Full text
116,152 characters
· extracted from
preprint-html
· click to expand
GABA-independent activation of GABAB receptor by mechanical forces | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results GABA-independent activation of GABAB receptor by mechanical forces Yujia Huo , Yiwei Zhou , Li Lin , Fan Yang , Jiyong Meng , Feiteng He , Fengfan Zhang , Mengdan Song , Cangsong Shen , Yuxuan Liu , Philippe Rondard , Chanjuan Xu , X.Z. Shawn Xu , View ORCID Profile Jianfeng Liu doi: https://doi.org/10.1101/2025.06.09.658551 Yujia Huo 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yiwei Zhou 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Li Lin 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Fan Yang 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jiyong Meng 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Feiteng He 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China 3 Life Sciences Institute, University of Michigan , Ann Arbor, MI 48109, USA 4 Department of Molecular and Integrative Physiology, University of Michigan Medical School , Ann Arbor, MI 48109, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Fengfan Zhang 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China 3 Life Sciences Institute, University of Michigan , Ann Arbor, MI 48109, USA 4 Department of Molecular and Integrative Physiology, University of Michigan Medical School , Ann Arbor, MI 48109, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mengdan Song 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Cangsong Shen 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Yuxuan Liu 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site Philippe Rondard 5 Institut de Génomique Fonctionnelle (IGF), Univ. Montpellier , CNRS, INSERM, 34094 Montpellier, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Chanjuan Xu 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China 2 Bioland Laboratory, Guangzhou Regenerative Medicine and Health Guangdong Laboratory , 510005 Guangzhou, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: jfliu{at}mail.hust.edu.cn shawnxu{at}umich.edu chanjuanxu{at}hust.edu.cn X.Z. Shawn Xu 3 Life Sciences Institute, University of Michigan , Ann Arbor, MI 48109, USA 4 Department of Molecular and Integrative Physiology, University of Michigan Medical School , Ann Arbor, MI 48109, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: jfliu{at}mail.hust.edu.cn shawnxu{at}umich.edu chanjuanxu{at}hust.edu.cn Jianfeng Liu 1 Cellular Signaling Laboratory, Key Laboratory of Molecular Biophysics of Ministry of Education, College of Life Science and Technology, Huazhong University of Science and Technology , Wuhan, Hubei, China 2 Bioland Laboratory, Guangzhou Regenerative Medicine and Health Guangdong Laboratory , 510005 Guangzhou, China Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jianfeng Liu For correspondence: jfliu{at}mail.hust.edu.cn shawnxu{at}umich.edu chanjuanxu{at}hust.edu.cn Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract The heterodimeric GABA B receptor, composed of GB1 and GB2 subunits, is a metabotropic G protein-coupled receptor (GPCR) activated by the neurotransmitter GABA. GABA binds to the extracellular domain of GB1 to activate G proteins through GB2. Here we show that GABA B receptors can be activated by mechanical forces, such as traction force and shear stress, in a GABA-independent manner. This GABA-independent mechano-activation of GABA B receptor is mediated by a direct interaction between integrins and the extracellular domain of GB1, indicating that GABA B receptor and integrin form a novel type of mechano-transduction complex. Mechanistically, shear stress promotes the binding of integrin to GB1 and induces an allosteric re-arrangement of GABA B receptor transmembrane domains towards an active conformation, culminating in receptor activation. Furthermore, we demonstrate that shear stress-induced GABA B receptor activation plays a crucial role in astrocyte remodeling. These findings reveal a previously unrecognized function of GABA B receptor in mechano-transduction, uncovering a novel ligand-independent activation mechanism for GPCRs. Introduction γ-Aminobutyric acid (GABA) is the primary inhibitory neurotransmitter in the brain. GABA B receptor is a G protein coupled receptor (GPCR) that binds to GABA 1 , 2 . As a metabotropic receptor, GABA B receptor plays a crucial role in regulating brain functions and is implicated in various physiological processes, such as locomotion, learning and memory, and cognition 3 – 7 . It facilitates slow and long-term synaptic inhibition by inhibiting voltage-gated Ca 2+ channels and preventing neurotransmitter release at presynaptic sites 8 . Additionally, it activates G protein-gated inwardly rectifying K + channels and induces slow inhibitory potentials at postsynaptic sites in neurons 8 . GABA B receptor also has the ability to trigger Ca 2+ release 9 , 10 and regulate astrocyte morphogenesis 10 , 11 . Dysregulation of GABA B receptor activity has been implicated in various diseases, such as epilepsy 12 , 13 , anxiety 14 , depression 15 , 16 , spasticity 17 , addiction 18 , pain 19 , Rett-like Phenotype 20 , epileptic encephalopathy 21 and fragile X syndrome 22 . Therefore, GABA B receptor represents an excellent therapeutic target. Baclofen (Lioresal) is a specific agonist of GABA B receptor and is used to treat spasticity in multiple sclerosis and alcohol abuse disorder 23 – 25 . Notably, GABA B receptor is present not only in the central nervous system but also in peripheral regions such as the gastrointestinal (GI) tract, where it is involved in regulating intestinal motility, gastric emptying, and esophageal sphincter relaxation 26 – 28 . This raises the possibility that mechanical forces may regulate GABA B receptor activity. However, whether mechanical forces can regulate GABA B receptor activity has not been explored. GABA B receptor is a Class C GPCR that forms an obligatory heterodimer consisting of two subunits, GB1 and GB2. Each subunit comprises a large extracellular Venus flytrap domain (VFT) followed by canonical seven-transmembrane domains (7TMs) 29 , 30 . The VFT domain consists of two lobes: LB1 and LB2 30 . In the inactive state, GABA B receptor interacts through the LB1 of two subunits and the intracellular tips of transmembrane domain 3 and 5 (TM3 and TM5) 31 . Agonists (GABA, Baclofen) and antagonists (CGP54626) bind to a large crevice between LB1 and LB2 in the VFT domain of GB1 (VFT GB1 ). While the agonists stabilize the closure of VFT GB1 , the antagonists prevent the closure of VFT GB1 ( Fig. 1a ). Agonist binding brings LB1 of VFT GB1 (LB1 GB1 ) closer to LB2 of VFT GB1 (LB2 GB1 ) to stabilize VFT GB1 closure, further bringing LB2 GB1 and LB2 of GB2 (LB2 GB2 ) in contact 30 , 32 – 34 . The interplay between LB2 GB1 and LB2 GB2 , which is essential for receptor activation, triggers a rearrangement from the inactive 7TM interface formed by intracellular tips of TM3 and TM5 of GB1 and GB2 to the active interface formed by TM6 of GB1 and TM6 of GB2, leading to the coupling of G i/o proteins to GB2 in a shallow pocket formed by TM3 and three intracellular loops 30 , 32 – 35 ( Fig. 1a ). Additionally, positive allosteric modulators (PAMs) of GABA B receptor, such as Rac BHFF, GS39783 and CGP7930, bind within the TM6-TM6 interface to stabilize the active conformation of the receptor 30 , 32 , 33 , 36 . This mode of GABA B receptor activation has been extensively characterized and validated using multiple approaches. However, it is unclear whether additional mechanisms are in place to activate GABA B receptor. Download figure Open in new tab Fig. 1 | Traction force and shear stress activate GABA B receptor. a , Schematic illustration depicting the modulation of GABA B receptor activity by ligands (e.g. agonists: GABA and baclofen; antagonist: CGP54626). b, Schematic representation of the experiments applying traction force and shear stress to cells in this study, encompassing conditions such as cell suspension or adhesion; PDL or FN coating; and shear stress treatment. No GABA was added in these experiments. c, IP 1 production in HEK293 cells transfected with vector or GABA B receptor, along with G qi9 chimera in the corresponding conditions: suspension or adhesion (left) ; PDL or FN coating (middle) , without (control) or with shear stress (15 dyn/cm 2 , 15 min) (right) . Data are present as mean ± s.e.m. from five biologically independent experiments each performed in triplicates and analyzed using unpaired t test (two-tailed) to determine significance. *** P < 0.001, * P 0.05. d, G i protein activation in HEK293 cells transfected with vector or GABA B receptor, along with G i protein sensors under suspension, PDL-coating or FN-coating condition. Left: Schematic presentation of G i protein activity measurement using G i protein BRET sensor. Right: BRET ratio of cells in suspension or cells cultured in PDL-coating or FN-coating dishes. Data are present as mean ± s.e.m. from nine biologically independent experiments for vector and GABA B receptor respectively each performed in triplicates, and analyzed using repeat measurements one-way ANOVA with Tukey’s multiple comparisons test to determine significance. *** P < 0.001, ** P 0.05. e, Real-time recording of intracellular Ca 2+ release in HEK293 cells expressing GABA B receptor and G qi9 . Left: Schematic presentation of shear stress loading device and real-time recording of Ca 2+ response in single cells. Right: Real-time Ca 2+ signal measurement. After the recording of basal state of Ca 2+ release for 50 seconds, cells were subjected to shear stress for 100 seconds. Shear stress was then halted for 150 seconds, after which baclofen was injected for 200 seconds. Data are present as mean ± s.e.m. from 85 cells recorded. Here, we report a novel ligand-independent activation mechanism of the GABA B receptor. We found that GABA B receptor can be activated by mechanical forces (e.g., traction force and shear stress) independent of GABA. We demonstrated that GABA B receptor and integrins form a novel type of mechano-transduction complex and that shear stress-induced GABA B receptor activation plays a crucial role in astrocyte remodeling. Thus, our findings reveal a previously unrecognized function of the GABA B receptor in mechano-transduction, uncovering a novel ligand-independent activation mechanism for GPCRs. Results GABA B receptor is activated by mechanical forces GABA B receptor can be activated in a ligand-dependent manner by agonists, such as GABA and baclofen ( Fig. 1a ). However, whether a ligand-independent stimulus, such as mechanical forces, can activate GABA B receptor remains unknown. To test this possibility, we explored whether different forces, such as traction force and shear stress, play a role in GABA B receptor activation ( Fig. 1b ). Both traction force and shear stress are common mechanical forces experienced by cells 37 , 38 . We first examined traction force. When growing on the surface of a substrate such as a culture dish coated with poly-D-lysine (PDL), cells usually adhere to the surface of the dish, and traction force develops between the cytoskeleton and extracellular matrix (ECM) 39 . However, no such traction force was observed in cells growing in suspension 40 . In addition, coating the culture dish with specialized ECM proteins, such as fibronectin (FN) which binds to the cell surface protein integrin, enhances traction force and promotes cell adhesion 41 – 43 . Myosin II activity is commonly used as a reliable readout of traction force in the cell 44 , 45 . We found that in cultured HEK293 cells, myosin II activity was nearly undetectable in suspension cells; in contrast, myosin II activity was clearly observed in adherent cells growing on PDL-coated dishes ( Supplementary Fig. 1a ). Treatment with FN further increased myosin II activity in adherent HEK293 cells ( Supplementary Fig. 1b ). These results are consistent with the notion that traction force develops in adherent cells and further increases when cells were attached to ECM proteins 46 . We then examined the activity of GABA B receptor in both adherent and suspended HEK293 cells expressing GABA B receptor and a chimeric Gq i9 , in which the G i/o -coupled GABA B receptor can couple to the PLC pathway 36 . We thereby measured the production of the downstream metabolite inositol monophosphate (IP 1 ), using a commonly used assay that reports GPCR activity 47 . Interestingly, when cells expressing GABA B receptor was attached on dishes coated with PDL, the IP 1 production was significantly increased compared with that in suspension condition ( Fig. 1c ). The activity of GABA B receptor was further increased in adherent cells growing on FN-coated dishes compared with PDL-coated dishes ( Fig. 1c ). Disruption of traction force by blebbistatin, which inhibits myosin II cross-bridge cycling 48 , blocked GABA B receptor activity in adherent cells ( Supplementary Fig. 1c ). These results reveal a correlation between the GABA B receptor activity and traction force, suggesting that mechanical forces can activate GABA B receptor. Because FN coating reflects a more physiological condition, we decided to focus on characterizing cells growing under this condition. Next, we evaluated the effect of shear stress on GABA B receptor. Shear stress increased IP 1 production in adherent HEK293 cells expressing the GABA B receptor and Gq i9 but not in control cells expressing only Gq i9 ( Fig. 1c ). This experiment suggests that shear stress can also activate GABA B receptor. We also performed experiments to verify if GABA B receptor-induced direct G i/o protein responses can be activated by traction force, using a sensitive BRET G i protein sensor as reported by us recently 49 . The decreased BRET ratio represents the conformational rearrangement between Gα i and Gβγ subunit and the activation of G i protein. The BRET ratio in GABA B receptor-expressing cells was lower than that in control cells expressing only G i protein sensor ( Fig. 1d ), due to the constitutive activity of GABA B receptor 20 , 33 , 36 . The BRET signal was significantly decreased in cells expressing GABA B receptor cultured on PDL or FN-coated surface compared with that in suspension condition ( Fig. 1d ). As a control, the BRET ratio in cells expressing only G i protein sensor ( Fig. 1d ), or expressing a GABA B receptor mutant which cannot couple to G protein (GABA B -ΔG) ( Supplementary Fig. 1d ), show no significant change compared with suspension, PDL-coating and FN-coating condition. This experiment confirms that mechano-force activates GABA B receptor-induced G i/o signaling. While IP 1 production serves as a reliable readout for GABA B receptor activation, it only reports the accumulative rather than the dynamic activity of GABA B receptor. To provide further evidence, we performed calcium imaging experiments to monitor the dynamic activity of GABA B receptors in response to shear stress in real-time. We found that shear stress could also induce GABA B receptor activity in cells expressing GABA B receptor and G qi9 shown by the calcium imaging assay ( Fig. 1e ). A transient increase of Ca 2+ release was observed after shear stress application, which quickly peaked and then gradually decreased to basal levels ( Fig. 1e ). The kinetics of shear stress-induced Ca 2+ were slower, and the strength of shear stress-induced Ca 2+ was lower than that of baclofen ( Supplementary Fig. 1e ). No such activity was observed in the control cells expressing only G qi9 ( Supplementary Fig. 1f ). Thus, both assays reveal that shear stress can activate GABA B receptor. Taken together, these results demonstrated that GABA B receptor can be activated by mechanical forces. No GABA or any other GABA B receptor agonist was present in our assays and the concentration of GABA in the medium or the buffer was very low ( Supplementary Fig. 2 ), indicating that the observed mechano-activation of the GABA B receptor is ligand-independent. Mechano-activation of GABA B receptor occurs through a physical interaction with integrin How is GABA B receptor activated by mechanical forces? The observation that the GABA B receptor can be activated in adherent cells but not in suspension cells indicates that the mechano-activation of GABA B receptor is cell condition-specific, suggesting the participation of additional proteins. As the ECM protein FN greatly enhanced the mechano-activation of GABA B receptor ( Fig. 1c ) and FN acts by directly binding to the cell surface protein integrin 50 , we hypothesized that integrin may be involved in the mechano-activation of GABA B receptor. The fact that integrin is a mechano-sensor, which connects both ECM proteins and the cytoskeleton and is sensitive to traction force and shear stress 51 , 52 , further supports this model. To test this model, we turned our attention to integrin β 3 , which is the primary receptor for FN 53 , 54 . As a receptor of FN, integrin β 3 can function as a heterodimer with integrin α 55 . Knockdown of integrin β by siRNA abolished traction force-induced GABA receptor activation ( Fig. 2a , Supplementary Fig. 3a ). These results suggest that integrin β 3 plays an important role in the mechano-activation of GABA B receptor. Download figure Open in new tab Fig. 2 | Mechano-activation of GABA B receptor requires integrin β 3 interaction. a , IP 1 production in HEK293 cells transfected with either control siRNA or integrin β3 siRNA, along with the expressing of vector and G qi9 , or GABA B receptor and G qi9 , under either adhesion or suspension conditions. Data are present as mean ± s.e.m. from five biologically independent experiments and analyzed using unpaired t test (two-tailed) to determine significance. *** P 0.05. b , Co-immunoprecipitation of GABA B receptor and integrin β 3 in HEK293 cells transfected with GABA B receptor constructs (Snap-tagged GB1 and GB2) using anti-integrin β 3 antibody, under basal condition. Only GB1 in cell surface was labeled and visualized using an impermeable Snap fluorescent substrate. c-f, Co-immunoprecipitation of GABA B receptor and integrin β 3 in HEK293 cells transfected with GABA B receptor constructs (HA-tagged GB1 and GB2) using anti-HA antibody, under conditions including suspension or adhesion (c) , without (control) or with shear stress (c) , Blebbistatin (50 μM, 30 min) treatment (d) , RGDS (10 μM, 12 h) treatment (e) , or CGP54626 (50 μM, 30 min) treatment (f) . Blots are representative from at least three biologically independent experiments ( c , suspension or adhesion, n = 3; control or with shear stress, n = 4; d , n = 3; e , n = 3; f , n = 4). The amount of integrin β 3 immunoprecipitated by IgG or HA antibody are present as mean ± s.e.m. in (e) and analyzed using unpaired t test (two-tailed) to determine significance. ** P < 0.01. g, Schematic representation of the BRET assay detecting direct interaction between GABA B receptor and integrin β 3 . Rluc was fused in C-terminal of GB1 or GB2 subunit (GB1 Rluc or GB2 Rluc ) as luminescence donor. Venus was fused in C-terminal of integrin β 3 or integrin α V subunit (integrin β 3Venus or integrin α Venus ) as fluorescence acceptor. h-i, Interaction of GABA B receptor and integrin β 3 interaction between GB1 and integrin β 3 or GB1 and integrin α V (h) , or GB2 and integrin β 3 (i) detected using BRET titration assay. Data were analyzed by nonlinear regression on a pooled data set from at least three biologically independent experiments each performed in triplicates, fitting with 1-site binding model in GraphPad Prism 8. To investigate how integrin β 3 mediates the mechano-activation of GABA B receptor, we asked whether GABA B receptor physically interacts with integrin β 3 . Indeed, when expressed in HEK293 cells, GABA B receptor co-immunoprecipitated (co-IP) with endogenous integrin β 3 . This was performed using two different approaches to tag (HA tag and Snap tag) the GB1 subunit of GABA B receptor ( Fig. 2b , Supplementary Fig. 3b-d ). We also detected integrin α v in the complex (Supplementary Fig. 3e) , which is consistent with the notion that integrin β 3 functions as a heterodimer with integrin α v50, 56 . Thus, GABA B receptor and integrin α v β 3 appear to form a protein complex. In support of this, we found that GABA B receptor and integrin β 3 also co-localized in HEK293 cells ( Supplementary Fig. 3f ). These results together demonstrate GABA B receptor physically interacts with integrin α v β 3 to form a protein complex. Interestingly, the interaction between integrin β 3 and GABA B receptor appeared to be much stronger in adherent cells ( Fig. 2c ) . Disruption of traction force using blebbistatin greatly diminished the interaction between integrin β 3 and GABA B receptor ( Fig. 2d , Supplementary Fig. 3g) . Conversely, applying shear stress to HEK293 cells further enhanced integrin β 3 and GABA B receptor interaction in these cells ( Fig. 2c ,). These findings indicate that mechanical forces promote the formation of a GABA B receptor-integrin α v β 3 complex by facilitating the interaction between the two proteins. To provide further evidence that integrin α v β 3 and GABA B receptor physically interact with each other, we tested the inhibitor and the antagonist. The integrin β 3 inhibitor RGDS and the GABA B receptor antagonist CGP54626 both inhibited the interaction between integrin β 3 and GABA B receptor ( Fig. 2e-f , Supplementary Fig. 3g ). This suggests that the interaction between integrin β 3 and GABA B receptor is rather specific. Furthermore, the formation of GABA B receptor and integrin α v β 3 complex increased with GABA treatment ( Supplementary Fig. 3h ). Overall, our observation suggests that the formation of GABA B receptor-integrin α v β 3 complex may depend on their active conformation. We then investigated whether the interaction between GABA B receptor and integrin α v β 3 is direct. To test this, we performed a bioluminescence resonance energy transfer (BRET) titration experiment 57 , 58 . The energy donor Rellina luciferase (Rluc) and the energy acceptor Venus were attached to the C-terminus of GB1 or GB2 subunit of GABA B receptor, integrin β 1 , integrin β 3 and integrin α v (named as GB1 Rluc , GB2 Rluc , integrin β 1Venus , integrin β 3Venus and integrin α vVenus ), respectively ( Fig. 2g ). Within a distance of 10 Å, energy transfer occurs between Rluc and Venus, which would indicate a direct interaction between the two proteins. In this assay, by examining the BRET ratio as a function of the relative amounts of the two tested proteins, one would not only be able to evaluate if a direct interaction occurs between the two proteins, but also can assess the relative strength of the interaction. We first performed control experiments. While no BRET signals were detected between Venus and GABA B receptor (negative control), strong BRET signals were observed between mGlu2 and 5-HT 2a that are known to directly interact (positive control) 59 , validating the assay. Importantly, we observed strong BRET signals between GABA B receptor and integrin β 3 ( Fig. 2h ). These BRET signals were much more robust than those between mGlu2 and 5-HT 2a , suggesting that the interaction between GABA B receptor and integrin β 3 is stronger than that between mGlu2 and 5-HT 2a , which has been demonstrated to form oligomer 59 . By contrast, weak, if any, BRET signals were detected between integrin α v and GABA B receptor ( Fig. 2h ) . Thus, although integrin α v was present in the integrin α v β 3 -GABA B receptor complex (Supplementary Fig. 3e) , it did not appear to directly interact with GABA B receptor, further supporting the model that integrin β 3 rather than α v directly interacts with GABA B receptor. Notably, the BRET signals between GB1 and integrin β 3 were much more robust than those between GB2 and integrin β 3 , suggesting that GABA B receptor interacts with integrin β 3 primarily via its GB1 subunit ( Fig. 2i ). These results demonstrate that the mechano-activation of GABA B receptor requires integrin α v β 3 , which is primarily mediated by a direct interaction between integrin β 3 and the GB1 subunit of GABA B receptor. Taken together, our data suggest that GABA B receptor responds to mechanical forces through a novel mechano-transduction complex formed with integrin α v β 3 and that mechanical forces can promote the formation of this protein complex. FN can also bind to integrin α v β 160 . BRET signals were also observed between integrin β1 and GABA B receptor ( Supplementary Fig. 3i ), suggesting a formation of mechano-transduction GABA B receptor complex with FN-related integrin proteins. Interestingly, other ECM proteins such as collagen I also increased GABA B receptor activation ( Supplementary Fig. 3j ), suggesting the involvement of other integrin subtypes. Both GB1 and GB2 are required for GABA B receptor activation by mechanical forces As GABA B receptor interacted with integrin β 3 primarily through its GB1 subunit, we wondered if GB1 alone can interact with integrin β 3 . As GB1 alone cannot localize to the plasma membrane, we tested GB1 ASA , a GB1 subunit mutant which can localize to the cell surface on its alone 61 , and found that it cannot be activated by traction force ( Fig. 3a ). A similar phenomenon was observed with GB2 alone ( Fig. 3a ). Thus, both GB1 and GB2 subunits are required for the mechano-activation of GABA B receptor. As GB2 is responsible for coupling G proteins to GABA B receptor upon agonist binding, we tested GB2 L685P , a mutant form of GB2 that is incapable of activating G proteins 62 . The traction force failed to induce GABA B receptor activation in HEK293 cells expressing GB1, GB2 L685P and G qi9 ( Fig. 3b ). Thus, similar to ligand-dependent activation of GABA B receptor, mechanical activation of this receptor also requires coupling of G proteins to the receptor via the GB2 subunit. These results indicate that while GABA B receptor interacts with integrin β 3 primarily via the GB1 subunit, the GB2 subunit is also necessary for GABA B receptor activation by mechanical forces and this ligand-independent activation mode required G protein coupling to GB2. Thus, both GB1 and GB2 subunits participate in the formation of the mechano-transduction complex with integrin α v β 3 . Download figure Open in new tab Fig. 3 | Both GB1 and GB2 subunits are required for GABA B receptor activation by mechanical forces. a-d , IP 1 production in HEK293 cells transfected with the indicated constructs, along with G qi9 under either suspension or adhesion conditions: (a) : vector, GABA B receptor (GB1 and GB2), GB1 only or GB2 only; (b) : vector, GABA B receptor or GABA B -ΔG (mutant with L685 in GB2 substituted with Phenylalanine that fails to couple G protein); (c) : vector, GABA B receptor, or GABA B -ΔB (mutant with the residues S276 and E465 in GB1 mutated to Analine that fails to bind GABA); (d) : vector or GABA B receptor, treated with or without antagonist CGP54626 (50 μM, 30 min). Data are present as mean ± s.e.m. from at least three biologically independent experiments (n = 4, 6, 5, 5 for a-d respectively) each performed in triplicates, and analyzed using unpaired t test (two-tailed) to determine significance. *** P < 0.001, * P 0.05. e, Model of the traction force-induced GABA B receptor activation through the closure of GB1 VFT -induced LB2 GB1 and LB2 GB2 in contact. The traction force-activated GABA B receptor requires both GB1 and GB2, and relies on GB2 for G protein coupling. Whereas the traction force-activated GABA B receptor is independent of GABA binding, preventing VFT GB1 closure by antagonist CGP54626 GABA B receptor abolishs traction force-induced GABA B receptor activation, indicating the closure of GB1 VFT -induced LB2 GB1 and LB2 GB2 in contact is important for traction force-induced GABA B receptor activation. Furthermore, to understand how mechano-activation occurs through the interaction between the GB1 and GB2 subunits, we generated a GB1 mutant by inserting two mutations (S246A and E465A) into GB1 VFT as previously reported 63 – 65 to prevent GABA binding but not to prevent the closure of GB1 VFT -brought GB1 LB2 and GB2 LB2 in contact ( Fig. 3c ). The GABA B -ΔB composed by this GB1 mutant and GB2 wild type can still be activated by traction force to the similar extend as GABA B receptor ( Fig. 3c ), demonstrating GABA-binding into GB1 VFT was not required in mechano-activation of GABA B receptor and indicating that mechano-force alone also stabilize the closure of GB1 VFT -brought LB2 of two subunits in contact. An antagonist (CGP54626) can prevent GB1 VFT closure-induced two LB2 in contact 32 . CGP54626 completely blocked traction force-induced GABA B receptor activation, indicating that mechano-force induced GABA B receptor activation requires the closure of GB1 VFT -brought two LB2 of two subunits in contact ( Fig. 3d ). This data is also consistent with the observation that CGP54626 inhibited the interaction between integrin β 3 and GABA B receptor ( Fig. 2f ) whereas GABA B -ΔB still interacts with integrin β 3 ( Supplementary Fig. 3k ). Overall, our results show that the traction force-activated GABA B receptor requires both GB1 and GB2 subunit, and is dependent on the closure of GB1 VFT -induced LB2 GB1 and LB2 GB2 in contact, and GB2 subunit for G protein coupling, but independent of GABA binding, suggesting that mechano-force acts as a positive allosteric modulator agonist (PAM Ago) of the GABA B receptor ( Fig. 3e ). Mapping the region in GABA B receptor that interacts with integrin β 3 We then sought to map the region in GB1 that interacts with integrin β 3 . First, we first examined the role of VFT in the extracellular domain of GB1 (VFT GB1 ). Deleting VFT in GB1with a truncated GABA B receptor (GABA B -ΔVFT) lacking the VFT domain of GB1 (GB1-ΔVFT) ( Fig. 4a ), abolished the interaction between integrin β 3 and GABA B receptor, revealing a key role of VFT GB1 in mediating the interaction ( Fig. 4b , Supplementary Fig. 4a ). Similarly, traction force and shear stress failed to induce GABA B -ΔVFT activation in HEK293 cells ( Fig. 4c-d ), indicating that the VFT GB1 is required for the mechano-activation of GABA B receptor. Both results suggest that the VFT GB1 may mediate the physical interaction between GB1 and integrin β 3 . Download figure Open in new tab Fig. 4 | VFT of GB1 is responsible for the interaction between GABA B receptor and integrin β 3 , and the mechano-activation of GABA B receptor. a , Schematic representation of GABA B -ΔVFT truncation, in which GB1 subunit lacks of the VFT domain (GB1-ΔVFT), but retains the ability to be activated by positive allosteric modulator Rac BHFF (yellow square). Co-immunoprecipitation experiments were performed using anti-HA antibody targeting to the HA tag, which is fused in the N-terminal of GB1 or GB1-ΔVFT. b, Co-immunoprecipitation of GABA B receptor or GABA B -ΔVFT and integrin β 3 using anti-HA antibody. Blots are from one representative of five biologically independent experiments. c, IP 1 production in cells transfected with GABA B receptor, or GABA B -ΔVFT, along with G qi9 under suspension or adhesion conditions. Data are present as mean ± s.e.m. from four biologically independent experiments each performed in triplicates and analyzed using unpaired t test (two-tailed) to determine significance. * P 0.05. d, Real-time recording of intracellular Ca 2+ release in HEK293 cells expressing GABA B -ΔVFT and G qi9 . After recording the basal state of Ca 2+ release for 50 seconds, cells were subjected to shear stress for 100 seconds. Shear stress was then halted for 150 seconds, after which Rac BHFF was added for 200 seconds. Data are present as mean ± s.e.m. from 135 cells recorded. Next, we used a glycan wedge scanning approach to map the interaction interface between the VFT GB1 and integrin β 3 . A consensus sequence NXS/T was introduced into GB1 VFT to enable the conjugation of a bulky N-glycan moiety to the side chain of the Asn residue, thereby forming a steric wedge to prevent GB1 from interacting with other proteins 66 . We selected seven GB1 mutants: 320 STL 322 (M1), 326 EER 328 (M2), 330 KEA 332 (M3), 337 TFR 339 (M4), 347 AVP 349 (M5), 352 NLK 354 (M6) and 356 QDA 358 (M7) ( Fig. 5a-c ). We have previously shown that the presence of an N-glycan moiety in these mutants do not affect agonist-induced GABA B receptor activation 66 . We found that although the traction force failed to activate M2, M4, M6 and M7, it was still able to activate M1, M3 and M5 ( Fig. 5d ). Moreover, the amount of integrin β 3 co-IPed with GB1 was greatly reduced in M7 mutant, but not in M3 mutant ( Supplementary Fig. 4b ). This indicates that residues 326-328, 337-339, 351-353 and 356-358 in GB1 VFT are important for its interaction with integrin β 3 . Interestingly, these sequences in GB1 are highly conserved across different species ( human , mouse , C. elegant , D. melanogaster , R. norvegicus , B. taurus , C. sabaeus ), especially the last 5 residues RQDAR ( Supplementary Fig. 4c ). We thus tested this RQDAR motif in GB1 VFT , and found that the GABA B -5A mutant (GB1 RQDAR-5A + GB2) ( Fig. 5b ), in which RQDAR were mutated into five A (Ala) residues, exhibited a much weaker interaction with integrin β 3 ( Supplementary Fig. 4d ). Importantly, this GABA B -5A mutant could still be activated by GABA ( Fig. 5e ), but lost sensitivity to traction force and shear stress ( Fig. 5f-g ). This set of experiments demonstrate that the GB1 subunit of GABA B receptor interacts with integrin β 3 via its VFT domain and that the RQDAR motif in VFT GB1 is important for GABA B receptor’s interaction with integrin β 3 as well as its activation by mechanical forces. Download figure Open in new tab Fig. 5 | Mapping the interaction region between GABA B receptor and integrin β 3 . a , 3D model of the VFT of GB1 and GB2. N-glycosylation mutations (M1-7) are highlighted in LB2 of GB1 VFT. b, Detailed presentation of the mutants of M1-7 and 5A. c, Schematic representation of GABA B -M1-7 and GABA B -5A. d, IP 1 production in HEK293 cells transfected with GABA B receptor WT, or GABA B receptor mutants M1-7 along with G qi9 under suspension or adhesion conditions. Data are present as mean ± s.e.m. from at least three biologically independent experiments (from left to right: n = 6, 6, 6, 5, 6, 5, 5, 4, 5) each performed in triplicates and analyzed using paired t test (two-tailed) to determine significance. ** P < 0.01, * P 0.05. e, Intracellular calcium release induced by different dose of GABA in HEK293 cells transfected with GABA B receptor WT and G qi9 , or GABA B -5A and G qi9 . Data are presented as mean ± s.e.m. from three biologically independent experiments each performed in triplicates. f, IP 1 production in HEK293 cells transfected with GABA B receptor WT and G qi9 , or GABA B -5A and G qi9 under suspension or adhesion conditions. Data are mean ± s.e.m. from at least four biologically independent experiments each performed in triplicates and analyzed using unpaired t test (two-tailed) to determine significance. * P 0.05. g, Real-time recording of intracellular Ca 2+ release in HEK293 cells expressing GABA B -5A and G qi9 . After recording the basal state of Ca 2+ release for 50 seconds, cells were subjected to shear stress for 100 seconds. Shear stress was then halted for 150 seconds, after which baclofen was added for 200 seconds. Data are present as mean ± s.e.m. from 111 cells recorded. Mechano-force acts as a positive allosteric modulator agonist (PAM ago) for GABA B receptor activation Ligand-induced GABA B receptor activation features a close contact between LB2 GB1 and LB2 GB2 , further triggers an allosteric rearrangement of 7TMs at the TM6-TM6 interface between GB1 and GB2 subunits ( Fig. 6a ), which is considered a hallmark of the active state of GABA B receptor 30 , 32 – 35 . Upon ligand binding, the two Val residues in TM6 of GB1 6 . 56 and GB2 6 . 56 turn close to each other in the active state of the receptor 35 ( Fig. 6b ). The close proximity of the two Val residues in this active state enables the formation of GB1-GB2 dimers through covalent cross-linking of the two subunits, in which the two Val residues are mutated to Cys residue: GB1 6 .56C and GB2 6 .56C 35 . Thus, this assay allows the probing of the active state of GABA B receptor in HEK293 cells transfected only with GB1 6 .56C and GB2 6 .56C . Consistent with our previous reports, GABA treatment promoted the formation of GB1 6 .56C -GB2 6 .56C dimers 35 . Of primary significance, shear stress also promoted the formation of GB1 6 .56C -GB2 6 .56C dimers ( Fig. 6c ). Furthermore, FN-treatment also increases of formation of GB1 6 .56C -GB2 6 .56C dimers ( Fig. 6d ). Finally, we used a FRET-based inter-subunit sensor of the GABA B receptor to measure the conformational change between two VFTs of GABA B receptor as previously reported by us 67 ( Fig. 6e ). The FRET ratio was increased under FN treatment ( Fig. 6f ), suggesting that interaction between FN and integrin induce a change in the conformation of two VFTs to bring the GB1 LB 2 and GB2 LB 2 in contact. In all, these set of experiments demonstrate that mechanical forces can facilitate an allosteric interaction between two VFTs to further induce re-arrangement of 7TMs of GABA B receptor towards an active conformation in a manner similar to that induced by ligand binding, demonstrating that the mechanic force acts as a PAM ago for GABA B receptor activation. Download figure Open in new tab Fig. 6 | Mechano-force acts as a positive allosteric modulator agonist (PAM ago) for GABA B receptor activation. a , Schematic representation of the active state of GABA B receptor, while the TM6s of GB1 and GB2 are rearranged towards each other. b, Highlight of the cysteine substitutions (red balls) in the position 6.56 of TM6 in GB1 and GB2 in its active state structure (PDB: 7EB2). c, Cross-linking of cell surface GABA B receptor between the two cysteines in GB1 6 . 56 and GB2 6 . 56 with CuP treatment along with no shear stress (control), shear stress treatment (15 dyn/cm 2 , 30 min) or GABA treatment (100 μ, 30 min). d, Cross-linking of cell surface GABA B receptor dimer between the two cysteines in GB1 6 . 56 and GB2 6 . 56 encompassing three conditions: without CuP treatment, with CuP treatment, with both CuP and GABA treatment, under PDL or FN-treated condition. MW, molecular weight. Blots in (c-d) are from one representative experiment of five biologically independent experiments. The bars show the percentage of GB1-GB2 dimer, which are relative to total amount of GB1 including GB1-GB1 dimer and GB1 monomer in each lane. Data are present as mean ± s.e.m. from five biologically independent experiments respectively in (c-d) and analyzed using paired t test (two-tailed) to determine significance. * P < 0.05, ** P < 0.01. e, Schematic representation of the inter-subunit sensor of GABA B receptor, measuring the conformational change between VFT GB1 and VFT GB2 . The LB1 GB1 is tagged with ACP and labeled with fluorescent molecular as energy donor, while LB1 GB2 is tagged with Snap and labeled with fluorescent molecular as energy acceptor. FRET can be measured between two fluorescent molecules. f, FRET ratio measured using the inter subunit sensor of GABA B receptor shown in (e) . HEK293 cells were transfected with GABA B sensors and cultured under PDL and FN coating condition. Data are present as mean ± s.e.m. from five biologically independent experiments each performed in triplicates and analyzed using paired t test (two-tailed) to determine significance. ** P < 0.01. g-h, Dose response curve and E max analysis of GABA-induced IP 1 production in HEK293 cells transfected with GABA B receptor and G qi9 under suspension or adhesion conditions (g) , or under PDL or FN-treatment (h) . Data are present as as mean ± s.e.m. from five and three biologically independent experiments each performed in triplicates in (g) and (h) respectively. E max are analyzed using paired t test (two-tailed) to determine significance. * P < 0.05. More interestingly, we also observed that FN-treatment also increases of GABA-induced formation of GB1 6 .56C -GB2 6 .56C dimers ( Fig. 6d ), suggesting the PAM effect of mechano-force on GABA-induced activation of GABAB receptor. We further verified whether and how mechanical forces allosterically regulate GABA-induced GABA B receptor activity. Interestingly, both the efficacy and potency of GABA-induced receptor activation was increased under adhesion and FN-treated conditions (suspension vs adhesion, E max : 256 nM vs 552 nM, EC 50 : 0.18 μM vs 0.08 μM; PDL vs FN, E max : 168 nM vs 257 nM, EC 50 : 0.19 μM vs 0.02 μM) ( Fig. 6g-h ), highlighting the potential PAM effect of mechano-force on GABA-induced GABA B receptor function in vivo . GABA B receptor is required for shear stress-induced remodeling of astrocytes Having characterized the mechanisms underlying GABA B receptor activation by mechanical forces, we investigated whether and how mechanical force may regulate cellular physiology. GABA B receptors are widely expressed in many types of neurons in the brain 8 . However, the relative low abundance and high heterogeneity of neurons (compared to glial cells) pose a challenge for investigating this question in neurons. In addition to neurons, GABA B receptors are also broadly expressed in glial cells, particularly in astrocytes 9 , 11 , which are the most abundant neural cells in the brain 68 . In response to mechanical insults experienced during traumatic brain injury, astrocytes undergo morphological, molecular and functional remodeling, which transforms them into reactive astrocytes in a process called reactive astrogliosis 69 . Reactive astrocytes play an important role in tissue repair and remodeling following brain trauma 70 – 72 . Other pathological conditions such as infection, ischemia, epilepsy, and cancer also trigger reactive astrogliosis 71 , 73 – 76 . The robust remodeling of astrocytes induced by mechanical insults, high abundance of these glial cells in the brain, and relative ease of culture prompted us to explore whether GABA B receptors contribute to mechano-induced reactive astrogliosis. To do so, we cultured primary astrocytes isolated from the mouse brain and assayed the effects of shear stress on their remodeling. We found that shear stress greatly increased the size of astrocytes and their expression of glial fibrillary acidic protein (GFAP), two key parameters of astrocyte reactivity 76 , 77 , indicating that shear stress promoted reactive astrogliosis ( Fig. 7a-c ). Importantly, siRNA knockdown of the GABA B receptor abolished the shear stress-induced increase in the size of astrocytes as well as the expression level of GFAP, pointing to a key role of GABA B receptor in the process ( Fig. 7a-d ). Additionally, baclofen increased both cell size and GFAP expression of astrocytes, which mimicked the effect of shear stress, demonstrating the physiological role of GABA B receptor activation in astrocyte remodeling ( Supplementary Fig. 5 ). Together, these results demonstrate that shear stress-induced reactive astrogliosis requires GABA B receptors. Download figure Open in new tab Fig. 7 | GABA B receptor is required for shear stress-induced astrocyte remodeling. a , Immunofluorescent staining of GFAP (red), GFP (green) and DAPI (cyan) in astrocytes transfected with control siRNA or GABA B receptor siRNA along with GFP, treatment with or without shear stress (15 dyn/cm 2 , 30 min). Images are representative from three biologically independent experiments. Scale bar: 10 μm. b-c, Analysis of the cell size and GFAP expression of astrocytes with the same treatment in (a) . Measurements are made on each cell by cell basis (ROI) from three biologically independent experiments (number of cells from left to right: n = 47, 37, 32, 39). Data are present as mean ± s.e.m and analyzed using ordinary one-way ANOVA with Tukey’s multiple comparisons test to determine significance. *** P < 0.001, ** P < 0.01, ns: non-significant. d, RNA interference efficacy of the GB1 in astrocytes in (b-c) using qPCR detecting gbb1 expression. Data are present as mean ± s.e.m. from three biologically independent experiments and analyzed with unpaired t test (two-tailed) to determine significance. *** P < 0.001. Shear stress activates astrocytes in a GABA B receptor-dependent manner The finding that GABA B receptors are required for shear stress to promote reactive astrogliosis suggests that shear stress may activate GABA B receptor in these primary cells just like when it was expressed in HEK293 cells. To test this hypothesis, astrocytes were recorded using calcium imaging to determine their response to shear stress. In astrocytes, Ca 2+ is a major downstream event of GABA B receptor and dependent on G i/o protein, as previously reported 9 , 78 – 81 . Therefore, no transfection of G protein chimera was required to detect GABA B receptor-induced Ca 2+ signal in astrocytes. The cells with Ca 2+ activation was characterized as previously 82 by an increasing in the Ca 2+ signal to reach a peak after stimulus and sustain for more than 5s. Owning to the heterogeneity of primary astrocytes, approximately 37.29% of astrocytes were sensitive to baclofen and were found to induce Ca 2+ release, similar to a previous report 9 . About half (45.76%) of the astrocytes were sensitive to shear stress with a transient but significant increase of the Ca 2+ signal ( Fig. 8a ). Among them, 62.04% were sensitive to baclofen, a GABA B receptor-specific agonist, indicating that most shear stress-sensitive astrocytes expressed GABA B receptors ( Fig. 8a-b ). Notably, siRNA knockdown of the GABA B receptor greatly reduced the population of astrocytes that were sensitive to baclofen (reduced to 6.69% from 37.29%) ( Supplementary Fig. 6a-c ) as well as shear stress (reduced to 13.48% from 45.76%) ( Fig. 8c-d ), indicating that GABA B receptors play a crucial role in mediating shear stress-induced response in these primary cells. The strength of the Ca 2+ signal was significantly decreased for both shear stress and baclofen treatment, when GABA B receptor was knocked down, whereas as a control, the population of astrocytes with ATP sensitivity remained 100% and the Ca 2+ signal was still strongly activated ( Supplementary Fig. 6d ). Overall, we demonstrated that shear stress can activate astrocytes in a GABA B receptor-dependent manner. This suggests a model in which shear stress can activate GABA B receptor in astrocytes, triggering reactive astrogliosis. Download figure Open in new tab Fig. 8 | Shear stress activates GABA B receptor in astrocytes. a , Real-time recording of intracellular Ca 2+ release in astrocytes under shear stress. Cells were transfected with control siRNA and treated with shear stress, baclofen (100 μM) or ATP (100 μM) in the indicated time point. Data are representative from six biologically independent experiments. b, Percentage of astrocytes in response to shear stress or baclofen in 236 recorded cells. c, Real-time recording of intracellular Ca 2+ release in astrocytes under shear stress. Cells are transfected with siRNA knocking down GABA B receptor and administrated to shear stress, baclofen (100 μM) or ATP (100 μM) in the indicated time point. Data are representative from six biologically independent experiments. d, Percentage of astrocytes with the calcium response (sensitive) or without the calcium response (insensitive) to shear stress (control siRNA: 236 cells; GABA B siRNA: 314 cells). Data are analyzed with χ2 test to determine significance. **** P < 0.0001. Discussion As a classic class C GPCR, the activation mechanism of GABA B receptor has been extensively characterized at both the biochemical and structural levels, which features a series of ligand binding-induced structural rearrangements in the receptor, culminating in its formation of a ternary complex with heterotrimeric G i/o proteins 30 , 83 . In this study, we found that GABA B receptors were activated by mechanical forces in a GABA-independent manner. To the best of our knowledge, this is the first report of a ligand-independent activation mechanism for GABA B receptor. It is notable that the GABA B receptor forms a protein complex with integrin and that GABA B receptor sensing of mechanical forces requires a direct interaction with integrin. We thus propose that GABA B receptor and integrin form a mechano-transduction complex. In this complex, integrin likely functions as a mechano-sensor, as integrin is well-known to sense mechanical forces such as traction force and shear stress in cellular mechanotransduction 51 , 84 . On the other hand, as blocking integrin function or inhibiting its expression abolishes the mechano-activation of GABA B receptors, GABA B receptors may not directly sense mechanical forces but rather function as a transducer that transduces mechanical signals to downstream G proteins. Here we showed that GABA B receptor interacts with the integrin subunit β3 and β1. Other integrins may also be involved as FN and RGDS can bind to several integrin types 55 , 60 . A growing list of GPCRs have been reported to be mechanosensitive, such as AT1R 85 , 86 , H1R 86 , 87 , bradykinin B2R 88 , GPR68 89 , and adhesion GPCRs 90 – 92 . Unlike GABA B receptors, these mechanosensitive GPCRs are believed to directly sense mechanical forces as a mechano-sensor, though the underlying mechano-transduction mechanisms are not well understood. Thus, GABA B receptor represents the first GPCR that acts as a mechano-transducer rather than a mechano-sensor, revealing a novel role for GPCRs in mechano-transduction. Strikingly, although mechanical forces activate GABA B receptor in the absence of ligand binding, they trigger an allosteric rearrangement of the 7TMs in GABA B receptor towards an active state in a manner similar to that induced by ligand binding. Specifically, both ligand binding and shear stress induced a similar allosteric rearrangement of 7TMs in the TM6-TM6 interface of the GB1 and GB2 subunits. This structural rearrangement has been shown to open a shallow cavity at the intracellular side of GABA B receptor to provide access for G protein binding 30 , 32 – 35 , which is a hallmark of the active state of GABA B receptor. Notably, agonists such as GABA and baclofen bind to a larger crevice between LB1 and LB2 of VFT GB1 to bring the two LB2 of two subunits in contact. As shear stress promotes the binding of integrin to LB2 of VFT GB1 , it is conceivable that shear stress may activate the GABA B receptor by promoting integrin binding to LB2 of VFT GB1 , which in turn pushes the two LB2 in contact and triggers an allosteric rearrangement of 7TMs in the TM6-TM6 interface towards an active conformation, culminating in receptor activation. In this regard, shear stress-induced binding of integrin to GB1 would mimic the role of ligand (e.g. GABA) binding to GB1 in GABA B receptor activation, providing a potential molecular mechanism by which mechanical forces activate GABA B receptor and allosterically potentiate the GABA effect as a PAM ago ( Fig. 9 ). However, though both GABA and mechanical force lead to GABA B -mediated G activation, the mechanism is not exactly the same. The FRET between the N-terminal of GB1 and GB2 subunit showed higher signal under mechanical force, while GABA induced a decreased FRET signal. These two observations are not contradictory, because the closure of GB1 VFT is the critical step to initiate the receptor activation. Further structural analysis of GABA B receptor and integrin complex will be needed to fully understand the activation mechanism. It is also different from the adhesion GPCRs, which act as mechano-sensors and rely on an extremely large N terminus for ECM recognition and an autoproteolysis domain that undergoes self-cleavage for receptor activation 92 , 93 . The GABA B activation displayed faster under baclofen treatment than shear stress induced Ca 2+ signal in our experiments. This faster chemical response than mechno-force was also observed in GPR68 89 . However, it doesn’t indicate a faster response to baclofen than to shear stress, as these two stimuli are not directly comparable. A saturating concentration of baclofen can be applied to fully activate the GABA B receptor, whereas higher shear stress speeds would detach cells, preventing reliable signal detection. This fundamental difference precludes a strict kinetic comparison. Download figure Open in new tab Fig. 9 | Schematic model of GABA-independent allosteric activation of GABA B receptor by mechanical forces through integrin interaction. Antagonist CGP54626-bound GABA B receptor fails to interact with integrin β3 whereas integrin β3 interacts with GB1 VFT of GABA B receptor with constitutive activity. Mechanical force promotes GB1 VFT and integrin β3 interaction to stabilize the closure of GB1 VFT -induced LB2 GB1 and LB2 GB2 in contact, further inducing an allosteric re-arrangement of the GABA B receptor 7TM towards an TM6-TM6 active conformation, culminating in the asymmetric activation of the receptor with G protein under GB2. Mechanical force acts as a positive allosteric modulator to boost up GABA-induced GABA B receptor activation through interaction between GB1 VFT and integrin β3. We showed that shear stress could stimulate the activity of primary astrocytes in a GABA B receptor-dependent, but GABA-independent manner. We also found that shear stress promotes reactive astrogliosis, a process by which astrocytes undergo remodeling in response to pathological conditions, such as brain trauma, to transition into reactive astrocytes that are important for tissue repair 70 – 72 . Although the brain is typically considered as a protected organ, it may also experience transient shear stress, such as during traumatic brain injury, which can generate both localized and distributed forces throughout the brain 70 , 71 , 94 . Importantly, shear stress-induced reactive astrogliosis requires GABA B receptor. These results together suggest a model in which mechanical forces activate GABA B receptors in astrocytes to promote reactive astrogliosis. Though we confirmed no GABA in our experiments, the endogenous GABA is present in vivo, which may work synergistically together with shear stress. Although GABA B receptor appears to a major contributor to astrocyte mechano-sensitivity, siRNA knockdown of the GABA B receptor eliminated most but not all mechanosensitive astrocytes. This is consistent with the notion that additional mechano-sensors are present in these glial cells, such as mechanosensitive Piezo channels as reported recently 95 . As the sole metabotropic GABA receptor, GABA B receptor regulates a wide spectrum of physiological processes, ranging from synaptic inhibition to locomotion 7 , cognition 6 , addiction 18 , epilepsy 12 , 13 , and astrocyte morphogenesis 10 , 11 . To date, all the physiological functions carried out by GABA B receptor have been attributed to its activation by GABA. Our discovery of a GABA-independent activation mechanism of the GABA B receptor and its crucial role in promoting astrocyte remodeling raises the possibility that this novel mode of activation may contribute to additional aspects of GABA B receptor functions in the brain. Our work also raises the possibility that other GPCRs could be potentially sensitive to mechanical forces by forming a mechano-transduction complex with integrin. Materials and methods Antibodies Mouse monoclonal GB1 antibody targeting to the extracellular domain (#55051) was acquired from Abcam (Shanghai, China), and GB1 polyclonal antibody (#BS2717) was obtained from Bioworld Technology (Shanghai, China). Integrin β 3 antibody (#sc-46655) and anti-mouse IgG (#sc-2025) for co-immunoprecipitation experiment were purchased from Santa Cruz Biotechnology (Shanghai, China). Integrin α v antibody (#A2091) was purchased from ABclonal Technology (Wuhan, China). Integrin β 3 antibody (#13166), β-actin (#4967), phospho-Myosin Light Chain 2 (MLC-PP, #3675), GFAP (#3670), anti-mouse IgG HRP-linked antibody (#7076), anti-rabbit IgG HRP-linked antibody (#7074), anti-rabbit IgG (H+L) (DyLight TM 800 4X PEG Conjugate) (#5151) and anti-mouse IgG (H+L) (DyLight TM 800 4X PEG Conjugate) (#5257) were purchased from Cell Signaling Technology (Shanghai, China). Anti-HA antibody (#3F10) was purchased from Roche (Shanghai, China). Cy3 AffiniPure Donkey Anti-Mouse IgG (H+L) (A0521) was purchased from Beyotime Biotechnology (Shanghai, China). Reagents Dulbecco’s Modified Eagle Medium (DMEM, #8120251), fetal bovine serum (FBS, #10437028), penicillin-streptomycin (#15140-122), Opti-MEM medium (#31985070), cell dissociation buffer (#2075828), Fluo4-AM (#F14202), lipofectamine 2000 (#11668019) and Pierce TM enhanced chemiluminescence reagents (#37074) were purchased from Thermo Fisher Scientific (Shanghai, China). Proteinase cocktail inhibitor (#04693159001) was bought from Roche (Shanghai, China). Protein G beads (#3394201) and nitrocellulose membranes (#HATF00010) were from Millipore (Shanghai, China). GABA (γ-aminobutyric acid) (#43811), Dichloro (1, 10-phenanthroline) copper (II) (#362204), Poly-D-Lysine (#P1149) and Poly-L-ornithine hydromide (#P3655) were bought from Sigma (Shanghai, China). Blebbistatin (#B1387) was purchased from ApexBio Technology (Shanghai, China). Recombinant Human Fibronectin (#40113ES10) was from Yeasen (Shanghai, China). CGP54626 hydrochloride (#HY-101378) and RGDS peptide (Arg-Gly-Asp-Ser, #HY-12290) were from Med Chem Express (Shanghai, China). Baclofen (#0796) and Rac BHFF (#3313) were from Tocris Bioscience (Shanghai, China). Coelenterazine H (#S2011) was purchased from Promega (Beijing, China). Snap-Surface Alexa Fluor 647 (#S9136) was from New England Biolabs (Ipswich, MA, USA). Plasmids The pRK5 plasmids encoding N-terminal HA-tagged wild-type rat GB1a, GB1 ASA , GB1 Δ VFT , N-terminal Flag-tagged wild-type rat GB2 were described previously 36 , 66 . HA-Snap- GB1, HA-Snap- GB1 6 .56C , and Flag-Halo- GB2 6 .56C have been reported previously 35 . The pRK5 plasmids encodes the GB1 ΔVFT , tagged with HA and Snap inserted after the signal peptide. The pRK5 plasmids encoding wild-type human Integrin β 3 (UniProt: P05106) was tagged with HA tag, inserted immediately after the signal peptide. The Integrin α v plasmid (UniProt: P06756, #P40612) was purchased from the company (Miaolingbio, Wuhan, China). The probes (full-length mVenus, Rluc, YFP or RFP) were fused to the C terminus of the GB1, GB2, Integrin β 3 , Integrin β 1 , Integrin α v , mGlu2 or 5-HT 2a receptors. G i protein sensors including G i1 -Nluc, G β1 and G γ2 -Venus were previously described 49 . All the mutants for GABA B receptor were generated by site-directed mutagenesis using the QuikChange mutagenesis protocol (Agilent Technologies, Stratagene, La Jolla, CA). HEK293 Cell culture and transfection HEK293 cells (ATCC, CRL-1573, lot: 3449904) were cultured in DMEM supplemented with 10% fetal bovine serum (heat-inactivated) at 37 °C under 5% CO 2 . Transfection was performed using lipofectamine 2000 following manufacturer protocol. Two million cells were transfected with indicated plasmids with the lipofectamine/DNA ratio at 2:1, and the total DNA at 1.5 μg in 35 mm diameter dishes. Primary astrocyte culture All experiments were approved by the Animal Experimentation Ethics Committee of School of Life Science and Technology at Huazhong University of Science and Technology and were specifically designed to minimize the number of animals used. Primary astrocytes were cultured as described previously 96 . Briefly, the cerebral cortex was dissected from KunMing mice (one day old) obtained from the Hubei Provincial Center for Disease Control and Prevention. Following careful removal of meninges, tissues were dissected and cut into small pieces using sharp blades, then digested in 1-2 ml of Trypsin/EDTA in a 37 °C water bath for 8 min. The supernatant was discarded, and the tissue was gently triturated using a 1 ml pipette. The homogenate was centrifuged at 180 g for 5 min. The pellet was re-suspended and seeded in a T75 flask pre-coated with poly-L-ornithine. Cells were cultured in DMEM medium, supplemented with 10% FBS at the density of 1 × 10 4 /cm 2 . 24 hours after the initial plating, the media were changed with DMEM supplemented with 10% FBS, 100 units/mL of penicillin, and 100 µg/mL of streptomycin and suspended cells were removed. The cells were cultured at 37 °C in a 5% CO 2 incubator for 7 days. The dishes were shaken at 260 rpm (2 h, 37 °C) to obtain purified astrocytes. The remaining enriched astrocyte culture was exposed to 0.5% trypsin for 5 min to cause detachment of the glial monolayer and cells were then re-plated in a new T75 flask to further purify astrocytes. The astrocytes were used after three times of passage at day 21 for all the experiments. Cell suspension and adhesion experiment Cell adhesion experiments were performed as previously described 97 . HEK293 cells were suspended using cell dissociation buffer and collected by centrifugation (180 g, 5 min) to remove the supernatant. Then cells were suspended in PBS and seeded into 96-well plate. For the suspension condition, the well was coated with 1% BSA. For the adhesion condition, the surface of the well was coated with poly-D-lysine (PDL) (5 μg/cm 2 ). The cells were kept in the wells for 3-4 h at 37 °C under 5% CO 2 , then lysis buffer was added directly for further measurement of IP 1 production measurements. PDL and FN treatment Poly-D-lysine (PDL) coated surfaces were prepared by incubating 5 μg/cm 2 PDL dissolved in phosphate-buffered saline in uncovered tissue culture dishes overnight at 37 °C. Fibronectin (FN)-coated surfaces were prepared by incubating 5 μg/cm 2 FN diluted in phosphate-buffered saline (PBS) in tissue culture dishes overnight at 37 °C as reported 97 . The HEK293 cells expressing indicated plasmids were seeded into PDL-coated wells or FN-coated wells with culture medium for 24 h at 37 °C under 5% CO 2 . Then cells were lysed for IP 1 production measurements. Shear Stress loading experiments Shear stress was applied to cultured cells using an in vitro shear stress system as previous report 98 . A peristaltic pump (BT-CA600, Naturethink, China) was used to drive a stable flow shear stress. HEK293 cells were seeded on glass plates pre-coated with FN, then tranfected with indicated plasmids when cells grew to ∼80% confluence. After 24 h, glass plates were transferred onto a parallel-plate flow chamber (C901) and subjected to 15 dyn/cm 2 (1.5 Pascals) of shear stress for 15 min, followed by IP 1 production measurement. IP 1 measurement IP 1 production was measured using the IP-One HTRF kit (62IPAPEB, Revvity, Codolet, France). Cryptate-labelled anti-IP 1 monoclonal antibody and d2-labelled IP 1 were diluted in lysis buffer and added to the cell lysis in 96-well plate. After 1 h of incubation at 25°C, the plates were read in PHERAstar FS (BMG Labtech, USA) with excitation at 337 nm and emission at 620 and 665 nm. The accumulation of IP1 concentration (nM) was calculated according to a standard dose response curve. G i1 protein dissociation measurement G i1 protein dissociation measurements were performed as previously described 49 . HEK293 cells were transfected with Gi protein sensors including G αi -Nluc (1.5 ng), G β1 (10 ng) and Venus-G γ2 (10 ng), along with vector (control) or GB1 and GB2 (GABA B receptor, 30 ng + 40 ng) per well in 96-well plate and cultured for 24h. Then cells were pre-incubated in PBS for 30 min. The signals emitted by the donor (460-500 nm band-pass filter, Em 480 nm) and the acceptor (510-550 nm band-pass filter, Em 530 nm) were recorded after the addition of 10 μM furimazine using the PHERAstar FS (BMG Labtech, USA) with the program PHERAstar control (Version 4.00 R4). All measurements were performed at 37°C. The BRET signal (BRET ratio) was determined by calculating the ratio between the emission of acceptor and donor (Em 530 nm / Em 480 nm). Laminar shear stress stimulation Coverslips were plated in the laminar shear stress imaging chamber (open diamond bath imaging chambers RC-26, Warner) prior to experiments. Then chambers were mounted onto the microscope and connected to the peristaltic pump (ISM827B, Ismatec). Continuous laminar flow was applied to cells for 100 s. Shear stress (τ) in arterial segments was calculated in the following equation, according to previous research 87 , where Q is flow rate, μ is fluid viscosity and d is arterial diameter. Polytetrafluoroethylene capillary tubes (d = 0.5 mm) were adapted to model arteries and only focused on the fluorescence from transfected cells next to the fluid input terminal, enabling to estimate the fluid shear stress on the surface of the coverslips. To calculate a specific value of shear stress, the flow rate (Q = 4.8 ml·min - 1 ) of imaging buffer was controlled through a peristaltic-pump and measured the viscosity of fluid flow (μ = 0.681 ± 0.017 mPa·s, mean ± s.e.m., n = 8) through viscometers. Finally, all the parameters were bring into equation (1) to calculate the value of fluid shear stress (τ = 4.44 ± 0.11 Pa, mean ± s.e.m.). Calcium imaging Calcium imaging was measured as previously reported 82 . For HEK293 cells, they were seeded onto FN-coated coverslips 6 hours after plasmid transfection. After another 24 hours, HEK293 cells were incubated with 1 μM Fluo4-AM in the imaging buffer (130 mM NaCl, 5.1 mM KCl, 0.42 mM KH 2 PO 4 , 0.32 mM Na 2 HPO 4 , 5.27 mM glucose, 20 mM HEPES, 3.3 mM Na 2 CO 3 , 1 mM MgSO 4 , 1.3 mM CaCl 2 , 0.1% BSA, 2.5 mM probenecid, pH adjusted to 7.4) for 30 min at 37°C. For primary astrocytes, they were incubated with 1 μM Fluo4-AM in the imaging buffer (145 mM NaCl, 2.5 mM KCl, 1 mM MgSO 4 , 2 mM CaCl 2 , 10 mM glucose, 10 mM HEPES, 3.3 mM Na 2 CO 3 , 1 mM MgSO 4 , 2 mM CaCl 2 , pH adjusted to 7.4) for 30 min at 37°C. Cells were washed with imaging buffer and pre-incubated for 5 min at room temperature before calcium imaging. Intracellular Ca 2+ fluorescence intensity was measured at 485 nm to indicate basal signal (F basal ) and response signal under stimulation of shear stress or baclofen (F response ). The fluorescence ratio (ΔF/F = (F response -F basal ) / F basal ) was calculated to represent the effect of shear stress or drugs on calcium signaling. RNA interference The integrin β 3 siRNA (#sc-63292) and control siRNA (#sc-37007) were purchased from Santa Cruz (Shanghai, China) and the GB1 siRNAs were synthesized from GenePharma (Suzhou, China) and the sequences are: GCGGUUUCCAACGUUCUUUTT (Forward), AAAGAACGUUGGAAACCGCTT (Reverse); GCUACAAGAAGAUCGGCUATT (Forward), UAGCCGAUCUUCUUGUAGCTT (Reverse); GGGAGAAGCCAGUUCCCAUTT (Forward), AUGGGAACUGGCUUCUCCCTT (Reverse). To knockdown integrin β 3 expression, HEK293 cells were transfected with lipofectamine 2000 mixed with integrin β 3 siRNA, with a lipid/siRNA ratio at 2:1. The cells were then cultured for 24 h and subjected to IP 1 measurements. In parallel, Western blotting was performed to confirm the knockdown of integrin β 3 . To knockdown GABA B receptor expression, primary astrocytes were transfected with lipofectamine 2000 mixed with GB1 siRNA. The GFP plasmid was co-transfected as reporter of transfection. The lipid/DNA and siRNA ratio was 3:1. Cells were then cultured for 48 h and subjected to Western blotting, calcium imaging and fluorescent imaging. In parallel, quantitative real-time PCR (qPCR) was performed to confirm the knockdown of GB1. The total RNA was extracted with TRIzol (Life Technologies), and qPCR reactions were performed in a 96-well format using Power SYBR Green (Thermo Fisher Scientific). The following primers were used: GB1 forward: ACAGACCAAATCTACCGGGC, GB1 reverse: GTGCTGTCGTAGTAGCCGAT. Relative mRNA levels were calculated using the ΔΔCT method. Co-immunoprecipitation (Co-IP) For HEK293 cells transfected with GABA B receptor with HA-tagged GB1 and Flag-tagged GB2 (HA-GB1 and Flag-GB2), cells were lysed 24 hours after transfection with immunoprecipitation (IP) cell lysis buffer (20 mM Tris, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, with complete proteinase inhibitors, pH adjusted to 7.5) on ice for 30 min. For HEK293 cells transfected with GABA B receptor with HA and Snap-tagged GB1, and Flag-tagged GB2 (HA-Snap-GB1 and Flag-GB2), cells were first labeled with 100 nM Snap-649 24 hours after transfection in culture medium at 37 °C for 2 h, then lysed with IP lysis buffer. Lysate were centrifuged at 11,000 g for 10 min at 4 °C. The supernatant was incubated with anti-HA or anti-integrin β 3 antibody overnight at 4 °C on a rotating wheel and then incubated with Protein G Beads (60 µL of a 50% bead slurry, Millipore) for 4-6 h at 4 °C. The pellet was washed four times with 600 µL of IP cell lysis buffer and resuspended with 2 × SDS sample buffer. Samples were boiled at 95 4 °C for 10 min and subjected to Western blotting analysis. Western blotting Equal amounts of protein were separated by SDS-polyacrylamide gel electrophoresis (PAGE) on 10 to 12% gels. Proteins were transferred to nitrocellulose membranes and washed in blocking buffer (10% BSA in Tris-buffered saline and 0.1% Tween 20) for 2 hours at room temperature. The blots were incubated with primary antibodies overnight at 4°C and then incubated with HRP-linked or fluorescent dye-linked secondary antibodies for 2 hours at room temperature. Immunoblots were detected using Pierce TM enhanced chemiluminescence reagents and visualized by X-ray film, or the membranes were imaged on an Odyssey CLx imager (LI-COR Bioscience, Lincoln, NE, USA) at 700 nm and 800 nm. The density of immunoreactive bands was measured by Image J software and normalized as the fold of the basal control. Bioluminescence resonance energy transfer (BRET) titration experiment BRET titration experiments were performed to measure the direct interaction between proteins as previous reported 57 . Increasing amounts of Venus-tagged receptors were co-expressed with constant amounts of Rluc-tagged receptors in HEK293 cells and cultured for 24 h. Then, after one time wash with PBS, the substrate coelenterazine h (5 μM) was added and BRET signals (emission light at 480 nm and 530 nm, respectively) were detected by Mithras LB940 (Berthold Technologies GmbH & Co., KG). The BRET signals were plotted against the relative expression levels of each tagged receptor. netBRET ratio = [YFP emission at 530 nm/Rluc emission 480 nm] (where Rluc-tagged receptor is cotransfected with Venus-tagged receptor) – [YFP emission at 530 nm/Rluc emission 480 nm] (where Rluc-tagged receptor is transfected alone), in the same experiment. The results were analyzed by nonlinear regression assuming a model with one-site binding (GraphPad Prism, version 8, GraphPad software) on a pooled dataset from three independent experiments. Fluorescent imaging HEK293 cells and astrocytes were fixed with 4% formaldehyde and blocked with 2% BSA and 0.1% Triton X-100 in PBS. HEK293 cells were stained with 4′6-diamidino-2-phenylindole (DAPI) for 30 min. Then cells were washed with PBS and mounted with FluorSave reagent (AR1109, Boster Biological Technology Co. Ltd., Wuhan, China) for fluorescent imaging. Astrocytes were incubated with a primary mouse monoclonal GFAP antibody (1:100) at 4°C overnight. After washing three times with PBS, cells were incubated with a secondary anti-mouse-Cy3 antibody at room temperature for 2 hours. After another washing of three times with PBS, the cells were incubated with DAPI at room temperature for 30 min. Then cells were washed with PBS and mounted with Fluorsave reagent. Fluorescent images of labeled cells were acquired using an Olympus FV3000 Laser Scanning Confocal Microscope (60 × objective, Olympus, Tokyo, Japan) equipped with appropriate fluorescence and filters (DAPI: 405/449 nm; YFP: 488/519 nm; RFP: 543/620 nm; Cy3: 543/620 nm; DAPI: 405/449 nm; GFP, 488/519 nm). The images were digitized and saved in TIFF format. respectively, more than five microscopic fields were randomly chosen for analysis. Images were processed and fluorescence (yellow in merge panels) was quantified with Image J plugin JACoP using Manders’ co-localization coefficients M1&M2. The settings of the confocal microscope were kept the same for all images when fluorescence intensity was compared. The intensity and area of GFAP were quantified using ImageJ software. Intracellular calcium release measurements The intracellular calcium release measurements were performed as previously described 99 . HEK293 cells were transfected with plasmids encoding the indicated GABA B receptor and a chimeric protein G qi9 for 24 h. The cells were then preincubated for 1 h with Ca 2+ -sensitive Fluo-4 (Life Technologies). The fluorescence signals (excitation at 485 nm and emission at 525 nm) were measured for 60 s (Flexstation 3, Molecular Devices) and recorded using a Flexstation 3 microplate reader (Molecular Devices, Sunnyvale, CA, USA). The agonist was added after the first 20 s. The Ca 2+ response is expressed as an agonist stimulated increase in fluorescence. Cross-linking and fluorescent-labeled blot experiments The Cross-linking experiments were performed as previously described 35 . HEK293 cells were transfected with HA-Snap-GB1 6 . 56 and Flag-Halo-GB2 6 . 56 by lipofectamine 2000 and plated in 12-well plates for 24 h. Then cells were labeled with 100 nM Snap-649 non cell permeant in culture medium at 37°C for 2 h. Cells were treated in different mechanical force condition with or without GABA (100 μM) treatment. Afterwards, cross-link buffer (1.5 mM Cu(II)-(o-phenanthroline), 1 mM CaCl 2 , 5 mM MgSO 4 , 16.7 mM Tris HCl, pH 8.0 and 100 mM NaCl) was added at 37°C for 30 min. After incubation with 10 mM N-ethylmaleimide at 4°C for 15 min to stop the cross-linking reaction, cells were lysed with lysis buffer (containing 50 mM Tris pH 7.4, 150 mM NaCl, 1% NP-40 and 0.5% sodium deoxycholate) at 4°C for 1 h. After centrifugation at 12,000 × g for 30 min at 4°C, supernatants were mixed with loading buffer at 37°C for 10 min. In reducing conditions, samples were treated without DTT in loading buffer for 10 min before loading the samples. Equal amounts of proteins were resolved by 8% SDS-PAGE. Proteins were transferred to nitrocellulose membranes (Millipore). Membrane was imaged on an Odyssey CLx imager (LI-COR Bioscience, Lincoln, NE, USA) at 800 nm. Inter subunit FRET sensor measurement The pRK5 plasmids encoding GB1b subunit with the extracellular ACP-tag inserted in the lobe1 67 and N-terminal Snap-tag GB2 subunit 100 have been described previously. HEK293 cells were co-transfected to express GB1b subunit with the extracellular ACP-tag inserted in the lobe1 and N-terminal Snap-tag GB2 subunit using Lipofectamine 2000 in a 100-mm cell culture dish following the manufacturer’s instructions. Twenty-four hours after transfection, cells were plated in fibronectin (FN)-coated or polyornithine (PLO)-coated white 96-well plates (Greiner Bio-One) at 10 5 cells per well and cultured 24h at 37 °C and followed by 12 h at 30°C with 5% CO 2 . To covalently label CoA-Lumi4®-Tb and Snap-Green on GABA B receptors, combined labelling of Snap– and ACP-tag were performed following the protocol described previously with a small modification 101 . Briefly, transfected cells were first incubated with 300 nM Snap-Green in DMEM (1X) + GlutaMaxTM-I medium for 1 h at 37°C, then washed once and incubated with 10 mM MgCl2, 1 mM DTT, 2 μM CoA-Lumi4®-Tb and 1 µM Sfp synthase in Tag-Lite® buffer for 1.5 h at 37°C. Next, cells were washed three times in Tag-Lite® buffer, and incubated with 60 μL Tag-Lite® buffer. The trFRET measurements were performed in Greiner white 96-well plates, using a PHERAstar FS microplate reader with the following setup; after excitation with a laser at 337 nm (40 flashes per well), the fluorescence was collected at 520 nm. The acceptor ratio was calculated using the sensitized acceptor signal integrated over the time window [50 µs-100 µs], divided by the sensitized acceptor signal integrated over the time window [900 µs-1150 µs]. Molecular modelling and sequence alignment The molecular model of GB1 VFT is generated with PyMOL software (Palo Alto, CA, USA) based on the cryo-EM structure of the GABA B receptor (PDB: 7EB2). A model of GB1 VFT to show the residues in LB2 substituted by N-glycan was retrieved from GPCRdb. The protein sequences of the GABA B1a subunit in various species were collected in UniProt ( http://www.uniprot.org ). The multiple sequence alignment was generated using Clustal Omega ( https://www.ebi.ac.uk/Tools/msa/clustalo/ ) and the graphic was prepared on the ESPript 3.0 server ( http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi ). Statistical analysis Data are means ± s.e.m. from at least three independent experiments and statistical analyses were performed in GraphPad Prism 8 software. P-values were determined using the unpaired t test (two-tailed), paired t test (two-tailed) or ordinary one-way ANOVA with Tukey’s multiple comparisons test (**** P < 0.0001, *** P < 0.001, ** P < 0.01, * P 0.05 was considered statistically not significant (ns). For dose-response experiments, data are normalized and analyzed using nonlinear curve fitting for the log (agonist) vs. response (three parameters) curves. Author contributions J.L., X.Z.S.X. and C.X. conceived and supervised the whole project. Y.Z., and Y.H. performed traction experiments, shear stress experiments, IP 1 measurements experiments, Co-IP experiments and GB1/integrin interface identification. Y.H. performed fluorescent imaging, BRET experiments and the calcium imaging in astrocytes. L.L., performed the calcium imaging and intracellular calcium release measurements in HEK293 cells, molecular modelling, and sequence alignment. Y.H., Y.Z. and L.L. performed cross-linking experiments, and. F.H. helped to set up the single-cell calcium imaging system. F.Y. helped with the Western blotting detection qPCR, BRET experiment and calcium imaging in astrocytes and HEK293 cells. F.Z. and M.S. helped with the calcium imaging in HEK293 cells. C.S. helped with the molecular modelling. Y.L. helped with the Co-IP and BRET experiment. J.L., X.Z.S.X. and C.X. wrote the manuscript with inputs from all the authors. Competing interests The authors declare no competing interests. Data Availability All the other data generated in this study are provided in the Supplementary information and source data files. The raw data for all Figures and Supplementary Figures are available in Source Data files, accompanying this paper. A reporting summary for this article is available as a Supplementary Information file. Supplementary figures Supplementary Fig. 1 | Mechanical forces activate GABA B receptor. a-b , Immunoblots of phosphorylated MLC2 and β-actin of HEK293 cells under either suspension or adhesion condition (a) , or PDL or FN coating (b) . Data are present as mean ± s.e.m. from three biologically independent experiments and analyzed using unpaired t test (two-tailed) to determine significance. ** P < 0.01, * P < 0.05. c, IP 1 production in cells transfected with vector and G qi9 , or GABA B receptor and G qi9 , treated with or without blebbistatin (50 μM, 30 min) under suspension or adhesion condition. Data are present as mean ± s.e.m. from four biologically independent experiments each performed in triplicates and analyzed using unpaired t test (two-tailed) to determine significance. ** P < 0.01, * P 0.05. d, G i protein activation in HEK293 cells transfected with GABA B -ΔG a GABA B receptor mutant that fails to couple to G protein, along with G i protein sensors under suspension, PDL-coating or FN coating condition. Data are present as mean ± s.e.m. from six biologically independent experiments each performed in triplicates, and analyzed using repeat measurements one-way ANOVA with Tukey’s multiple comparisons test to determine significance. not significant (ns) > 0.05. e, Analysis of the peak value of Ca 2+ signal in Fig. 1f . Data are present as as mean ± s.e.m. from 85 cells and analyzed using ordinary one-way ANOVA with Tukey’s multiple comparisons test to determine significance. **** P 0.05. f, Real-time recording of intracellular Ca 2+ release in HEK293 cells transfected with vector and G qi9 . Shear stress, baclofen (100 μM) was applied in the indicated time point. Data are present as mean ± s.e.m. from 239 cells recorded. Supplementary Fig. 2 | Measurement of GABA concentration. a , GABA concentration in HEK293 cells transfected with GABA B receptor and G qi9 under PDL-coated, FN-coated, or shear stress condition. b , Dose response curve of GABA activated Ca 2+ release in HEK293 cells transfected with GABA B receptor and G qi9 . The dotting line represent the response of GABA under the concentration in (a) . Data are present as mean ± s.e.m. from three biologically independent experiments in (a) and (b) each performed in triplicates. Supplementary Fig. 3 | GABA B receptor interacts with integrin β 3 . a , Expression of integrin β 3 and GB1 in Fig. 2a . Bars represent the expression of integrin β 3 and present as mean ± s.e.m. from four biologically independent experiments and analyzed using ordinary one-way ANOVA with Tukey’s multiple comparisons to determine significance. *** P < 0.001, ** P < 0.01. b , Analysis of the amount of GB1 Co-IPed using anti-IgG or anti-integrin β 3 antibody in Fig. 2b . Data are present as mean ± s.e.m. from four biologically independent experiments and analyzed using unpaired t test (two-tailed) to determine significance. *** P < 0.001. c-d, Co-immunoprecipitation of GABA B receptor and integrin β 3 in HEK293 cells transfected with GABA B receptor (HA-tagged GB1 and Flag-tagged GB2) using anti-integrin β 3 antibody (c) or anti-HA antibody (d) . e, Co-immunoprecipitation of GABA B receptor and integrin α v in HEK293 cells transfected with GABA B receptor (HA-tagged GB1 and Flag-tagged GB2) using anti-HA antibody. Bars represent the amount of GB1 Co-IPed by anti-integrin β 3 antibody (c) , or integrin β 3 Co-IPed by anti-HA antibody (d, e) . Data are present as mean ± s.e.m. from at least three biologically independent experiments ( c : n = 4; d , n = 4; e : n = 3) and analyzed using unpaired t test (two-tailed) to determine significance. f, Co-localization of GABA B receptor (YFP fused-GB1 and GB2) and integrin β 3 fused with RFP in transfected HEK293 cells. (Scar bar: 10 μm, 89.829 ± 1.432% overlapped, n > 20). g, Analysis of the amount of integrin β 3 Co-IPed by anti-HA antibody with or without the following drug treatment: Blebbistatin (50 μM, 30 min), RGDS (10 μM, 12 h) or CGP54626 (50 μM, 30 min) in Fig. 2d-f . Data are present as mean ± s.e.m. from at least three biologically independent experiments (n = 3; 3; 4 for Blebbistatin, RGDS and CGP54626 respectively) and analyzed using unpaired t test (two-tailed) to determine significance. **** P < 0.0001, *** P < 0.001, ** P < 0.01. h, Co-immunoprecipitation of GABA B receptor and integrin β 3 in HEK293 cells transfected with GABA B receptor (HA-tagged GB1 and Flag-tagged GB2) using anti-HA antibody with or without GABA (100 μM, 10 min) treatment. Bars represent the analysis of the amount of integrin β 3 Co-IPed by anti-HA antibody with or without the GABA treatment. Data are present as mean ± s.e.m. from at four biologically independent experiments and analyzed using unpaired t test (two-tailed) to determine significance. *** P < 0.001. i, Interaction of GABA B receptor and integrin β 3 interaction between GB1 and integrin β 1 detected using BRET titration assay. Data were analyzed by nonlinear regression on a pooled data set from at least three biologically independent experiments each performed in triplicates, fitting with 1-site binding model in GraphPad Prism 8. j, IP 1 production in cells transfected with vector or GABA B receptor along with G qi9 chimera under PDL, FN or collagen coating. Data are present as mean ± s.e.m. from three biologically independent experiments each performed in triplicates and analyzed using unpaired t test (two-tailed) to determine significance. ** P < 0.01, * P < 0.05. k, Co-immunoprecipitation of GABA B receptor and integrin β 3 in HEK293 cells transfected with GABA B receptor (HA-tagged GB1 and Flag-tagged GB2) or GABA B -ΔB mutant (HA-tagged GB1-S246A/E465A and Flag-tagged GB2) using anti-HA antibody under suspension and adhesion condition. Supplementary Fig. 4 | Mapping key residues involved in GABA B receptor and integrin interaction. a , Analysis of Co-IPed of integrin β 3 by anti-HA antibody targeting to GABA B -ΔVFT or GABA B in Fig. 4c . Data are present as mean ± s.e.m. from five biologically independent experiments and are analyzed using unpaired t test (two-tailed) to determine significance. **** P < 0.0001. b, Co-immunoprecipitation of GABA B -M3 and GABA B -M7 with integrin β 3 in HEK293 cells. The amount of integrin β 3 Co-IPed by IgG or HA antibody are present as mean ± s.e.m. from five biologically independent experiments and analyzed using ordinary one-way ANOVA with Tukey’s multiple comparisons to determine significance. **** P 0.05. c , Sequence alignment of potential regions involved in GABA B receptor and integrin β 3 interaction in indicated rat, mouse, human, monkey, bovine, drosophila and C.elegans GB1 subunit with Clustal Omega and displayed by ESPript 3 ( http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi ). d, Co– immunoprecipitation analysis of interaction between GABA B -5A and integrin β 3 in HEK293 cells. The amount of integrin β 3 Co-IPed by IgG or HA antibody are present as mean ± s.e.m. from four biologically independent experiments and analyzed using unpaired t test (two-tailed) to determine significance. ** P < 0.01. Supplementary 5 | Baclofen activated GABA B receptor to induced astrocyte remodeling. a , Representative immunofluorescent staining of GFAP (red) and DAPI (cyan) in astrocytes treated without or with baclofen (100 μM, 14-16h). Scale bar: 10 μm. b-c, Analysis of the cell size and GFAP expression in (a) . Cell basis (ROI) are presented in the bars as mean ± s.e.m. from indicated number of cells (control: n = 14, baclofen: n = 16) measured in three biologically independent experiments and analyzed using unpaired t test (two-tailed) to determine significance. ** P < 0.01. Supplementary Fig. 6 | GABA B receptor-mediated intracellular calcium release in astrocytes. a-b , Real time recording of intracellular Ca 2+ release in astrocytes transfected with control siRNA (a) or GABA B siRNA (b) under baclofen (100 μM) and ATP (100 μM) stimulation. Data are representative from three biologically independent experiments. c, Percentage of different populations of astrocytes in which baclofen activated calcium response (sensitive) or unable to activate calcium response (insensitive). Data are analyzed with χ2 test to determine significance. **** P < 0.0001. d, Analysis of the peak value of Ca 2+ signal in Fig. 8a and 8c . Data are present as as mean ± s.e.m. from 15 cells with control siRNA and 45 cells with GABA B siRNA, and analyzed using ordinary one-way ANOVA with Tukey’s multiple comparisons test to determine significance. **** P < 0.0001, *** P < 0.001, * P < 0.05. Acknowledgments We thank the Research Core Facilities of Life Science (HUST, Wuhan) for their assistance in functional measurements. This work was supported by grants from National Key R&D Program of China (grant number 2021ZD0203302 and 2022YFE0116600 to J. L.), the National Natural Science Foundation of China (NSFC) (grant number 32330049, 82320108021 and 32421003 to J. L., 32271198 to C. X.), the Major Project of Guangzhou National Laboratory (grant number GZNL2023A03007 to J.L.) and the Key Technologies R&D Program of Guangdong Province (grant number 2010A080813001 to J. L.). Funder Information Declared National Key R&D Program of China , 2021ZD0203302 , 2022YFE0116600 National Natural Science Foundation of China , 32330049 , 82320108021 , 32421003 , 32271198 Major Project of Guangzhou National Laboratory , GZNL2023A03007 Key Technologies R&D Program of Guangdong Province , 2010A080813001 References 1. ↵ Bowery , N.G. et al. International Union of Pharmacology. XXXIII. Mammalian gamma-aminobutyric acid(B) receptors: structure and function . Pharmacol Rev 54 , 247 – 264 ( 2002 ). OpenUrl Abstract / FREE Full Text 2. ↵ Ulrich , D. & Bettler , B . GABA(B) receptors: synaptic functions and mechanisms of diversity . Curr Opin Neurobiol 17 , 298 – 303 ( 2007 ). OpenUrl CrossRef PubMed Web of Science 3. ↵ Bassetti , D . Keeping the Balance: GABA(B) Receptors in the Developing Brain and Beyond . Brain Sci 12 ( 2022 ). 4. ↵ Enna , S.J. & Bowery , N.G . GABA(B) receptor alterations as indicators of physiological and pharmacological function . Biochem Pharmacol 68 , 1541 – 1548 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 5. ↵ Schuler , V. et al. Epilepsy, hyperalgesia, impaired memory, and loss of pre– and postsynaptic GABA(B) responses in mice lacking GABA(B(1)) . Neuron 31 , 47 – 58 ( 2001 ). OpenUrl CrossRef PubMed Web of Science 6. ↵ Heaney , C.F. & Kinney , J.W . Role of GABA(B) receptors in learning and memory and neurological disorders . Neurosci Biobehav Rev 63 , 1 – 28 ( 2016 ). OpenUrl CrossRef PubMed 7. ↵ Jacobson , L.H. et al. Differential roles of GABAB1 subunit isoforms on locomotor responses to acute and repeated administration of cocaine . Behav Brain Res 298 , 12 – 16 ( 2016 ). OpenUrl CrossRef PubMed 8. ↵ Bettler , B. , Kaupmann , K. , Mosbacher , J. & Gassmann , M . Molecular structure and physiological functions of GABA(B) receptors . Physiol Rev 84 , 835 – 867 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 9. ↵ Mariotti , L. , Losi , G. , Sessolo , M. , Marcon , I. & Carmignoto , G . The inhibitory neurotransmitter GABA evokes long-lasting Ca(2+) oscillations in cortical astrocytes . Glia 64 , 363 – 373 ( 2016 ). OpenUrl CrossRef PubMed 10. ↵ Cheng , Y.T. et al. Inhibitory input directs astrocyte morphogenesis through glial GABA(B)R . Nature 617 , 369 – 376 ( 2023 ). OpenUrl CrossRef PubMed 11. ↵ Gould , T. et al. GABA(B) receptor-mediated activation of astrocytes by gamma-hydroxybutyric acid . Philos Trans R Soc Lond B Biol Sci 369 , 20130607 ( 2014 ). OpenUrl CrossRef PubMed 12. ↵ Jafarian , M. et al. The effect of GABAergic neurotransmission on the seizure-related activity of the laterodorsal thalamic nuclei and the somatosensory cortex in a genetic model of absence epilepsy . Brain Res 1757 , 147304 ( 2021 ). OpenUrl CrossRef PubMed 13. ↵ Cediel , M.L. et al. GABBR1 monoallelic de novo variants linked to neurodevelopmental delay and epilepsy . Am J Hum Genet 109 , 1885 – 1893 ( 2022 ). OpenUrl CrossRef PubMed 14. ↵ Felice , D. , Cryan , J.F. & O’Leary , O.F. GABA(B) Receptors: Anxiety and Mood Disorders . Curr Top Behav Neurosci 52 , 241 – 265 ( 2022 ). OpenUrl PubMed 15. ↵ Jacobson , L.H. , Vlachou , S. , Slattery , D.A. , Li , X. & Cryan , J.F . The Gamma-Aminobutyric Acid B Receptor in Depression and Reward . Biol Psychiatry 83 , 963 – 976 ( 2018 ). OpenUrl CrossRef PubMed 16. ↵ Frankowska , M. , Filip , M. & Przegalinski , E . Effects of GABAB receptor ligands in animal tests of depression and anxiety . Pharmacol Rep 59 , 645 – 655 ( 2007 ). OpenUrl PubMed 17. ↵ Chang , E. et al. A Review of Spasticity Treatments: Pharmacological and Interventional Approaches . Crit Rev Phys Rehabil Med 25 , 11 – 22 ( 2013 ). OpenUrl CrossRef PubMed 18. ↵ Cousins , M.S. , Roberts , D.C. & de Wit , H . GABA(B) receptor agonists for the treatment of drug addiction: a review of recent findings . Drug Alcohol Depend 65 , 209 – 220 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 19. ↵ Malcangio , M. GABA(B) receptors and pain . Neuropharmacology 136 , 102 – 105 ( 2018 ). OpenUrl CrossRef PubMed 20. ↵ Vuillaume , M.L. et al. A novel mutation in the transmembrane 6 domain of GABBR2 leads to a Rett-like phenotype . Ann Neurol 83 , 437 – 439 ( 2018 ). OpenUrl CrossRef PubMed 21. ↵ Yoo , Y. et al. GABBR2 mutations determine phenotype in rett syndrome and epileptic encephalopathy . Ann Neurol 82 , 466 – 478 ( 2017 ). OpenUrl CrossRef PubMed 22. ↵ Henderson , C. et al. Reversal of disease-related pathologies in the fragile X mouse model by selective activation of GABAB receptors with arbaclofen . Sci Transl Med 4 , 152ra128 ( 2012 ). OpenUrl Abstract / FREE Full Text 23. ↵ Nieto , A. , Bailey , T. , Kaczanowska , K. & McDonald , P. GABA(B) Receptor Chemistry and Pharmacology: Agonists, Antagonists, and Allosteric Modulators . Curr Top Behav Neurosci 52 , 81 – 118 ( 2022 ). OpenUrl PubMed 24. Holtyn , A.F. & Weerts , E.M . GABA(B) Receptors and Alcohol Use Disorders: Preclinical Studies . Curr Top Behav Neurosci 52 , 157 – 194 ( 2022 ). OpenUrl PubMed 25. ↵ Logge , W.B. , Morley , K.C. & Haber , P.S . GABA(B) Receptors and Alcohol Use Disorders: Clinical Studies . Curr Top Behav Neurosci 52 , 195 – 212 ( 2022 ). OpenUrl PubMed 26. ↵ Tedeschi , L. et al. Endogenous gamma-hydroxybutyric acid is in the rat, mouse and human gastrointestinal tract . Life Sci 72 , 2481 – 2488 ( 2003 ). OpenUrl CrossRef PubMed 27. Auteri , M. , Zizzo , M.G. & Serio , R . GABA and GABA receptors in the gastrointestinal tract: from motility to inflammation . Pharmacol Res 93 , 11 – 21 ( 2015 ). OpenUrl CrossRef PubMed 28. ↵ Hyland , N.P. & Cryan , J.F . A Gut Feeling about GABA: Focus on GABA(B) Receptors . Front Pharmacol 1 , 124 ( 2010 ). OpenUrl CrossRef PubMed 29. ↵ Pin , J.P. & Bettler , B. Organization and functions of mGlu and GABA(B) receptor complexes . Nature 540 , 60 – 68 ( 2016 ). OpenUrl CrossRef PubMed 30. ↵ Shen , C. et al. Structural basis of GABA(B) receptor-G(i) protein coupling . Nature 594 , 594 – 598 ( 2021 ). OpenUrl CrossRef PubMed 31. ↵ Park , J. et al. Structure of human GABA(B) receptor in an inactive state . Nature 584 , 304 – 309 ( 2020 ). OpenUrl CrossRef PubMed 32. ↵ Mao , C. et al. Cryo-EM structures of inactive and active GABA(B) receptor . Cell Res 30 , 564 – 573 ( 2020 ). OpenUrl CrossRef PubMed 33. ↵ Shaye , H. et al. Structural basis of the activation of a metabotropic GABA receptor . Nature 584 , 298 – 303 ( 2020 ). OpenUrl CrossRef PubMed 34. ↵ Papasergi-Scott , M.M. et al. Structures of metabotropic GABA(B) receptor . Nature 584 , 310 – 314 ( 2020 ). OpenUrl CrossRef PubMed 35. ↵ Xue , L. et al. Rearrangement of the transmembrane domain interfaces associated with the activation of a GPCR hetero-oligomer . Nat Commun 10 , 2765 ( 2019 ). OpenUrl CrossRef PubMed 36. ↵ Liu , L. et al. Allosteric ligands control the activation of a class C GPCR heterodimer by acting at the transmembrane interface . Elife 10 ( 2021 ). 37. ↵ Wang , N. et al. Mechanical behavior in living cells consistent with the tensegrity model . Proc Natl Acad Sci U S A 98 , 7765 – 7770 ( 2001 ). OpenUrl Abstract / FREE Full Text 38. ↵ Xiao , R. , Liu , J. & Xu , X.Z.S . Mechanosensitive GPCRs and ion channels in shear stress sensing . Curr Opin Cell Biol 84 , 102216 ( 2023 ). OpenUrl CrossRef PubMed 39. ↵ Humphrey , J.D. , Dufresne , E.R. & Schwartz , M.A. Mechanotransduction and extracellular matrix homeostasis . Nat Rev Mol Cell Biol 15 , 802 – 812 ( 2014 ). OpenUrl CrossRef PubMed 40. ↵ Dobereiner , H.G. , Dubin-Thaler , B.J. , Giannone , G. & Sheetz , M.P . Force sensing and generation in cell phases: analyses of complex functions . J Appl Physiol (1985) 98 , 1542 – 1546 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 41. ↵ Wang , N . Review of Cellular Mechanotransduction . J Phys D Appl Phys 50 ( 2017 ). 42. Maruthamuthu , V. , Sabass , B. , Schwarz , U.S. & Gardel , M.L . Cell-ECM traction force modulates endogenous tension at cell-cell contacts . Proc Natl Acad Sci U S A 108 , 4708 – 4713 ( 2011 ). OpenUrl Abstract / FREE Full Text 43. ↵ Roca-Cusachs , P. et al. Integrin-dependent force transmission to the extracellular matrix by alpha-actinin triggers adhesion maturation . Proc Natl Acad Sci U S A 110 , E1361 – 1370 ( 2013 ). OpenUrl Abstract / FREE Full Text 44. ↵ Chrzanowska-Wodnicka , M. & Burridge , K . Rho-stimulated contractility drives the formation of stress fibers and focal adhesions . J Cell Biol 133 , 1403 – 1415 ( 1996 ). OpenUrl Abstract / FREE Full Text 45. ↵ Fernandez-Gonzalez , R. , Simoes Sde , M. , Roper , J.C. , Eaton , S. & Zallen , J.A . Myosin II dynamics are regulated by tension in intercalating cells . Dev Cell 17 , 736 – 743 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 46. ↵ Schwarz , U.S. & Gardel , M.L . United we stand: integrating the actin cytoskeleton and cell-matrix adhesions in cellular mechanotransduction . J Cell Sci 125 , 3051 – 3060 ( 2012 ). OpenUrl Abstract / FREE Full Text 47. ↵ Thomsen , W. , Frazer , J. & Unett , D . Functional assays for screening GPCR targets . Current Opinion in Biotechnology ( 2005 ). 48. ↵ Engler , A.J. , Sen , S. , Sweeney , H.L. & Discher , D.E . Matrix elasticity directs stem cell lineage specification . Cell 126 , 677 – 689 ( 2006 ). OpenUrl CrossRef PubMed Web of Science 49. ↵ Xu , C. et al. Specific pharmacological and G(i/o) protein responses of some native GPCRs in neurons . Nat Commun 15 , 1990 ( 2024 ). OpenUrl CrossRef PubMed 50. ↵ Hynes , R.O . Integrins: bidirectional, allosteric signaling machines . Cell 110 , 673 – 687 ( 2002 ). OpenUrl CrossRef PubMed Web of Science 51. ↵ Sun , Z. , Guo , S.S. & Fassler , R. Integrin-mediated mechanotransduction . J Cell Biol 215 , 445 – 456 ( 2016 ). OpenUrl Abstract / FREE Full Text 52. ↵ Li , Z. , Lee , H. & Zhu , C . Molecular mechanisms of mechanotransduction in integrin-mediated cell-matrix adhesion . Exp Cell Res 349 , 85 – 94 ( 2016 ). OpenUrl CrossRef PubMed 53. ↵ Tan , Y. et al. Matrix softness regulates plasticity of tumour-repopulating cells via H3K9 demethylation and Sox2 expression . Nat Commun 5 , 4619 ( 2014 ). OpenUrl CrossRef PubMed 54. ↵ Weisel , J.W. Fibrinogen and fibrin . Adv Protein Chem 70 , 247 – 299 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 55. ↵ Takada , Y. , Ye , X. & Simon , S. The integrins . Genome Biol 8 , 215 ( 2007 ). OpenUrl CrossRef PubMed 56. ↵ Sun , G. , Guillon , E. & Holley , S.A . Integrin intra-heterodimer affinity inversely correlates with integrin activatability . Cell Rep 35 , 109230 ( 2021 ). OpenUrl CrossRef PubMed 57. ↵ Liu , J. et al. Biased signaling due to oligomerization of the G protein-coupled platelet-activating factor receptor . Nat Commun 13 , 6365 ( 2022 ). OpenUrl CrossRef PubMed 58. ↵ Ayoub , M.A. & Pfleger , K.D . Recent advances in bioluminescence resonance energy transfer technologies to study GPCR heteromerization . Curr Opin Pharmacol 10 , 44 – 52 ( 2010 ). OpenUrl CrossRef PubMed 59. ↵ Gonzalez-Maeso , J. et al. Identification of a serotonin/glutamate receptor complex implicated in psychosis . Nature 452 , 93 – 97 ( 2008 ). OpenUrl CrossRef PubMed Web of Science 60. ↵ Bachmann , M. , Kukkurainen , S. , Hytönen , V.P. & Wehrle-Haller , B . Cell Adhesion by Integrins . Physiological Reviews 99 , 1655 – 1699 ( 2019 ). OpenUrl CrossRef PubMed 61. ↵ Pagano , A. et al. C-terminal interaction is essential for surface trafficking but not for heteromeric assembly of GABA(b) receptors . J Neurosci 21 , 1189 – 1202 ( 2001 ). OpenUrl Abstract / FREE Full Text 62. ↵ Duthey , B. et al. A single subunit (GB2) is required for G-protein activation by the heterodimeric GABA(B) receptor . J Biol Chem 277 , 3236 – 3241 ( 2002 ). OpenUrl Abstract / FREE Full Text 63. ↵ Galvez , T. et al. Mutagenesis and modeling of the GABAB receptor extracellular domain support a venus flytrap mechanism for ligand binding . J Biol Chem 274 , 13362 – 13369 ( 1999 ). OpenUrl Abstract / FREE Full Text 64. Julie Kniazeff , T.G. , Gilles Labesse , and Jean-Philippe Pin No Ligand Binding in the GB2 Subunit of the GABAB Receptor Is Required for Activation and Allosteric Interaction between the Subunits . The Journal of Neuroscience , 22 ( 17 ): 7352 – 7361 ( 2002 ). OpenUrl Abstract / FREE Full Text 65. ↵ Galvez , T. et al. Mapping the Agonist-binding Site of GABAB Type 1 Subunit Sheds Light on the Activation Process of GABABReceptors . Journal of Biological Chemistry 275 , 41166 – 41174 ( 2000 ). OpenUrl Abstract / FREE Full Text 66. ↵ Rondard , P. et al. Functioning of the dimeric GABA(B) receptor extracellular domain revealed by glycan wedge scanning . EMBO J 27 , 1321 – 1332 ( 2008 ). OpenUrl Abstract / FREE Full Text 67. ↵ Lecat-Guillet , N. et al. FRET-Based Sensors Unravel Activation and Allosteric Modulation of the GABAB Receptor . Cell Chemical Biology 24 , 360 – 370 ( 2017 ). OpenUrl CrossRef PubMed 68. ↵ Freeman , M.R. Specification and morphogenesis of astrocytes . Science 330 , 774 – 778 ( 2010 ). OpenUrl Abstract / FREE Full Text 69. ↵ Escartin , C. et al. Reactive astrocyte nomenclature, definitions, and future directions . Nature neuroscience 24 , 312 – 325 ( 2021 ). OpenUrl CrossRef PubMed 70. ↵ Burda , J.E. , Bernstein , A.M. & Sofroniew , M.V . Astrocyte roles in traumatic brain injury . Experimental neurology 275 Pt 3 , 305 – 315 ( 2016 ). OpenUrl CrossRef PubMed 71. ↵ Burda , J.E. & Sofroniew , M.V . Reactive gliosis and the multicellular response to CNS damage and disease . Neuron 81 , 229 – 248 ( 2014 ). OpenUrl CrossRef PubMed Web of Science 72. ↵ Sofroniew , M.V . Molecular dissection of reactive astrogliosis and glial scar formation . Trends in neurosciences 32 , 638 – 647 ( 2009 ). OpenUrl CrossRef PubMed Web of Science 73. ↵ Vezzani , A. et al. Astrocytes in the initiation and progression of epilepsy . Nat Rev Neurol 18 , 707 – 722 ( 2022 ). OpenUrl CrossRef PubMed 74. Schwartz , H. et al. Incipient Melanoma Brain Metastases Instigate Astrogliosis and Neuroinflammation . Cancer Res 76 , 4359 – 4371 ( 2016 ). OpenUrl Abstract / FREE Full Text 75. Zorec , R. , Zupanc , T.A. & Verkhratsky , A . Astrogliopathology in the infectious insults of the brain . Neurosci Lett 689 , 56 – 62 ( 2019 ). OpenUrl CrossRef PubMed 76. ↵ Pekny , M. & Nilsson , M. Astrocyte activation and reactive gliosis . Glia 50 , 427 – 434 ( 2005 ). OpenUrl CrossRef PubMed Web of Science 77. ↵ Sofroniew , M.V. & Vinters , H.V. Astrocytes: biology and pathology . Acta Neuropathol 119 , 7 – 35 ( 2010 ). OpenUrl CrossRef PubMed Web of Science 78. ↵ Mederos , S. et al. GABAergic signaling to astrocytes in the prefrontal cortex sustains goal-directed behaviors . Nature neuroscience 24 , 82 – 92 ( 2021 ). OpenUrl CrossRef PubMed 79. Perea , G. et al. Activity-dependent switch of GABAergic inhibition into glutamatergic excitation in astrocyte-neuron networks . eLife 5 ( 2016 ). 80. Nagai , J. et al. Hyperactivity with Disrupted Attention by Activation of an Astrocyte Synaptogenic Cue . Cell 177 , 1280 – 1292 .e1220 ( 2019 ). OpenUrl CrossRef PubMed 81. ↵ Mariotti , L. et al. Interneuron-specific signaling evokes distinctive somatostatin-mediated responses in adult cortical astrocytes . Nature Communications 9 ( 2018 ). 82. ↵ Gong , J. et al. A Cold-Sensing Receptor Encoded by a Glutamate Receptor Gene . Cell 178 , 1375 – 1386 .e1311 ( 2019 ). OpenUrl CrossRef PubMed 83. ↵ Zhang , W. et al. GABAB receptor upregulates fragile X mental retardation protein expression in neurons . Sci Rep 5 , 10468 ( 2015 ). OpenUrl CrossRef PubMed 84. ↵ Cooper , J. & Giancotti , F.G . Integrin Signaling in Cancer: Mechanotransduction, Stemness, Epithelial Plasticity, and Therapeutic Resistance . Cancer Cell 35 , 347 – 367 ( 2019 ). OpenUrl CrossRef PubMed 85. ↵ Zou , Y. et al. Mechanical stress activates angiotensin II type 1 receptor without the involvement of angiotensin II . Nat Cell Biol 6 , 499 – 506 ( 2004 ). OpenUrl CrossRef PubMed Web of Science 86. ↵ Mederos y Schnitzler , M. , et al. Gq-coupled receptors as mechanosensors mediating myogenic vasoconstriction . EMBO J 27 , 3092 – 3103 ( 2008 ). OpenUrl Abstract / FREE Full Text 87. ↵ Erdogmus , S. et al. Helix 8 is the essential structural motif of mechanosensitive GPCRs . Nat Commun 10 , 5784 ( 2019 ). OpenUrl CrossRef PubMed 88. ↵ Chachisvilis , M. , Zhang , Y.L. & Frangos , J.A . G protein-coupled receptors sense fluid shear stress in endothelial cells . Proc Natl Acad Sci U S A 103 , 15463 – 15468 ( 2006 ). OpenUrl Abstract / FREE Full Text 89. ↵ Xu , J. et al. GPR68 Senses Flow and Is Essential for Vascular Physiology . Cell 173 , 762 – 775 .e716 ( 2018 ). OpenUrl CrossRef PubMed 90. ↵ Scholz , N. et al. The adhesion GPCR latrophilin/CIRL shapes mechanosensation . Cell Rep 11 , 866 – 874 ( 2015 ). OpenUrl CrossRef PubMed 91. Scholz , N. et al. Mechano-dependent signaling by Latrophilin/CIRL quenches cAMP in proprioceptive neurons . Elife 6 ( 2017 ). 92. ↵ Yeung , J. et al. GPR56/ADGRG1 is a platelet collagen-responsive GPCR and hemostatic sensor of shear force . Proceedings of the National Academy of Sciences of the United States of America 117 , 28275 – 28286 ( 2020 ). OpenUrl Abstract / FREE Full Text 93. ↵ Scholz , N. et al. The Adhesion GPCR Latrophilin/CIRL Shapes Mechanosensation . Cell reports 11 , 866 – 874 ( 2015 ). OpenUrl CrossRef PubMed 94. ↵ Hemphill , Matthew A. , Dauth , S. , Yu , Chung J. , Dabiri , Borna E. & Parker , Kevin K . Traumatic Brain Injury and the Neuronal Microenvironment: A Potential Role for Neuropathological Mechanotransduction . Neuron 85 , 1177 – 1192 ( 2015 ). OpenUrl CrossRef PubMed 95. ↵ Chi , S. et al. Astrocytic Piezo1-mediated mechanotransduction determines adult neurogenesis and cognitive functions . Neuron 110 , 2984 – 2999 e2988 ( 2022 ). OpenUrl CrossRef PubMed 96. ↵ Wang , X.S. et al. Activation of G protein-coupled receptor 30 protects neurons by regulating autophagy in astrocytes . Glia 68 , 27 – 43 ( 2020 ). OpenUrl CrossRef PubMed 97. ↵ Galownia , N.C. , Kushiro , K. , Gong , Y. & Asthagiri , A.R . Selective desensitization of growth factor signaling by cell adhesion to fibronectin . J Biol Chem 282 , 21758 – 21766 ( 2007 ). OpenUrl Abstract / FREE Full Text 98. ↵ Tahimic , C.G. et al. Regulation of Ligand and Shear Stress-induced Insulin-like Growth Factor 1 (IGF1) Signaling by the Integrin Pathway . J Biol Chem 291 , 8140 – 8149 ( 2016 ). OpenUrl Abstract / FREE Full Text 99. ↵ Liu , J. et al. Allosteric control of an asymmetric transduction in a G protein-coupled receptor heterodimer . Elife 6 ( 2017 ). 100. ↵ Laëtitia Comps-Agrar , D.M. , Philippe Rondard , Jean-Philippe Pin , Eric Trinquet , Laurent Prézeau Cell-surface protein-protein interaction analysis with time-resolved FRET and snap-tag technologies application to G protein-coupled receptor oligomerization . Methods Molecular Biology , 201 – 214 ( 2011 ). 101. ↵ Monnier , C. et al. Trans-activation between 7TM domains: implication in heterodimeric GABAB receptor activation . EMBO J 30 , 32 – 42 ( 2011 ). OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted June 12, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following GABA-independent activation of GABAB receptor by mechanical forces Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share GABA-independent activation of GABAB receptor by mechanical forces Yujia Huo , Yiwei Zhou , Li Lin , Fan Yang , Jiyong Meng , Feiteng He , Fengfan Zhang , Mengdan Song , Cangsong Shen , Yuxuan Liu , Philippe Rondard , Chanjuan Xu , X.Z. Shawn Xu , Jianfeng Liu bioRxiv 2025.06.09.658551; doi: https://doi.org/10.1101/2025.06.09.658551 Share This Article: Copy Citation Tools GABA-independent activation of GABAB receptor by mechanical forces Yujia Huo , Yiwei Zhou , Li Lin , Fan Yang , Jiyong Meng , Feiteng He , Fengfan Zhang , Mengdan Song , Cangsong Shen , Yuxuan Liu , Philippe Rondard , Chanjuan Xu , X.Z. Shawn Xu , Jianfeng Liu bioRxiv 2025.06.09.658551; doi: https://doi.org/10.1101/2025.06.09.658551 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7618) Biochemistry (17635) Bioengineering (13859) Bioinformatics (41846) Biophysics (21401) Cancer Biology (18534) Cell Biology (25422) Clinical Trials (138) Developmental Biology (13352) Ecology (19860) Epidemiology (2067) Evolutionary Biology (24285) Genetics (15582) Genomics (22463) Immunology (17700) Microbiology (40298) Molecular Biology (17141) Neuroscience (88424) Paleontology (666) Pathology (2825) Pharmacology and Toxicology (4813) Physiology (7633) Plant Biology (15107) Scientific Communication and Education (2042) Synthetic Biology (4284) Systems Biology (9808) Zoology (2267)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.