BMSC-Exo miR-122-5p facilitates osteogenic differentiation of MC3T3-E1 cells through specifically suppressing SPRY2 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article BMSC-Exo miR-122-5p facilitates osteogenic differentiation of MC3T3-E1 cells through specifically suppressing SPRY2 Zhiyu Chen, Yizhe Fan, Chengyi Yang, Chenhao Wang, Peng Wang, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4723687/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Bone Marrow Mesenchymal Stem Cells-Exosomes (BMSC-Exo) possess the ability to facilitate bone remodeling, and this mechanism has always been of great interest in the field. Our study aimed to elucidate the impacts of BMSC-Exo on MC3T3-E1, the murine embryonic osteogenic progenitor cells, and the interaction behind. Methods We initially extracted and characterized exosomes from BMSCs. Following treatment with GW4869, a compound that inhibits exosome production and release, BMSCs produced exosomes (BMSC-Exo). These were subsequently combined in culture with MC3T3-E1 cells. Upon an application of Phalloidin and PKH26 staining, we observed morphology of the cellular actin fibers and the uptake of exosomes. To evaluate the osteogenic potential of the cells, we utilized Alizarin Red S (ARS) and Alkaline Phosphatase (ALP) staining. Additionally, we measured expressions of osteogenic factors RUNX2, ALP, OSX, OCN, and OPN through qRT-PCR and Western blot analyses. Afterwards, we intervened with BMSC-Exo with a lentivirus over-expressing miR-122-5p and co-cultured it with MC3T3-E1 cells. To further assess osteogenic differentiation, we conducted additional ARS & ALP staining, along with qRT-PCR and Western blot assays. With the help of dual-luciferase reporter assay, we found that miR-122-5p interacts specifically with SPRY2. Ultimately, we treated MC3T3-E1 cells with a lentivirus over-expressing miR-122-5p and a plasmid over-expressing OE-SPRY2. Osteogenic differentiation was then assessed using ARS & ALP staining, qRT-PCR, and Western blot. Results Our laboratory outcomes demonstrated that exosomes derived from BMSC-Exo are instrumental in the advancement of calcified nodule genesis within MC3T3-E1 cells, concurrently amplifying the transcriptional and translational expressions of osteogenic markers (RUNX2, ALP, OSX, OCN, and OPN). These excreted exosomes from the BMSCs modified by a miR-122-5p-over-expressing lentivirus are found to further accelerate osteogenic differentiation of the cells. Moreover, our application of dual-luciferase reporter gene system has elucidated a specific interplay between miR-122-5p and SPRY2. Furthermore, overexpressing of SPRY2 negates the miR-122-5p-induced osteogenic differentiation. Conclusions BMSC-Exo facilitates osteogenic differentiation in MC3T3-E1 cells by suppressing SPRY2, a process mediated by miR-122-5p. BMSCs exosomes osteogenic differentiation miR-122-5p SPRY2 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Human skeletal system is endowed with an unparalleled capacity for regeneration, capable of self-repair through a reconstitution of cellular sequences and alignments, a rarity among bodily tissues. Nonetheless, this process of fracture healing is often complicated by the advent of infection, inadequate stabilization, or unsuccessful surgical endeavors, potentially culminating in chronic pathological conditions [1]. Contextually, modern medical science has devised a multitude of strategies to accelerate the osseous healing process, spanning domains of biological and biophysical interventions [2]. Osseous matrix is inherently composed of collagen and calcium phosphate, which not only constitute skeletal framework but also provide requisite structural scaffolding for the ligaments and tendons that adhere to it. In a process of skeletal reconstitution, osteoclasts are tasked with the degradation and resorption of senescent bone, supplanted by osteoblasts that synthesize and deposit novel bone tissue. Mesenchymal stem cells (MSCs) are indispensable in this transformative cascade, undergoing differentiation into osteogenic progenitors, which subsequently evolve into pre-osteoblasts and ultimately mature into functional osteocytes. Moreover, bone marrow mesenchymal stem cells (BMSCs) hold a pivotal position as the progenitors of adipocytes and the osteogenic lineage within the marrow, serving with critical efficacy to sustain marrow’s ecological balance and integrity of skeletal health. Exosomes are a diverse group of homogenous vesicles secreted by most mammalian cell types. They encapsulate a plethora of molecular constituents, including nucleic acids, amino acids, metabolites, and proteins [3], which modulate cellular physiology and pathogenesis through the conveyance of bioactive signals [4]. An abundance of researches have indicated that exosomes derived from Bone Marrow Mesenchymal Stem Cells (BMSC-Exo) possess a propelling influence on the process of osteogenesis. Furthermore, investigations have revealed that in patients with Postmenopausal Osteoporosis (PMOP), long non-coding RNAs (lncRNAs) expression expression differs in BMSC exosomes [5]. Concurrently, other studies have highlighted that circular RNAs (circRNAs) present differential expression patterns, implicated in regulation of various signaling pathways [6]. MicroRNAs (miRNAs), as pivotal components of exosomes, engage in reparative mechanisms, including promotion of cellular proliferation, angiogenesis, and the inhibition of apoptosis [7]. Those exosomes secreted by BMSCs are replete with the molecule MALAT1, which modulates miR-34c/SATB2 signaling pathway to augment osteoblasts’ activity in osteoporotic murine models [8]. Furthermore, the miR-21-5p molecule encapsulated within BMSCs-derived exosomes demonstrates a potential to ameliorate osteoporotic symptoms through targeting KLF3 [9]. These research findings underscored an affirmative role of miRNAs in exosomes from BMSCs in the growth and differentiation of osteoblasts. Subsidiary research indicated that the miR-122-5p molecule within exosomes is capable of regulating apoptosis and permeability in cerebral microvascular endothelial cells [10], inhibiting the tumorigenic potential of gastric cancer [11], and obstructing osteoclast differentiation induced by RANKL [12]. Although functions of miR-122-5p in osteogenic differentiation is gaining recognition, the specific impact within BMSCs-derived exosomes remains insufficiently explored. Consequently, this study extracted exosomes from BMSCs and co-cultivated them with mouse embryonic osteogenic progenitor cells MC3T3-E1 to explore the role of miR-122-5p in osteogenic differentiation. Methods Cell culture BMSC and MC3T3-E1 cells were procured from iCell Bioscience Inc. (No. MIC-iCell-s018 and No. iCell-m031). Cryovials containing these cells were immersed in a 37℃ water bath and agitated to expedite the thawing process. Post-thawing, cells were aliquoted into either the primary mesenchymal stem cell culture medium (iCell, Shanghai, China) or a complete growth medium, ensuring homogeneous integration. Subsequently, mixture undergoes centrifugation at 1000 rpm for a duration ranging from 3 to 5 min; supernatant was then aspirated, leaving the cells to be resuspended. Cellular suspension was thereafter transferred into culture flasks pre-equilibrated with the corresponding culture medium or complete growth medium. Flasks were subsequently incubated at 37℃ with 5% CO 2 for cell cultivation. Cell processing DMSO was utilized to formulate a suspension of GW4869. BMSCs were subjected to treatment with GW4869 at concentrations of 5 and 10 µM (HY-19363, MCE, Shanghai, China) or with miR-122-5p mimic/NC via lentivirus overexpression, followed by collection of exosomes secreted by BMSCs. After 48 hours of co-culture with MC3T3-E1 cells, the exosomes were collected. In a separate experimental series, Lipofectamine 2000 (11668019, Invitrogen, California, USA) was initially employed to transfect miR-122-5p mimic/NC into MC3T3-E1 cells, which were subsequently transfected with OE-SPRY2/NC (overexpression plasmid) 48 h later. Cells were harvested after another 48 h of culture. Exosome extraction Cells were placed into sterile, enzyme-free 15 mL centrifuge tubes, followed by centrifugation at 4℃ with a force of 2000×g for 30 min. Those samples were then passed via a 0.22 µm membrane and transferred to new centrifuge tubes for resting on ice. An equal volume to cell volume of Total Exosome Isolation Reagent (4478359, Invitrogen, California, USA) was added to the samples, which were then thoroughly mixed by pipetting. Then mixture was rotated at a temperature between 2 ~ 8℃ for 30 min to ensure uniform blending. Subsequently, centrifugation was performed at 25℃ with a force of 10000×g for 10 min. The supernatant was discarded, and the pellet was resuspended within PBS to obtain exosome sample. Identification of exosomes Exosome samples from various groups were applied onto carbon-supported film-coated copper grids, where excess liquid was absorbed after 3 to 5 min. Subsequently, a 2% PBS (Servicebio, Wuhan, China) was applied, and once dried, the grids were examined under a transmission electron microscope (HITACHI, Japan). Those samples, diluted with 1X PBS buffer, were placed into a cleaned sample chamber for Nanoparticle Tracking Analysis (NTA) with the ZetaView PMX 110 apparatus (Particle Metrix, Germany) to assess exosomes. Dual-luciferase assay Upon the application of dual-luciferase assay kit (RG008, Beyotime, Shanghai, China), the experiment was conducted. Linear fragments of the pGL6-miR vector were digested with HindIII and BamHI restriction endonucleases (ER0051, Invitrogen, CA, USA), followed by a 2-h incubation in a water bath, and then retrieved with the kit. SPRY2 gene (ELK biotechnology, Wuhan, China) was amplified via PCR and underwent a recombination reaction with the vector at 37℃ for 30 min. High-efficiency DH5a competent cells (EC001, ELK biotechnology, Wuhan, China) were employed for transformation, with monoclonal selection for sequencing analysis conducted after one day to isolate the correct monoclonal colonies. miR-122-5p mimic/NC (Guangzhou, China), pGL6-SPRY2 (/pGL6) & pRL-TK plasmids, and Lipofectamine 2000 (11668019, Invitrogen, CA, USA) were each diluted in Opti-MEM and incubated at 25℃ for 5 min. After combining the diluted solutions, the transfection mixture was incubated at 25℃ for 20 min. The mixture was then added to the cells and incubated at 37℃ with 5% CO 2 for 24 h for transfection. Following transfection, those cells were lysed thoroughly, and 100 µL of the Renilla luciferase assay reagent (prepared at a ratio of 1:100) was added to measure relative light units. Those PCR primer sequences for SPRY2 were detailed in Supplementary Table 1, while the miR-122-5p mimic/NC sequences were presented in Supplementary Table 2. Phalloidin and PKH26 staining Exosome suspension was incorporated into a 2 µM PKH26 working solution (PKH26PCL, Sigma, Shanghai, China) and cultured at 25℃ for 5 min. Excess dye was removed by filtration through a 0.22 µm filter, and the mixture was subsequently added to the cells under observation. Those cells were subsequently treated with 4% paraformaldehyde for 20 min. The fixed cell smears were then removed and placed onto slides, encircled with a histological pen to prevent the loss of incubation medium during subsequent incubation steps. Red phalloidin-TRITC (40734ES75, Yeasen, Shanghai, China) was diluted 1:300 in a 1% BSA solution (4240GR250, Biofroxx, Guangzhou, China) to create the working solution. Following PBS rinsing, DAPI (D8417-1MG, Sigma, Shanghai, China) was applied for nuclear staining and cultured in the dark at 25℃ for 20 to 30 min. Finally, the slides were sealed using anti-fluorescence quenching mounting medium (V900155-25G, Sigma, Shanghai, China) before being examined and imaged under a microscope. qRT-PCR analysis Total cellular RNA was isolated with TRIzol (EP013, ELK Biotechnology, Wuhan, China). Synthesis of the first-strand cDNA was facilitated by the EntiLink™ 1st Strand cDNA Synthesis Super Mix (EQ031, ELK Biotechnology, Wuhan, China). qPCR was performed with the EnTurbo™ SYBR Green PCR SuperMix kit (EQ001, ELK Biotechnology, Wuhan, China). Reaction protocol entailed an initial denaturation phase at 90℃ for 30 s, followed by 40 rounds consisting of 90℃ for 10 s, 58℃ for 30 s, and 72℃ for 30 s. For the shake of miR-122-5p quantification, U6 was deemed as an endogenous reference gene, whereas GAPDH assumes this role in other instances. Specific primer sequences were delineated in Table 1 . Table 1 The sequences of qRT-PCR Name 5’-3’ sequences GAPDH F: TGAAGGGTGGAGCCAAAAG R: AGTCTTCTGGGTGGCAGTGAT RUNX2 F: CGCCACCACTCACTACCACAC R: TGGATTTAATAGCGTGCTGCC ALP F: TGACTACCACTCGGGTGAACC R: TGATATGCGATGTCCTTGCAG OSX F: TGTCTATAAGCCCAAGGCGG R: TCCTGACAGTTGGGGCAGTC OCN F: TTCTGCTCACTCTGCTGACCC R: CTGATAGCTCGTCACAAGCAGG OPN F: TCTGAGGGACTAACTACGACCAT R: TGGAAGAGTTTCTTGCTTAAAGTC U6 F: CTCGCTTCGGCAGCACAT R: AACGCTTCACGAATTTGCGT miR-122-5p F: TCAGGTGGAGTGTGACAATGG R: CTCAACTGGTGTCGTGGAGTC Western Blot Cells were lysed, with the lysate solution (AS1004, ASPEN), yielding a total protein extract. The protein content was determined with the BCA Protein Assay Kit (AS1086, ASPEN). SDS-PAGE gels were formulated, with each well loaded with 20 µg of protein, followed by electrophoresis and membrane transfer. Primary antibodies (diluted to 1:1000) were incubated overnight at 4℃, followed by secondary antibodies (diluted to 1:10000) were incubated at 25℃ for 30 min. Subsequently, freshly prepared ECL luminescent reagent (A:B = 1:1; AS1059, ASPEN) was added, and the gel was scanned and archived. AlphaEaseFC software was employed to analyze the optical density values. Primary antibodies utilized in this experiment included rabbit antibodies targeting GAPDH (1:10000; ab181602, abcam, Shanghai, China), RUNX2 (20700-1-AP, Proteintech, Wuhan, China), ALP (18507-1-AP, Proteintech, Wuhan, China), OSX (ab209484, abcam, Shanghai, China), OCN (ab93876, abcam, Shanghai, China), OPN (ab63856, abcam, Shanghai, China), and SPRY2 (ab85670, abcam, Shanghai, China). Secondary antibody was an HRP-conjugated rabbit anti-goat antibody (AS1108, ASPEN). ARS staining Cell specimens were treated with a 4% paraformaldehyde solution (80096618, Sinopharm Chemical Reagent Co., Ltd, Shanghai, China) for 10 to 20 min, followed by another rinse with PBS. Subsequently, specimens were stained with ARS staining solution (G1038, Servicebio Wuhan, China) for 5 to 10 min. After air-drying the slides, they were clarified with xylene (10023418, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China) for 5 min, and subsequently mounted with neutral gum (G8590, Solarbio, Beijing, China). Those slides were examined and photographed under an inverted microscope (OLYMPUS, Japan). ALP staining Cell samples were treated with a 4% paraformaldehyde solution (80096618, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China) for a period ranging from 10 to 20 min, followed by another wash with PBS. Subsequently, working solution (C3206, Beyotime, Shanghai, China) was applied, and those samples were incubated at 37℃ in a dark environment for 30 to 60 min, followed by a rinse with distilled water to terminate the reaction. Samples were then treated with Azure B solution for 3 min, followed by staining with hematoxylin solution (H9627-25G, Sigma, Shanghai, China) for a duration of 3 to 10 min. Differentiation was carried out with 1% hydrochloric acid (10011018, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China), and the samples were re-stained with 1% ammonia water (10002018, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China) for the blueing processing, concluding with mounting with glycerin gelatin (10010618; 10010328, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China). Statistic analysis All data in this study are reported as mean ± SD with n = 3. Results of the experiment were analyzed and graphed with GraphPad Prism 8.0. For comparing multiple groups, meet the criteria for normal distribution, we used a one-way analysis of variance with Tukey’s post hoc test for data that followed a normal distribution; when the normal distribution was not met, the Friedman test was utilized. A statistical difference was determined to be true when p < 0.05. Results BMSC-Exo stimulates osteogenic differentiation in MC3T3-E1 cells Exosomes were extracted and harvested from BMSCs treated with the exosome synthesis/release inhibitor GW4869 at concentrations of 5 and 10 µM for identification. The identification confirmed successful exosome extraction, with BMSCs demonstrated to secrete exosomes, and GW4869 was shown to inhibit exosome secretion in BMSCs (Figure S1 ). Subsequently, BMSCs were subjected to intervention with 5 and 10 µM GW4869, and the secreted exosomes were co-cultured with murine pre-osteoblasts MC3T3-E1, followed by cell collection for analysis. Our analysis revealed that MC3T3-E1 cells co-cultured with BMSC-Exo maintained intact myofibril morphology and rendered increased exosome uptake; in contrast, the addition of GW4869 led to disorganized myofibrils and decreased exosome uptake (Fig. 1 A). ARS staining indicated an evident increase in calcium nodule formation in MC3T3-E1 cells co-cultured with BMSC-Exo; however, the addition of GW4869 notably reduced calcium nodule formation, with the 10 µM concentration showing a more pronounced effect than the 5 µM concentration (Fig. 1 B, D). ALP staining results also demonstrated a notable enhanced ALP expression in BMSC-Exo-treated MC3T3-E1 cells; the addition of GW4869, however, resulted in a significant decrease in ALP expression (Fig. 1 C, E). Intervention with BMSC-Exo promoted miR-122-5p expression, whereas addition of GW4869 suppressed miR-122-5p expression. Furthermore, levels of osteogenic transcription factors were examined, revealing that BMSC-Exo greatly up-regulated mRNA and protein expression of RUNX2, ALP, OSX, OCN, and OPN in MC3T3-E1 cells, while addition of GW4869 notably down-regulated expression of these factors (Fig. 2 ). BMSC-Exo enhances osteogenic differentiation of MC3T3-E1 cells through miR-122-5p Previous findings indicated that BMSC-Exo could facilitate osteogenic differentiation of MC3T3-E1 cells, with an elevation in miR-122-5p level. To ascertain the function of exosomal miR-122-5p, BMSCs were transfected with a lentivirus carrying a miR-122-5p overexpression vector, followed by co-culturing BMSC-Exo with MC3T3-E1 cells. Our findings indicated that miR-122-5p overexpression in BMSCs led to an enhanced secretion of exosomes that could further augment the levels of calcium nodules and ALP in MC3T3-E1 cells (Fig. 3 ). Regarding osteogenic transcription factors, overexpression of miR-122-5p similarly induced a further increase in mRNA and protein levels of RUNX2, OSX, OCN, and OPN. Additionally, expression of SPRY2 was examined, and it was found that co-culturing with exosomes could decrease expression of SPRY2 in MC3T3-E1 cells, with overexpression of miR-122-5p further promoting this decrease (Fig. 4 ). MiR-122-5p accelerates osteogenic differentiation of MC3T3-E1 cells by specifically suppressing SPRY2 To investigate the potential for miR-122-5p to regulate osteogenic differentiation by acting on SPRY2, an initial interaction was verified through a dual-luciferase reporter gene assay, demonstrating a definitive interplay between miR-122-5p and SPRY2. (Fig. 5 A). Subsequently, exosomes secreted from BMSCs treated with a lentivirus for miR-122-5p overexpression were co-cultured with MC3T3-E1 cells, along with transfection of an overexpression plasmid for SPRY2. Our findings indicated that overexpression of SPRY2 down-regulates expression of miR-122-5p (Fig. 5 B-C). Further, ARS staining revealed a notable reduction in the number of calcium nodules within the cells following SPRY2 overexpression (Fig. 5 D). Additionally, qRT-PCR and Western blot analyses discovered that SPRY2 overexpression suppresses expression of osteogenic transcription factors RUNX2, ALP, OSX, OCN, and OPN at both the mRNA and protein levels (Fig. 6 ). Discussion In recent decades, MSCs have garnered considerable attention in regenerative medicine due to their differentiation potential, immunomodulatory properties, and robust in vivo expansion capabilities. Investigations have suggested that those soluble paracrine factors secreted by MSCs might be pivotal to their potent pleiotropic effects, with the efficacy of exosomes being particularly salient [13]. In recent years, a plethora of studies has brought to light the proactive influence of exosomes derived from stem cells in facilitating bone tissue healing and regeneration. Nonetheless, the precise mechanisms by which BMSC-Exo showcases its effects remain not fully elucidated. In this study, we conducted co-culture experiments with exosomes secreted by BMSCs and MC3T3-E1 cells to delve deeply into the specific mechanisms of action of BMSCs-derived exosomes on osteoblasts. Our outcomes indicated that miR-122-5p within BMSCs-derived exosomes is capable of enhancing osteogenic differentiation of cells, a process potentially related to its targeting of SPRY2. These discoveries substantiated the positive function of BMSCs-derived exosomes in fostering osteogenic differentiation and highlight their prospective value in future therapeutic strategies for bone regeneration. Exosomes are extracellular vesicles originating from eukaryotic cells, representing pivotal influence across a spectrum of physiological and pathological processes. They engage in the modulation of immune responses [14] and facilitate the transmission of cellular signals through the conveyance of proteins, nucleic acids, and lipids, contributing substantively to the proliferation of tumors [15]. Particularly in domain of fracture healing, exosomes derived from MSCs have increasingly become the subject of intensive scrutiny. These exosomes have been shown to stimulate osteoblast viability, migration, and angiogenesis. This study initially appraised the exosomes secreted by BMSCs. Thereafter, BMSCs were treated with GW4869 the exosome synthesis/release inhibitor, and the ensuing exosomes, post-treatment, were meticulously collected. Upon co-culturing these exosomes with mouse embryonic osteogenic precursor cells MC3T3-E1, it was observed that exosomes secreted by BMSCs accelerated MC3T3-E1 cells’ osteogenic differentiation. Additionally, our findings revealed that these BMSCs-derived exosomes of BMSCs-Exo are instrumental in enhancing expression of miR-122-5p within the cells. miRNAs have emerged as a central focus of research in realms of biology and fundamental medical science due to their extensive involvement in gene expression regulation [16]. miRNAs are implicated in biological functions and disease mechanisms of a multitude of diseases, including cardiovascular conditions [17], cerebrovascular pathologies [18], inflammatory bowel diseases [19], and skeletal disorders [20]. Typically, miRNAs evince their regulatory effects by targeting mRNAs, thereby establishing a complex network of regulation where a single miRNA might target multiple mRNA, and conversely, single mRNAs might be subject to regulation by various miRNAs [21]. Exosomes, functioning as mediators of intercellular communication, facilitate the transfer of miRNAs from MSCs to recipient cells. Studies have indicated that miRNAs within exosomes are closely associated with genesis, metastasis, and chemoresistance of tumors [11]. Moreover, exosomal miRNAs have demonstrated indispensable relevance in domains of fracture healing and osteogenesis. For instance, research by Jiang et al. [22] has uncovered that exosomal miR-25, derived from BMSCs, modulates SMURF1, thereby influencing RUNX2 and enhancing fracture healing process in mice. In our study, we have identified that exosomes originating from BMSCs might enhance the osteogenic differentiation of MC3T3-E1 cells through miR-122-5p. To substantiate this hypothesis, we constructed a lentiviral vector over-expressing miR-122-5p, infected BMSCs with it, and subsequently co-cultured the exosomes secreted by these cells with MC3T3-E1 cells.We found that overexpression of miR-122-5p in exosomes further augmented the osteogenic differentiation induced by BMSCs-Exo in MC3T3-E1 cells, a mechanism potentially linked to SPRY2. Sprouty (SPRY) was initially identified in Drosophila melanogaster [23] and function as inhibitors of receptor tyrosine kinase signaling [24], holding regulatory effects on development of tracheal system and eyes. SPRY gene family encompasses four homologous genes, which are intricately linked to a variety of developmental and physiological processes in mammals. These genes are inseparably associated with formation and proper functioning of numerous organs, such as the vasculature, skeletal system, prostate, and the urogenital system [25]. Researches have indicated SPRY2 implicates in pathophysiological mechanisms of various malignancies, including breast cancer [24], colorectal cancer [26], and prostate cancer [27]. Moreover, SPRY2 is frequently targeted by miRNAs in regulation of numerous disease processes. For instance, Hsa-miR-22-3p indirectly modulates SPRY2, inhibiting epithelial-mesenchymal transition, cell motility, and invasive potential in hepatocellular carcinoma cells [28]. miR-21promotes neuroblastoma progression by targeting the 3’UTR of SPRY2, leading to activation of the extracellular signal-regulated kinase pathway. To confirm the binding interaction between miR-122-5p and SPRY2, we employed a dual-luciferase reporter gene system [29]. Subsequently, we carried out a lentiviral vector over-expressing miR-122-5p and a plasmid over-expressing SPRY2 to treat MC3T3-E1 cells. Our outcomes revealed that miR-122-5p affects osteogenic differentiation process of cells by targeting SPRY2. Our study has unveiled that BMSCs-Exo facilitates osteogenic differentiation in MC3T3-E1 cells by modulating SPRY2 through miR-122-5p. However, this study is not devoid of limitations. Although preclinical data have substantiated the safety of exosomes, thereby rendering their clinical application feasible, there remains an absence of a universally acknowledged optimal protocol regarding production, isolation, storage, dosage, and administration methods of exosomes [13]. Furthermore, in order to comprehensively elucidate impacts and underlying mechanisms of BMSCs-derived exosomes on osteogenic differentiation in animals, additional in vivo experiments are warranted for validation. In summary, our study has established that BMSCs-Exo is conducive to osteogenic differentiation of MC3T3-E1 cells through a mechanism involving the upregulation of miR-122-5p, which targets and inhibits SPRY2. Conclusions Based on the findings from our study, exosomes derived from bone marrow mesenchymal stem cells (BMSC-Exo) play a critical role in promoting osteogenic differentiation in MC3T3-E1 cells. We demonstrated that BMSC-Exo induce the formation of calcified nodules and enhance the expression of osteogenic markers such as RUNX2, ALP, OSX, OCN, and OPN at both transcriptional and translational levels. Importantly, modification of BMSC-Exo with a miR-122-5p-overexpressing lentivirus further accelerates osteogenic differentiation. Through dual-luciferase reporter assays, we identified that miR-122-5p targets SPRY2, and overexpression of SPRY2 attenuates the osteogenic effects induced by miR-122-5p. These findings highlight a novel mechanism by which BMSC-Exo regulate osteogenesis via miRNA-mediated suppression of SPRY2. This study underscores the therapeutic potential of BMSC-Exo in bone regenerative medicine, offering insights into targeted strategies for enhancing bone healing and regeneration processes. Declarations Competing interests The authors declare that they have no competing interests. Authors' contributions WLY and ZYC designed the research study. CYY and CHW conducted the extraction of exosome samples. PW, SLC and YKW were responsible for subsequent experimental operation, data analysis and prepared figures/tables. ZYC and YZF are the major contributor in writing the original manuscript. WLY revised and edited this manuscript. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work. Funding This work was supported by the Top Talent Support Program for young and middle-aged people of Wuxi Health Committee (grant number: BJ2023070). Acknowledgments The authors declare that they have not used Artificial Intelligence in this study. Availability of data and materials The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation. Consent for publication All authors have read and approved the final manuscript for submission and publication. Ethics approval and consent to participate Not applicable. References Wildemann B, Ignatius A, Leung F, Taitsman LA, Smith RM, Pesántez R, et al. Non-union bone fractures. Nat Rev Dis Primers. 2021;7(1):57. https://doi.org/10.1038/s41572-021-00289-8. Einhorn TA, Gerstenfeld LC. Fracture healing: mechanisms and interventions. Nat Rev Rheumatol. 2015;11(1):45-54. https://doi.org/10.1038/nrrheum.2014.164. Kalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes. Science. 2020;367(6478) https://doi.org/10.1126/science.aau6977. Simons M, Raposo G. Exosomes--vesicular carriers for intercellular communication. Curr Opin Cell Biol. 2009;21(4):575-81. https://doi.org/10.1016/j.ceb.2009.03.007. Wang J, Fu M, He S, Cai P, Xiang X, Fang L. Expression profile analysis of lncRNA in bone marrow mesenchymal stem cells exosomes of postmenopausal osteoporosis patients through microarray and bioinformatics analyses. Pathol Res Pract. 2022;236:153985. https://doi.org/10.1016/j.prp.2022.153985. Fu M, Fang L, Xiang X, Fan X, Wu J, Wang J. Microarray analysis of circRNAs sequencing profile in exosomes derived from bone marrow mesenchymal stem cells in postmenopausal osteoporosis patients. J Clin Lab Anal. 2022;36(1):e23916. https://doi.org/10.1002/jcla.23916. Zhao G, Ge Y, Zhang C, Zhang L, Xu J, Qi L, et al. Progress of Mesenchymal Stem Cell-Derived Exosomes in Tissue Repair. Curr Pharm Des. 2020;26(17):2022-37. https://doi.org/10.2174/1381612826666200420144805. Yang X, Yang J, Lei P, Wen T. LncRNA MALAT1 shuttled by bone marrow-derived mesenchymal stem cells-secreted exosomes alleviates osteoporosis through mediating microRNA-34c/SATB2 axis. Aging (Albany NY). 2019;11(20):8777-91. https://doi.org/10.18632/aging.102264. You M, Ai Z, Zeng J, Fu Y, Zhang L, Wu X. Bone mesenchymal stem cells (BMSCs)-derived exosomal microRNA-21-5p regulates Kruppel-like factor 3 (KLF3) to promote osteoblast proliferation in vitro. Bioengineered. 2022;13(5):11933-44. https://doi.org/10.1080/21655979.2022.2067286. Li Q, Nong A, Huang Z, Xu Y, He K, Jia Y, et al. Exosomes containing miR-122-5p secreted by LPS-induced neutrophils regulate the apoptosis and permeability of brain microvascular endothelial cells by targeting OCLN. Am J Transl Res. 2021;13(5):4167-81. Jiao Y, Zhang L, Li J, He Y, Zhang X, Li J. Exosomal miR-122-5p inhibits tumorigenicity of gastric cancer by downregulating GIT1. Int J Biol Markers. 2021;36(1):36-46. https://doi.org/10.1177/1724600821990677. Choi JH, Sung SE, Kang KK, Lee S, Sung M, Park WT, et al. Extracellular Vesicles from Human Adipose Tissue-Derived Mesenchymal Stem Cells Suppress RANKL-Induced Osteoclast Differentiation via miR122-5p. Biochem Genet. 2024;62(4):2830-52. https://doi.org/10.1007/s10528-023-10569-5. Nikfarjam S, Rezaie J, Zolbanin NM, Jafari R. Mesenchymal stem cell derived-exosomes: a modern approach in translational medicine. J Transl Med. 2020;18(1):449. https://doi.org/10.1186/s12967-020-02622-3. Tavasolian F, Hosseini AZ, Rashidi M, Soudi S, Abdollahi E, Momtazi-Borojeni AA, et al. The Impact of Immune Cell-derived Exosomes on Immune Response Initiation and Immune System Function. Curr Pharm Des. 2021;27(2):197-205. https://doi.org/10.2174/1381612826666201207221819. Pathania AS, Prathipati P, Challagundla KB. New insights into exosome mediated tumor-immune escape: Clinical perspectives and therapeutic strategies. Biochim Biophys Acta Rev Cancer. 2021;1876(2):188624. https://doi.org/10.1016/j.bbcan.2021.188624. Agbu P, Carthew RW. MicroRNA-mediated regulation of glucose and lipid metabolism. Nat Rev Mol Cell Biol. 2021;22(6):425-38. https://doi.org/10.1038/s41580-021-00354-w. Henning RJ. Cardiovascular Exosomes and MicroRNAs in Cardiovascular Physiology and Pathophysiology. J Cardiovasc Transl Res. 2021;14(2):195-212. https://doi.org/10.1007/s12265-020-10040-5. Zhao J, Zhou Y, Guo M, Yue D, Chen C, Liang G, et al. MicroRNA-7: expression and function in brain physiological and pathological processes. Cell Biosci. 2020;10:77. https://doi.org/10.1186/s13578-020-00436-w. Wani S, Man Law IK, Pothoulakis C. Role and mechanisms of exosomal miRNAs in IBD pathophysiology. Am J Physiol Gastrointest Liver Physiol. 2020;319(6):G646-g54. https://doi.org/10.1152/ajpgi.00295.2020. Huang W, Wu Y, Qiao M, Xie Z, Cen X, Huang X, et al. CircRNA-miRNA networks in regulating bone disease. J Cell Physiol. 2022;237(2):1225-44. https://doi.org/10.1002/jcp.30625. Diener C, Keller A, Meese E. Emerging concepts of miRNA therapeutics: from cells to clinic. Trends Genet. 2022;38(6):613-26. https://doi.org/10.1016/j.tig.2022.02.006. Jiang Y, Zhang J, Li Z, Jia G. Bone Marrow Mesenchymal Stem Cell-Derived Exosomal miR-25 Regulates the Ubiquitination and Degradation of Runx2 by SMURF1 to Promote Fracture Healing in Mice. Front Med (Lausanne). 2020;7:577578. https://doi.org/10.3389/fmed.2020.577578. Hacohen N, Kramer S, Sutherland D, Hiromi Y, Krasnow MA. sprouty encodes a novel antagonist of FGF signaling that patterns apical branching of the Drosophila airways. Cell. 1998;92(2):253-63. https://doi.org/10.1016/s0092-8674(00)80919-8. Dai H, Xu W, Wang L, Li X, Sheng X, Zhu L, et al. Loss of SPRY2 contributes to cancer-associated fibroblasts activation and promotes breast cancer development. Breast Cancer Res. 2023;25(1):90. https://doi.org/10.1186/s13058-023-01683-8. Kawazoe T, Taniguchi K. The Sprouty/Spred family as tumor suppressors: Coming of age. Cancer Sci. 2019;110(5):1525-35. https://doi.org/10.1111/cas.13999. Stuckel AJ, Zeng S, Lyu Z, Zhang W, Zhang X, Dougherty U, et al. Epigenetic DNA Modifications Upregulate SPRY2 in Human Colorectal Cancers. Cells. 2021;10(10) https://doi.org/10.3390/cells10102632. Ye J, Liu W, Yu X, Wu L, Chen Z, Yu Y, et al. TRAF7-targeted HOXA5 acts as a tumor suppressor in prostate cancer progression and stemness via transcriptionally activating SPRY2 and regulating MEK/ERK signaling. Cell Death Discov. 2023;9(1):378. https://doi.org/10.1038/s41420-023-01675-9. Cui S, Chen Y, Guo Y, Wang X, Chen D. Hsa-miR-22-3p inhibits liver cancer cell EMT and cell migration/ invasion by indirectly regulating SPRY2. PLoS One. 2023;18(2):e0281536. https://doi.org/10.1371/journal.pone.0281536. Chen J, Xu Y, Wu P, Chen X, Weng W, Li D. Transcription Factor FOXO3a Overexpression Inhibits the Progression of Neuroblastoma by Regulating the miR-21/SPRY2/ERK Axis. World Neurosurg. 2022;164:e99-e112. https://doi.org/10.1016/j.wneu.2022.04.009. Supplementary Files SupplementaryMeterials.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4723687","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":341454833,"identity":"60e2a648-873a-466c-9bb1-f11caf1df4c0","order_by":0,"name":"Zhiyu Chen","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine Wuxi Affiliated Hospital: Wuxi Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhiyu","middleName":"","lastName":"Chen","suffix":""},{"id":341454834,"identity":"d098c63c-b90d-4ff3-9a2d-2e6f36a1b6ac","order_by":1,"name":"Yizhe Fan","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine Wuxi Affiliated Hospital: Wuxi Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yizhe","middleName":"","lastName":"Fan","suffix":""},{"id":341454835,"identity":"9f6a5ad6-0814-4a2a-8861-e3c914fa8212","order_by":2,"name":"Chengyi Yang","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine Wuxi Affiliated Hospital: Wuxi Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chengyi","middleName":"","lastName":"Yang","suffix":""},{"id":341454836,"identity":"61b0e23b-5015-4075-b3b2-a7ad4d2ced59","order_by":3,"name":"Chenhao Wang","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine Wuxi Affiliated Hospital: Wuxi Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chenhao","middleName":"","lastName":"Wang","suffix":""},{"id":341454837,"identity":"61c4c369-b7db-40b4-b4b5-a012bcbdfb83","order_by":4,"name":"Peng Wang","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine Wuxi Affiliated Hospital: Wuxi Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Wang","suffix":""},{"id":341454838,"identity":"6df96860-ea6e-4916-890a-e3173dc50563","order_by":5,"name":"Shaolei Cheng","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine Wuxi Affiliated Hospital: Wuxi Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Shaolei","middleName":"","lastName":"Cheng","suffix":""},{"id":341454839,"identity":"6d632a51-b27c-42de-88fa-b8c031327d7d","order_by":6,"name":"Yikai Wang","email":"","orcid":"","institution":"Nanjing University of Chinese Medicine Wuxi Affiliated Hospital: Wuxi Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yikai","middleName":"","lastName":"Wang","suffix":""},{"id":341454840,"identity":"d07da9c0-928e-428b-acfa-4526457775d3","order_by":7,"name":"Wulin You","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0ElEQVRIiWNgGAWjYLCCBwY2cvLsDUCWgQWRWhIK0owNew6AtEgQq+XD4cSGGwkgJhFaDI73mEkkGBw2Zpz5/OqGHwUSDPzt3Qn4tZw5A9KSLscunVN2swfoMIkzZzfg13Ijx+xGgoG1MePsnLQbPEAtBhK5RGlhTmy4eSbt5h8StDgDvc9+7DZRtkieOVb+I8EAFMg5bLdlDCR4CPqF73jzZoMPf0BRefzZzTdABn97L34tCgfgTB4DMIlXOQjIN8CZ7A8Iqh4Fo2AUjIKRCQB9wUwFT3OQkwAAAABJRU5ErkJggg==","orcid":"","institution":"Nanjing University of Chinese Medicine Wuxi Affiliated Hospital: Wuxi Hospital of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Wulin","middleName":"","lastName":"You","suffix":""}],"badges":[],"createdAt":"2024-07-11 11:08:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4723687/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4723687/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":64462717,"identity":"b7aba3a1-ea29-46c2-ab88-87a763ac7513","added_by":"auto","created_at":"2024-09-13 13:06:46","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1136135,"visible":true,"origin":"","legend":"\u003cp\u003eBMSC-Exo promotes calcium nodule formation and ALP expression in MC3T3-E1 cells. (A) Phalloidin and PKH26 staining. (B, D) ARS staining results. (C, E) ALP staining results. Note: in contrast to control group, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; in contrast to exosome group, #\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ##\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-4723687/v1/4879448335b384e7914af84c.png"},{"id":64462718,"identity":"6032db2c-21f6-4eac-99e8-d542a94d62cb","added_by":"auto","created_at":"2024-09-13 13:06:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":377469,"visible":true,"origin":"","legend":"\u003cp\u003eBMSC-Exo promots levels of miR-122-5p and osteogenic cytokines in MC3T3-E1 cells. (A) qRT-PCR test results. (B) Western blot test results. Note: in contrast to control group, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; in contrast to exosome group, #\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ##\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01. Full-length blots/gels are presented in Supplementary Fig. 2.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4723687/v1/90a3b659314d66ddbc0735d6.png"},{"id":64463484,"identity":"e8623543-c9a2-45b8-8ee2-7e9496665e9c","added_by":"auto","created_at":"2024-09-13 13:14:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":693837,"visible":true,"origin":"","legend":"\u003cp\u003eBMSC-Exo facilitates formation of calcium nodules and expression of ALP in MC3T3-E1 cells through miR-122-5p. (A) ARS staining results. (B) ALP staining results. Note: in contrast to control group, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; in contrast to miR-122-5p NC group, #\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ##\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4723687/v1/45fec0b7afd0fa4434b139a0.png"},{"id":64462721,"identity":"23950584-7f1a-4f50-a9c5-856fced0e6a8","added_by":"auto","created_at":"2024-09-13 13:06:46","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":362792,"visible":true,"origin":"","legend":"\u003cp\u003eBMSC-Exo facilitates expression of osteoblast cytokines and SPRY2 in MC3T3-E1 cells. (A) qRT-PCR test results. (B) Western blot test results. Note: in contrast to control group, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; in contrast to miR-122-5p NC group, #\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, ##\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01. Full-length blots/gels are presented in Supplementary Fig. 3.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4723687/v1/cf25a75c70804e51e50f7780.png"},{"id":64462720,"identity":"0884d2e0-b2bb-40e5-b4d7-fa75c2f394bb","added_by":"auto","created_at":"2024-09-13 13:06:46","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":540740,"visible":true,"origin":"","legend":"\u003cp\u003eMiR-122-5p accelerates osteogenic differentiation of MC3T3-E1 cells through specifically suppressing SPRY2. (A) Dual-luciferase reporter assay outcomes. (B) qRT-PCR assessment on miR-122-5p expression. (C) Quantification of SPRY2 mRNA and protein expressions. (D) ARS staining results. Note: in contrast to miR-122-5p+OE-NC group, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01. Full-length blots/gels are presented in Supplementary Fig. 4.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4723687/v1/88e220dde5bd3bd9827edfdd.png"},{"id":64462722,"identity":"c5cbcd98-c066-46ab-b02d-3585dd38ed1f","added_by":"auto","created_at":"2024-09-13 13:06:46","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":198737,"visible":true,"origin":"","legend":"\u003cp\u003eMiR-122-5p is conductive to expression of osteoblast in MC3T3-E1 cells. (A) The results of qRT-PCR test. (B) The results of Western blot test. Note: in contrast to miR-122-5p+OE-NC group, *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01. Full-length blots/gels are presented in Supplementary Fig. 5.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-4723687/v1/26aafe7786d1fc5a8f10d82d.png"},{"id":65315398,"identity":"ad52583e-0638-4eb3-b531-ad3ad27f53ef","added_by":"auto","created_at":"2024-09-26 03:24:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3944456,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4723687/v1/d8f60d10-da4b-4f39-9d75-e807edbfb1b3.pdf"},{"id":64462723,"identity":"3963edc0-2fce-4f35-882e-61a0b3b8db7f","added_by":"auto","created_at":"2024-09-13 13:06:46","extension":"docx","order_by":17,"title":"","display":"","copyAsset":false,"role":"supplement","size":2733386,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMeterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-4723687/v1/d64f2431a76b028b59f821c3.docx"}],"financialInterests":"","formattedTitle":"BMSC-Exo miR-122-5p facilitates osteogenic differentiation of MC3T3-E1 cells through specifically suppressing SPRY2","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHuman skeletal system is endowed with an unparalleled capacity for regeneration, capable of self-repair through a reconstitution of cellular sequences and alignments, a rarity among bodily tissues. Nonetheless, this process of fracture healing is often complicated by the advent of infection, inadequate stabilization, or unsuccessful surgical endeavors, potentially culminating in chronic pathological conditions [1]. Contextually, modern medical science has devised a multitude of strategies to accelerate the osseous healing process, spanning domains of biological and biophysical interventions [2]. Osseous matrix is inherently composed of collagen and calcium phosphate, which not only constitute skeletal framework but also provide requisite structural scaffolding for the ligaments and tendons that adhere to it. In a process of skeletal reconstitution, osteoclasts are tasked with the degradation and resorption of senescent bone, supplanted by osteoblasts that synthesize and deposit novel bone tissue. Mesenchymal stem cells (MSCs) are indispensable in this transformative cascade, undergoing differentiation into osteogenic progenitors, which subsequently evolve into pre-osteoblasts and ultimately mature into functional osteocytes. Moreover, bone marrow mesenchymal stem cells (BMSCs) hold a pivotal position as the progenitors of adipocytes and the osteogenic lineage within the marrow, serving with critical efficacy to sustain marrow\u0026rsquo;s ecological balance and integrity of skeletal health.\u003c/p\u003e \u003cp\u003eExosomes are a diverse group of homogenous vesicles secreted by most mammalian cell types. They encapsulate a plethora of molecular constituents, including nucleic acids, amino acids, metabolites, and proteins [3], which modulate cellular physiology and pathogenesis through the conveyance of bioactive signals [4]. An abundance of researches have indicated that exosomes derived from Bone Marrow Mesenchymal Stem Cells (BMSC-Exo) possess a propelling influence on the process of osteogenesis. Furthermore, investigations have revealed that in patients with Postmenopausal Osteoporosis (PMOP), long non-coding RNAs (lncRNAs) expression expression differs in BMSC exosomes [5]. Concurrently, other studies have highlighted that circular RNAs (circRNAs) present differential expression patterns, implicated in regulation of various signaling pathways [6]. MicroRNAs (miRNAs), as pivotal components of exosomes, engage in reparative mechanisms, including promotion of cellular proliferation, angiogenesis, and the inhibition of apoptosis [7]. Those exosomes secreted by BMSCs are replete with the molecule MALAT1, which modulates miR-34c/SATB2 signaling pathway to augment osteoblasts\u0026rsquo; activity in osteoporotic murine models [8]. Furthermore, the miR-21-5p molecule encapsulated within BMSCs-derived exosomes demonstrates a potential to ameliorate osteoporotic symptoms through targeting KLF3 [9]. These research findings underscored an affirmative role of miRNAs in exosomes from BMSCs in the growth and differentiation of osteoblasts. Subsidiary research indicated that the miR-122-5p molecule within exosomes is capable of regulating apoptosis and permeability in cerebral microvascular endothelial cells [10], inhibiting the tumorigenic potential of gastric cancer [11], and obstructing osteoclast differentiation induced by RANKL [12]. Although functions of miR-122-5p in osteogenic differentiation is gaining recognition, the specific impact within BMSCs-derived exosomes remains insufficiently explored. Consequently, this study extracted exosomes from BMSCs and co-cultivated them with mouse embryonic osteogenic progenitor cells MC3T3-E1 to explore the role of miR-122-5p in osteogenic differentiation.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eCell culture\u003c/h2\u003e\n \u003cp\u003eBMSC and MC3T3-E1 cells were procured from iCell Bioscience Inc. (No. MIC-iCell-s018 and No. iCell-m031). Cryovials containing these cells were immersed in a 37℃ water bath and agitated to expedite the thawing process. Post-thawing, cells were aliquoted into either the primary mesenchymal stem cell culture medium (iCell, Shanghai, China) or a complete growth medium, ensuring homogeneous integration. Subsequently, mixture undergoes centrifugation at 1000 rpm for a duration ranging from 3 to 5 min; supernatant was then aspirated, leaving the cells to be resuspended. Cellular suspension was thereafter transferred into culture flasks pre-equilibrated with the corresponding culture medium or complete growth medium. Flasks were subsequently incubated at 37℃ with 5% CO\u003csub\u003e2\u003c/sub\u003e for cell cultivation.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003eCell processing\u003c/h2\u003e\n \u003cp\u003eDMSO was utilized to formulate a suspension of GW4869. BMSCs were subjected to treatment with GW4869 at concentrations of 5 and 10 \u0026micro;M (HY-19363, MCE, Shanghai, China) or with miR-122-5p mimic/NC via lentivirus overexpression, followed by collection of exosomes secreted by BMSCs. After 48 hours of co-culture with MC3T3-E1 cells, the exosomes were collected. In a separate experimental series, Lipofectamine 2000 (11668019, Invitrogen, California, USA) was initially employed to transfect miR-122-5p mimic/NC into MC3T3-E1 cells, which were subsequently transfected with OE-SPRY2/NC (overexpression plasmid) 48 h later. Cells were harvested after another 48 h of culture.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003eExosome extraction\u003c/h2\u003e\n \u003cp\u003eCells were placed into sterile, enzyme-free 15 mL centrifuge tubes, followed by centrifugation at 4℃ with a force of 2000\u0026times;g for 30 min. Those samples were then passed via a 0.22 \u0026micro;m membrane and transferred to new centrifuge tubes for resting on ice. An equal volume to cell volume of Total Exosome Isolation Reagent (4478359, Invitrogen, California, USA) was added to the samples, which were then thoroughly mixed by pipetting. Then mixture was rotated at a temperature between 2\u0026thinsp;~\u0026thinsp;8℃ for 30 min to ensure uniform blending. Subsequently, centrifugation was performed at 25℃ with a force of 10000\u0026times;g for 10 min. The supernatant was discarded, and the pellet was resuspended within PBS to obtain exosome sample.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003eIdentification of exosomes\u003c/h2\u003e\n \u003cp\u003eExosome samples from various groups were applied onto carbon-supported film-coated copper grids, where excess liquid was absorbed after 3 to 5 min. Subsequently, a 2% PBS (Servicebio, Wuhan, China) was applied, and once dried, the grids were examined under a transmission electron microscope (HITACHI, Japan). Those samples, diluted with 1X PBS buffer, were placed into a cleaned sample chamber for Nanoparticle Tracking Analysis (NTA) with the ZetaView PMX 110 apparatus (Particle Metrix, Germany) to assess exosomes.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003eDual-luciferase assay\u003c/h2\u003e\n \u003cp\u003eUpon the application of dual-luciferase assay kit (RG008, Beyotime, Shanghai, China), the experiment was conducted. Linear fragments of the pGL6-miR vector were digested with HindIII and BamHI restriction endonucleases (ER0051, Invitrogen, CA, USA), followed by a 2-h incubation in a water bath, and then retrieved with the kit. SPRY2 gene (ELK biotechnology, Wuhan, China) was amplified via PCR and underwent a recombination reaction with the vector at 37℃ for 30 min. High-efficiency DH5a competent cells (EC001, ELK biotechnology, Wuhan, China) were employed for transformation, with monoclonal selection for sequencing analysis conducted after one day to isolate the correct monoclonal colonies. miR-122-5p mimic/NC (Guangzhou, China), pGL6-SPRY2 (/pGL6) \u0026amp; pRL-TK plasmids, and Lipofectamine 2000 (11668019, Invitrogen, CA, USA) were each diluted in Opti-MEM and incubated at 25℃ for 5 min. After combining the diluted solutions, the transfection mixture was incubated at 25℃ for 20 min. The mixture was then added to the cells and incubated at 37℃ with 5% CO\u003csub\u003e2\u003c/sub\u003e for 24 h for transfection. Following transfection, those cells were lysed thoroughly, and 100 \u0026micro;L of the Renilla luciferase assay reagent (prepared at a ratio of 1:100) was added to measure relative light units. Those PCR primer sequences for SPRY2 were detailed in Supplementary Table\u0026nbsp;1, while the miR-122-5p mimic/NC sequences were presented in Supplementary Table\u0026nbsp;2.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003ePhalloidin and PKH26 staining\u003c/h2\u003e\n \u003cp\u003eExosome suspension was incorporated into a 2 \u0026micro;M PKH26 working solution (PKH26PCL, Sigma, Shanghai, China) and cultured at 25℃ for 5 min. Excess dye was removed by filtration through a 0.22 \u0026micro;m filter, and the mixture was subsequently added to the cells under observation. Those cells were subsequently treated with 4% paraformaldehyde for 20 min. The fixed cell smears were then removed and placed onto slides, encircled with a histological pen to prevent the loss of incubation medium during subsequent incubation steps. Red phalloidin-TRITC (40734ES75, Yeasen, Shanghai, China) was diluted 1:300 in a 1% BSA solution (4240GR250, Biofroxx, Guangzhou, China) to create the working solution. Following PBS rinsing, DAPI (D8417-1MG, Sigma, Shanghai, China) was applied for nuclear staining and cultured in the dark at 25℃ for 20 to 30 min. Finally, the slides were sealed using anti-fluorescence quenching mounting medium (V900155-25G, Sigma, Shanghai, China) before being examined and imaged under a microscope.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003eqRT-PCR analysis\u003c/h2\u003e\n \u003cp\u003eTotal cellular RNA was isolated with TRIzol (EP013, ELK Biotechnology, Wuhan, China). Synthesis of the first-strand cDNA was facilitated by the EntiLink\u0026trade; 1st Strand cDNA Synthesis Super Mix (EQ031, ELK Biotechnology, Wuhan, China). qPCR was performed with the EnTurbo\u0026trade; SYBR Green PCR SuperMix kit (EQ001, ELK Biotechnology, Wuhan, China). Reaction protocol entailed an initial denaturation phase at 90℃ for 30 s, followed by 40 rounds consisting of 90℃ for 10 s, 58℃ for 30 s, and 72℃ for 30 s. For the shake of miR-122-5p quantification, U6 was deemed as an endogenous reference gene, whereas GAPDH assumes this role in other instances. Specific primer sequences were delineated in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eThe sequences of qRT-PCR\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"2\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e5\u0026rsquo;-3\u0026rsquo; sequences\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TGAAGGGTGGAGCCAAAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: AGTCTTCTGGGTGGCAGTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eRUNX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: CGCCACCACTCACTACCACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: TGGATTTAATAGCGTGCTGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eALP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TGACTACCACTCGGGTGAACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: TGATATGCGATGTCCTTGCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eOSX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TGTCTATAAGCCCAAGGCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: TCCTGACAGTTGGGGCAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eOCN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TTCTGCTCACTCTGCTGACCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: CTGATAGCTCGTCACAAGCAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eOPN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TCTGAGGGACTAACTACGACCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: TGGAAGAGTTTCTTGCTTAAAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eU6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: CTCGCTTCGGCAGCACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: AACGCTTCACGAATTTGCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003emiR-122-5p\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF: TCAGGTGGAGTGTGACAATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR: CTCAACTGGTGTCGTGGAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"left\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003eWestern Blot\u003c/h2\u003e\n \u003cp\u003eCells were lysed, with the lysate solution (AS1004, ASPEN), yielding a total protein extract. The protein content was determined with the BCA Protein Assay Kit (AS1086, ASPEN). SDS-PAGE gels were formulated, with each well loaded with 20 \u0026micro;g of protein, followed by electrophoresis and membrane transfer. Primary antibodies (diluted to 1:1000) were incubated overnight at 4℃, followed by secondary antibodies (diluted to 1:10000) were incubated at 25℃ for 30 min. Subsequently, freshly prepared ECL luminescent reagent (A:B\u0026thinsp;=\u0026thinsp;1:1; AS1059, ASPEN) was added, and the gel was scanned and archived. AlphaEaseFC software was employed to analyze the optical density values.\u003c/p\u003e\n \u003cp\u003ePrimary antibodies utilized in this experiment included rabbit antibodies targeting GAPDH (1:10000; ab181602, abcam, Shanghai, China), RUNX2 (20700-1-AP, Proteintech, Wuhan, China), ALP (18507-1-AP, Proteintech, Wuhan, China), OSX (ab209484, abcam, Shanghai, China), OCN (ab93876, abcam, Shanghai, China), OPN (ab63856, abcam, Shanghai, China), and SPRY2 (ab85670, abcam, Shanghai, China). Secondary antibody was an HRP-conjugated rabbit anti-goat antibody (AS1108, ASPEN).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eARS staining\u003c/h2\u003e\n \u003cp\u003eCell specimens were treated with a 4% paraformaldehyde solution (80096618, Sinopharm Chemical Reagent Co., Ltd, Shanghai, China) for 10 to 20 min, followed by another rinse with PBS. Subsequently, specimens were stained with ARS staining solution (G1038, Servicebio Wuhan, China) for 5 to 10 min. After air-drying the slides, they were clarified with xylene (10023418, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China) for 5 min, and subsequently mounted with neutral gum (G8590, Solarbio, Beijing, China). Those slides were examined and photographed under an inverted microscope (OLYMPUS, Japan).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eALP staining\u003c/h2\u003e\n \u003cp\u003eCell samples were treated with a 4% paraformaldehyde solution (80096618, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China) for a period ranging from 10 to 20 min, followed by another wash with PBS. Subsequently, working solution (C3206, Beyotime, Shanghai, China) was applied, and those samples were incubated at 37℃ in a dark environment for 30 to 60 min, followed by a rinse with distilled water to terminate the reaction. Samples were then treated with Azure B solution for 3 min, followed by staining with hematoxylin solution (H9627-25G, Sigma, Shanghai, China) for a duration of 3 to 10 min. Differentiation was carried out with 1% hydrochloric acid (10011018, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China), and the samples were re-stained with 1% ammonia water (10002018, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China) for the blueing processing, concluding with mounting with glycerin gelatin (10010618; 10010328, Sinopharm Chemical Reagent CO., Ltd, Shanghai, China).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistic analysis\u003c/h2\u003e\n \u003cp\u003eAll data in this study are reported as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD with n\u0026thinsp;=\u0026thinsp;3. Results of the experiment were analyzed and graphed with GraphPad Prism 8.0. For comparing multiple groups, meet the criteria for normal distribution, we used a one-way analysis of variance with Tukey\u0026rsquo;s post hoc test for data that followed a normal distribution; when the normal distribution was not met, the Friedman test was utilized. A statistical difference was determined to be true when \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eBMSC-Exo stimulates osteogenic differentiation in MC3T3-E1 cells\u003c/h2\u003e \u003cp\u003eExosomes were extracted and harvested from BMSCs treated with the exosome synthesis/release inhibitor GW4869 at concentrations of 5 and 10 \u0026micro;M for identification. The identification confirmed successful exosome extraction, with BMSCs demonstrated to secrete exosomes, and GW4869 was shown to inhibit exosome secretion in BMSCs (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Subsequently, BMSCs were subjected to intervention with 5 and 10 \u0026micro;M GW4869, and the secreted exosomes were co-cultured with murine pre-osteoblasts MC3T3-E1, followed by cell collection for analysis. Our analysis revealed that MC3T3-E1 cells co-cultured with BMSC-Exo maintained intact myofibril morphology and rendered increased exosome uptake; in contrast, the addition of GW4869 led to disorganized myofibrils and decreased exosome uptake (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). ARS staining indicated an evident increase in calcium nodule formation in MC3T3-E1 cells co-cultured with BMSC-Exo; however, the addition of GW4869 notably reduced calcium nodule formation, with the 10 \u0026micro;M concentration showing a more pronounced effect than the 5 \u0026micro;M concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, D). ALP staining results also demonstrated a notable enhanced ALP expression in BMSC-Exo-treated MC3T3-E1 cells; the addition of GW4869, however, resulted in a significant decrease in ALP expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, E). Intervention with BMSC-Exo promoted miR-122-5p expression, whereas addition of GW4869 suppressed miR-122-5p expression. Furthermore, levels of osteogenic transcription factors were examined, revealing that BMSC-Exo greatly up-regulated mRNA and protein expression of RUNX2, ALP, OSX, OCN, and OPN in MC3T3-E1 cells, while addition of GW4869 notably down-regulated expression of these factors (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eBMSC-Exo enhances osteogenic differentiation of MC3T3-E1 cells through miR-122-5p\u003c/h2\u003e \u003cp\u003ePrevious findings indicated that BMSC-Exo could facilitate osteogenic differentiation of MC3T3-E1 cells, with an elevation in miR-122-5p level. To ascertain the function of exosomal miR-122-5p, BMSCs were transfected with a lentivirus carrying a miR-122-5p overexpression vector, followed by co-culturing BMSC-Exo with MC3T3-E1 cells. Our findings indicated that miR-122-5p overexpression in BMSCs led to an enhanced secretion of exosomes that could further augment the levels of calcium nodules and ALP in MC3T3-E1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Regarding osteogenic transcription factors, overexpression of miR-122-5p similarly induced a further increase in mRNA and protein levels of RUNX2, OSX, OCN, and OPN. Additionally, expression of SPRY2 was examined, and it was found that co-culturing with exosomes could decrease expression of SPRY2 in MC3T3-E1 cells, with overexpression of miR-122-5p further promoting this decrease (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMiR-122-5p accelerates osteogenic differentiation of MC3T3-E1 cells by specifically suppressing SPRY2\u003c/h2\u003e \u003cp\u003eTo investigate the potential for miR-122-5p to regulate osteogenic differentiation by acting on SPRY2, an initial interaction was verified through a dual-luciferase reporter gene assay, demonstrating a definitive interplay between miR-122-5p and SPRY2. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Subsequently, exosomes secreted from BMSCs treated with a lentivirus for miR-122-5p overexpression were co-cultured with MC3T3-E1 cells, along with transfection of an overexpression plasmid for SPRY2. Our findings indicated that overexpression of SPRY2 down-regulates expression of miR-122-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-C). Further, ARS staining revealed a notable reduction in the number of calcium nodules within the cells following SPRY2 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Additionally, qRT-PCR and Western blot analyses discovered that SPRY2 overexpression suppresses expression of osteogenic transcription factors RUNX2, ALP, OSX, OCN, and OPN at both the mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn recent decades, MSCs have garnered considerable attention in regenerative medicine due to their differentiation potential, immunomodulatory properties, and robust in vivo expansion capabilities. Investigations have suggested that those soluble paracrine factors secreted by MSCs might be pivotal to their potent pleiotropic effects, with the efficacy of exosomes being particularly salient [13]. In recent years, a plethora of studies has brought to light the proactive influence of exosomes derived from stem cells in facilitating bone tissue healing and regeneration. Nonetheless, the precise mechanisms by which BMSC-Exo showcases its effects remain not fully elucidated. In this study, we conducted co-culture experiments with exosomes secreted by BMSCs and MC3T3-E1 cells to delve deeply into the specific mechanisms of action of BMSCs-derived exosomes on osteoblasts. Our outcomes indicated that miR-122-5p within BMSCs-derived exosomes is capable of enhancing osteogenic differentiation of cells, a process potentially related to its targeting of SPRY2. These discoveries substantiated the positive function of BMSCs-derived exosomes in fostering osteogenic differentiation and highlight their prospective value in future therapeutic strategies for bone regeneration.\u003c/p\u003e \u003cp\u003eExosomes are extracellular vesicles originating from eukaryotic cells, representing pivotal influence across a spectrum of physiological and pathological processes. They engage in the modulation of immune responses [14] and facilitate the transmission of cellular signals through the conveyance of proteins, nucleic acids, and lipids, contributing substantively to the proliferation of tumors [15]. Particularly in domain of fracture healing, exosomes derived from MSCs have increasingly become the subject of intensive scrutiny. These exosomes have been shown to stimulate osteoblast viability, migration, and angiogenesis.\u003c/p\u003e \u003cp\u003eThis study initially appraised the exosomes secreted by BMSCs. Thereafter, BMSCs were treated with GW4869 the exosome synthesis/release inhibitor, and the ensuing exosomes, post-treatment, were meticulously collected. Upon co-culturing these exosomes with mouse embryonic osteogenic precursor cells MC3T3-E1, it was observed that exosomes secreted by BMSCs accelerated MC3T3-E1 cells\u0026rsquo; osteogenic differentiation. Additionally, our findings revealed that these BMSCs-derived exosomes of BMSCs-Exo are instrumental in enhancing expression of miR-122-5p within the cells.\u003c/p\u003e \u003cp\u003emiRNAs have emerged as a central focus of research in realms of biology and fundamental medical science due to their extensive involvement in gene expression regulation [16]. miRNAs are implicated in biological functions and disease mechanisms of a multitude of diseases, including cardiovascular conditions [17], cerebrovascular pathologies [18], inflammatory bowel diseases [19], and skeletal disorders [20]. Typically, miRNAs evince their regulatory effects by targeting mRNAs, thereby establishing a complex network of regulation where a single miRNA might target multiple mRNA, and conversely, single mRNAs might be subject to regulation by various miRNAs [21]. Exosomes, functioning as mediators of intercellular communication, facilitate the transfer of miRNAs from MSCs to recipient cells. Studies have indicated that miRNAs within exosomes are closely associated with genesis, metastasis, and chemoresistance of tumors [11]. Moreover, exosomal miRNAs have demonstrated indispensable relevance in domains of fracture healing and osteogenesis. For instance, research by Jiang et al. [22] has uncovered that exosomal miR-25, derived from BMSCs, modulates SMURF1, thereby influencing RUNX2 and enhancing fracture healing process in mice. In our study, we have identified that exosomes originating from BMSCs might enhance the osteogenic differentiation of MC3T3-E1 cells through miR-122-5p. To substantiate this hypothesis, we constructed a lentiviral vector over-expressing miR-122-5p, infected BMSCs with it, and subsequently co-cultured the exosomes secreted by these cells with MC3T3-E1 cells.We found that overexpression of miR-122-5p in exosomes further augmented the osteogenic differentiation induced by BMSCs-Exo in MC3T3-E1 cells, a mechanism potentially linked to SPRY2.\u003c/p\u003e \u003cp\u003eSprouty (SPRY) was initially identified in Drosophila melanogaster [23] and function as inhibitors of receptor tyrosine kinase signaling [24], holding regulatory effects on development of tracheal system and eyes. SPRY gene family encompasses four homologous genes, which are intricately linked to a variety of developmental and physiological processes in mammals. These genes are inseparably associated with formation and proper functioning of numerous organs, such as the vasculature, skeletal system, prostate, and the urogenital system [25]. Researches have indicated SPRY2 implicates in pathophysiological mechanisms of various malignancies, including breast cancer [24], colorectal cancer [26], and prostate cancer [27]. Moreover, SPRY2 is frequently targeted by miRNAs in regulation of numerous disease processes. For instance, Hsa-miR-22-3p indirectly modulates SPRY2, inhibiting epithelial-mesenchymal transition, cell motility, and invasive potential in hepatocellular carcinoma cells [28]. miR-21promotes neuroblastoma progression by targeting the 3\u0026rsquo;UTR of SPRY2, leading to activation of the extracellular signal-regulated kinase pathway. To confirm the binding interaction between miR-122-5p and SPRY2, we employed a dual-luciferase reporter gene system [29]. Subsequently, we carried out a lentiviral vector over-expressing miR-122-5p and a plasmid over-expressing SPRY2 to treat MC3T3-E1 cells. Our outcomes revealed that miR-122-5p affects osteogenic differentiation process of cells by targeting SPRY2.\u003c/p\u003e \u003cp\u003eOur study has unveiled that BMSCs-Exo facilitates osteogenic differentiation in MC3T3-E1 cells by modulating SPRY2 through miR-122-5p. However, this study is not devoid of limitations. Although preclinical data have substantiated the safety of exosomes, thereby rendering their clinical application feasible, there remains an absence of a universally acknowledged optimal protocol regarding production, isolation, storage, dosage, and administration methods of exosomes [13]. Furthermore, in order to comprehensively elucidate impacts and underlying mechanisms of BMSCs-derived exosomes on osteogenic differentiation in animals, additional in vivo experiments are warranted for validation.\u003c/p\u003e \u003cp\u003eIn summary, our study has established that BMSCs-Exo is conducive to osteogenic differentiation of MC3T3-E1 cells through a mechanism involving the upregulation of miR-122-5p, which targets and inhibits SPRY2.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eBased on the findings from our study, exosomes derived from bone marrow mesenchymal stem cells (BMSC-Exo) play a critical role in promoting osteogenic differentiation in MC3T3-E1 cells. We demonstrated that BMSC-Exo induce the formation of calcified nodules and enhance the expression of osteogenic markers such as RUNX2, ALP, OSX, OCN, and OPN at both transcriptional and translational levels. Importantly, modification of BMSC-Exo with a miR-122-5p-overexpressing lentivirus further accelerates osteogenic differentiation. Through dual-luciferase reporter assays, we identified that miR-122-5p targets SPRY2, and overexpression of SPRY2 attenuates the osteogenic effects induced by miR-122-5p. These findings highlight a novel mechanism by which BMSC-Exo regulate osteogenesis via miRNA-mediated suppression of SPRY2. This study underscores the therapeutic potential of BMSC-Exo in bone regenerative medicine, offering insights into targeted strategies for enhancing bone healing and regeneration processes.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWLY and ZYC designed the research study. CYY and CHW conducted the extraction of exosome samples. PW, SLC and YKW were responsible for subsequent experimental operation, data analysis and prepared figures/tables. ZYC and YZF are the major contributor in writing the original manuscript. WLY revised and edited this manuscript. All authors contributed to editorial changes in the manuscript. All authors read and approved the final manuscript. All authors have participated sufficiently in the work and agreed to be accountable for all aspects of the work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Top Talent Support Program for young and middle-aged people of Wuxi Health Committee (grant number: BJ2023070).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have not used Artificial Intelligence in this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have read and approved the final manuscript for submission and publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWildemann B, Ignatius A, Leung F, Taitsman LA, Smith RM, Pes\u0026aacute;ntez R, et al. Non-union bone fractures. Nat Rev Dis Primers. 2021;7(1):57. https://doi.org/10.1038/s41572-021-00289-8.\u003c/li\u003e\n\u003cli\u003eEinhorn TA, Gerstenfeld LC. Fracture healing: mechanisms and interventions. Nat Rev Rheumatol. 2015;11(1):45-54. https://doi.org/10.1038/nrrheum.2014.164.\u003c/li\u003e\n\u003cli\u003eKalluri R, LeBleu VS. The biology, function, and biomedical applications of exosomes. Science. 2020;367(6478) https://doi.org/10.1126/science.aau6977.\u003c/li\u003e\n\u003cli\u003eSimons M, Raposo G. Exosomes--vesicular carriers for intercellular communication. Curr Opin Cell Biol. 2009;21(4):575-81. https://doi.org/10.1016/j.ceb.2009.03.007.\u003c/li\u003e\n\u003cli\u003eWang J, Fu M, He S, Cai P, Xiang X, Fang L. Expression profile analysis of lncRNA in bone marrow mesenchymal stem cells exosomes of postmenopausal osteoporosis patients through microarray and bioinformatics analyses. Pathol Res Pract. 2022;236:153985. https://doi.org/10.1016/j.prp.2022.153985.\u003c/li\u003e\n\u003cli\u003eFu M, Fang L, Xiang X, Fan X, Wu J, Wang J. Microarray analysis of circRNAs sequencing profile in exosomes derived from bone marrow mesenchymal stem cells in postmenopausal osteoporosis patients. J Clin Lab Anal. 2022;36(1):e23916. https://doi.org/10.1002/jcla.23916.\u003c/li\u003e\n\u003cli\u003eZhao G, Ge Y, Zhang C, Zhang L, Xu J, Qi L, et al. Progress of Mesenchymal Stem Cell-Derived Exosomes in Tissue Repair. Curr Pharm Des. 2020;26(17):2022-37. https://doi.org/10.2174/1381612826666200420144805.\u003c/li\u003e\n\u003cli\u003eYang X, Yang J, Lei P, Wen T. LncRNA MALAT1 shuttled by bone marrow-derived mesenchymal stem cells-secreted exosomes alleviates osteoporosis through mediating microRNA-34c/SATB2 axis. Aging (Albany NY). 2019;11(20):8777-91. https://doi.org/10.18632/aging.102264.\u003c/li\u003e\n\u003cli\u003eYou M, Ai Z, Zeng J, Fu Y, Zhang L, Wu X. Bone mesenchymal stem cells (BMSCs)-derived exosomal microRNA-21-5p regulates Kruppel-like factor 3 (KLF3) to promote osteoblast proliferation in vitro. Bioengineered. 2022;13(5):11933-44. https://doi.org/10.1080/21655979.2022.2067286.\u003c/li\u003e\n\u003cli\u003eLi Q, Nong A, Huang Z, Xu Y, He K, Jia Y, et al. Exosomes containing miR-122-5p secreted by LPS-induced neutrophils regulate the apoptosis and permeability of brain microvascular endothelial cells by targeting OCLN. Am J Transl Res. 2021;13(5):4167-81.\u003c/li\u003e\n\u003cli\u003eJiao Y, Zhang L, Li J, He Y, Zhang X, Li J. Exosomal miR-122-5p inhibits tumorigenicity of gastric cancer by downregulating GIT1. Int J Biol Markers. 2021;36(1):36-46. https://doi.org/10.1177/1724600821990677.\u003c/li\u003e\n\u003cli\u003eChoi JH, Sung SE, Kang KK, Lee S, Sung M, Park WT, et al. Extracellular Vesicles from Human Adipose Tissue-Derived Mesenchymal Stem Cells Suppress RANKL-Induced Osteoclast Differentiation via miR122-5p. Biochem Genet. 2024;62(4):2830-52. https://doi.org/10.1007/s10528-023-10569-5.\u003c/li\u003e\n\u003cli\u003eNikfarjam S, Rezaie J, Zolbanin NM, Jafari R. Mesenchymal stem cell derived-exosomes: a modern approach in translational medicine. J Transl Med. 2020;18(1):449. https://doi.org/10.1186/s12967-020-02622-3.\u003c/li\u003e\n\u003cli\u003eTavasolian F, Hosseini AZ, Rashidi M, Soudi S, Abdollahi E, Momtazi-Borojeni AA, et al. The Impact of Immune Cell-derived Exosomes on Immune Response Initiation and Immune System Function. Curr Pharm Des. 2021;27(2):197-205. https://doi.org/10.2174/1381612826666201207221819.\u003c/li\u003e\n\u003cli\u003ePathania AS, Prathipati P, Challagundla KB. New insights into exosome mediated tumor-immune escape: Clinical perspectives and therapeutic strategies. Biochim Biophys Acta Rev Cancer. 2021;1876(2):188624. https://doi.org/10.1016/j.bbcan.2021.188624.\u003c/li\u003e\n\u003cli\u003eAgbu P, Carthew RW. MicroRNA-mediated regulation of glucose and lipid metabolism. Nat Rev Mol Cell Biol. 2021;22(6):425-38. https://doi.org/10.1038/s41580-021-00354-w.\u003c/li\u003e\n\u003cli\u003eHenning RJ. Cardiovascular Exosomes and MicroRNAs in Cardiovascular Physiology and Pathophysiology. J Cardiovasc Transl Res. 2021;14(2):195-212. https://doi.org/10.1007/s12265-020-10040-5.\u003c/li\u003e\n\u003cli\u003eZhao J, Zhou Y, Guo M, Yue D, Chen C, Liang G, et al. MicroRNA-7: expression and function in brain physiological and pathological processes. Cell Biosci. 2020;10:77. https://doi.org/10.1186/s13578-020-00436-w.\u003c/li\u003e\n\u003cli\u003eWani S, Man Law IK, Pothoulakis C. Role and mechanisms of exosomal miRNAs in IBD pathophysiology. Am J Physiol Gastrointest Liver Physiol. 2020;319(6):G646-g54. https://doi.org/10.1152/ajpgi.00295.2020.\u003c/li\u003e\n\u003cli\u003eHuang W, Wu Y, Qiao M, Xie Z, Cen X, Huang X, et al. CircRNA-miRNA networks in regulating bone disease. J Cell Physiol. 2022;237(2):1225-44. https://doi.org/10.1002/jcp.30625.\u003c/li\u003e\n\u003cli\u003eDiener C, Keller A, Meese E. Emerging concepts of miRNA therapeutics: from cells to clinic. Trends Genet. 2022;38(6):613-26. https://doi.org/10.1016/j.tig.2022.02.006.\u003c/li\u003e\n\u003cli\u003eJiang Y, Zhang J, Li Z, Jia G. Bone Marrow Mesenchymal Stem Cell-Derived Exosomal miR-25 Regulates the Ubiquitination and Degradation of Runx2 by SMURF1 to Promote Fracture Healing in Mice. Front Med (Lausanne). 2020;7:577578. https://doi.org/10.3389/fmed.2020.577578.\u003c/li\u003e\n\u003cli\u003eHacohen N, Kramer S, Sutherland D, Hiromi Y, Krasnow MA. sprouty encodes a novel antagonist of FGF signaling that patterns apical branching of the Drosophila airways. Cell. 1998;92(2):253-63. https://doi.org/10.1016/s0092-8674(00)80919-8.\u003c/li\u003e\n\u003cli\u003eDai H, Xu W, Wang L, Li X, Sheng X, Zhu L, et al. Loss of SPRY2 contributes to cancer-associated fibroblasts activation and promotes breast cancer development. Breast Cancer Res. 2023;25(1):90. https://doi.org/10.1186/s13058-023-01683-8.\u003c/li\u003e\n\u003cli\u003eKawazoe T, Taniguchi K. The Sprouty/Spred family as tumor suppressors: Coming of age. Cancer Sci. 2019;110(5):1525-35. https://doi.org/10.1111/cas.13999.\u003c/li\u003e\n\u003cli\u003eStuckel AJ, Zeng S, Lyu Z, Zhang W, Zhang X, Dougherty U, et al. Epigenetic DNA Modifications Upregulate SPRY2 in Human Colorectal Cancers. Cells. 2021;10(10) https://doi.org/10.3390/cells10102632.\u003c/li\u003e\n\u003cli\u003eYe J, Liu W, Yu X, Wu L, Chen Z, Yu Y, et al. TRAF7-targeted HOXA5 acts as a tumor suppressor in prostate cancer progression and stemness via transcriptionally activating SPRY2 and regulating MEK/ERK signaling. Cell Death Discov. 2023;9(1):378. https://doi.org/10.1038/s41420-023-01675-9.\u003c/li\u003e\n\u003cli\u003eCui S, Chen Y, Guo Y, Wang X, Chen D. Hsa-miR-22-3p inhibits liver cancer cell EMT and cell migration/ invasion by indirectly regulating SPRY2. PLoS One. 2023;18(2):e0281536. https://doi.org/10.1371/journal.pone.0281536.\u003c/li\u003e\n\u003cli\u003eChen J, Xu Y, Wu P, Chen X, Weng W, Li D. Transcription Factor FOXO3a Overexpression Inhibits the Progression of Neuroblastoma by Regulating the miR-21/SPRY2/ERK Axis. World Neurosurg. 2022;164:e99-e112. https://doi.org/10.1016/j.wneu.2022.04.009.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"BMSCs, exosomes, osteogenic differentiation, miR-122-5p, SPRY2","lastPublishedDoi":"10.21203/rs.3.rs-4723687/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4723687/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eBone Marrow Mesenchymal Stem Cells-Exosomes (BMSC-Exo) possess the ability to facilitate bone remodeling, and this mechanism has always been of great interest in the field. Our study aimed to elucidate the impacts of BMSC-Exo on MC3T3-E1, the murine embryonic osteogenic progenitor cells, and the interaction behind.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eWe initially extracted and characterized exosomes from BMSCs. Following treatment with GW4869, a compound that inhibits exosome production and release, BMSCs produced exosomes (BMSC-Exo). These were subsequently combined in culture with MC3T3-E1 cells. Upon an application of Phalloidin and PKH26 staining, we observed morphology of the cellular actin fibers and the uptake of exosomes. To evaluate the osteogenic potential of the cells, we utilized Alizarin Red S (ARS) and Alkaline Phosphatase (ALP) staining. Additionally, we measured expressions of osteogenic factors RUNX2, ALP, OSX, OCN, and OPN through qRT-PCR and Western blot analyses. Afterwards, we intervened with BMSC-Exo with a lentivirus over-expressing miR-122-5p and co-cultured it with MC3T3-E1 cells. To further assess osteogenic differentiation, we conducted additional ARS \u0026amp; ALP staining, along with qRT-PCR and Western blot assays. With the help of dual-luciferase reporter assay, we found that miR-122-5p interacts specifically with SPRY2. Ultimately, we treated MC3T3-E1 cells with a lentivirus over-expressing miR-122-5p and a plasmid over-expressing OE-SPRY2. Osteogenic differentiation was then assessed using ARS \u0026amp; ALP staining, qRT-PCR, and Western blot.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eOur laboratory outcomes demonstrated that exosomes derived from BMSC-Exo are instrumental in the advancement of calcified nodule genesis within MC3T3-E1 cells, concurrently amplifying the transcriptional and translational expressions of osteogenic markers (RUNX2, ALP, OSX, OCN, and OPN). These excreted exosomes from the BMSCs modified by a miR-122-5p-over-expressing lentivirus are found to further accelerate osteogenic differentiation of the cells. Moreover, our application of dual-luciferase reporter gene system has elucidated a specific interplay between miR-122-5p and SPRY2. Furthermore, overexpressing of SPRY2 negates the miR-122-5p-induced osteogenic differentiation.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eBMSC-Exo facilitates osteogenic differentiation in MC3T3-E1 cells by suppressing SPRY2, a process mediated by miR-122-5p.\u003c/p\u003e","manuscriptTitle":"BMSC-Exo miR-122-5p facilitates osteogenic differentiation of MC3T3-E1 cells through specifically suppressing SPRY2","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-13 13:06:41","doi":"10.21203/rs.3.rs-4723687/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"31c77f5b-753c-4493-bfd3-794e0ee5376f","owner":[],"postedDate":"September 13th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-09-26T03:23:57+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-13 13:06:41","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4723687","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4723687","identity":"rs-4723687","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.