for germline transmission. CRISPR progenies were examined for oligodendroglial cell morphology and myelin sheaths formation and elongation. Mosaic fish generation Cell transplantation was performed from sox10:mRFP to HuC:gal4;UAS:synaptophysin-GFP blastulae. Briefly, donor and receptor eggs were harvested separately and dechorionated with pronase 3% in a glass Petri dish. The embryos were transferred to agar molds (PT-1, Adaptive Science Tools) using a glass Pasteur pipette with a fire-polished tip. 30 to 50 cells were taken from the donor embryos and introduced into the receptor embryos using a capillary needle with a 40 µm diameter bevelled tip attached to a manual injector (CellTram Oil, Eppendorf, Germany). Finally, embryos were transferred to glass Petri dishes and maintained at 28.5°C. Immunostaining Whole larvae were euthanized with 0.2% Tricaine (MS222, Sandoz, Levallois-Perret, France) and then fixed overnight in 4% PFA (PFA, 1514-S, Electron Microscopy Sciences). After several washing steps with 0.1 M PBS, heads and yolks were removed to allow penetration of antibodies. Larve were then incubated overnight in blocking solution (2 mg/mL of BSA, 10% goat serum, 0.5% Triton X-100 (T9284, Sigma), 1% DMSO in 0.1M PBS). Anti-PSD-95 antibody (ab18258, abcam, rabbit IgG, 1,1000 dilution) was incubated 2 days in 2 mg/mL of BSA, 10% NGS, 0.7% Triton X-100, 1% DMSO in 0.1M PBS buffer. After several washing steps, spinal cords were incubated overnight with rabbit anti-IgG conjugated Alexa 488 (A21206, Invitrogen, 1/1000 dilution) in 1 mg/mL BSA, 1% NGS, 0.5% Triton X-100, 1% DMSO in 0.1M PBS. Spinal cords were mounted with ibidi mounting medium (50001, Clinisciences). Zebrafish dissociation and RT-qPCR Whole larvae were euthanized with 0.2% Tricaine (MS222, Sandoz, Levallois-Perret, France) and dissociated into QIAzol lysis reagent (79306, QIAgen). Chloroform addition allowed to retrieve RNA that is finally precipitated with isopropanol. RNA extraction was then performed using the RNeasy Mini Kit (74104, QIAgen) according to manufacturer’s instructions. Total RNA harvested was assessed using Nanodrop (Applied Biosystems). cDNA was then synthesized using the High-Capacity cDNA Reverse Transcriptase kit (11146-016, Invitrogen). Finally, qPCR reaction was performed using Light Cycler® 480 SYBR Green I Master Mix (04707516001, Roche) and specific probes for dlg4a (5’ AGCGATGGGTTTTCTGCGTA 3’; 5’ GCGAACTCTCCACCAGTAGT 3’) and dlg4b (5’ ATCCACGCATACACACCTCAG 3’; 5’ CAACATCTCCGTCCATACCGT 3’). β-actin was used as housekeeping gene. The ΔΔCt method was used to calculate mRNA abundancy and mRNA fold changes. Confocal imaging Larvae were anesthetized in 0.02% Tricaïne (MS222, Sandoz, Levallois-Perret, France) and mounted with 1.5% low-melting point agarose (16520, invitrogen). To study pre-synaptic puncta onto oligodendroglial cells and glutamatergic connectivity, spinal cords were imaged using an Olympus FV-1000 confocal microscope with a 40X water immersion objective using 473 and 543nm laser lines. Z-stacks (0.8µm z-step) were taken and whenever applicable, 3D reconstructions were performed using the Volocity software (Perkin Elmer, USA). Pre-synaptic synaptophysin:GFP puncta (larger than 0.35 μm in diameter, Niell et al., 2004) in close apposition with individual sox10:mRFP oligodendroglial cells were visualized and quantified. To study PSD-95 puncta in oligodendroglia and oligodendroglia-specific dlg4 loss-of-function, spinal cords were image with a Leica inverted SP8 X white light laser confocal microscope with a 63X oil or a 25X water immersion objective using 488 and 561 nm laser lines. Z-stacks (0.5 µm or 1.02 µm) were taken and Olig1-expressing oligodendroglial cells as well as MBP+ internodes were 3D reconstructed and quantified with IMARIS (Oxford Instruments). Calcium imaging Three dpf embryos derived from eggs injected with the sox10:GCaMP6 plasmid (provided by Pr. David Lyons, Centre for Discovery Brain Sciences, University of Edinburgh, UK) were screened for fluorescence. Those with positive cells were selected and cells with oligodendroglial morphology were registered for calcium transients using an Olympus FV-1000 confocal microscope, by z-stacks with a frame interval of 30 seconds. The ΔF/F. of maximal projection images was subsequently analyzed with Image J. Electron microscopy Tg(vGlut2a:Gal4;UAS:GFP::sox10:mRFP) and Tg(vGlut2a:Gal4;UAS:BnTx/LC:GFP::sox10:mRFP) 5dpf fish were anesthetized with Tricaine and fixated in 0.1% (16520, Electron Microscopy Sciences) in sodium cacodylate buffer (11652, Electron Microscopy Sciences). After rinsing in 0.1M PB, fish were mounted in agarose and 40μm-longitudinal sections were obtained with a Leica VT1000S Vibratome. Sections were incubated with 2.5% glutaraldehyde (16520, Electron Microscopy Sciences), followed by fixation with 2% osmium tetroxyde (OsO4, 19150, Electron Microscopy Sciences) solution and tissue dehydratation. Next, the tissue was incubated in Epon resine (embed 812 embedding kit, 14120, Electron Microscopy Sciences) at 56°C to allow polymerization. Molds were cut at a UC7 Leica ultramicrotome. Ultrathin sections were observed at the transmission electronic microscope (Hitachi HT7700). Quantification and statistical analysis All graphics and statistical tests were performed using GraphPad Prism9. Shapiro-Wilk normality test was used to assess the Gaussian distribution of the data. Statistical tests were done depending on the type of distribution. Two-tailed unpaired Student’s t test was performed for normally distributed groups, while non-normally distributed groups were compared using the Mann-Whitney test. Statistical tests used are indicated in legends with the number of fish, cells or internodes studied. All data are represented as mean ± standard deviation excepted for Figure 3 where data are represented as violin plots. p-values are indicated on the figure legends, with * p < 0.05; ** p < 0.01, *** p < 0.001; **** p < 0.0001. Acknowledgements We thank Dr Claire Wyart (Paris Brain Institute - ICM Paris) for fruitful comments and feedbacks during this study, and for kindly providing Tg(s1020t:Gal4) fish line 35 . We are grateful to Sophie Nunes, Antoine Arneau, Nolwenn Jezequel (PHENO-Zfish facility, ICM) for fish care, and the ICM imaging facility (ICM Quant) for confocal imaging and electron microscopy. We thank Prof. Koichi Kawakami (NIG, Japan) for sharing the Tol2 system plasmids; Dr. Max Suster for sharing the Tg(UAS:BoTxBLC-GFP) transgenic line; Pr. David A. Lyons (University of Edinburgh, UK) for the Tg(mbp:EGFP) line and sox10:GCaMP6 construct; Dr. Bruce Appel (University of Colorado, USA) for Tg(sox10:mRFP) , Tg(Olig2:dsRed) and Tg(Olig2:GFP) lines; Pr. Tim Czopka (University of Edinburgh, UK) for the Tg(Olig1:KalTA4) line; Dr. James Jontes (The Ohio State University, USA) for the UAS:synaptophysin-GFP construct; Dr. Martin P.Meyer (King’s College London, UK) for the UAS:PSD-95/GFP construct; Dr. Mariano Soiza-Reilly (Sorbonne University, France) for advices on pre- and post-synaptic antibodies. This study was supported by grants from ANR (RPV14017DDA), the program “Investissements d’Avenir” ANR-10-IAIHU-06 (IHU-A-ICM), ANR-11-INBS-0011 (NeurATRIS) and the French MS Foundation, France Sclérose en Plaques. M.A.M. was supported by a PhD fellowship from Sorbonne university and NeurATRIS, M.G. was funded by postdoctoral fellowships from France Sclérose en Plaques and IBRO. References 1. ↵ Demerens , C. , Stankoff , B. , Logak , M. , Anglade , P. , Allinquant , B. , Couraud , F. , Zalc , B. , and Lubetzki , C . ( 1996 ). Induction of myelination in the central nervous system by electrical activity . Proc Natl Acad Sci U S A 93 , 9887 – 9892 . doi: 10.1073/pnas.93.18.9887 . OpenUrl Abstract / FREE Full Text 2. ↵ Wake , H. , Lee , P.R. , and Fields , R.D . ( 2011 ). Control of Local Protein Synthesis and Initial Events in Myelination by Action Potentials . Science (1979) 333 , 1647 – 1651 . doi: 10.1038/jid.2014.371 . OpenUrl Abstract / FREE Full Text 3. Gibson , E.M. , Purger , D. , Mount , C.W. , Goldstein , A.K. , Lin , G.L. , Wood , L.S. , Inema , I. , Miller , S.E. , Bieri , G. , Zuchero , J.B. , et al. ( 2014 ). Neuronal activity promotes oligodendrogenesis and adaptive myelination in the mammalian brain . Science (1979) 344 , 1 – 27 . doi: 10.1126/science.1252304 . OpenUrl Abstract / FREE Full Text 4. ↵ Hines , J.H. , Ravanelli , A.M. , Schwindt , R. , Scott , E.K. , and Appel , B . ( 2015 ). Neuronal activity biases axon selection for myelination in vivo . Nat Neurosci 18 , 683 – 689 . doi: 10.1038/nn.3992 . OpenUrl CrossRef PubMed 5. ↵ Mensch , S. , Baraban , M. , Almeida , R. , Czopka , T. , Ausborn , J. , El Manira , A. , and Lyons , D.A . ( 2015 ). Synaptic vesicle release regulates the number of myelin sheaths made by individual oligodendrocytes in vivo . Nat Neurosci 18 . doi: 10.1038/nn.3991.Synaptic . OpenUrl CrossRef 6. ↵ Makinodan , M. , Rosen , K.M. , Ito , S. , and Corfas , G . ( 2012 ). A critical period for social experience-dependent oligodendrocyte maturation and myelination . Science (1979) 337 , 1357 – 1360 . doi: 10.1126/science.1220845 . OpenUrl Abstract / FREE Full Text 7. Liu , J. , Dietz , K. , Deloyht , J.M. , Pedre , X. , Kelkar , D. , Kaur , J. , Vialou , V. , Lobo , M.K. , Dietz , D.M. , Nestler , E.J. , et al. ( 2012 ). Impaired adult myelination in the prefrontal cortex of socially isolated mice . Nat Neurosci 15 . doi: 10.1038/nn.3263 . OpenUrl CrossRef PubMed 8. ↵ McKenzie , I.A. , Ohayon , D. , Li , H. , De Faria , J.P. , Emery , B. , Tohyama , K. , and Richardson , W.D. ( 2014 ). Motor skill learning requires active central myelination . Science (1979) 346 . doi: 10.1126/science.1254960 . OpenUrl Abstract / FREE Full Text 9. ↵ Franklin , R.J.M. , and Ffrench-Constant , C . ( 2008 ). Remyelination in the CNS: From biology to therapy . Preprint , doi: 10.1038/nrn2480 https://doi.org/10.1038/nrn2480. OpenUrl CrossRef PubMed Web of Science 10. ↵ Bergles , D.E. , Roberts , J.D.B. , Somogyl , P. , and Jahr , C.E . ( 2000 ). Glutamatergic synapses on oligodendrocyte precursor cells in the hippocampus . Nature 405 , 187 – 191 . doi: 10.1038/35012083 . OpenUrl CrossRef PubMed Web of Science 11. ↵ Ziskin , J.L. , Nishiyama , A. , Rubio , M. , Fukaya , M. , and Bergles , D.E . ( 2007 ). Vesicular release of glutamate from unmyelinated axons in white matter . Nat Neurosci 10 , 321 – 330 . doi: 10.1038/nn1854 . OpenUrl CrossRef PubMed Web of Science 12. ↵ Kukley , M. , Capetillo-Zarate , E. , and Dietrich , D . ( 2007 ). Vesicular glutamate release from axons in white matter . Nat Neurosci 10 , 311 – 320 . doi: 10.1038/nn1850 . OpenUrl CrossRef PubMed Web of Science 13. ↵ Kougioumtzidou , E. , Shimizu , T. , Hamilton , N.B. , Tohyama , K. , Sprengel , R. , Monyer , H. , Attwell , D. , and Richardson , W.D . ( 2017 ). Signalling through AMPA receptors on oligodendrocyte precursors promotes myelination by enhancing oligodendrocyte survival . Elife 6 . doi: 10.7554/eLife.28080 . OpenUrl CrossRef PubMed 14. ↵ Káradóttir , R. , Cavelier , P. , Bergersen , L.H. , and Attwell , D . ( 2005 ). NMDA receptors are expressed in oligodendrocytes and activated in ischaemia . Nature 438 . doi: 10.1038/nature04302 . OpenUrl CrossRef PubMed Web of Science 15. ↵ Micu , I. , Jiang , Q. , Coderre , E. , Ridsdale , A. , Zhang , L. , Woulfe , J. , Yin , X. , Trapp , B.D. , McRory , J.E. , Rehak , R. , et al. ( 2006 ). NMDA receptors mediate calcium accumulation in myelin during chemical ischaemia . Nature 439 . doi: 10.1038/nature04474 . OpenUrl CrossRef PubMed Web of Science 16. ↵ Lundgaard , I. , Luzhynskaya , A. , Stockley , J.H. , Wang , Z. , Evans , K.A. , Swire , M. , Volbracht , K. , Gautier , H.O.B. , Franklin , R.J.M. , ffrench-Constant , C. , et al. ( 2013 ). Neuregulin and BDNF Induce a Switch to NMDA Receptor-Dependent Myelination by Oligodendrocytes . PLoS Biol 11 . doi: 10.1371/journal.pbio.1001743 . OpenUrl CrossRef PubMed 17. de Biase , L.M. , Kang , S.H. , Baxi , E.G. , Fukaya , M. , Pucak , M.L. , Mishina , M. , Calabresi , P.A. , and Bergles , D.E. ( 2011 ). NMDA receptor signaling in oligodendrocyte progenitors is not required for oligodendrogenesis and myelination . Journal of Neuroscience 31 , 12650 – 12662 . doi: 10.1523/JNEUROSCI.2455-11.2011 . OpenUrl Abstract / FREE Full Text 18. Guo , F. , Maeda , Y. , Ko , E.M. , Delgado , M. , Horiuchi , M. , Soulika , A. , Miers , L. , Burns , T. , Itoh , T. , Shen , H. , et al. ( 2012 ). Disruption of NMDA receptors in oligodendroglial lineage cells does not alter their susceptibility to experimental autoimmune encephalomyelitis or their normal development . Journal of Neuroscience 32 . doi: 10.1523/JNEUROSCI.4073-11.2012 . OpenUrl Abstract / FREE Full Text 19. ↵ Li , C. , Xiao , L. , Liu , X. , Yang , W. , Shen , W. , Hu , C. , Yang , G. , and He , C . ( 2013 ). A functional role of nmda receptor in regulating the differentiation of oligodendrocyte precursor cells and remyelination . Glia 61 . doi: 10.1002/glia.22469 . OpenUrl CrossRef PubMed Web of Science 20. ↵ De Biase , L.M. , Nishiyama , A. , and Bergles , D.E. ( 2010 ). Excitability and synaptic communication within the oligodendrocyte lineage . Journal of Neuroscience 30 , 3600 – 3611 . doi: 10.1523/JNEUROSCI.6000-09.2010 . OpenUrl Abstract / FREE Full Text 21. ↵ Kukley , M. , Nishiyama , A. , and Dietrich , D . ( 2010 ). The fate of synaptic input to NG2 glial cells: Neurons specifically downregulate transmitter release onto differentiating oligodendroglial cells . Journal of Neuroscience 30 . doi: 10.1523/JNEUROSCI.0854-10.2010 . OpenUrl Abstract / FREE Full Text 22. ↵ Micu , I. , Plemel , J.R. , Lachance , C. , Proft , J. , Jansen , A.J. , Cummins , K. , van Minnen , J. , and Stys , P.K. ( 2016 ). The molecular physiology of the axo-myelinic synapse . Exp Neurol 276 , 41 – 50 . doi: 10.1016/j.expneurol.2015.10.006 . OpenUrl CrossRef PubMed 23. ↵ Krasnow , A.M. , Ford , M.C. , Valdivia , L.E. , Wilson , S.W. , and Attwell , D . ( 2018 ). Regulation of developing myelin sheath elongation by oligodendrocyte calcium transients in vivo . Nat Neurosci 21 , 24 – 30 . doi: 10.1038/s41593-017-0031-y . OpenUrl CrossRef PubMed 24. ↵ Baraban , M. , Koudelka , S. , and Lyons , D.A . ( 2018 ). Ca 2+ activity signatures of myelin sheath formation and growth in vivo . Nat Neurosci 21 , 19 – 25 . doi: 10.1038/s41593-017-0040-x . OpenUrl CrossRef PubMed 25. ↵ Almeida , R.G. , Williamson , J.M. , Madden , M.E. , Early , J.J. , Voas , M.G. , Talbot , W.S. , Bianco , I.H. , and Lyons , D.A . ( 2021 ). Myelination induces axonal hotspots of synaptic vesicle fusion that promote sheath growth . Current Biology 31 , 3743 – 3754 . doi: 10.1016/j.cub.2021.06.036 . OpenUrl CrossRef PubMed 26. ↵ Koyama , M. , Kinkhabwala , A. , Satou , C. , Higashijima , S.I. , and Fetcho , J . ( 2011 ). Mapping a sensory-motor network onto a structural and functional ground plan in the hindbrain . Proc Natl Acad Sci U S A 108 . doi: 10.1073/pnas.1012189108 . OpenUrl Abstract / FREE Full Text 27. ↵ Kirby , B.B. , Takada , N. , Latimer , A.J. , Shin , J. , Carney , T.J. , Kelsh , R.N. , and Appel , B . ( 2006 ). In vivo time-lapse imaging shows dynamic oligodendrocyte progenitor behavior during zebrafish development . Nat Neurosci 9 , 1506 – 1511 . doi: 10.1038/nn1803 . OpenUrl CrossRef PubMed Web of Science 28. ↵ Kimura , Y. , Satou , C. , and Higashijima , S.I . ( 2008 ). V2a and V2b neurons are generated by the final divisions of pair-producing progenitors in the zebrafish spinal cord . Development 135 . doi: 10.1242/dev.024802 . OpenUrl Abstract / FREE Full Text 29. ↵ Czopka , T. , ffrench-Constant , C. , and Lyons , D.A. ( 2013 ). Individual oligodendrocytes have only a few hours in which to generate new myelin sheaths invivo . Dev Cell 25 , 599 – 609 . doi: 10.1016/j.devcel.2013.05.013 . OpenUrl CrossRef PubMed Web of Science 30. ↵ Almeida , R.G. , Czopka , T. , Ffrench-Constant , C. , and Lyons , D.A . ( 2011 ). Individual axons regulate the myelinating potential of single oligodendrocytes in vivo . Development 138 , 4443 – 4450 . doi: 10.1242/dev.071001 . OpenUrl Abstract / FREE Full Text 31. ↵ Keith , D. , and El-Husseini , A . ( 2008 ). Excitation control: Balancing PSD-95 function at the synapse . Front Mol Neurosci 1 . doi: 10.3389/neuro.02.004.2008 . OpenUrl CrossRef PubMed 32. ↵ Marisca , R. , Hoche , T. , Agirre , E. , Hoodless , L.J. , Barkey , W. , Auer , F. , Castelo-Branco , G. , and Czopka , T . ( 2020 ). Functionally distinct subgroups of oligodendrocyte precursor cells integrate neural activity and execute myelin formation . Nat Neurosci 23 , 363 – 374 . doi: 10.1038/s41593-019-0581-2 . OpenUrl CrossRef PubMed 33. ↵ Hsu , P.D. , Scott , D.A. , Weinstein , J.A. , Ran , F.A. , Konermann , S. , Agarwala , V. , Li , Y. , Fine , E.J. , Wu , X. , Shalem , O. , et al. ( 2013 ). DNA targeting specificity of RNA-guided Cas9 nucleases . Nat Biotechnol . doi: 10.1038/nbt.2647 . OpenUrl CrossRef PubMed 34. ↵ Doench , J.G. , Fusi , N. , Sullender , M. , Hegde , M. , Vaimberg , E.W. , Donovan , K.F. , Smith , I. , Tothova , Z. , Wilen , C. , Orchard , R. , et al. ( 2016 ). Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9 . Nat Biotechnol 34 , 184 – 191 . doi: 10.1038/nbt.3437 . OpenUrl CrossRef PubMed 35. ↵ Wyart , C. , Bene , F. Del , Warp , E. , Scott , E.K. , Trauner , D. , Baier , H. , and Isacoff , E.Y. ( 2009 ). Optogenetic dissection of a behavioural module in the vertebrate spinal cord . Nature 2009 461:7262 461 , 407 – 410 . doi: 10.1038/nature08323 . OpenUrl CrossRef PubMed Web of Science 36. ↵ Wake , H. , Ortiz , F.C. , Woo , D.H. , Lee , P.R. , Angulo , M.C. , and Fields , R.D . ( 2015 ). Nonsynaptic junctions on myelinating glia promote preferential myelination of electrically active axons . Nat Commun 6 . doi: 10.1038/ncomms8844 . OpenUrl CrossRef PubMed 37. ↵ Koudelka , S. , Voas , M.G.G. , Almeida , R.G.G. , Baraban , M. , Soetaert , J. , Meyer , M.P.P. , Talbot , W.S.S. , and Lyons , D.A.A . ( 2016 ). Individual Neuronal Subtypes Exhibit Diversity in CNS Myelination Mediated by Synaptic Vesicle Release . Current Biology 26 , 1447 – 1455 . doi: 10.1016/j.cub.2016.03.070 . OpenUrl CrossRef PubMed 38. ↵ Sun , W. , Matthews , E.A. , Nicolas , V. , Schoch , S. , and Dietrich , D . ( 2016 ). Ng2 glial cells integrate synaptic input in global and dendritic calcium signals . Elife . doi: 10.7554/eLife.16262 . OpenUrl CrossRef PubMed 39. ↵ Li , J. , Miramontes , T. , Czopka , T. , and Monk , K . ( 2024 ). Synaptic input and Ca2+ activity in zebrafish oligodendrocyte precursor cells contribute to myelin sheath formation . Nat Neurosci 27 , 219 – 231 . OpenUrl CrossRef PubMed 40. ↵ Kukley , M. , Kiladze , M. , Tognatta , R. , Hans , M. , Swandulla , D. , Schramm , J. , and Dietrich , D . ( 2007 ). Glial cells are born with synapses . The FASEB Journal 22 , 2957 – 2969 . doi: 10.1096/fj.07-090985 . OpenUrl CrossRef 41. ↵ Zhu , Y. , Xu , J. , and Heinemann , S.F . ( 2009 ). Two Pathways of Synaptic Vesicle Retrieval Revealed by Single-Vesicle Imaging . Neuron 61 , 397 – 411 . doi: 10.1016/j.neuron.2008.12.024 . OpenUrl CrossRef PubMed Web of Science 42. ↵ Sakry , D. , Karram , K. , and Trotter , J . ( 2011 ). Synapses between NG2 glia and neurons . Preprint , doi: 10.1111/j.1469-7580.2011.01359.x https://doi.org/10.1111/j.1469-7580.2011.01359.x. OpenUrl CrossRef PubMed Web of Science 43. ↵ Zhang , Y. , Chen , K. , Sloan , S.A. , Bennett , M.L. , Scholze , A.R. , O’Keeffe , S. , Phatnani , H.P. , Guarnieri , P. , Caneda , C. , Ruderisch , N. , et al. ( 2014 ). An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex . Journal of Neuroscience 34 , 11929 – 11947 . doi: 10.1523/JNEUROSCI.1860-14.2014 . OpenUrl Abstract / FREE Full Text 44. ↵ Marques , S. , Zeisel , A. , Codeluppi , S. , Van Bruggen , D. , Falcão , A.M. , Xiao , L. , Li , H. , Häring , M. , Hochgerner , H. , Romanov , R.A. , et al. ( 2016 ). Oligodendrocyte heterogeneity in the mouse juvenile and adult central nervous system . Science (1979) 352 , 1326 – 1329 . doi: 10.1126/science.aaf6463 . OpenUrl Abstract / FREE Full Text 45. ↵ Hughes , A.N. , and Appel , B . ( 2019 ). Oligodendrocytes express synaptic proteins that modulate myelin sheath formation . Nat Commun 10 , 1 – 15 . doi: 10.1038/s41467-019-12059-y . OpenUrl CrossRef PubMed 46. ↵ Fields , R.D . ( 2008 ). Oligodendrocytes changing the rules: Action potentials in glia and oligodendrocytes controlling action potentials . Preprint , doi: 10.1177/1073858408320294 https://doi.org/10.1177/1073858408320294. OpenUrl CrossRef PubMed Web of Science 47. ↵ Windrem , M.S. , Osipovitch , M. , Liu , Z. , Bates , J. , Chandler-Militello , D. , Zou , L. , Munir , J. , Schanz , S. , McCoy , K. , Miller , R.H. , et al. ( 2017 ). Human iPSC Glial Mouse Chimeras Reveal Glial Contributions to Schizophrenia . Cell Stem Cell 21 . doi: 10.1016/j.stem.2017.06.012 . OpenUrl CrossRef PubMed 48. ↵ Maldonado , P.P. , and Angulo , M.C . ( 2015 ). Multiple modes of communication between neurons and oligodendrocyte precursor cells . Neuroscientist 21 , 266 – 276 . doi: 10.1177/1073858414530784 . OpenUrl CrossRef PubMed 49. Kwan , K.M. , Fujimoto , E. , Grabher , C. , Mangum , B.D. , Hardy , M.E. , Campbell , D.S. , Parant , J.M. , Yost , H.J. , Kanki , J.P. , and Chien , C. Bin ( 2007 ). The Tol2kit: A multisite gateway-based construction Kit for Tol2 transposon transgenesis constructs . Developmental Dynamics 236 , 3088 – 3099 . doi: 10.1002/dvdy.21343 . OpenUrl CrossRef PubMed Web of Science 50. ↵ de Faria , O. , Gonsalvez , D.G. , Nicholson , M. , and Xiao , J. ( 2019 ). Activity-dependent central nervous system myelination throughout life . J Neurochem 148 , 447 – 461 . doi: 10.1111/jnc.14592 . OpenUrl CrossRef PubMed 51. Shin , J. , Park , H.C. , Topczewska , J.M. , Madwsley , D.J. , and Appel , B . ( 2003 ). Neural cell fate analysis in zebrafish using olig2 BAC transgenics . Methods in Cell Science 25 , 7 – 14 . doi: 10.1023/B:MICS.0000006847.09037.3a . OpenUrl CrossRef PubMed 52. ↵ Cohen , C.C.H. , Popovic , M.A. , Klooster , J. , Weil , M.T. , Möbius , W. , Nave , K.A. , and Kole , M.H.P . ( 2020 ). Saltatory Conduction along Myelinated Axons Involves a Periaxonal Nanocircuit . Cell 180 . doi: 10.1016/j.cell.2019.11.039 . OpenUrl CrossRef PubMed 53. Kimura , Y. , Hisano , Y. , Kawahara , A. , and Higashijima , S.I . ( 2014 ). Efficient generation of knock-in transgenic zebrafish carrying reporter/driver genes by CRISPR/Cas9-mediated genome engineering . Sci Rep 4 . doi: 10.1038/srep06545 . OpenUrl CrossRef PubMed 54. ↵ Kimmel , C.B. , Ballard , W.W. , Kimmel , S.R. , Ullmann , B. , and Schilling , T.F . ( 1995 ). Stages of embryonic development of the zebrafish . Developmental Dynamics 203 , 253 – 310 . doi: 10.1002/aja.1002030302 . OpenUrl CrossRef PubMed Web of Science 55. ↵ Di Donato , V. , De Santis , F. , Auer , T.O. , Testa , N. , Sánchez-Iranzo , H. , Mercader , N. , Concordet , J.P. , and Bene , F. Del ( 2016 ). 2C-Cas9: A versatile tool for clonal analysis of gene function . Genome Res 26 , 681 – 692 . doi: 10.1101/gr.196170.115 . OpenUrl Abstract / FREE Full Text 56. ↵ Concordet , J.P. , and Haeussler , M . ( 2018 ). CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens . Nucleic Acids Res 46 , W242 – W245 . doi: 10.1093/NAR/GKY354 . OpenUrl CrossRef 57. Monk , K.R. , Naylor , S.G. , Glenn , T.D. , Mercurio , S. , Perlin , J.R. , Dominguez , C. , Moens , C.B. , and Talbot , W.S . ( 2009 ). A G protein-coupled receptor is essential for schwann cells to initiate myelination . Science (1979) 325 . doi: 10.1126/science.1173474 . OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted February 11, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Post-Synaptic Density Proteins in Oligodendrocytes are Required for Activity-Dependent Myelin Sheath Growth Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Post-Synaptic Density Proteins in Oligodendrocytes are Required for Activity-Dependent Myelin Sheath Growth MA Masson , M Graciarena , M Porte , B Nait Oumesmar bioRxiv 2025.02.10.637467; doi: https://doi.org/10.1101/2025.02.10.637467 Share This Article: Copy Citation Tools Post-Synaptic Density Proteins in Oligodendrocytes are Required for Activity-Dependent Myelin Sheath Growth MA Masson , M Graciarena , M Porte , B Nait Oumesmar bioRxiv 2025.02.10.637467; doi: https://doi.org/10.1101/2025.02.10.637467 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7636) Biochemistry (17705) Bioengineering (13899) Bioinformatics (41967) Biophysics (21460) Cancer Biology (18600) Cell Biology (25526) Clinical Trials (138) Developmental Biology (13384) Ecology (19909) Epidemiology (2067) Evolutionary Biology (24326) Genetics (15613) Genomics (22512) Immunology (17740) Microbiology (40423) Molecular Biology (17193) Neuroscience (88645) Paleontology (667) Pathology (2835) Pharmacology and Toxicology (4825) Physiology (7647) Plant Biology (15159) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9825) Zoology (2271)