Antineoplastic with DNA fragmentation assay and anti-oxidant, anti- inflammatory with gene expression activity of Lactobacillus plantarum isolated From local Egyptian milk products | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Antineoplastic with DNA fragmentation assay and anti-oxidant, anti- inflammatory with gene expression activity of Lactobacillus plantarum isolated From local Egyptian milk products Mohamed Elhalik, Alsayed E. Mekky, Mohamed Khedr, Waleed B. Suleiman This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4302290/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Oct, 2024 Read the published version in BMC Microbiology → Version 1 posted 12 You are reading this latest preprint version Abstract Probiotic bacteria are emerging as promising biotherapeutic agents and environmentally friendly alternatives to antibiotics. They play crucial roles as antioxidants and anti-inflammatory agents, all while minimizing adverse side effects. A significant portion of lactic acid bacteria (LAB), known for their human health benefits, are derived from milk and have been utilized in biotherapeutic applications or for producing valuable metabolites (nutraceuticals). However, the specific role of milk-associated LAB in biotherapeutics remains underexplored. To address this, eight milk product samples were randomly selected from a market in Egypt, diluted, and then cultured anaerobically on MRS agar. From these samples, 16 suspected LAB isolates were obtained and underwent rapid preliminary identification. Among these isolates, the Lactobacillus plantarum strain (OQ547261.1) was identified and shown to exhibit strong antioxidant activity. This activity was evaluated using the DPPH assay at various concentrations, ranging from 1000 to 1.95 µg/mL. The results revealed that L. plantarum displayed notable antioxidant activities of 71.8% and 93.8% at concentrations of 125–1000 µg/mL, respectively. In contrast, lower concentrations of 7.81, 3.9, and 1.95 µg/mL showed activities of 45.1%, 34.2%, and 27.2%, respectively, compared to ascorbic acid (the standard reference drug). The anti-inflammatory efficacy of L. plantarum was evaluated based on its capability to prevent hemolysis induced by hypotonic conditions in a laboratory setting. At a concentration of 1000 µg/mL, L. plantarum managed to reduce hemolysis by 97.7%, nearly matching the 99.5% inhibition rate achieved by the standard drug, indomethacin, at an identical concentration. Moreover, L. plantarum exhibited high hemolytic activity at 100 µg/mL (14.3%), which decreased to 1.4% at 1000 µg/mL. Analysis using high-performance liquid chromatography (HPLC) determined the presence of polyphenolic compounds in L. plantarum , showing an abundance of phenolic acids and flavonoids. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) demonstrated that L. plantarum increased gene expression of the inflammatory marker TLR2 by 133%, and cellular oxidation markers SOD1 and SOD2 by 65% and 74.2%, respectively, while suppressing CRP expression by 33.3%. These results underscore L. plantarum's exceptional anti-inflammatory and antioxidant activities. Furthermore, L. plantarum induces cancer cell death through necrotic nuclear DNA fragmentation. These findings suggest that L. plantarum is not only suitable for nutraceutical production but also holds potential as a probiotic strain. Future research should focus on enhancing the capacity of this strain across various industries and fostering innovation in multiple fields. Antineoplastic Anti-oxidant Anti-inflammatory DNA fragmentation Lactobacillus plantarum Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Introduction Probiotics, when incorporated into food, contribute to a balanced microbial environment in the gastrointestinal tract, thereby supporting overall health. Research indicates that probiotics offer several health benefits, including anti-allergic, anti-cancer properties, a reduction in cholesterol levels, enhancement of the immune response, and alleviation of symptoms associated with irritable bowel syndrome and gastrointestinal inflammation [ 1 ]. The strains used in probiotics are often derived from the gastrointestinal tract (GIT) itself or other sources, such as feces and milk. Lactic acid bacteria (LAB) are predominantly utilized in creating probiotic formulations. LAB, a natural part of the GIT flora in animals, has been deemed safe by the Food and Drug Administration [ 2 ]. The description refers to a specific category of bacteria that are gram-positive and capable of living with or without oxygen (facultatively aerobic) while not undergoing sporulation. These organisms can appear in shapes that are either spherical (cocci) or cylindrical (rod-shaped) and are notably recognized for their production of lactic acid as a metabolic byproduct [ 3 ]. Lactic acid bacteria (LAB) play a role in triggering immune responses and reducing or inhibiting the growth of pathogens through various mechanisms. Notably, numerous studies have identified their ability to inhibit α-glucosidase [ 4 , 5 ]. LABs are also known for producing bacteriocins, protein substances capable of acting against pathogenic bacteria, and possessing unique systems for breaking down different digestive substances [ 6 ]. Hernández-González et al. [ 7 ] explored the potential of LAB as immunomodulators, probiotics, and antimicrobials in veterinary applications. Additionally, research has consistently demonstrated that probiotics can act as antimicrobial agents, providing a viable alternative to traditional antibiotics. This antimicrobial effect, antagonistic to both gram-negative and gram-positive pathogenic bacteria such as E. coli, P. aeruginosa , and S. aureus , contributes to the fight against antibiotic resistance [ 8 ]. Exopolysaccharides produced by Lactobacillus strains are recognized for their broad range of applications, particularly for their strong antioxidant and antibacterial capabilities. Specific strains, including L. plantarum ZDY2013, L. gasseri FR4, L. delbrueckii sp., and L. bulgaricus SRFM-1, have been identified to exhibit activities that neutralize free radicals [ 9 ]. Reactive oxygen species (ROS) play crucial roles in various cellular processes, such as apoptosis, signaling, gene expression, and the transportation of molecules. However, an overabundance of ROS can lead to a multitude of pathological conditions, including DNA damage, carcinogenesis, and cellular degeneration, potentially triggering diseases like cancer, inflammation, lung injury, and other disorders [ 10 , 11 ]. Recent research has increasingly demonstrated that certain strains of L. plantarum , isolated from traditional fermented foods and known for producing exopolysaccharides [ 12 ], possess valuable properties, especially as antioxidants. This underscores the potential of EPS in the development of functional foods and its application across various industries. However, the investigation into the antioxidant activities of EPS produced by L. plantarum has not been systematic or comprehensive, given the variety of free radical models and mechanisms yet to be fully explored in vitro [ 13 ]. Consequently, advancing L. plantarum as a natural antioxidant source requires extensive research focused on optimizing production yield and thoroughly understanding its physiochemical and bioactive properties [ 14 , 15 ]. LAB strains have shown remarkable properties, such as wound healing and anti-inflammatory properties [ 16 ]. The demethylation of the TLR2 gene promoter has been linked to increased expression of pro-inflammatory cytokines and angiogenic markers, which are critical in the early stages of inflammation [ 17 ]. The initial discovery and documentation of TLR2, along with TLR1, TLR3, TLR4, and TLR5, occurred in 1998. Subsequent research over the years has highlighted TLR2's pivotal role in vertebrate immune responses [ 18 ]. Unique among the Toll-like receptors (TLRs), TLR2 is capable of forming functional heterodimers with various other TLRs. Moreover, TLR2 can engage with numerous non-TLR entities, facilitating the detection of a wide array of pathogen-associated molecular patterns (PAMPs) from all microbial domains, including fungi, viruses, parasites, and bacteria. The TLR2 gene is expressed not only by immune cells but also by endothelial and epithelial cells, underscoring its extensive involvement in immune responses [ 19 ]. In addition to its well-documented functions, inflammation is central to the pathogenesis of many diseases, with C-reactive protein (CRP) being a sensitive marker for inflammation. Recent findings suggest that CRP not only marks but also actively contributes to inflammatory and immune processes [ 20 ]. This emerging understanding of CRP's role encompasses two immunological aspects: the initiation of the classical complement pathway via C1q binding, and the enhancement of immunity through the opsonization of biological particles and their interaction with Fcγ receptors on globulins [ 21 ]. The aim of the study is to investigate the biotherapeutic potential of the Lactobacillus plantarum strain as a sustainable alternative to antibiotics, and to explore its antioxidant and anti-inflammatory properties. Also, the study aims to assess the strain's capacity to produce beneficial metabolites (nutraceuticals), its ability to induce cancer cell death via necrotic nuclear DNA fragmentation, and its potential as a probiotic strain across various industries. Additionally, the research aims to contribute to the understanding of milk-associated lactic acid bacteria (LAB) as biotherapeutics, further encouraging innovation in the field. Material and methods Collection of Milk Samples In the winter of 2022, eight different milk product samples were collected from the Egyptian market using sterile glass tubes. These samples were then transported to the laboratory in containers that maintained a controlled temperature and were stored at 4°C until they were ready for experimentation. Isolation of Lactobacillus spp. from samples The milk samples were first diluted with saline, then pour-plated onto MRS agar, and incubated in an anaerobic environment at 37°C for a period ranging from 24 to 48 hours. Following incubation, colonies that appeared morphologically distinct and well-separated were chosen for further cultivation. These selected colonies were then subcultured onto new MRS agar plates using the streak plate method to obtain pure cultures [ 22 ]. The first identification of the Lactobacillus strains The process of identifying the pure cultures involved utilizing Bergey's Manual of Determinative Bacteriology and software tools such as PIBWin and IDENTAX [ 23 , 24 ]. An in-depth examination of the colonies' physical attributes was conducted, including observations of their shape, color, and texture. Subsequently, the isolates underwent gram staining and were examined under a microscope to verify their purity. Isolates identified as gram-positive rods that were also catalase-negative underwent further characterization. This included tests for cytochrome oxidase activity, ability to grow at temperatures of 15°C and 45°C, and acid production from various carbohydrates like L-arabinose and D-fructose, among others, in designated media. The characterization process also encompassed evaluating acid and gas production from glucose, performing methyl red and Voges-Proskauer tests, assessing ammonia production from arginine, and testing for nitrate reduction. Finally, the pure isolates were evaluated by incubating them in MRS broth enriched with NaCl of 2% to select the best organisms that recorded high absorbance. Molecular identification of the most potent Lactobacillus strain amplification and sequencing of 16S rRNA The genomic DNA from LAB isolates was isolated using the QIAamp DNA Mini Kit (Qiagen SA, Courtaboeuf, France). The concentration and purity of the DNA were assessed using a NanoDrop spectrophotometer, followed by PCR amplification with two universal bacterial primers for the 16S rRNA gene: 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-TACGGYTACCTTGTTACGACTT-3′) [ 25 ]. The PCR products were then purified with the QIAquick PCR Purification Kit (Qiagen SA, Courtaboeuf, France) and sequenced on an ABI 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). The 16S rRNA gene sequences were analyzed using Geneious Bioinformatics software (Version 11, available at http://www.geneious.com ) and were further compared using the Basic Local Alignment Search Tool at the National Center for Biological Information (NCBI), where they were submitted to obtain accession numbers [ 26 , 27 ]. Phylogenetic tree construction was carried out following protocols described in previous studies, using the Tamura genetic distance model, the neighbor-joining method for tree construction, and validating the tree with one thousand bootstrap resamples. The phylogenetic tree was visualized with the aid of GeneDoc and Geneious software tools. Study of the optimization parameters for increasing the growth yield of Lactobacillus plantarum Effects of different incubation periods and incubation conditions The aim of this experiment was to determine the best incubation time for cultivating a highly effective bacterial strain on MRS medium, which is tailored for lactic acid bacteria. The study involved incubating this strain for periods of 0, 10, 20, 30, 40, and 50 hours, under both static conditions and with agitation at 150 rpm. Following each incubation interval, the optical density of the culture was assessed using a 721 spectrophotometer (M-ETCAL) [ 28 ]. Effects of different temperatures A pure culture of Lactobacillus isolate was suspended in MRS broth and incubated at temperatures of 20, 25, 30, 35, 40, 45 and 50°C for 48 hours. Growth, indicated by turbidity, was evaluated after 48 hours for the higher temperatures. This approach enabled the assessment of the bacterial isolates' growth capabilities across a wide range of temperatures [ 28 ]. Effects of different pH values The optimal components of MRS media were adjusted to a range of pH levels (2, 3, 4, 5, 6, 7, 8, and 9) using a buffer solution to mitigate pH changes caused by metabolic processes. The optical density of the culture was measured at the conclusion of their respective incubation periods [ 28 ]. Effects of different nitrogen sources The effect of different organic and inorganic nitrogen sources, as well as amino acids such as ammonium nitrate, ammonium sulfate, urea, peptone, tryptophan, and yeast extract, on growth was evaluated with an equivalent nitrogen level present in each medium used. All other optimal conditions were maintained as previously described [ 29 ]. Effects of different carbon sources MRS media for lactic acid bacteria were each enriched with various carbon sources, each at a 0.5 percent concentration. These carbon sources included sucrose, glucose, maltose, starch, lactose, and bagasse. All the previously mentioned optimal conditions were applied in each instance. At the conclusion of every incubation period, the optical density was measured using a spectrophotometer (721 spectrophotometer, M-ETCAL) [ 29 ]. NaCl tolerance test The tolerance to sodium chloride (NaCl) of the isolate was evaluated by incubating it in MRS broth enriched with varying concentrations of NaCl (2%, 3%, 4%, 5%, 6%, 7%, and 8%). After adding 10 ml of the overnight culture of the isolate to the broth, the samples were then incubated anaerobically at 37°C for a duration of 18 to 24 hours. The growth of Lactobacillus plantarum was determined by measuring the absorbance at 600 nm using MRS broth without NaCl as the control [ 30 ]. Bile salt tolerance test The evaluation of bile tolerance was conducted as described by Jomehzadeh et al. [ 30 ]. Lactobacillus plantarum was initially grown overnight at 37°C in MRS broth. For the bile tolerance test, these cultures were then introduced into MRS broth tubes containing 0.3% (w/v) bile salts (Oxgall) at a 1% (v/v) concentration. The inoculated tubes were incubated at 37°C for time periods of 2, 4, 6, and 8 hours. Tubes that were not inoculated acted as controls for the experiment. Bacterial growth was measured using a spectrophotometer, recording the optical density (O.D.) at 660 nm. Ethanol tolerance test For the ethanol tolerance assessment, the isolate was cultured in MRS broth containing different ethanol concentrations (2.5%, 5%, 10%, 15%, and 20%) [ 31 ]. The bacterial suspension was prepared in the same manner as described previously, with 100 µL transferred into 10 mL of various MRS broth. After incubation, 1 mL was taken from each incubated broth and diluted appropriately. Subsequently, the total viable cell counts were determined using the plate count method. Each experiment was performed in triplicate. Estimation of active compounds produced by L. plantarum The HPLC investigation was done using an Agilent 1260 series. The division was completed by utilizing Zorbax overshadowing. Furthermore, the mobile phase consisted of water (A) and 0.05% trifluoroacetic acid in acetonitrile (B), utilized alongside the C8 column (4.6 mm x 250 mm i.d., 5 µm) at a flow rate of 0.9 ml/min. The portable stage was modified continuously on a straight slope as follows: 0 min (82% A); 0–1 min (82% A); 1–11 min (75% A); 11–18 min (60% A); 18–22 min (82% A); 22–24 min (82% A). The multi-frequency finder was observed at 280 nm. The infusion volume was 5 µl for every one of the example arrangements. The section temperature was kept at 40°C. In vitro assessments of L. plantarum Anti-neoplastic activity of L. plantarum using the MTT assay Cell metabolic activity was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay from Sigma-Aldrich, following the protocol previously described [ 32 ]. The purpose of this assessment was to ascertain the effect of bacterial supernatants on the metabolic processes of HCT 116 cells, independent of cell proliferation. Initially, a consistent monolayer of HCT 116 cells was prepared as described earlier. These cells were then exposed to incremental concentrations of CFS, CFSp, and CFSpe for periods of 24 or 48 hours in an environment composed of 5% CO 2 and 95% air. Cells that were incubated in the standard complete medium (DMEM with 10% FBS) acted as reference controls. The optical density (OD) was recorded at 490 nm. The results were calculated using the equation: OD of treated cells at each time point / OD of reference control at T0 × 100 [ 33 ]. Measurement of DNA fragmentation DNA fragmentation was assessed using the method described by Sugihara et al. [ 34 ]. Briefly, cells weighing 25 mg were homogenized and washed with a phosphate buffer solution (PBS) that included 10 mM EDTA. The cell lysis was carried out with 250 ml of lysis buffer (pH 8.0), comprising 10 mM Tris base, 1 mM EDTA, and 0.2% Triton X-100, followed by incubation at -20°C for 20 minutes. After incubation, the lysates were centrifuged at 10,000 rpm for 15 minutes at 4°C to separate the intact chromatin from the fragmented DNA (supernatant). The pellet was dissolved in 0.5 N perchloric acid, while 5.5 N perchloric acid was added to the supernatant to achieve a final concentration of about 6.0 N. The samples were then heated at 90°C for 20 minutes and centrifuged at 10,000 rpm for 10 minutes to remove residual proteins. To each sample, 160 ml of diphenylamine (DPA) solution [comprising 150 mg DPA in 10 ml glacial acetic acid, 150 ml sulfuric acid, and 50 ml acetaldehyde (16 mg/ml)] was added, followed by incubation at room temperature for 24 hours. The absorbance at 600 nm was measured using a UV double beam spectrophotometer (Shimadzu, Tokyo, Japan). The percentage of DNA fragmentation was calculated with the formula: %DNA fragmentation = (OD of supernatant / (OD of supernatant + OD of pellet)) x 100, where OD represents optical density [ 35 ]. DNA assay through gel electrophoresis The assessment of DNA fragmentation was carried out by analyzing the nuclear DNA laddering pattern, following the method outlined by Majtnerova et al. [ 36 ]. In detail, cells were first homogenized and incubated overnight at 37°C in phosphate-buffered saline (PBS). This step was followed by cell lysis in 0.5 mL of DNA extraction buffer, which contained 50 mM Tris-HCl, 10 mM EDTA, 0.5% Triton, and 100 mg/mL proteinase K at a pH of 8.0. Afterward, the lysate was treated with 100 mg/mL DNase-free RNase at 37°C for 2 hours. Subsequently, the mixture underwent three sequential extractions with an equal volume of chloroform and phenol (1:1 v/v), and then one more extraction with chloroform alone, with each extraction followed by centrifugation at 13,000 rpm for 5 minutes at 4°C. DNA was then precipitated by adding two volumes of ice-cold absolute ethanol and one-tenth volume of 3 M sodium acetate, pH 5.2, and the mixture was left to stand at -20°C for 1 hour before being centrifuged at 10,000 rpm for 10 minutes at 4°C. The DNA pellet was rinsed with 70% ethanol, allowed to air-dry, and then dissolved in 10 mM Tris-HCl and 1 mM EDTA, pH 8.0. The isolated DNA was then subjected to electrophoresis in a 1.5% agarose gel and stained with ethidium bromide, using Tris/acetate/EDTA (TAE) buffer (pH 8.5, 2 mM EDTA, and 40 mM Tris-acetate) for visualization [ 33 ]. Anti-inflammatory activity Preparation of erythrocyte suspension Workers' fresh whole blood (3 ml) was drawn into heparinized tubes and subsequently centrifuged at 3000 rpm for 10 minutes to separate the components. The red blood cell (RBC) pellets obtained were resuspended in an equal volume of normal saline, matching that of the previously removed supernatant. This step was followed by the preparation of a 40% (v/v) suspension of the resuspended RBCs in an isotonic phosphate buffer solution (10 mM sodium phosphate buffer, pH 7.4), calculated according to the adjusted volume. The isotonic buffer solution was formulated by dissolving 0.2 g of NaH 2 PO 4 , 1.15 g of Na 2 HPO 4 , and 9 g of NaCl in 1 liter of distilled water. This buffered solution was used to facilitate the application of the reconstituted red blood cells (the resuspended supernatant). 1. Hypotonicity induced hemolysis In this study, extracts were dissolved in distilled water to create a hypotonic solution [ 37 ]. For each concentration level (100, 200, 400, 600, 800, and 1000 g/ml), 5 ml of this solution containing the extracts was placed into pairs of centrifuge tubes. In a similar manner, varying concentrations of the extracts, from 100 to 1000 g/ml, were added to pairs of centrifuge tubes filled with 5 ml of an isotonic solution. As controls, tubes were prepared with 5 ml of a 200 g/ml indomethacin solution and 5 ml of distilled water, serving as the vehicle. To each tube, 0.1 ml of an erythrocyte suspension was added and then gently mixed. The tubes were incubated for an hour at room temperature (37°C) and subsequently centrifuged at 1300 g for 3 minutes. The optical density (OD) reflecting the concentration of hemoglobin in the supernatant was measured at 540 nm using a Spectronic (Milton Roy) spectrophotometer. Assuming distilled water causes 100 percent hemolysis, the percentage inhibition of hemolysis by the extracts was calculated using the formula: % Inhibition of hemolysis = 1 - ((OD2 - OD1) / (OD3 - OD1)) * 100. Here, OD1 represents the absorbance of the test sample in isotonic solution, OD2 represents the absorbance in hypotonic solution, and OD3 represents the absorbance of the control sample in hypotonic solution. 2. Hemolytic assay The hemolytic assay was conducted following the method described by Bulmus et al. (2003). Fresh human red blood cells were collected and washed three times with 150 mM NaCl (at 2500 rpm for 10 minutes). The plasma was discarded, and the cells were resuspended in phosphate-buffered saline (PBS, pH 7.4) to achieve a 2% RBC concentration. Serial two-fold dilutions of the extract (concentrations of 1000, 800, 600, 400, 200, 100, and 50 µg/ml) were mixed with a 2% RBC solution, and the total volume of the reaction mixture was adjusted to 1 ml with PBS. The reaction mixture was incubated in a water bath at 37°C for 1 hour. Following incubation, the mixture was centrifuged at 2500 rpm for 15 minutes. The optical density of the collected supernatant was measured at 541 nm, using PBS as the blank [ 38 ]. Deionized water served as a positive control. The experiment was performed in triplicate, and the results were expressed as mean ± S.D. The percentage of hemolysis was calculated using the formula: percentage hemolysis = [(Absorbance of sample - Absorbance of blank) × 100] / Absorbance of positive control. Antioxidant activity The antioxidant capacity of L. plantarum was assessed using the DPPH (2,2-diphenylpicrylhydrazyl) free radical scavenging method [ 39 , 40 ]. Briefly, a solution of 0.1 mM DPPH in ethanol was prepared. To each 1 ml of this solution, 3 ml of the extracts at varying ethanol concentrations (from 3.9 to 1000 g/ml) were added. For this investigation, only ethanol-soluble extracts were utilized, and these were diluted to different concentrations. After thorough mixing, the solutions were allowed to stand at room temperature for 30 minutes. The absorbance was recorded at 517 nm using a UV-VIS Milton Roy spectrophotometer. Ascorbic acid served as the reference standard, and the procedure was repeated three times. The IC 50 value, indicative of the concentration needed to reduce 50% of the DPPH free radicals, was calculated from the log dose inhibition curve. A reduction in the absorbance of the reaction mixture correlates to an increase in free radical scavenging activity. The percentage of DPPH inhibition was calculated using the formula: inhibition (%) = [(Absorbance of control - Absorbance of sample) / Absorbance of control] × 100. Total RNA isolation and cDNA synthesis Total RNA was isolated from 48-hour cultures of LAB strains grown in liquid MRS medium using the Trizol reagent (Gibco) according to the protocol provided by the manufacturer. The synthesis of the first-strand cDNA was performed using the Advantage RT-for PCR Kit (Clontech, Palo Alto, CA, USA). Reverse transcription polymerase chain reaction (rt-PCR) was executed in 50 µl reactions using specific primers detailed in Table 1 . Each PCR reaction mix included 75 ng of the generated cDNA, 200 mM dNTPs, 0.1 mM of each specific primer, 1.5 mM MgCl2, and 1 U of Taq DNA polymerase (Takara), with the final volume adjusted to 50 µl with sterile water. The PCR amplification followed these conditions: an initial denaturation step at 94°C for 4 minutes; 32 cycles of denaturation at 94°C for 30 seconds, annealing at 50°C for 50 seconds, extension at 71.5°C for 1 minute; and a final extension at 71.5°C for 5 minutes. The PCR products were then run on an agarose gel using TAE buffer (40 mM Tris-Acetate, pH 7.6, and 1 mM EDTA). After electrophoresis, the gels were stained with ethidium bromide (0.5 mg/ml) and the bands were visualized under UV light. The lengths of the amplicons were compared to a standard DNA marker (GeneRuler™ 100 bp DNA Ladder, MBI Fermentas, Vilnius, Lithuania) to determine their sizes [ 41 ]. Table (1) PCR- specific primers which used to amplify four genes beside RecA as housekeeping gene Primer Sequence (5'->3') Length Tm GC% Strand Ref FW primer- TLR2 GCTCAGACTTGAGCACTATACA 22 57.62 45.45 + This study RW primer- TLR2 GGCTTGAACCAGGAAGACGA 20 59.9 55 - FW primer 1- CRP CGACCCGTGGGTACAGTATTT 21 59.7 52.3 + RW primer 1- CRP TAACGAGCTCCCAGACCAGA 20 59.9 55 - FW primer 2- CRP ACAGTTTTACAGTGGGTGGGT 21 59.4 47.6 + RW primer 2- CRP TTGCTGGGCTTCCCATTTCA 20 60.1 50 - FW primer 4- SOD1 ACTTGGGCAATGTGACTGCT 20 60.1 50 + RW primer 4- SOD1 TGGGCGATCCCAATTACACC 20 60.1 55 - FW primer 9- SOD1 CGTGGCCTAGCGAGTTATGG 20 60.6 60 + RW primer 9- SOD1 ATAGACACATCGGCCACACC 20 59.8 55 - FW primer 3- SOD2 GTTCCGAGTTTTCCAGGCAC 20 59.4 55 + RW primer 3- SOD2 CACCTGAAGTCAAGTGGGCT 20 59.8 55 - FW primer 6- SOD2 GGTTTTGGGGTATCTGGGCT 20 59.6 55 + RW primer 6- SOD2 ATCGTGCCTGGAAAACTCGG 20 60.6 55 - FW primer 7- SOD2 TGGAGGAGAACTCGCTTCGT 20 60.8 55 + RW primer 7- SOD2 CCCCAAAAGGCACAGACTCA 20 60.1 55 - FW 1-18S GCCCTAATTGGTCCAGGCG 19 44 44.3 + RW 1-18S ACAACGGCGTTCTCTCCTAT 20 44 44.4 - FW 2 -18S ACACAACGTCATTGCAAATGTGA 23 44 44.3 + RW 2 -18S GCCTGGACCAATTAGGGCAT 20 44 44.3 - Real time PCR amplification conditions Using the primers shown in Table 1 , complementary DNA (cDNA) from six samples (three treated and three controls) was subjected to semiquantitative PCR. 2x Quantitech SYBR® Green RT Mix (Fermentase) containing approximately 12.5 l of the 25 l of the real-time PCR experiment consisted of 1 l of 50 ng cDNA, 1 l of 25 pm/l from each forward and reverse primer, and 9.25 l of RNase-free water. A centrifuge was used on the samples before they were loaded into the rotor wells. PCR program set for interest genes as starting denaturation for 2 minutes at 95°C, then cycles at 95°C/30 sec, annealing at 57.5°C/30 sec, extension step at 72°C/30 sec. On the other hand, PCR program for 18S, which standard housekeeping gene, was optimized and adjusted as follows: denaturation at 95°C/2 min, annealing at 44°C/25 sec, extension at 72°C/30 sec. The Rotor Quality 6000 gear from Qiagen in the USA was utilized to do the response. The PCR cycle at which the threshold cycle (CT) results are present [ 42 ]. Data analysis Using the dd∆ct technique and Microsoft Excel, comparative quantification analysis was carried out. Results and discussion Probiotics, recognized for their nutraceutical benefits, require verification of their safety for human health before they can be endorsed as beneficial gut bacteria. The market is replete with various probiotic strains, presenting an opportunity to utilize this readily available resource for isolating and crafting new, improved probiotic strains with significant medical benefits. This approach is a promising strategy for the development of superior probiotic strains [ 43 ]. The genus Lactobacillus represents a broad and varied collection of gram-positive, non-sporulating, facultatively anaerobic bacteria. It includes species such as Lactobacillus plantarum , Lactobacillus fermentum , Lactobacillus paracasei, Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus bulgaricus, Lactobacillus casei , and Lactobacillus reuteri , among others. This sort assumes an imperative part in food maturation and can likewise be viewed as in the gastrointestinal (G arrangement of people and creatures in factor sums [ 44 ]. Eight examples of milk were randomly collected from the markets in Egypt. The initial samples were anaerobically plated onto MRS agar after being serially diluted. A total of 16 lactic acid bacteria isolates were retrieved from the previously mentioned samples and subjected to rapid preliminary identification. The total discoveries of morphological and biochemical tests. The best organism has been selected based on its ability to grow at a 2% salt concentration and yield the highest absorbance. The morphological and biochemical tests of the best organism are introduced in Table 2 . Staining revealed the gram-positive nature of the isolate, which had a purple or violet color. The isolate was rod-shaped and had long, rounded ends. They showed up generally as a chain of 3–4 cells, either single or two by two (Fig. 1 ). The hanging drop strategy showed that the microscopic organisms were non-motile, which is one of the interesting attributes of Lactobacilli . This may be because of the shortfall of extraordinary propeller-like flagella in Lactobacilli answerable for motility. Similar findings were made by Forouhandeh [ 45 ] in the isolation of Lactobacillus species from various dairy products. The absence of air bubbles indicated that the isolated microbes were catalase-negative, thereby incapable of breaking down hydrogen peroxide to release oxygen. It is well established that Lactobacillus species do not produce catalase. Comparable findings were documented by Mithun et al. [ 46 ]. The preliminary optimization, including pH, temperature, incubation period, carbon, nitrogen sources, NaCl, ethanol, and bile salt, was used in this study. The L. plantarum strain was incubated at varying temperatures, from 20 ºC to 45 ºC. The findings indicated that the optimal growth temperature for the L. plantarum isolate was 30°C, with an enzyme activity level of 1.879 ± 0.130. Conversely, the lowest enzyme activity, 0.513 ± 0.01, was observed at a lower temperature of 20 o C, with enzyme activity diminishing sharply as temperatures approached this lower limit. Consequently, the study identified that enzyme activity decreased at temperatures below 30°C, while increasing up to 35 o C, establishing 30 o C as the ideal temperature for cultivating the L. plantarum strain (Fig. 2 (A) ). The best incubation duration for producing the L. plantarum strain was detected at 24 hours, with the most conducive conditions for its growth under static conditions being 1.796 ± 0.012 ( Fig. 2 (B)) . The study also explored the effect of pH levels on the production of the L. plantarum strain, revealing that the most favorable pH for its production was 6, with an optimal yield of 2.123 ± 0.27 (80%) ( Fig. 2 (C&D) . Furthermore, the research investigated the impact of different carbon and nitrogen sources on the strain's production. It was found that glucose combined with yeast extract resulted in the highest production levels, with values of 2.971 ± 0.020 and 2.414 ± 0.26, respectively (Fig. 2 (E and F) ). The optimal production of the L. plantarum strain was achieved using lactose as the carbon source and ammonium nitrate as the nitrogen source. Additionally, the study assessed the tolerance of the L. plantarum strain to NaCl, ethanol, and bile salts, recording values of 2.987 ± 0.2 (93%) at 2% (Fig. 2 (G&H) ), 1.877 ± 0.2 (70%) at 2.5% (Fig. 2 (I&J) ), and 2.325 ± 0.2 (75%) at 0.1% (Fig. 2 (K&L) ), respectively, demonstrating the strain's resilience to these conditions. Similarly, Coulon et al. [ 47 ] have reported that Lactobacillus casei ATCC393 found 35 o C to be the optimal temperature for the production of β-glucosidase among the various temperature ranges. Also, the ideal temperature for compound creation from yeast, such as Debaryomyces pseudopolymorphus [ 48 ] and Saccharomyces cescerevisiae [ 49 ], was 40°C, respectively. The ideal pH for Lactobacillus rhamnosus CRL 98 was 6.4, which was like the L. plantarum strain, which expressed that various upsides of ideal pH were accounted for in various types of lactic corrosive microscopic organisms. Lactobacillus mesenteroides [ 50 ] and Lactobacillus plantarum [ 51 ] grow at an optimum pH of 5.0 and 5.4, respectively. The metabolism of carbon sources releases energy, which is utilized by the organism for its growth and development. The influence of different carbon sources on the production of L. plantarum strains was investigated in this study. It was discovered that lactose serves as an efficient carbon source for cultivating the L. plantarum strain. Interestingly, the organism demonstrated significant growth on xylose, resulting in the highest protein activity in the culture broth compared to other carbon sources tested. This observation indicates that the Lactobacillus plantarum strain is capable of thriving or adapting to diverse environmental conditions. In certain examinations on glycosidase chemicals from different sources, Grimaldi et al. [ 52 ] have announced that the presence of glucose or fructose diminishes the exercises. Also. when culture in a fluid medium contained corn grain, the greatest aggregate β-glucosidase creation was accounted for, cellulose and glucose prompted elevated degrees of β-glucosidase creation, Pediococci sp. creation of β-D-glucopyranosidase movement was unequivocally worked on by both glucose and fructose, and furthermore, it was presented as an expected supportive source from which higher compounds could be cleansed [ 53 ]. L. plantarum strain was developed on carbon wellsprings of focus 1% m/v. In many microorganisms, both organic and inorganic nitrogen forms are metabolized to produce amino acids, nucleic acids, proteins, and components of the cell wall [ 54 ]. It was found that the use of ammonium nitrate resulted in the highest production levels of the Lactobacillus plantarum strain among various organic and inorganic nitrogen sources tested, with urea-containing medium showing the lowest activity. Regarding the impact of different ethanol concentrations on the optical density and viability of the L. plantarum strain, it was observed that a 2.5% (v/v) ethanol concentration yielded the highest activity compared to other tested concentrations. Furthermore, Spano et al. [ 55 ] reported that the β-glucosidase gene from Lactobacillus plantarum was inhibited by 12% (v/v) ethanol [ 52 ]. Notably, ethanol was found to activate the enzyme in wine at concentrations above 15% (v/v). In contrast, Grimaldi et al. [ 52 ] noted that the stimulatory effect of 4% v/v ethanol is more pronounced at lower concentrations, aligning with previous findings for Oenococcus oeni and other yeast biomasses. The study led with various groupings of NaCl for the creation of L. plantarum showed the greatest worth at convergence of 2% NaCl. It has been demonstrated that sodium ions in the surrounding environment are necessary for efficient membrane transport. The utilization of NaCl in a concentrate by Damaso et al. [ 56 ] demonstrated that it is necessary for the synthesis of another enzyme, xylanase. Lactobacilli was identified genetically through PCR amplification and sequencing of 16S rDNA using two bacterial universal primers, as mentioned. The PCR amplicon was purified from gel, then sequenced and aligned through NCBI BLASTn for firmly related sequences on the NCBI gene bank database; this indicates that it belonged to Lactobacillus plantrum , and its phylogenetic tree was designed through MEGA 11 with the most related sequences as described in Fig. 3 . This technique was used by Khedr et al. [ 41 ] to identify Lactobacillus delbrueckii . Simmalry, Abdel Ghany et al. [ 42 ] used this technique to identify Lactobacillus acidophilus . Table 2 The morphological and biochemical characterization of the best organism. No. Characteristics Results Morphological tests 1 Gram staining +ve 2 Shape Rod 3 Colony morphology Circular, white, glistering, convex. 4 Motility Non motile Biochemical tests 1 Catalase - 2 Citrate test - 3 NH3 from arginine - 4 Hydrogen sulphide production - 5 Indole production - 6 Methyl red reaction + 7 Oxidase test - 8 Urease test - 9 Voges Proskauer Reaction - 10 Glucose utlization + 11 Glucose (Gas) (Co 2 ) - 12 Sucrose utlization + 13 Lactose utlization + 14 Maltose utlization + 15 Mannitol utlization + 16 Arabinose utlization - 17 Salicin utlization + +, positive result; -, negative result. from the NCB Gene Bank site. High-Performance Liquid Chromatography (HPLC) is a critical and versatile analytical method extensively employed across various fields. It is utilized for both the separation and quantification of organic and inorganic substances in a wide array of samples, including those from industrial, pharmaceutical, food, and environmental sources. Moreover, it is increasingly applied to biological samples and the extraction of natural products. Through HPLC, compounds are differentiated based on their interactions with the mobile phase solvent and the solid material within a tightly packed column, under high pressure. This technique is gaining recognition as a preferred method for fingerprinting analysis, crucial for the quality assurance of herbal products [ 57 ]. Various researchers and scholars have highlighted the application of HPLC in the characterization and quantification of secondary metabolites in plant extracts, specifically targeting phenolic compounds, steroids, flavonoids, and alkaloids [ 58 – 60 ]. Flavonoids constitute a vast group of polyphenolic compounds, all structurally derived from the base molecule flavone and produced by plants. These substances, found in fruits and vegetables, are recognized for their broad and significant health benefits, which include radical scavenging and metal chelating activities. The antioxidant properties of flavonoids in vitro stem from their ability to mitigate free radical formation, leading to various biological effects. Numerous studies have highlighted that flavonoids such as rutin, kaempferol, quercetin and apigenin, among others, are renowned for their anti-inflammatory, anti-allergic, antithrombotic, hepatoprotective, antispasmodic, and anticancer properties [ 61 , 62 ]. The biological activities, such as their antimutagenicity, antibacterial, antiviral, anti-inflammatory, and apoptotic properties, among others, must be justified by distinguishing and quantitating such mixtures [ 63 ]. Syringic acid is accepted to have various advantageous natural exercises, including the insurance of the mind, heart, and liver, as well as anticancer, antimicrobial, against aggravation, antidiabetic, hostile to nitrosative, and cell reinforcement properties [ 64 ]. Coumaric acid demonstrates a wide range of bioactive properties, including antioxidant, anti-inflammatory, anti-mutagenic, anti-ulcer, antiplatelet, and anti-cancer activities. Besides, it plays a role in mitigating atherosclerosis, oxidative damage to the heart, damage to ocular tissues caused by UV light, neuronal injury, anxiety, gout, and diabetes [ 65 ]. According to the current study, CA may alleviate diabetes by increasing its immunomodulatory effect and defending against oxidative stress and inflammation. Quercetin has drawn expanding consideration because of its cancer prevention agent, antibacterial, and anti-inflammatory effects [ 66 , 67 ]. The results from the study on L. plantarum indicate that the strain tested is capable of producing secondary metabolites with promising antimicrobial, antioxidant, and anti-inflammatory properties (Table 3 and Fig. 4 ). However, to validate L. plantarum's potential as a biomedical agent, in vivo studies will be necessary. Table 3 Bioactive compounds isolated from L. plantarum . Peak No. RT Type Area % Compound name Molecular weight (g/mol) Molecular formula 1 3.592 BV 74.5124 Gallic acid 170.12 C 7 H 6 O 5 2 4.308 BB 10.7387 Chlorogenic acid 354.31 C 16 H 18 O 9 3 4.494 - 0.0000 Catechin 290.26 C 15 H 14 O 6 4 5.622 BV 5.2960 Methyl gallate 184.147 C 8 H 8 O 5 5 5.904 VV 2.0099 Coffeic acid 180.16 C 9 H 8 O 4 6 6.161 VB 3.1779 Syringic acid 198.17 C 9 H 10 O 5 7 6.649 - 0.0000 Pyro catechol 110.1 C 6 H 6 O 2 8 6.925 - 0.0000 Rutin 610.517 C 27 H 30 O 16 9 7.411 BB 0.4946 Ellagic acid 302.197 C 14 H 6 O 8 10 8.702 - 0.0000 Coumaric acid 164.16 C9H8O3 11 9.123 - 0.0000 Vanillin 152.15 C 8 H 8 O 3 12 9.756 - 0.0000 Ferulic acid 194.18 C 10 H 10 O 4 13 10.263 BB 5.4176 Naringenin 272.257 C 15 H 12 O 5 14 11.846 - 0.0000 Rosmarinic acid 360.318 C 18 H 16 O 8 15 16.021 - 0.0000 Daidzein 254.23 C 15 H 10 O 4 16 17.331 - 0.0000 Querectin 302.236 C 15 H 10 O 7 17 19.263 - 0.0000 Cinnamic acid 148.1586 C 9 H 8 O 2 18 20.610 - 0.0000 Kaempferol 286.23 C 15 H 10 O 6 19 21.205 - 0.0000 Hesperetin 302.27 C 16 H 14 O 6 Anti-Neoplastic activity of Lactobacillus plantarum Figure 5 illustrates changes in cell morphology and shape within a monolayer culture as an initial and distinct effect observed following exposure to L. plantarum , captured using an inverted light microscope. The inhibitory effect of L. plantarum on human colon cancer cells (HCT116), along with the degree of cell suppression, was confirmed using the MTT assay at different concentrations ranging from 1000 to 31.25 µg/mL. Significantly, the IC50 value, indicating the concentration needed to inhibit 50% of the cancer cells (HCT116), was found to be 100.11 µg/mL. Lactobacillus strains are commonly recognized for their health-promoting roles as microbial food supplements, with benefits such as enhancing gut health, boosting the immune system, and lowering the risk of certain cancers [ 68 ]. Regular consumption of yogurt and other probiotic dairy products has been suggested to inhibit the growth of colon cancer cells [ 69 ]. The surface components of Lactobacillus strains have shown anticancer activities. This study explores the anti-cancer capabilities of L. plantarum . Previous research has indicated the role of autophagy in cancer prevention and treatment. This investigation found distinctive morphological and biochemical markers of autophagy, such as autophagic vacuoles and acidic vesicular organelles, in HCT116 colon cancer cells treated with L. plantarum , suggesting that L. plantarum triggers autophagic cell death in HCT116 colon cancer cells [ 70 ]. DNA fragmentation ability of lactobacillus plantrum Our research demonstrates that L. plantarum significantly contributes to triggering cell death in cancer cells via DNA fragmentation, indicative of necrosis. This observation is supported by gel electrophoresis findings, which displayed DNA fragmentation in cells treated with L. plantarum , in stark contrast to the intact DNA in untreated (control) cancer cells, as illustrated in Fig. 6 . This finding differs from the behavior of nuclear DNA in cancer cells. Moreover, Choi et al. [ 71 ] discovered that soluble polysaccharides from the cell wall of L. acidophilus 606 inflicted damage on HT-29 cancer cells, a phenomenon largely attributed to the initiation of apoptosis rather than necrosis, as evidenced by nuclear DNA fragmentation and the lack of PI staining. This marks a pioneering instance of cancer cell apoptosis triggered by Lactobacilli -derived polysaccharides. Additionally, proteomic analysis revealed that polysaccharides from L. acidophilus 606 significantly affected the expression of proteins such as the Bcl-2-interacting mediator and cell division cycle proteins. These findings underline the potent antioxidative and anticancer properties of soluble polysaccharides from L. acidophilus 606 against various cancer cell lines. The potential of these polysaccharide components to be integrated into foods or used as supplements in cancer therapy is significant [ 72 , 73 ]. Furthermore, L. plantarum is shown to modulate the expression of crucial genes like AKT, PTEN, BAX, and TLR4, which are involved in apoptosis and anti-apoptosis mechanisms in the AGS gastric cancer cell line [ 74 ]. Anti-inflammatory activity of Lactobacillus plantarum The evaluation of L. plantarum's anti-inflammatory effects was conducted through its capacity to suppress hypotonicity-induced hemolysis and perform hemolytic assays in vitro. The results showed that L. plantarum significantly reduced hemolysis by 97.7% at a concentration of 1000 µg/mL, nearly matching the 99.5% effectiveness of indomethacin, a widely recognized anti-inflammatory medication, at the same concentration (Fig. 7). On the contrary, the hemolytic activity of L. plantarum peaked at 14.3% at a concentration of 100 µg/mL and then diminished to 1.4% at 1000 µg/mL (Fig. 8 ). These findings underscore the potential of L. plantarum as an effective anti-inflammatory agent [ 75 ]. Similarly, L. casei and L. acidophilus have been observed to significantly alleviate paw swelling in rats, indicating their anti-inflammatory properties. Research conducted by Ganji-Arjenaki and Rafieian-Kopaei [ 76 ] has shown the efficacy of various Lactobacillus strains in the treatment of inflammatory bowel disease. In contrast, a study found that exopolysaccharides from Bacillus circulans exhibited a 92% anti-inflammatory effect, while EPS from Pseudomonas mendocina AB1 showed a lesser effect of 59.07% [ 77 ]. These comparative insights call for further investigation to elucidate the mechanisms of EPS in protein protection and their application in developing new anti-inflammatory treatments [ 78 ]. Figure 7. Effect of L. plantarum on HRBC hemolysis and membrane stabilization The L. plantarum strain we studied exhibited notable anti-inflammatory properties by reducing the expression of two critical markers of inflammation in human cells: CRP and TLR2. Specifically, the expression levels of CRP and TLR2 decreased by one and eight times, respectively, in the cell line treated with our strain, which was fermented for 72 hours and then incubated for five hours at 37°C. These findings are consistent with in vitro research conducted by Borchers et al. [ 79 ], which indicates that Lactobacillus plantarum 299v may reduce inflammation in humans through the suppression of TLR activation. Additionally, the interaction observed between human peripheral blood mononuclear cells (PBMCs) and L. plantarum species underscores L. plantarum's potential to modulate PBMC responses [ 80 ]. Antioxidant activity of Lactobacillus plantarum Lactic acid bacteria (LAB), including those with antioxidant enzymes, are vital for enzymatic defense against oxidative stress. The antioxidant potential of L. plantarum was evaluated over a spectrum of concentrations from 1000 to 1.95 µg/mL, as shown in Fig. 9 . The results indicated that L. plantarum exhibited notable antioxidant efficiency, with activities of 71.8% and 93.8% at concentrations ranging from 125 to 1000 µg/mL, respectively. However, at lower concentrations of 7.81, 3.9, and 1.95 µg/mL, the observed antioxidant activities were 45.1%, 34.2%, and 27.2%, respectively, when compared to ascorbic acid, the standard reference used. Moreover, L. plantarum has demonstrated its capacity to counteract free radicals. Our study highlights that L. plantarum strains AR113, AR269, AR300, AR501, and P. pentosaceus AR243 showed considerable resilience against hydrogen peroxide [ 81 ]. In this context, L. plantarum was recognized for its profound antioxidant activity. This is in line with the findings of Li et al. [ 82 ], who found that L. plantarum strains from traditional Chinese fermented foods possess antioxidant capabilities, with L. plantarum C88 showcasing optimal hydroxyl radical and DPPH scavenging activities against hydrogen peroxide at a density of 1010 CFU/ml. The DPPH scavenging efficiency of our isolates surpassed those documented by Benattouche et al. [ 83 ], who reported antioxidant activities ranging from 16–56% for exopolysaccharides derived from various yogurt LABs at a concentration of 1000 µg/mL. Gene expression was induced by Lactobacillus plantarum . Moreover, L. plantarum has been found to modulate the expression of the antioxidant markers SOD1 and SOD2, enhancing their levels by 65% and 74.2%, respectively. It also significantly boosts the gene expression of TLR2 by 133% compared to the control, while reducing CRP expression by 33.3%, as depicted in Figs. 10 A and B . These results are in line with findings by Rolfe [ 84 ], who observed that LAB supplementation could mitigate oxidative stress in piglets. Many probiotics, particularly LAB, are increasingly recognized as alternatives to antibiotics and as therapeutic options for managing post-weaning syndrome. They achieve their beneficial effects through various actions, including immune system activation, pathogen invasion blockade, and antimicrobial substance production. Supplementation with LAB notably enhances (p < 0.05) the expression of Btk, HO-1, Nrf2, TLR4, and TLR2 in the jejunum, in contrast to the LPS-only group. Protein expression of TLR4, Btk, and Nrf2 in the ileum of LPS-challenged piglets was also elevated (p < 0.05) following LAB supplementation [ 85 ]. Additionally, LAB helps shield the intestine from oxidative damage in animals by activating antioxidant enzymes and preserving redox homeostasis [ 13 ]. Four interest gene sequences were aligned against the most related sequences in the NCBI database; based on their sequences, phylogenetic trees were constructed as shown in Fig. 11 . Conclusion A study in Egypt involving eight randomly selected milk product samples led to the identification of 16 potential lactic acid bacteria (LAB) isolates through anaerobic culturing on MRS agar. Among these, Lactobacillus plantarum (OQ547261.1) stood out for its significant antioxidant and anti-inflammatory properties. It showed high antioxidant activity, particularly at higher concentrations (71.8–93.8% between 125 and 1000 µg/mL), and demonstrated a 97.7% inhibition of hypotonicity-induced hemolysis at 1000 µg/mL, comparable to the activity of standard drugs. HPLC analysis revealed phenolic acids and flavonoids in L. plantarum , indicating its phytochemical richness. Moreover, RT-qPCR analysis showed L. plantarum significantly increased expression of inflammation and oxidation markers while reducing CRP expression, further confirming its anti-inflammatory and antioxidant capabilities. The real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) analysis showed that L. plantarum significantly increased the expression of TLR2 (an inflammatory marker) by 133%, and the cellular oxidation markers SOD1 and SOD2 by 65% and 74.2%, respectively, while it decreased CRP expression by 33.3%. Interestingly, L. plantarum also induced necrotic cancer cell death, highlighting its potential in nutraceuticals and as a valuable probiotic strain, suggesting a need for further research to explore its broad applications. Declarations Conflict of interest the authors declare no competing interests. Author Contribution Mohamed A. Elhalik: methodology and resources. Waleed B. Suleiman, conceptualization, methodology, and resources. Mohamed Khedr: methodology, Genetics identifications and software, and Alsayed E. Mekky: conceptualization, writing review, methodology, resources, investigation, writing original draft, GC-MAS ant total phenolic acids and submitting the paper to the journal. The author (s) read and approved the final manuscript. Data availability: All data included in this study were presented in the form of tables and figures. References Sharifi-Rad J, Rodrigues CF, Stojanović-Radić Z, Dimitrijević M, Aleksić A, Neffe-Skocińska K, Zielińska D, Kołożyn-Krajewska D, Salehi B. Milton Prabu SJM: Probiotics: versatile bioactive components in promoting human health. 2020, 56(9):433. Peng X, Ed-Dra A, Yue MJCRFS. Nutrition: Whole genome sequencing for the risk assessment of probiotic lactic acid bacteria. 2023, 63(32):11244–62. Barnes L-M, Hanlon GWJAPE-BTD. Medicines Mo: Fundamentals of microbiology. 2021:184. Ren C, Faas MM, de Vos PJCRiFS. Nutrition: Disease managing capacities and mechanisms of host effects of lactic acid bacteria. 2020, 61(8):1365–1393. Saha UB. Saroj SDJERoA-iT: Lactic acid bacteria: Prominent player in the fight against human pathogens. 2022, 20(11):1435–53. Verma DK, Thakur M, Singh S, Tripathy S, Gupta AK, Baranwal D, Patel AR, Shah N, Utama GL, Niamah AKJFB. Bacteriocins as antimicrobial and preservative agents in food: Biosynthesis, separation and application. 2022, 46:101594. Hernández-González JC, Martínez-Tapia A, Lazcano-Hernández G, García-Pérez BE, Castrejón-Jiménez NSJA. Bacteriocins from lactic acid bacteria. A powerful alternative as antimicrobials, probiotics, and immunomodulators in veterinary medicine. 2021, 11(4):979. Silva DR, Sardi JCO, de Souza Pitangui N, Roque SM, da Silva ACB. Rosalen PLJJoFF: Probiotics as an alternative antimicrobial therapy: Current reality and future directions. 2020, 73:104080. Angelin J, Kavitha MJIJBM. Exopolysaccharides from probiotic bacteria and their health potential. 2020, 162:853–865. Kirtonia A, Sethi G, Garg MJC, Sciences ML. The multifaceted role of reactive oxygen species in tumorigenesis. 2020, 77:4459–83. Chaudhary MR, Chaudhary S, Sharma Y, Singh TA, Mishra AK, Sharma S, Mehdi MMJB. Aging, oxidative stress and degenerative diseases: mechanisms, complications and emerging therapeutic strategies. 2023, 24(5):609–62. Saleem M, Malik S, Mehwish HM, Ali MW, Hussain N, Khurshid M, Rajoka MSR, Chen YJAM. Isolation and functional characterization of exopolysaccharide produced by Lactobacillus plantarum S123 isolated from traditional Chinese cheese. 2021, 203:3061–70. Feng T, Wang JJGM. Oxidative stress tolerance and antioxidant capacity of lactic acid bacteria as probiotic: A systematic review. 2020, 12(1):1801944. Yilmaz B, Bangar SP, Echegaray N, Suri S, Tomasevic I, Manuel Lorenzo J, Melekoglu E, Rocha JM, Ozogul FJM. The impacts of Lactiplantibacillus plantarum on the functional properties of fermented foods: A review of current knowledge. 2022, 10(4):826. Rodríguez LGR, Gasga VMZ, Pescuma M, Van Nieuwenhove C, Mozzi F, Burgos JASJFRI. Fruits and fruit by-products as sources of bioactive compounds. Benefits and trends of lactic acid fermentation in the development of novel fruit-based functional beverages. 2021, 140:109854. Jenab A, Roghanian R, Emtiazi GJDD. Development, Therapy: Bacterial natural compounds with anti-inflammatory and immunomodulatory properties (mini review). 2020:3787–801. Deng J-Y, Wu X-Q, He W-J, Liao X, Tang M. Nie X-QJJoAR: Targeting DNA methylation and demethylation in diabetic foot ulcers. 2023. Li Y, Hu J, Zhang Y, Yan K, Zhang M, Li Y, Huang X, Tang J, Yao T, Wang DJF, et al. Identification and characterization of toll-like receptor genes in silver pomfret (Pampus argenteus) and their involvement in the host immune response to Photobacterium damselae subsp. Damselae Nocardia seriolae Infect. 2023;141:109071. Teixeira HS, Zhao J, Kazmierski E, Kinane DF, Benakanakere MRJC. TLR3-Dependent activation of TLR2 endogenous ligands via the MyD88 signaling pathway augments the innate immune response. 2020, 9(8):1910. Hou K, Wu Z-X, Chen X-Y, Wang J-Q, Zhang D, Xiao C, Zhu D, Koya JB, Wei L, Li et al. JJSt : Microbiota in health and diseases. 2022, 7(1):135. Lasorsa F, Rutigliano M, Milella M, Ferro M, Pandolfo SD, Crocetto F, Simone S, Gesualdo L, Battaglia M. Ditonno PJIJoMS: Complement System and the Kidney: Its Role in Renal Diseases, Kidney Transplantation and Renal Cell Carcinoma. 2023, 24(22):16515. Kajal A, Ankur G, Jagriti SJIJARBS. Isolation and identification of Lactobacilli bacteria from raw cow milk in local region of Agra. 2017, 4(11):98–102. Sharpe ME. Identification of the lactic acid bacteria. 1979. Tserovska L, Stefanova S, Yordanova T. Identification of lactic acid bacteria isolated from katyk, goat’s milk and cheese. 2002. Belmok A, Rodrigues-Oliveira T, Lopes F, Krüger R, Kyaw CJBJB. The influence of primer choice on archaeal phylogenetic analyses based on 16S rRNA gene PCR. 2021, 83. Cui Y, Qu XJTFS. Technology: Genetic mechanisms of prebiotic carbohydrate metabolism in lactic acid bacteria: Emphasis on Lacticaseibacillus casei and Lacticaseibacillus paracasei as flexible, diverse and outstanding prebiotic carbohydrate starters. 2021, 115:486–99. Felis GE, Dellaglio FJC. Taxonomy of lactobacilli and bifidobacteria. 2007, 8(2):44. Yang E, Fan L, Yan J, Jiang Y, Doucette C, Fillmore S. Walker BJAe: Influence of culture media, pH and temperature on growth and bacteriocin production of bacteriocinogenic lactic acid bacteria. 2018, 8(1):1–14. Agbankpe AJ, Dougnon TV, Balarabe R, Deguenon E, Baba-Moussa LJVW. In vitro assessment of antibacterial activity from Lactobacillus spp. strains against virulent Salmonella species isolated from slaughter animals in Benin. 2019, 12(12):1951. Jomehzadeh N, Javaherizadeh H, Amin M, Saki M, Al-Ouqaili MT, Hamidi H, Seyedmahmoudi M. Gorjian ZJIJoID: Isolation and identification of potential probiotic Lactobacillus species from feces of infants in southwest Iran. 2020, 96:524–30. Li P, Gu Q, Yang L, Yu Y, Wang YJF. Characterization of extracellular vitamin B12 producing Lactobacillus plantarum strains and assessment of the probiotic potentials. 2017, 234:494–501. Kamiloglu S, Sari G, Ozdal T, Capanoglu EJFF. Guidelines for cell viability assays. 2020, 1(3):332–349. Suleiman WB, Shehata RM, Younis AM. In vitro assessment of multipotential therapeutic importance of Hericium erinaceus mushroom extracts using different solvents. Bioresources Bioprocess. 2022;9(1):1–13. Sugihara A, Van Avermaete F, Roelant E, Punjabi U, De Neubourg DJEJoO, Gynecology, Biology R. The role of sperm DNA fragmentation testing in predicting intra-uterine insemination outcome: A systematic review and meta-analysis. 2020, 244:8–15. El-Naggar HA, Bashar MA, Rady I, El-Wetidy MS, Suleiman WB, Al-Otibi FO, Al-Rashed SA, Abd El-Maoula LM, Salem E-SS, Attia EM, et al. Two red sea sponge extracts (Negombata magnifica and Callyspongia siphonella) induced anticancer and antimicrobial activity. Appl Sci. 2022;12(3):1400. Majtnerova P, Capek J, Petira F, Handl J. Rousar TJSr: Quantitative spectrofluorometric assay detecting nuclear condensation and fragmentation in intact cells. 2021, 11(1):11921. Aidoo DB, Konja D, Henneh IT, Ekor MJIJI. Protective effect of bergapten against human erythrocyte hemolysis and protein denaturation in vitro. 2021, 2021. Zhang P, Ouyang Q, Zhai T, Sun J, Wu J, Qin F, Zhang N, Yue S, Yang X, Zhang HJN. An inflammation-targeted nanoparticle with bacteria forced release of polymyxin B for pneumonia therapy. 2022, 14(41):15291–304. Akmal U, Ghori I, Elasbali AM, Alharbi B, Farid A, Alamri AS, Muzammal M, Asdaq SMB, Naiel MA, Ghazanfar SJF. Probiotic and antioxidant potential of the Lactobacillus spp. Isolated from artisanal fermented pickles. 2022, 8(7):328. Suleiman WB, Helal EE-H. Chemical constituents and potential pleiotropic activities of Foeniculum vulgare (Fennel) ethanolic extract; in vitro approach. Egypt J Chem. 2022;65(7):617–26. Khedr M, Youssef FS, El-Kattan N, Abozahra MS, Selim MN, Yousef A, Khalil KM. Mekky AEJJoGE, Biotechnology: FolE gene expression for folic acid productivity from optimized and characterized probiotic Lactobacillus delbrueckii. 2023, 21(1):169. Abdel Ghany Elrahmany HM, Ali AA, El-Batawy OI, Khedr M, Hassan MAJEJC. Genetic engineering of UV-mutated Bifidobacterium longum and Lactobacillus acidophilus in relation to folic acid and Anti-inflammatory productivity. 2023, 66(13):983–92. Yang J, Zhang G, Peng M, Tan S, Ge S, Yang X, Liang Y, Wen Z, Xie L, Zhou TJAM. Bionic regulators break the ecological niche of pathogenic bacteria for modulating dysregulated microbiome in colitis. 2022, 34(39):2204650. Ansari F, Bahadori A, Samakkhah SA, Pirouzian HR, Pourjafar H. Probiotic Lactic Acid Bacteria: Taxonomy, Properties and Benefits. Handbook of Food Bioactive Ingredients: Properties and Applications. Springer; 2023. pp. 1–31. Forouhandeh H, Vahed SZ, Hejazi M, Nahaei M, Dibavar MAJCRB. Isolation and phenotypic characterization of lactobacillus species from various dairy products. 2010, 3(2):84–8. Mithun S, Dipak V, Sheela SJIJS, Publications R. Isolation and Identification of lactobacilli from raw milk samples obtained from Aarey Milk Colony. 2015, 5(4):1–5. Coulon S, Chemardin P, Gueguen Y, Arnaud A. Galzy PJAb, biotechnology: Purification and characterization of an intracellular β-glucosidase from Lactobacillus casei ATCC 393. 1998, 74:105–14. Villena MA, Iranzo JFÚ, Gundllapalli SB, Otero RRC, Pérez AIBJE, Technology M. Characterization of an exocellular β-glucosidase from Debaryomyces pseudopolymorphus. 2006, 39(2):229–34. de Araujo Ribeiro GC, de Assis SAJPB. Biotechnology: β-glucosidases from Saccharomyces cerevisiae: production, protein precipitation, characterization, and application in the enzymatic hydrolysis of delignified sugarcane bagasse. 2024:1–11. Bowers EM, Ragland LO, Byers LDJBBA-P, Proteomics. Salt effects on β-glucosidase: pH-profile narrowing. 2007, 1774(12):1500–7. Sestelo A, Poza M. Villa TJWJoM, Biotechnology: β-Glucosidase activity in a Lactobacillus plantarum wine strain. 2004, 20:633–7. Grimaldi A, Bartowsky E, Jiranek VJJAM. Screening of Lactobacillus spp. and Pediococcus spp. for glycosidase activities that are important in oenology. 2005, 99(5):1061–9. Osman AG, Avula B, Katragunta K, Ali Z, Chittiboyina AG, Khan IAJM. Elderberry Extracts: Characterization of the Polyphenolic Chemical Composition, Quality Consistency, Safety, Adulteration, and Attenuation of Oxidative Stress-and Inflammation-Induced Health Disorders. 2023, 28(7):3148. Jin P, Ren B, Wang XC, Jin X, Shi XJWR. Mechanism of microbial metabolic responses and ecological system conversion under different nitrogen conditions in sewers. 2020, 186:116312. Spano G, Rinaldi A, Ugliano M, Moio L, Beneduce L, Massa SJJAM. A β-glucosidase gene isolated from wine Lactobacillus plantarum is regulated by abiotic stresses. 2005, 98(4):855–61. Damaso MCT, Andrade CM, Pereira NJBJM Jr. Production and properties of the cellulase-free xylanase from Thermomyces lanuginosus IOC-4145. 2002, 33:333–8. Fan X-H, Cheng Y-Y, Ye Z-L, Lin R-C, Qian Z-ZJACA. Multiple chromatographic fingerprinting and its application to the quality control of herbal medicines. 2006, 555(2):217–24. Tang Y-C, Liu Y-J, He G-R, Cao Y-W, Bi M-M, Song M, Yang P-P, Xu L-F, Ming JJA. Comprehensive analysis of secondary metabolites in the extracts from different lily bulbs and their antioxidant ability. 2021, 10(10):1634. Aggarwal G, Sharma M, Singh R, Sharma UJSNPC. Plant-based natural product chemistry: An overview of the multistep journey involved in scientific validation of traditional knowledge. 2024, 80:327–77. Masike K, Stander MA, de Villiers AJJP, Analysis B. Recent applications of ion mobility spectrometry in natural product research. 2021, 195:113846. Saini N, Lather V, Gahlawat SKJA-CAMC. Exploring Phytochemicals from Himalayan Medicinal Plants as Novel Therapeutic Agents. 2022, 22(9):1674–98. Ramjane H, Bahorun T, Ramasawmy B, Ramful-Baboolall D, Boodia N, Aruoma OI, Neergheen VSJAJB, Sciences P. Exploration of the potential of terrestrial and marine biodiversity for the development of local nutraceutical products: a case for mauritius. 2021, 1. Bunse M, Daniels R, Gründemann C, Heilmann J, Kammerer DR, Keusgen M, Lindequist U, Melzig MF, Morlock GE. Schulz HJFiP: Essential oils as multicomponent mixtures and their potential for human health and well-being. 2022, 13:956541. Srinivasulu C, Ramgopal M, Ramanjaneyulu G, Anuradha C, Kumar CSJB. Pharmacotherapy: Syringic acid (SA)–a review of its occurrence, biosynthesis, pharmacological and industrial importance. 2018, 108:547–57. Pragasam SJ, Venkatesan V, Rasool MJI. Immunomodulatory and anti-inflammatory effect of p-coumaric acid, a common dietary polyphenol on experimental inflammation in rats. 2013, 36:169–76. Speisky H, Shahidi F, Costa de Camargo A, Fuentes JJA. Revisiting the oxidation of flavonoids: Loss, conservation or enhancement of their antioxidant properties. 2022, 11(1):133. Howlader P, Ghosh AK, Islam SS, Bir J, Banu GRJAI. Antiviral activity of Cynodon dactylon on white spot syndrome virus (WSSV)-infected shrimp: an attempt to mitigate risk in shrimp farming. 2020, 28:1725–38. Dahiya D, Nigam PSJM. The gut microbiota influenced by the intake of probiotics and functional foods with prebiotics can sustain wellness and alleviate certain ailments like gut-inflammation and colon-cancer. 2022, 10(3):665. Gomes S, Teixeira-Guedes C, Silva E, Baltazar F, Preto AJF. Function: Colon microbiota modulation by dairy-derived diet: New strategy for prevention and treatment of colorectal cancer. 2022, 13(18):9183–94. Vidoni C, Ferraresi A, Secomandi E, Vallino L, Dhanasekaran DN, Isidoro C. Epigenetic targeting of autophagy for cancer prevention and treatment by natural compounds. In: Seminars in cancer biology: 2020 . Elsevier: 34–44. Choi S, Kim Y, Han K, You S, Oh S, Kim SJLAM. Effects of Lactobacillus strains on cancer cell proliferation and oxidative stress in vitro. 2006, 42(5):452–8. Mingyi Y, Belwal T, Devkota HP, Li L, Luo ZJTiFS. Technology: Trends of utilizing mushroom polysaccharides (MPs) as potent nutraceutical components in food and medicine: A comprehensive review. 2019, 92:94–110. Ouyang Y, Qiu Y, Liu Y, Zhu R, Chen Y, El-Seedi HR, Chen X, Zhao CJFRI. Cancer-fighting potentials of algal polysaccharides as nutraceuticals. 2021, 147:110522. Maleki-Kakelar H, Dehghani J, Barzegari A, Barar J, Shirmohamadi M, Sadeghi J, Omidi YJBB. Lactobacillus plantarum induces apoptosis in gastric cancer cells via modulation of signaling pathways in Helicobacter pylori. 2020, 10(2):65. Amdekar S, Roy P, Singh V, Kumar A, Singh R, Sharma, PJIjoi. Anti-inflammatory activity of lactobacillus on carrageenan-induced paw edema in male wistar rats. 2012, 2012. Ganji-Arjenaki M, Rafieian‐Kopaei MJJ. Probiotics are a good choice in remission of inflammatory bowel diseases: A meta analysis and systematic review. 2018, 233(3):2091–103. Tarannum N, Hossain TJ, Ali F, Das T, Dhar K, Nafiz IHJL. Antioxidant, antimicrobial and emulsification properties of exopolysaccharides from lactic acid bacteria of bovine milk: Insights from biochemical and genomic analysis. 2023, 186:115263. Abdrabo MA-RA, Hassan SWM, Ibrahim HA, Abdul-Raouf UMJJ. Optimization of exopolysaccharides production from marine Pseudomonas mendocina AB1 with emphasis on different valuable applications. 2019, 7:7–20. Borchers A, Selmi C, Meyers F, Keen C, Gershwin M. Probiotics and immunity. J Gastroenterol. 2009. Hofeld BC, Puppala VK, Tyagi S, Ahn KW, Anger A, Jia S, Salzman NH, Hessner MJ, Widlansky MEJSR. Lactobacillus plantarum 299v probiotic supplementation in men with stable coronary artery disease suppresses systemic inflammation. 2021, 11(1):3972. Munteanu IG, Apetrei CJIJMS. Analytical methods used in determining antioxidant activity: A review. 2021, 22(7):3380. Li ShengYu LS, Zhao YuJuan ZY, Zhang Li ZL, Zhang Xue ZX, Huang Li HL, Li Da LD. Niu ChunHua NC, Yang ZhenNai YZ, Wang Qiang WQ: Antioxidant activity of Lactobacillus plantarum strains isolated from traditional Chinese fermented foods. 2012. Benattouche Z, Bouhadi D, Raho, GBJIjofs. Antioxidant and antibacterial activities of exopolysaccharides produced by lactic acid bacteria isolated from yogurt. 2018, 7(2). Rolfe RDJTJon. The role of probiotic cultures in the control of gastrointestinal health. 2000, 130(2):S396–402. Chen F, Chen J, Chen Q, Yang L, Yin J, Li Y, Huang XJA. Lactobacillus delbrueckii protected intestinal integrity, alleviated intestinal oxidative damage, and activated toll-like receptor–Bruton’s tyrosine kinase–nuclear factor erythroid 2-related factor 2 pathway in weaned piglets challenged with lipopolysaccharide. 2021, 10(3):468. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 29 Oct, 2024 Read the published version in BMC Microbiology → Version 1 posted Editorial decision: Revision requested 15 Jul, 2024 Reviews received at journal 23 Jun, 2024 Reviews received at journal 20 Jun, 2024 Reviews received at journal 15 Jun, 2024 Reviewers agreed at journal 15 Jun, 2024 Reviewers agreed at journal 15 Jun, 2024 Reviewers agreed at journal 15 Jun, 2024 Reviewers invited by journal 15 Jun, 2024 Editor invited by journal 22 May, 2024 Submission checks completed at journal 14 May, 2024 Editor assigned by journal 14 May, 2024 First submitted to journal 21 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4302290","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":305385427,"identity":"acf1f8bd-a266-471d-a5b2-1cb4e405702b","order_by":0,"name":"Mohamed Elhalik","email":"","orcid":"","institution":"Al–Azhar University","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"Elhalik","suffix":""},{"id":305385428,"identity":"656f5bc8-8b3c-4236-9c5c-d3bd9ff33d67","order_by":1,"name":"Alsayed E. Mekky","email":"","orcid":"","institution":"Al–Azhar University","correspondingAuthor":false,"prefix":"","firstName":"Alsayed","middleName":"E.","lastName":"Mekky","suffix":""},{"id":305385429,"identity":"866d8441-c2a7-41cc-a79f-61c482cc53d9","order_by":2,"name":"Mohamed Khedr","email":"","orcid":"","institution":"Al–Azhar University","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"Khedr","suffix":""},{"id":305385430,"identity":"ef5e2f09-f398-4b2f-95f7-f2e61518b475","order_by":3,"name":"Waleed B. Suleiman","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYDCCAwwMzAwMNgwMEmAuM9Fa0kjXcpgELXy3D7BJF/w5Ly8/u/nZB4YK68QG9vYLeLVInktgk57Zdtuwcc4x4xkMZ9ITG3jOFODVYnCGge02b8NtxmaJBGMGxrbDiQ0SOQmEtfD8OWffJpH+mYHxH1CL/BtitLAdSOyRyAHa0gCyhf0Afr+cYWD/PbMtOXmGRE4xQ8KxdOM2nhy8Ohj4zjAwGxf8sbOdPyN9M8OHGmvZfvbjD/DrYeD/gGCDPMHGwGNAQAsmYCdkyygYBaNgFIwwAAC1VESCtu4mvQAAAABJRU5ErkJggg==","orcid":"","institution":"Al–Azhar University","correspondingAuthor":true,"prefix":"","firstName":"Waleed","middleName":"B.","lastName":"Suleiman","suffix":""}],"badges":[],"createdAt":"2024-04-21 23:58:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4302290/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4302290/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12866-024-03576-y","type":"published","date":"2024-10-29T16:20:35+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":56987007,"identity":"e25e80a1-4e9c-4ad7-8efb-f35455dc9cff","added_by":"auto","created_at":"2024-05-23 05:19:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1467828,"visible":true,"origin":"","legend":"\u003cp\u003eThe morphological colonies of \u003cem\u003eLactobacillus\u003c/em\u003e sp. on MSR medium and its shape under light microscope. (X:1500).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/fbbf4e33530fdf2d46bac860.png"},{"id":56987987,"identity":"d9f27733-8459-404b-a181-54127c129ccc","added_by":"auto","created_at":"2024-05-23 05:35:25","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1018751,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of different (A) Temperatures, (B) Incubation periods, (C) PH, (D) PH (%), (E) Nitrogen sources, (F) Carbon sources, (G) NaCl, (H) NaCl (%),(I) Ethanol, (J) Ethanol (%),(K) Bile salt, (L), Bile salt (%) on the growth viability of \u003cem\u003eL. plantarum\u003c/em\u003e strain isolate.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/a8a861454cd1085eb94d8882.png"},{"id":56987641,"identity":"48a221fe-293c-43ac-8efd-9d3307bbaea3","added_by":"auto","created_at":"2024-05-23 05:27:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":132361,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of gene sequences of \u003cem\u003eL. plantarum\u003c/em\u003e isolate with the sequences retrieved from the NCB Gene Bank site.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/70952a73b0283a77ac4ebdaf.png"},{"id":56987003,"identity":"29ced72c-5b90-43dd-948e-6d86834bea6b","added_by":"auto","created_at":"2024-05-23 05:19:25","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":32823,"visible":true,"origin":"","legend":"\u003cp\u003eHPLC profile of bioactive compounds produced by\u003cstrong\u003e \u003c/strong\u003e\u003cem\u003eL. plantarum\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/bc34c23e00433d9f5f1841ee.png"},{"id":56987642,"identity":"4efc7d59-34ad-4c36-a091-3922b492b71f","added_by":"auto","created_at":"2024-05-23 05:27:25","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":281393,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological characteristics of cancer cells (HCT116) treated with \u003cem\u003eL. plantarum\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/c0d004a51f951082146bad99.png"},{"id":56987648,"identity":"c55e172d-0022-4c0a-ab6c-57336452f476","added_by":"auto","created_at":"2024-05-23 05:27:25","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":709131,"visible":true,"origin":"","legend":"\u003cp\u003eGel electrophoresis of nuclear DNA of untreated and treated cancer cell lines with \u003cem\u003eL. plantarum\u003c/em\u003e, where lanes 1, 2, 3 and 4 are for control cancer cells and lanes 5, 6, 7 and 8 are for treated cells.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/a32168c8778987ca365bf443.png"},{"id":56987005,"identity":"b31a3e17-6244-4c7f-b6f9-3b6fdeee85fa","added_by":"auto","created_at":"2024-05-23 05:19:25","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":49918,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eL. plantarum\u003c/em\u003e on HRBC hemolysis and membrane stabilization\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/c0b9dc62650427f1df3c6dbc.png"},{"id":56987644,"identity":"ef3d2842-c2e6-4dac-9c48-9aa45f6ccc67","added_by":"auto","created_at":"2024-05-23 05:27:25","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":70651,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eL. plantarum\u003c/em\u003e on hemolytic activity\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/ffc24ff352d1469a3c6acd84.png"},{"id":56987647,"identity":"2add45ac-ae24-47d9-b14b-4d3d5be1e808","added_by":"auto","created_at":"2024-05-23 05:27:25","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":55443,"visible":true,"origin":"","legend":"\u003cp\u003eAntioxidant activities of \u003cem\u003eL. plantarum\u003c/em\u003e using DPPH assay.\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/1f06bb2e3034850c4bcee8b0.png"},{"id":56987011,"identity":"1a89bb32-bef2-460d-801a-6d9610c7de37","added_by":"auto","created_at":"2024-05-23 05:19:25","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":691362,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA, B.\u003c/strong\u003e Folds of gene expression for four genes as anti-inflammatory markers TLR2 and CRP beside anti-oxidant markers SOD1 and SOD2 aginst control.\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/4940a1111e3034145509feb5.png"},{"id":56987013,"identity":"b18e4224-84e6-4aa9-9b3a-81735e15c17c","added_by":"auto","created_at":"2024-05-23 05:19:25","extension":"jpg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":514338,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree of four interest genes, A: CRP, B: TLR2, C: SOD1, and D: SOD2.\u003c/p\u003e","description":"","filename":"11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/ff94108a8c170dea3616c601.jpg"},{"id":68207366,"identity":"d2ce047c-ee90-485f-a2fd-6c6370795b3e","added_by":"auto","created_at":"2024-11-04 16:37:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7989296,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4302290/v1/8cb25e97-62b5-49ab-b47e-01782ba3f5af.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Antineoplastic with DNA fragmentation assay and anti-oxidant, anti- inflammatory with gene expression activity of Lactobacillus plantarum isolated From local Egyptian milk products","fulltext":[{"header":"Introduction","content":"\u003cp\u003eProbiotics, when incorporated into food, contribute to a balanced microbial environment in the gastrointestinal tract, thereby supporting overall health. Research indicates that probiotics offer several health benefits, including anti-allergic, anti-cancer properties, a reduction in cholesterol levels, enhancement of the immune response, and alleviation of symptoms associated with irritable bowel syndrome and gastrointestinal inflammation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The strains used in probiotics are often derived from the gastrointestinal tract (GIT) itself or other sources, such as feces and milk. Lactic acid bacteria (LAB) are predominantly utilized in creating probiotic formulations. LAB, a natural part of the GIT flora in animals, has been deemed safe by the Food and Drug Administration [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The description refers to a specific category of bacteria that are gram-positive and capable of living with or without oxygen (facultatively aerobic) while not undergoing sporulation. These organisms can appear in shapes that are either spherical (cocci) or cylindrical (rod-shaped) and are notably recognized for their production of lactic acid as a metabolic byproduct [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Lactic acid bacteria (LAB) play a role in triggering immune responses and reducing or inhibiting the growth of pathogens through various mechanisms. Notably, numerous studies have identified their ability to inhibit α-glucosidase [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. LABs are also known for producing bacteriocins, protein substances capable of acting against pathogenic bacteria, and possessing unique systems for breaking down different digestive substances [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Hern\u0026aacute;ndez-Gonz\u0026aacute;lez et al. [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] explored the potential of LAB as immunomodulators, probiotics, and antimicrobials in veterinary applications. Additionally, research has consistently demonstrated that probiotics can act as antimicrobial agents, providing a viable alternative to traditional antibiotics. This antimicrobial effect, antagonistic to both gram-negative and gram-positive pathogenic bacteria such as \u003cem\u003eE. coli, P. aeruginosa\u003c/em\u003e, and \u003cem\u003eS. aureus\u003c/em\u003e, contributes to the fight against antibiotic resistance [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Exopolysaccharides produced by \u003cem\u003eLactobacillus\u003c/em\u003e strains are recognized for their broad range of applications, particularly for their strong antioxidant and antibacterial capabilities. Specific strains, including \u003cem\u003eL. plantarum\u003c/em\u003e ZDY2013, \u003cem\u003eL. gasseri\u003c/em\u003e FR4, \u003cem\u003eL. delbrueckii\u003c/em\u003e sp., and \u003cem\u003eL. bulgaricus\u003c/em\u003e SRFM-1, have been identified to exhibit activities that neutralize free radicals [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Reactive oxygen species (ROS) play crucial roles in various cellular processes, such as apoptosis, signaling, gene expression, and the transportation of molecules. However, an overabundance of ROS can lead to a multitude of pathological conditions, including DNA damage, carcinogenesis, and cellular degeneration, potentially triggering diseases like cancer, inflammation, lung injury, and other disorders [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRecent research has increasingly demonstrated that certain strains of \u003cem\u003eL. plantarum\u003c/em\u003e, isolated from traditional fermented foods and known for producing exopolysaccharides [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], possess valuable properties, especially as antioxidants. This underscores the potential of EPS in the development of functional foods and its application across various industries. However, the investigation into the antioxidant activities of EPS produced by \u003cem\u003eL. plantarum\u003c/em\u003e has not been systematic or comprehensive, given the variety of free radical models and mechanisms yet to be fully explored \u003cem\u003ein vitro\u003c/em\u003e [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Consequently, advancing \u003cem\u003eL. plantarum\u003c/em\u003e as a natural antioxidant source requires extensive research focused on optimizing production yield and thoroughly understanding its physiochemical and bioactive properties [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLAB strains have shown remarkable properties, such as wound healing and anti-inflammatory properties [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The demethylation of the TLR2 gene promoter has been linked to increased expression of pro-inflammatory cytokines and angiogenic markers, which are critical in the early stages of inflammation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The initial discovery and documentation of TLR2, along with TLR1, TLR3, TLR4, and TLR5, occurred in 1998. Subsequent research over the years has highlighted TLR2's pivotal role in vertebrate immune responses [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Unique among the Toll-like receptors (TLRs), TLR2 is capable of forming functional heterodimers with various other TLRs. Moreover, TLR2 can engage with numerous non-TLR entities, facilitating the detection of a wide array of pathogen-associated molecular patterns (PAMPs) from all microbial domains, including fungi, viruses, parasites, and bacteria. The TLR2 gene is expressed not only by immune cells but also by endothelial and epithelial cells, underscoring its extensive involvement in immune responses [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In addition to its well-documented functions, inflammation is central to the pathogenesis of many diseases, with C-reactive protein (CRP) being a sensitive marker for inflammation. Recent findings suggest that CRP not only marks but also actively contributes to inflammatory and immune processes [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. This emerging understanding of CRP's role encompasses two immunological aspects: the initiation of the classical complement pathway via C1q binding, and the enhancement of immunity through the opsonization of biological particles and their interaction with Fcγ receptors on globulins [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe aim of the study is to investigate the biotherapeutic potential of the \u003cem\u003eLactobacillus plantarum\u003c/em\u003e strain as a sustainable alternative to antibiotics, and to explore its antioxidant and anti-inflammatory properties. Also, the study aims to assess the strain's capacity to produce beneficial metabolites (nutraceuticals), its ability to induce cancer cell death via necrotic nuclear DNA fragmentation, and its potential as a probiotic strain across various industries. Additionally, the research aims to contribute to the understanding of milk-associated lactic acid bacteria (LAB) as biotherapeutics, further encouraging innovation in the field.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCollection of Milk Samples\u003c/h2\u003e \u003cp\u003eIn the winter of 2022, eight different milk product samples were collected from the Egyptian market using sterile glass tubes. These samples were then transported to the laboratory in containers that maintained a controlled temperature and were stored at 4\u0026deg;C until they were ready for experimentation.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIsolation of\u003c/b\u003e \u003cb\u003eLactobacillus\u003c/b\u003e \u003cb\u003espp. from samples\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe milk samples were first diluted with saline, then pour-plated onto MRS agar, and incubated in an anaerobic environment at 37\u0026deg;C for a period ranging from 24 to 48 hours. Following incubation, colonies that appeared morphologically distinct and well-separated were chosen for further cultivation. These selected colonies were then subcultured onto new MRS agar plates using the streak plate method to obtain pure cultures [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe first identification of the\u003c/b\u003e \u003cb\u003eLactobacillus\u003c/b\u003e \u003cb\u003estrains\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe process of identifying the pure cultures involved utilizing Bergey's Manual of Determinative Bacteriology and software tools such as PIBWin and IDENTAX [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. An in-depth examination of the colonies' physical attributes was conducted, including observations of their shape, color, and texture.\u003c/p\u003e \u003cp\u003eSubsequently, the isolates underwent gram staining and were examined under a microscope to verify their purity. Isolates identified as gram-positive rods that were also catalase-negative underwent further characterization. This included tests for cytochrome oxidase activity, ability to grow at temperatures of 15\u0026deg;C and 45\u0026deg;C, and acid production from various carbohydrates like L-arabinose and D-fructose, among others, in designated media. The characterization process also encompassed evaluating acid and gas production from glucose, performing methyl red and Voges-Proskauer tests, assessing ammonia production from arginine, and testing for nitrate reduction. Finally, the pure isolates were evaluated by incubating them in MRS broth enriched with NaCl of 2% to select the best organisms that recorded high absorbance.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMolecular identification of the most potent\u003c/b\u003e \u003cb\u003eLactobacillus strain\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eamplification and sequencing of 16S rRNA\u003c/h2\u003e \u003cp\u003eThe genomic DNA from LAB isolates was isolated using the QIAamp DNA Mini Kit (Qiagen SA, Courtaboeuf, France). The concentration and purity of the DNA were assessed using a NanoDrop spectrophotometer, followed by PCR amplification with two universal bacterial primers for the 16S rRNA gene: 27F (5\u0026prime;-AGAGTTTGATCCTGGCTCAG-3\u0026prime;) and 1492R (5\u0026prime;-TACGGYTACCTTGTTACGACTT-3\u0026prime;) [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The PCR products were then purified with the QIAquick PCR Purification Kit (Qiagen SA, Courtaboeuf, France) and sequenced on an ABI 3500 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA).\u003c/p\u003e \u003cp\u003eThe 16S rRNA gene sequences were analyzed using Geneious Bioinformatics software (Version 11, available at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.geneious.com\u003c/span\u003e\u003cspan address=\"http://www.geneious.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e ) and were further compared using the Basic Local Alignment Search Tool at the National Center for Biological Information (NCBI), where they were submitted to obtain accession numbers [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Phylogenetic tree construction was carried out following protocols described in previous studies, using the Tamura genetic distance model, the neighbor-joining method for tree construction, and validating the tree with one thousand bootstrap resamples. The phylogenetic tree was visualized with the aid of GeneDoc and Geneious software tools.\u003c/p\u003e \u003cp\u003e \u003cb\u003eStudy of the optimization parameters for increasing the growth yield of\u003c/b\u003e \u003cb\u003eLactobacillus plantarum\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eEffects of different incubation periods and incubation conditions\u003c/h2\u003e \u003cp\u003eThe aim of this experiment was to determine the best incubation time for cultivating a highly effective bacterial strain on MRS medium, which is tailored for lactic acid bacteria. The study involved incubating this strain for periods of 0, 10, 20, 30, 40, and 50 hours, under both static conditions and with agitation at 150 rpm. Following each incubation interval, the optical density of the culture was assessed using a 721 spectrophotometer (M-ETCAL) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eEffects of different temperatures\u003c/h2\u003e \u003cp\u003eA pure culture of \u003cem\u003eLactobacillus\u003c/em\u003e isolate was suspended in MRS broth and incubated at temperatures of 20, 25, 30, 35, 40, 45 and 50\u0026deg;C for 48 hours. Growth, indicated by turbidity, was evaluated after 48 hours for the higher temperatures. This approach enabled the assessment of the bacterial isolates' growth capabilities across a wide range of temperatures [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eEffects of different pH values\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe optimal components of MRS media were adjusted to a range of pH levels (2, 3, 4, 5, 6, 7, 8, and 9) using a buffer solution to mitigate pH changes caused by metabolic processes. The optical density of the culture was measured at the conclusion of their respective incubation periods [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eEffects of different nitrogen sources\u003c/h2\u003e \u003cp\u003eThe effect of different organic and inorganic nitrogen sources, as well as amino acids such as ammonium nitrate, ammonium sulfate, urea, peptone, tryptophan, and yeast extract, on growth was evaluated with an equivalent nitrogen level present in each medium used. All other optimal conditions were maintained as previously described [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eEffects of different carbon sources\u003c/h2\u003e \u003cp\u003eMRS media for lactic acid bacteria were each enriched with various carbon sources, each at a 0.5 percent concentration. These carbon sources included sucrose, glucose, maltose, starch, lactose, and bagasse. All the previously mentioned optimal conditions were applied in each instance. At the conclusion of every incubation period, the optical density was measured using a spectrophotometer (721 spectrophotometer, M-ETCAL) [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eNaCl tolerance test\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe tolerance to sodium chloride (NaCl) of the isolate was evaluated by incubating it in MRS broth enriched with varying concentrations of NaCl (2%, 3%, 4%, 5%, 6%, 7%, and 8%). After adding 10 ml of the overnight culture of the isolate to the broth, the samples were then incubated anaerobically at 37\u0026deg;C for a duration of 18 to 24 hours. The growth of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e was determined by measuring the absorbance at 600 nm using MRS broth without NaCl as the control [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eBile salt tolerance test\u003c/h2\u003e \u003cp\u003eThe evaluation of bile tolerance was conducted as described by Jomehzadeh et al. [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. \u003cem\u003eLactobacillus plantarum\u003c/em\u003e was initially grown overnight at 37\u0026deg;C in MRS broth. For the bile tolerance test, these cultures were then introduced into MRS broth tubes containing 0.3% (w/v) bile salts (Oxgall) at a 1% (v/v) concentration. The inoculated tubes were incubated at 37\u0026deg;C for time periods of 2, 4, 6, and 8 hours. Tubes that were not inoculated acted as controls for the experiment. Bacterial growth was measured using a spectrophotometer, recording the optical density (O.D.) at 660 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eEthanol tolerance test\u003c/h2\u003e \u003cp\u003eFor the ethanol tolerance assessment, the isolate was cultured in MRS broth containing different ethanol concentrations (2.5%, 5%, 10%, 15%, and 20%) [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The bacterial suspension was prepared in the same manner as described previously, with 100 \u0026micro;L transferred into 10 mL of various MRS broth. After incubation, 1 mL was taken from each incubated broth and diluted appropriately. Subsequently, the total viable cell counts were determined using the plate count method. Each experiment was performed in triplicate.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e \u003cb\u003eEstimation of active compounds produced by\u003c/b\u003e \u003cb\u003eL. plantarum\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eThe HPLC investigation was done using an Agilent 1260 series. The division was completed by utilizing Zorbax overshadowing. Furthermore, the mobile phase consisted of water (A) and 0.05% trifluoroacetic acid in acetonitrile (B), utilized alongside the C8 column (4.6 mm x 250 mm i.d., 5 \u0026micro;m) at a flow rate of 0.9 ml/min. The portable stage was modified continuously on a straight slope as follows: 0 min (82% A); 0\u0026ndash;1 min (82% A); 1\u0026ndash;11 min (75% A); 11\u0026ndash;18 min (60% A); 18\u0026ndash;22 min (82% A); 22\u0026ndash;24 min (82% A). The multi-frequency finder was observed at 280 nm. The infusion volume was 5 \u0026micro;l for every one of the example arrangements. The section temperature was kept at 40\u0026deg;C.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003e \u003cb\u003eIn vitro assessments of\u003c/b\u003e \u003cb\u003eL. plantarum\u003c/b\u003e\u003c/p\u003e\u003cp\u003e \u003cb\u003eAnti-neoplastic activity of\u003c/b\u003e \u003cb\u003eL. plantarum\u003c/b\u003e \u003cb\u003eusing the MTT assay\u003c/b\u003e\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eCell metabolic activity was evaluated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay from Sigma-Aldrich, following the protocol previously described [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The purpose of this assessment was to ascertain the effect of bacterial supernatants on the metabolic processes of HCT 116 cells, independent of cell proliferation. Initially, a consistent monolayer of HCT 116 cells was prepared as described earlier. These cells were then exposed to incremental concentrations of CFS, CFSp, and CFSpe for periods of 24 or 48 hours in an environment composed of 5% CO\u003csub\u003e2\u003c/sub\u003e and 95% air. Cells that were incubated in the standard complete medium (DMEM with 10% FBS) acted as reference controls.\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eThe optical density (OD) was recorded at 490 nm. The results were calculated using the equation: OD of treated cells at each time point / OD of reference control at T0 \u0026times; 100 [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of DNA fragmentation\u003c/h2\u003e \u003cp\u003eDNA fragmentation was assessed using the method described by Sugihara et al. [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Briefly, cells weighing 25 mg were homogenized and washed with a phosphate buffer solution (PBS) that included 10 mM EDTA. The cell lysis was carried out with 250 ml of lysis buffer (pH 8.0), comprising 10 mM Tris base, 1 mM EDTA, and 0.2% Triton X-100, followed by incubation at -20\u0026deg;C for 20 minutes. After incubation, the lysates were centrifuged at 10,000 rpm for 15 minutes at 4\u0026deg;C to separate the intact chromatin from the fragmented DNA (supernatant). The pellet was dissolved in 0.5 N perchloric acid, while 5.5 N perchloric acid was added to the supernatant to achieve a final concentration of about 6.0 N. The samples were then heated at 90\u0026deg;C for 20 minutes and centrifuged at 10,000 rpm for 10 minutes to remove residual proteins. To each sample, 160 ml of diphenylamine (DPA) solution [comprising 150 mg DPA in 10 ml glacial acetic acid, 150 ml sulfuric acid, and 50 ml acetaldehyde (16 mg/ml)] was added, followed by incubation at room temperature for 24 hours. The absorbance at 600 nm was measured using a UV double beam spectrophotometer (Shimadzu, Tokyo, Japan). The percentage of DNA fragmentation was calculated with the formula: %DNA fragmentation = (OD of supernatant / (OD of supernatant\u0026thinsp;+\u0026thinsp;OD of pellet)) x 100, where OD represents optical density [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eDNA assay through gel electrophoresis\u003c/h2\u003e \u003cp\u003eThe assessment of DNA fragmentation was carried out by analyzing the nuclear DNA laddering pattern, following the method outlined by Majtnerova et al. [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In detail, cells were first homogenized and incubated overnight at 37\u0026deg;C in phosphate-buffered saline (PBS). This step was followed by cell lysis in 0.5 mL of DNA extraction buffer, which contained 50 mM Tris-HCl, 10 mM EDTA, 0.5% Triton, and 100 mg/mL proteinase K at a pH of 8.0. Afterward, the lysate was treated with 100 mg/mL DNase-free RNase at 37\u0026deg;C for 2 hours. Subsequently, the mixture underwent three sequential extractions with an equal volume of chloroform and phenol (1:1 v/v), and then one more extraction with chloroform alone, with each extraction followed by centrifugation at 13,000 rpm for 5 minutes at 4\u0026deg;C. DNA was then precipitated by adding two volumes of ice-cold absolute ethanol and one-tenth volume of 3 M sodium acetate, pH 5.2, and the mixture was left to stand at -20\u0026deg;C for 1 hour before being centrifuged at 10,000 rpm for 10 minutes at 4\u0026deg;C. The DNA pellet was rinsed with 70% ethanol, allowed to air-dry, and then dissolved in 10 mM Tris-HCl and 1 mM EDTA, pH 8.0. The isolated DNA was then subjected to electrophoresis in a 1.5% agarose gel and stained with ethidium bromide, using Tris/acetate/EDTA (TAE) buffer (pH 8.5, 2 mM EDTA, and 40 mM Tris-acetate) for visualization [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eAnti-inflammatory activity\u003c/h2\u003e \u003cdiv id=\"Sec16\" class=\"Section3\"\u003e \u003ch2\u003ePreparation of erythrocyte suspension\u003c/h2\u003e \u003cp\u003eWorkers' fresh whole blood (3 ml) was drawn into heparinized tubes and subsequently centrifuged at 3000 rpm for 10 minutes to separate the components. The red blood cell (RBC) pellets obtained were resuspended in an equal volume of normal saline, matching that of the previously removed supernatant. This step was followed by the preparation of a 40% (v/v) suspension of the resuspended RBCs in an isotonic phosphate buffer solution (10 mM sodium phosphate buffer, pH 7.4), calculated according to the adjusted volume. The isotonic buffer solution was formulated by dissolving 0.2 g of NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 1.15 g of Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e, and 9 g of NaCl in 1 liter of distilled water. This buffered solution was used to facilitate the application of the reconstituted red blood cells (the resuspended supernatant).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e1. Hypotonicity induced hemolysis\u003c/h2\u003e \u003cp\u003eIn this study, extracts were dissolved in distilled water to create a hypotonic solution [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. For each concentration level (100, 200, 400, 600, 800, and 1000 g/ml), 5 ml of this solution containing the extracts was placed into pairs of centrifuge tubes. In a similar manner, varying concentrations of the extracts, from 100 to 1000 g/ml, were added to pairs of centrifuge tubes filled with 5 ml of an isotonic solution. As controls, tubes were prepared with 5 ml of a 200 g/ml indomethacin solution and 5 ml of distilled water, serving as the vehicle. To each tube, 0.1 ml of an erythrocyte suspension was added and then gently mixed. The tubes were incubated for an hour at room temperature (37\u0026deg;C) and subsequently centrifuged at 1300 g for 3 minutes. The optical density (OD) reflecting the concentration of hemoglobin in the supernatant was measured at 540 nm using a Spectronic (Milton Roy) spectrophotometer. Assuming distilled water causes 100 percent hemolysis, the percentage inhibition of hemolysis by the extracts was calculated using the formula: % Inhibition of hemolysis\u0026thinsp;=\u0026thinsp;1 - ((OD2 - OD1) / (OD3 - OD1)) * 100. Here, OD1 represents the absorbance of the test sample in isotonic solution, OD2 represents the absorbance in hypotonic solution, and OD3 represents the absorbance of the control sample in hypotonic solution.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2. Hemolytic assay\u003c/h2\u003e \u003cp\u003eThe hemolytic assay was conducted following the method described by Bulmus et al. (2003). Fresh human red blood cells were collected and washed three times with 150 mM NaCl (at 2500 rpm for 10 minutes). The plasma was discarded, and the cells were resuspended in phosphate-buffered saline (PBS, pH 7.4) to achieve a 2% RBC concentration. Serial two-fold dilutions of the extract (concentrations of 1000, 800, 600, 400, 200, 100, and 50 \u0026micro;g/ml) were mixed with a 2% RBC solution, and the total volume of the reaction mixture was adjusted to 1 ml with PBS. The reaction mixture was incubated in a water bath at 37\u0026deg;C for 1 hour. Following incubation, the mixture was centrifuged at 2500 rpm for 15 minutes. The optical density of the collected supernatant was measured at 541 nm, using PBS as the blank [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Deionized water served as a positive control. The experiment was performed in triplicate, and the results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;S.D. The percentage of hemolysis was calculated using the formula: percentage hemolysis = [(Absorbance of sample - Absorbance of blank) \u0026times; 100] / Absorbance of positive control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eAntioxidant activity\u003c/h2\u003e \u003cp\u003eThe antioxidant capacity of \u003cem\u003eL. plantarum\u003c/em\u003e was assessed using the DPPH (2,2-diphenylpicrylhydrazyl) free radical scavenging method [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Briefly, a solution of 0.1 mM DPPH in ethanol was prepared. To each 1 ml of this solution, 3 ml of the extracts at varying ethanol concentrations (from 3.9 to 1000 g/ml) were added. For this investigation, only ethanol-soluble extracts were utilized, and these were diluted to different concentrations. After thorough mixing, the solutions were allowed to stand at room temperature for 30 minutes. The absorbance was recorded at 517 nm using a UV-VIS Milton Roy spectrophotometer. Ascorbic acid served as the reference standard, and the procedure was repeated three times. The IC\u003csub\u003e50\u003c/sub\u003e value, indicative of the concentration needed to reduce 50% of the DPPH free radicals, was calculated from the log dose inhibition curve. A reduction in the absorbance of the reaction mixture correlates to an increase in free radical scavenging activity. The percentage of DPPH inhibition was calculated using the formula: inhibition (%) = [(Absorbance of control - Absorbance of sample) / Absorbance of control] \u0026times; 100.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eTotal RNA isolation and cDNA synthesis\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from 48-hour cultures of LAB strains grown in liquid MRS medium using the Trizol reagent (Gibco) according to the protocol provided by the manufacturer. The synthesis of the first-strand cDNA was performed using the Advantage RT-for PCR Kit (Clontech, Palo Alto, CA, USA). Reverse transcription polymerase chain reaction (rt-PCR) was executed in 50 \u0026micro;l reactions using specific primers detailed in \u003cb\u003eTable\u0026nbsp;1\u003c/b\u003e. Each PCR reaction mix included 75 ng of the generated cDNA, 200 mM dNTPs, 0.1 mM of each specific primer, 1.5 mM MgCl2, and 1 U of Taq DNA polymerase (Takara), with the final volume adjusted to 50 \u0026micro;l with sterile water. The PCR amplification followed these conditions: an initial denaturation step at 94\u0026deg;C for 4 minutes; 32 cycles of denaturation at 94\u0026deg;C for 30 seconds, annealing at 50\u0026deg;C for 50 seconds, extension at 71.5\u0026deg;C for 1 minute; and a final extension at 71.5\u0026deg;C for 5 minutes. The PCR products were then run on an agarose gel using TAE buffer (40 mM Tris-Acetate, pH 7.6, and 1 mM EDTA). After electrophoresis, the gels were stained with ethidium bromide (0.5 mg/ml) and the bands were visualized under UV light. The lengths of the amplicons were compared to a standard DNA marker (GeneRuler\u0026trade; 100 bp DNA Ladder, MBI Fermentas, Vilnius, Lithuania) to determine their sizes [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eTable\u0026nbsp;(1)\u003c/strong\u003e \u003cp\u003ePCR- specific primers which used to amplify four genes beside RecA as housekeeping gene\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5'-\u0026gt;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLength\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGC%\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eStrand\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eRef\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW primer- TLR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTCAGACTTGAGCACTATACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e57.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e45.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"19\" rowspan=\"20\"\u003e \u003cp\u003e\u003cb\u003eThis study\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW primer- TLR2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCTTGAACCAGGAAGACGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW primer 1- CRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGACCCGTGGGTACAGTATTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e52.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW primer 1- CRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAACGAGCTCCCAGACCAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW primer 2- CRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAGTTTTACAGTGGGTGGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e47.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW primer 2- CRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTGCTGGGCTTCCCATTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW primer 4- SOD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACTTGGGCAATGTGACTGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW primer 4- SOD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGGCGATCCCAATTACACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW primer 9- SOD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTGGCCTAGCGAGTTATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW primer 9- SOD1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATAGACACATCGGCCACACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW primer 3- SOD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTCCGAGTTTTCCAGGCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW primer 3- SOD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACCTGAAGTCAAGTGGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW primer 6- SOD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTTTTGGGGTATCTGGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e59.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW primer 6- SOD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCGTGCCTGGAAAACTCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60.6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW primer 7- SOD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGAGGAGAACTCGCTTCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW primer 7- SOD2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCCCAAAAGGCACAGACTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW 1-18S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCCTAATTGGTCCAGGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e44.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW 1-18S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACAACGGCGTTCTCTCCTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e44.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFW 2 -18S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACACAACGTCATTGCAAATGTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e44.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRW 2 -18S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCTGGACCAATTAGGGCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e44.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eReal time PCR amplification conditions\u003c/h2\u003e \u003cp\u003eUsing the primers shown in \u003cb\u003eTable\u0026nbsp;1\u003c/b\u003e, complementary DNA (cDNA) from six samples (three treated and three controls) was subjected to semiquantitative PCR. 2x Quantitech SYBR\u0026reg; Green RT Mix (Fermentase) containing approximately 12.5 l of the 25 l of the real-time PCR experiment consisted of 1 l of 50 ng cDNA, 1 l of 25 pm/l from each forward and reverse primer, and 9.25 l of RNase-free water. A centrifuge was used on the samples before they were loaded into the rotor wells. PCR program set for interest genes as starting denaturation for 2 minutes at 95\u0026deg;C, then cycles at 95\u0026deg;C/30 sec, annealing at 57.5\u0026deg;C/30 sec, extension step at 72\u0026deg;C/30 sec. On the other hand, PCR program for 18S, which standard housekeeping gene, was optimized and adjusted as follows: denaturation at 95\u0026deg;C/2 min, annealing at 44\u0026deg;C/25 sec, extension at 72\u0026deg;C/30 sec. The Rotor Quality 6000 gear from Qiagen in the USA was utilized to do the response. The PCR cycle at which the threshold cycle (CT) results are present [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eUsing the dd∆ct technique and Microsoft Excel, comparative quantification analysis was carried out.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results and discussion","content":"\u003cp\u003eProbiotics, recognized for their nutraceutical benefits, require verification of their safety for human health before they can be endorsed as beneficial gut bacteria. The market is replete with various probiotic strains, presenting an opportunity to utilize this readily available resource for isolating and crafting new, improved probiotic strains with significant medical benefits. This approach is a promising strategy for the development of superior probiotic strains [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. The genus \u003cem\u003eLactobacillus\u003c/em\u003e represents a broad and varied collection of gram-positive, non-sporulating, facultatively anaerobic bacteria. It includes species such as \u003cem\u003eLactobacillus plantarum\u003c/em\u003e, \u003cem\u003eLactobacillus fermentum\u003c/em\u003e, \u003cem\u003eLactobacillus paracasei, Lactobacillus acidophilus, Lactobacillus rhamnosus, Lactobacillus bulgaricus, Lactobacillus casei\u003c/em\u003e, and \u003cem\u003eLactobacillus reuteri\u003c/em\u003e, among others. This sort assumes an imperative part in food maturation and can likewise be viewed as in the gastrointestinal (G arrangement of people and creatures in factor sums [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Eight examples of milk were randomly collected from the markets in Egypt. The initial samples were anaerobically plated onto MRS agar after being serially diluted. A total of 16 lactic acid bacteria isolates were retrieved from the previously mentioned samples and subjected to rapid preliminary identification. The total discoveries of morphological and biochemical tests. The best organism has been selected based on its ability to grow at a 2% salt concentration and yield the highest absorbance. The morphological and biochemical tests of the best organism are introduced in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Staining revealed the gram-positive nature of the isolate, which had a purple or violet color. The isolate was rod-shaped and had long, rounded ends. They showed up generally as a chain of 3\u0026ndash;4 cells, either single or two by two (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The hanging drop strategy showed that the microscopic organisms were non-motile, which is one of the interesting attributes of \u003cem\u003eLactobacilli\u003c/em\u003e. This may be because of the shortfall of extraordinary propeller-like flagella in \u003cem\u003eLactobacilli\u003c/em\u003e answerable for motility. Similar findings were made by Forouhandeh [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] in the isolation of \u003cem\u003eLactobacillus\u003c/em\u003e species from various dairy products. The absence of air bubbles indicated that the isolated microbes were catalase-negative, thereby incapable of breaking down hydrogen peroxide to release oxygen. It is well established that \u003cem\u003eLactobacillus\u003c/em\u003e species do not produce catalase. Comparable findings were documented by Mithun et al. [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe preliminary optimization, including pH, temperature, incubation period, carbon, nitrogen sources, NaCl, ethanol, and bile salt, was used in this study. The \u003cem\u003eL. plantarum\u003c/em\u003e strain was incubated at varying temperatures, from 20 \u0026ordm;C to 45 \u0026ordm;C. The findings indicated that the optimal growth temperature for the \u003cem\u003eL. plantarum\u003c/em\u003e isolate was 30\u0026deg;C, with an enzyme activity level of 1.879\u0026thinsp;\u0026plusmn;\u0026thinsp;0.130. Conversely, the lowest enzyme activity, 0.513\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01, was observed at a lower temperature of 20 \u003csup\u003eo\u003c/sup\u003eC, with enzyme activity diminishing sharply as temperatures approached this lower limit. Consequently, the study identified that enzyme activity decreased at temperatures below 30\u0026deg;C, while increasing up to 35 \u003csup\u003eo\u003c/sup\u003eC, establishing 30 \u003csup\u003eo\u003c/sup\u003eC as the ideal temperature for cultivating the \u003cem\u003eL. plantarum\u003c/em\u003e strain (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003e(A)\u003c/b\u003e). The best incubation duration for producing the \u003cem\u003eL. plantarum\u003c/em\u003e strain was detected at 24 hours, with the most conducive conditions for its growth under static conditions being 1.796\u0026thinsp;\u0026plusmn;\u0026thinsp;0.012 \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003e(B))\u003c/b\u003e. The study also explored the effect of pH levels on the production of the \u003cem\u003eL. plantarum\u003c/em\u003e strain, revealing that the most favorable pH for its production was 6, with an optimal yield of 2.123\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27 (80%) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003e(C\u0026amp;D)\u003c/b\u003e. Furthermore, the research investigated the impact of different carbon and nitrogen sources on the strain's production. It was found that glucose combined with yeast extract resulted in the highest production levels, with values of 2.971\u0026thinsp;\u0026plusmn;\u0026thinsp;0.020 and 2.414\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003e(E and F)\u003c/b\u003e). The optimal production of the \u003cem\u003eL. plantarum\u003c/em\u003e strain was achieved using lactose as the carbon source and ammonium nitrate as the nitrogen source. Additionally, the study assessed the tolerance of the \u003cem\u003eL. plantarum\u003c/em\u003e strain to NaCl, ethanol, and bile salts, recording values of 2.987\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 (93%) at 2% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003e(G\u0026amp;H)\u003c/b\u003e), 1.877\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 (70%) at 2.5% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003e(I\u0026amp;J)\u003c/b\u003e), and 2.325\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2 (75%) at 0.1% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u003cb\u003e(K\u0026amp;L)\u003c/b\u003e), respectively, demonstrating the strain's resilience to these conditions. Similarly, Coulon et al. [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] have reported that \u003cem\u003eLactobacillus casei\u003c/em\u003e ATCC393 found 35 \u003csup\u003eo\u003c/sup\u003eC to be the optimal temperature for the production of β-glucosidase among the various temperature ranges. Also, the ideal temperature for compound creation from yeast, such as \u003cem\u003eDebaryomyces pseudopolymorphus\u003c/em\u003e [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] and \u003cem\u003eSaccharomyces cescerevisiae\u003c/em\u003e [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], was 40\u0026deg;C, respectively. The ideal pH for \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e CRL 98 was 6.4, which was like the \u003cem\u003eL. plantarum\u003c/em\u003e strain, which expressed that various upsides of ideal pH were accounted for in various types of lactic corrosive microscopic organisms. \u003cem\u003eLactobacillus mesenteroides\u003c/em\u003e [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] and \u003cem\u003eLactobacillus plantarum\u003c/em\u003e [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] grow at an optimum pH of 5.0 and 5.4, respectively. The metabolism of carbon sources releases energy, which is utilized by the organism for its growth and development. The influence of different carbon sources on the production of \u003cem\u003eL. plantarum\u003c/em\u003e strains was investigated in this study. It was discovered that lactose serves as an efficient carbon source for cultivating the \u003cem\u003eL. plantarum\u003c/em\u003e strain. Interestingly, the organism demonstrated significant growth on xylose, resulting in the highest protein activity in the culture broth compared to other carbon sources tested. This observation indicates that the \u003cem\u003eLactobacillus plantarum\u003c/em\u003e strain is capable of thriving or adapting to diverse environmental conditions. In certain examinations on glycosidase chemicals from different sources, Grimaldi et al. [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e] have announced that the presence of glucose or fructose diminishes the exercises. Also. when culture in a fluid medium contained corn grain, the greatest aggregate β-glucosidase creation was accounted for, cellulose and glucose prompted elevated degrees of β-glucosidase creation, \u003cem\u003ePediococci\u003c/em\u003e sp. creation of β-D-glucopyranosidase movement was unequivocally worked on by both glucose and fructose, and furthermore, it was presented as an expected supportive source from which higher compounds could be cleansed [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. \u003cem\u003eL. plantarum\u003c/em\u003e strain was developed on carbon wellsprings of focus 1% m/v.\u003c/p\u003e \u003cp\u003eIn many microorganisms, both organic and inorganic nitrogen forms are metabolized to produce amino acids, nucleic acids, proteins, and components of the cell wall [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. It was found that the use of ammonium nitrate resulted in the highest production levels of the \u003cem\u003eLactobacillus plantarum\u003c/em\u003e strain among various organic and inorganic nitrogen sources tested, with urea-containing medium showing the lowest activity. Regarding the impact of different ethanol concentrations on the optical density and viability of the \u003cem\u003eL. plantarum\u003c/em\u003e strain, it was observed that a 2.5% (v/v) ethanol concentration yielded the highest activity compared to other tested concentrations. Furthermore, Spano et al. [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] reported that the β-glucosidase gene from \u003cem\u003eLactobacillus plantarum\u003c/em\u003e was inhibited by 12% (v/v) ethanol [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Notably, ethanol was found to activate the enzyme in wine at concentrations above 15% (v/v). In contrast, Grimaldi et al. [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e] noted that the stimulatory effect of 4% v/v ethanol is more pronounced at lower concentrations, aligning with previous findings for \u003cem\u003eOenococcus oeni\u003c/em\u003e and other yeast biomasses. The study led with various groupings of NaCl for the creation of \u003cem\u003eL. plantarum\u003c/em\u003e showed the greatest worth at convergence of 2% NaCl. It has been demonstrated that sodium ions in the surrounding environment are necessary for efficient membrane transport. The utilization of NaCl in a concentrate by Damaso et al. [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] demonstrated that it is necessary for the synthesis of another enzyme, xylanase.\u003c/p\u003e \u003cp\u003e \u003cem\u003eLactobacilli\u003c/em\u003e was identified genetically through PCR amplification and sequencing of 16S rDNA using two bacterial universal primers, as mentioned. The PCR amplicon was purified from gel, then sequenced and aligned through NCBI BLASTn for firmly related sequences on the NCBI gene bank database; this indicates that it belonged to \u003cem\u003eLactobacillus plantrum\u003c/em\u003e, and its phylogenetic tree was designed through MEGA 11 with the most related sequences as described in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. This technique was used by Khedr et al. [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] to identify \u003cem\u003eLactobacillus delbrueckii\u003c/em\u003e. Simmalry, Abdel Ghany et al. [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] used this technique to identify \u003cem\u003eLactobacillus acidophilus\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe morphological and biochemical characterization of the best organism.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCharacteristics\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eResults\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003eMorphological tests\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGram staining\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+ve\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eShape\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRod\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eColony morphology\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCircular, white, glistering, convex.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMotility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNon motile\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBiochemical tests\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCatalase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCitrate test\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNH3 from arginine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e4\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHydrogen sulphide production\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e5\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIndole production\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e6\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMethyl red reaction\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e7\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eOxidase test\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eUrease test\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e9\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVoges Proskauer Reaction\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGlucose utlization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e11\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGlucose (Gas) (Co\u003csub\u003e2\u003c/sub\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e12\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSucrose utlization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e13\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLactose utlization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMaltose utlization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e15\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMannitol utlization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eArabinose utlization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e17\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSalicin utlization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e+, positive result; -, negative result.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003efrom the NCB Gene Bank site.\u003c/p\u003e \u003cp\u003eHigh-Performance Liquid Chromatography (HPLC) is a critical and versatile analytical method extensively employed across various fields. It is utilized for both the separation and quantification of organic and inorganic substances in a wide array of samples, including those from industrial, pharmaceutical, food, and environmental sources. Moreover, it is increasingly applied to biological samples and the extraction of natural products. Through HPLC, compounds are differentiated based on their interactions with the mobile phase solvent and the solid material within a tightly packed column, under high pressure. This technique is gaining recognition as a preferred method for fingerprinting analysis, crucial for the quality assurance of herbal products [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Various researchers and scholars have highlighted the application of HPLC in the characterization and quantification of secondary metabolites in plant extracts, specifically targeting phenolic compounds, steroids, flavonoids, and alkaloids [\u003cspan additionalcitationids=\"CR59\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFlavonoids constitute a vast group of polyphenolic compounds, all structurally derived from the base molecule flavone and produced by plants. These substances, found in fruits and vegetables, are recognized for their broad and significant health benefits, which include radical scavenging and metal chelating activities. The antioxidant properties of flavonoids in vitro stem from their ability to mitigate free radical formation, leading to various biological effects. Numerous studies have highlighted that flavonoids such as rutin, kaempferol, quercetin and apigenin, among others, are renowned for their anti-inflammatory, anti-allergic, antithrombotic, hepatoprotective, antispasmodic, and anticancer properties [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. The biological activities, such as their antimutagenicity, antibacterial, antiviral, anti-inflammatory, and apoptotic properties, among others, must be justified by distinguishing and quantitating such mixtures [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. Syringic acid is accepted to have various advantageous natural exercises, including the insurance of the mind, heart, and liver, as well as anticancer, antimicrobial, against aggravation, antidiabetic, hostile to nitrosative, and cell reinforcement properties [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. Coumaric acid demonstrates a wide range of bioactive properties, including antioxidant, anti-inflammatory, anti-mutagenic, anti-ulcer, antiplatelet, and anti-cancer activities. Besides, it plays a role in mitigating atherosclerosis, oxidative damage to the heart, damage to ocular tissues caused by UV light, neuronal injury, anxiety, gout, and diabetes [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. According to the current study, CA may alleviate diabetes by increasing its immunomodulatory effect and defending against oxidative stress and inflammation. Quercetin has drawn expanding consideration because of its cancer prevention agent, antibacterial, and anti-inflammatory effects [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe results from the study on \u003cem\u003eL. plantarum\u003c/em\u003e indicate that the strain tested is capable of producing secondary metabolites with promising antimicrobial, antioxidant, and anti-inflammatory properties (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e3\u003c/span\u003e \u003cb\u003eand\u003c/b\u003e Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). However, to validate \u003cem\u003eL. plantarum's\u003c/em\u003e potential as a biomedical agent, \u003cem\u003ein vivo\u003c/em\u003e studies will be necessary.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBioactive compounds isolated from \u003cem\u003eL. plantarum\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePeak No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRT\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eType\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eArea %\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCompound name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMolecular weight (g/mol)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMolecular formula\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3.592\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e74.5124\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGallic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e170.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e7\u003c/sub\u003eH\u003csub\u003e6\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4.308\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10.7387\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eChlorogenic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e354.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e16\u003c/sub\u003eH\u003csub\u003e18\u003c/sub\u003eO\u003csub\u003e9\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4.494\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCatechin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e290.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e15\u003c/sub\u003eH\u003csub\u003e14\u003c/sub\u003eO\u003csub\u003e6\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5.622\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.2960\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMethyl gallate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e184.147\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e8\u003c/sub\u003eH\u003csub\u003e8\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e5.904\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.0099\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCoffeic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e180.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e9\u003c/sub\u003eH\u003csub\u003e8\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6.161\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.1779\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eSyringic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e198.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e9\u003c/sub\u003eH\u003csub\u003e10\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6.649\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePyro catechol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e110.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e6\u003c/sub\u003eH\u003csub\u003e6\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6.925\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRutin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e610.517\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e27\u003c/sub\u003eH\u003csub\u003e30\u003c/sub\u003eO\u003csub\u003e16\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7.411\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.4946\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEllagic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e302.197\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e14\u003c/sub\u003eH\u003csub\u003e6\u003c/sub\u003eO\u003csub\u003e8\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8.702\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCoumaric acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003e164.16\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eC9H8O3\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9.123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eVanillin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e152.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e8\u003c/sub\u003eH\u003csub\u003e8\u003c/sub\u003eO\u003csub\u003e3\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e9.756\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFerulic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e194.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e10\u003c/sub\u003eH\u003csub\u003e10\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10.263\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.4176\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNaringenin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e272.257\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e15\u003c/sub\u003eH\u003csub\u003e12\u003c/sub\u003eO\u003csub\u003e5\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e11.846\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRosmarinic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e360.318\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e18\u003c/sub\u003eH\u003csub\u003e16\u003c/sub\u003eO\u003csub\u003e8\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e16.021\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDaidzein\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e254.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e15\u003c/sub\u003eH\u003csub\u003e10\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17.331\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eQuerectin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e302.236\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e15\u003c/sub\u003eH\u003csub\u003e10\u003c/sub\u003eO\u003csub\u003e7\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e19.263\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCinnamic acid\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e148.1586\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e9\u003c/sub\u003eH\u003csub\u003e8\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e20.610\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eKaempferol\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e286.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e15\u003c/sub\u003eH\u003csub\u003e10\u003c/sub\u003eO\u003csub\u003e6\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e21.205\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eHesperetin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e302.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eC\u003csub\u003e16\u003c/sub\u003eH\u003csub\u003e14\u003c/sub\u003eO\u003csub\u003e6\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAnti-Neoplastic activity of\u003c/b\u003e \u003cb\u003eLactobacillus plantarum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e illustrates changes in cell morphology and shape within a monolayer culture as an initial and distinct effect observed following exposure to \u003cem\u003eL. plantarum\u003c/em\u003e, captured using an inverted light microscope. The inhibitory effect of \u003cem\u003eL. plantarum\u003c/em\u003e on human colon cancer cells (HCT116), along with the degree of cell suppression, was confirmed using the MTT assay at different concentrations ranging from 1000 to 31.25 \u0026micro;g/mL. Significantly, the IC50 value, indicating the concentration needed to inhibit 50% of the cancer cells (HCT116), was found to be 100.11 \u0026micro;g/mL. \u003cem\u003eLactobacillus\u003c/em\u003e strains are commonly recognized for their health-promoting roles as microbial food supplements, with benefits such as enhancing gut health, boosting the immune system, and lowering the risk of certain cancers [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. Regular consumption of yogurt and other probiotic dairy products has been suggested to inhibit the growth of colon cancer cells [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. The surface components of \u003cem\u003eLactobacillus\u003c/em\u003e strains have shown anticancer activities. This study explores the anti-cancer capabilities of \u003cem\u003eL. plantarum\u003c/em\u003e. Previous research has indicated the role of autophagy in cancer prevention and treatment. This investigation found distinctive morphological and biochemical markers of autophagy, such as autophagic vacuoles and acidic vesicular organelles, in HCT116 colon cancer cells treated with \u003cem\u003eL. plantarum\u003c/em\u003e, suggesting that \u003cem\u003eL. plantarum\u003c/em\u003e triggers autophagic cell death in HCT116 colon cancer cells [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDNA fragmentation ability of\u003c/b\u003e \u003cb\u003elactobacillus plantrum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOur research demonstrates that \u003cem\u003eL. plantarum\u003c/em\u003e significantly contributes to triggering cell death in cancer cells via DNA fragmentation, indicative of necrosis. This observation is supported by gel electrophoresis findings, which displayed DNA fragmentation in cells treated with \u003cem\u003eL. plantarum\u003c/em\u003e, in stark contrast to the intact DNA in untreated (control) cancer cells, as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. This finding differs from the behavior of nuclear DNA in cancer cells. Moreover, Choi et al. [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e] discovered that soluble polysaccharides from the cell wall of \u003cem\u003eL. acidophilus\u003c/em\u003e 606 inflicted damage on HT-29 cancer cells, a phenomenon largely attributed to the initiation of apoptosis rather than necrosis, as evidenced by nuclear DNA fragmentation and the lack of PI staining. This marks a pioneering instance of cancer cell apoptosis triggered by \u003cem\u003eLactobacilli\u003c/em\u003e-derived polysaccharides.\u003c/p\u003e \u003cp\u003eAdditionally, proteomic analysis revealed that polysaccharides from \u003cem\u003eL. acidophilus\u003c/em\u003e 606 significantly affected the expression of proteins such as the Bcl-2-interacting mediator and cell division cycle proteins. These findings underline the potent antioxidative and anticancer properties of soluble polysaccharides from \u003cem\u003eL. acidophilus\u003c/em\u003e 606 against various cancer cell lines. The potential of these polysaccharide components to be integrated into foods or used as supplements in cancer therapy is significant [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e, \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]. Furthermore, \u003cem\u003eL. plantarum\u003c/em\u003e is shown to modulate the expression of crucial genes like AKT, PTEN, BAX, and TLR4, which are involved in apoptosis and anti-apoptosis mechanisms in the AGS gastric cancer cell line [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAnti-inflammatory activity of\u003c/b\u003e \u003cb\u003eLactobacillus plantarum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe evaluation of \u003cem\u003eL. plantarum's\u003c/em\u003e anti-inflammatory effects was conducted through its capacity to suppress hypotonicity-induced hemolysis and perform hemolytic assays in vitro. The results showed that \u003cem\u003eL. plantarum\u003c/em\u003e significantly reduced hemolysis by 97.7% at a concentration of 1000 \u0026micro;g/mL, nearly matching the 99.5% effectiveness of indomethacin, a widely recognized anti-inflammatory medication, at the same concentration (Fig.\u0026nbsp;7). On the contrary, the hemolytic activity of \u003cem\u003eL. plantarum\u003c/em\u003e peaked at 14.3% at a concentration of 100 \u0026micro;g/mL and then diminished to 1.4% at 1000 \u0026micro;g/mL (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e8\u003c/span\u003e). These findings underscore the potential of \u003cem\u003eL. plantarum\u003c/em\u003e as an effective anti-inflammatory agent [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Similarly, \u003cem\u003eL. casei\u003c/em\u003e and \u003cem\u003eL. acidophilus\u003c/em\u003e have been observed to significantly alleviate paw swelling in rats, indicating their anti-inflammatory properties. Research conducted by Ganji-Arjenaki and Rafieian-Kopaei [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e] has shown the efficacy of various \u003cem\u003eLactobacillus\u003c/em\u003e strains in the treatment of inflammatory bowel disease. In contrast, a study found that exopolysaccharides from \u003cem\u003eBacillus circulans\u003c/em\u003e exhibited a 92% anti-inflammatory effect, while EPS from \u003cem\u003ePseudomonas mendocina\u003c/em\u003e AB1 showed a lesser effect of 59.07% [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. These comparative insights call for further investigation to elucidate the mechanisms of EPS in protein protection and their application in developing new anti-inflammatory treatments [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003eFigure 7.\u003c/b\u003e Effect of \u003cem\u003eL. plantarum\u003c/em\u003e on HRBC hemolysis and membrane stabilization\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe \u003cem\u003eL. plantarum\u003c/em\u003e strain we studied exhibited notable anti-inflammatory properties by reducing the expression of two critical markers of inflammation in human cells: CRP and TLR2. Specifically, the expression levels of CRP and TLR2 decreased by one and eight times, respectively, in the cell line treated with our strain, which was fermented for 72 hours and then incubated for five hours at 37\u0026deg;C. These findings are consistent with in vitro research conducted by Borchers et al. [\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e], which indicates that \u003cem\u003eLactobacillus plantarum\u003c/em\u003e 299v may reduce inflammation in humans through the suppression of TLR activation. Additionally, the interaction observed between human peripheral blood mononuclear cells (PBMCs) and \u003cem\u003eL. plantarum\u003c/em\u003e species underscores \u003cem\u003eL. plantarum's\u003c/em\u003e potential to modulate PBMC responses [\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003eAntioxidant activity of\u003c/b\u003e \u003cb\u003eLactobacillus plantarum\u003c/b\u003e\u003c/p\u003e \u003cp\u003eLactic acid bacteria (LAB), including those with antioxidant enzymes, are vital for enzymatic defense against oxidative stress. The antioxidant potential of \u003cem\u003eL. plantarum\u003c/em\u003e was evaluated over a spectrum of concentrations from 1000 to 1.95 \u0026micro;g/mL, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e9\u003c/span\u003e. The results indicated that \u003cem\u003eL. plantarum\u003c/em\u003e exhibited notable antioxidant efficiency, with activities of 71.8% and 93.8% at concentrations ranging from 125 to 1000 \u0026micro;g/mL, respectively. However, at lower concentrations of 7.81, 3.9, and 1.95 \u0026micro;g/mL, the observed antioxidant activities were 45.1%, 34.2%, and 27.2%, respectively, when compared to ascorbic acid, the standard reference used. Moreover, \u003cem\u003eL. plantarum\u003c/em\u003e has demonstrated its capacity to counteract free radicals. Our study highlights that \u003cem\u003eL. plantarum\u003c/em\u003e strains AR113, AR269, AR300, AR501, and \u003cem\u003eP. pentosaceus\u003c/em\u003e AR243 showed considerable resilience against hydrogen peroxide [\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e]. In this context, \u003cem\u003eL. plantarum\u003c/em\u003e was recognized for its profound antioxidant activity. This is in line with the findings of Li et al. [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e], who found that \u003cem\u003eL. plantarum\u003c/em\u003e strains from traditional Chinese fermented foods possess antioxidant capabilities, with \u003cem\u003eL. plantarum\u003c/em\u003e C88 showcasing optimal hydroxyl radical and DPPH scavenging activities against hydrogen peroxide at a density of 1010 CFU/ml. The DPPH scavenging efficiency of our isolates surpassed those documented by Benattouche et al. [\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e], who reported antioxidant activities ranging from 16\u0026ndash;56% for exopolysaccharides derived from various yogurt LABs at a concentration of 1000 \u0026micro;g/mL.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGene expression was induced by\u003c/b\u003e \u003cb\u003eLactobacillus plantarum\u003c/b\u003e.\u003c/p\u003e \u003cp\u003eMoreover, \u003cem\u003eL. plantarum\u003c/em\u003e has been found to modulate the expression of the antioxidant markers SOD1 and SOD2, enhancing their levels by 65% and 74.2%, respectively. It also significantly boosts the gene expression of TLR2 by 133% compared to the control, while reducing CRP expression by 33.3%, as depicted in Figs.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e10\u003c/span\u003eA \u003cb\u003eand B\u003c/b\u003e. These results are in line with findings by Rolfe [\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e], who observed that LAB supplementation could mitigate oxidative stress in piglets. Many probiotics, particularly LAB, are increasingly recognized as alternatives to antibiotics and as therapeutic options for managing post-weaning syndrome. They achieve their beneficial effects through various actions, including immune system activation, pathogen invasion blockade, and antimicrobial substance production. Supplementation with LAB notably enhances (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) the expression of Btk, HO-1, Nrf2, TLR4, and TLR2 in the jejunum, in contrast to the LPS-only group. Protein expression of TLR4, Btk, and Nrf2 in the ileum of LPS-challenged piglets was also elevated (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) following LAB supplementation [\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e]. Additionally, LAB helps shield the intestine from oxidative damage in animals by activating antioxidant enzymes and preserving redox homeostasis [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFour interest gene sequences were aligned against the most related sequences in the NCBI database; based on their sequences, phylogenetic trees were constructed as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e11\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eA study in Egypt involving eight randomly selected milk product samples led to the identification of 16 potential lactic acid bacteria (LAB) isolates through anaerobic culturing on MRS agar. Among these, \u003cem\u003eLactobacillus plantarum\u003c/em\u003e (OQ547261.1) stood out for its significant antioxidant and anti-inflammatory properties. It showed high antioxidant activity, particularly at higher concentrations (71.8\u0026ndash;93.8% between 125 and 1000 \u0026micro;g/mL), and demonstrated a 97.7% inhibition of hypotonicity-induced hemolysis at 1000 \u0026micro;g/mL, comparable to the activity of standard drugs. HPLC analysis revealed phenolic acids and flavonoids in \u003cem\u003eL. plantarum\u003c/em\u003e, indicating its phytochemical richness. Moreover, RT-qPCR analysis showed \u003cem\u003eL. plantarum\u003c/em\u003e significantly increased expression of inflammation and oxidation markers while reducing CRP expression, further confirming its anti-inflammatory and antioxidant capabilities. The real-time quantitative reverse transcription polymerase chain reaction (RT-qPCR) analysis showed that L. plantarum significantly increased the expression of TLR2 (an inflammatory marker) by 133%, and the cellular oxidation markers SOD1 and SOD2 by 65% and 74.2%, respectively, while it decreased CRP expression by 33.3%. Interestingly, \u003cem\u003eL. plantarum\u003c/em\u003e also induced necrotic cancer cell death, highlighting its potential in nutraceuticals and as a valuable probiotic strain, suggesting a need for further research to explore its broad applications.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003eConflict of interest the authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eMohamed A. Elhalik: methodology and resources. Waleed B. Suleiman, conceptualization, methodology, and resources. Mohamed Khedr: methodology, Genetics identifications and software, and Alsayed E. Mekky: conceptualization, writing review, methodology, resources, investigation, writing original draft, GC-MAS ant total phenolic acids and submitting the paper to the journal. The author (s) read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eData availability:\u003c/h2\u003e \u003cp\u003eAll data included in this study were presented in the form of tables and figures.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSharifi-Rad J, Rodrigues CF, Stojanović-Radić Z, Dimitrijević M, Aleksić A, Neffe-Skocińska K, Zielińska D, Kołożyn-Krajewska D, Salehi B. Milton Prabu SJM: Probiotics: versatile bioactive components in promoting human health. 2020, 56(9):433.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng X, Ed-Dra A, Yue MJCRFS. Nutrition: Whole genome sequencing for the risk assessment of probiotic lactic acid bacteria. 2023, 63(32):11244\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarnes L-M, Hanlon GWJAPE-BTD. Medicines Mo: Fundamentals of microbiology. 2021:184.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRen C, Faas MM, de Vos PJCRiFS. Nutrition: Disease managing capacities and mechanisms of host effects of lactic acid bacteria. 2020, 61(8):1365\u0026ndash;1393.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaha UB. Saroj SDJERoA-iT: Lactic acid bacteria: Prominent player in the fight against human pathogens. 2022, 20(11):1435\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerma DK, Thakur M, Singh S, Tripathy S, Gupta AK, Baranwal D, Patel AR, Shah N, Utama GL, Niamah AKJFB. Bacteriocins as antimicrobial and preservative agents in food: Biosynthesis, separation and application. 2022, 46:101594.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHern\u0026aacute;ndez-Gonz\u0026aacute;lez JC, Mart\u0026iacute;nez-Tapia A, Lazcano-Hern\u0026aacute;ndez G, Garc\u0026iacute;a-P\u0026eacute;rez BE, Castrej\u0026oacute;n-Jim\u0026eacute;nez NSJA. Bacteriocins from lactic acid bacteria. A powerful alternative as antimicrobials, probiotics, and immunomodulators in veterinary medicine. 2021, 11(4):979.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilva DR, Sardi JCO, de Souza Pitangui N, Roque SM, da Silva ACB. Rosalen PLJJoFF: Probiotics as an alternative antimicrobial therapy: Current reality and future directions. 2020, 73:104080.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAngelin J, Kavitha MJIJBM. Exopolysaccharides from probiotic bacteria and their health potential. 2020, 162:853\u0026ndash;865.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKirtonia A, Sethi G, Garg MJC, Sciences ML. The multifaceted role of reactive oxygen species in tumorigenesis. 2020, 77:4459\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaudhary MR, Chaudhary S, Sharma Y, Singh TA, Mishra AK, Sharma S, Mehdi MMJB. Aging, oxidative stress and degenerative diseases: mechanisms, complications and emerging therapeutic strategies. 2023, 24(5):609\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaleem M, Malik S, Mehwish HM, Ali MW, Hussain N, Khurshid M, Rajoka MSR, Chen YJAM. Isolation and functional characterization of exopolysaccharide produced by Lactobacillus plantarum S123 isolated from traditional Chinese cheese. 2021, 203:3061\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng T, Wang JJGM. Oxidative stress tolerance and antioxidant capacity of lactic acid bacteria as probiotic: A systematic review. 2020, 12(1):1801944.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYilmaz B, Bangar SP, Echegaray N, Suri S, Tomasevic I, Manuel Lorenzo J, Melekoglu E, Rocha JM, Ozogul FJM. The impacts of Lactiplantibacillus plantarum on the functional properties of fermented foods: A review of current knowledge. 2022, 10(4):826.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez LGR, Gasga VMZ, Pescuma M, Van Nieuwenhove C, Mozzi F, Burgos JASJFRI. Fruits and fruit by-products as sources of bioactive compounds. Benefits and trends of lactic acid fermentation in the development of novel fruit-based functional beverages. 2021, 140:109854.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJenab A, Roghanian R, Emtiazi GJDD. Development, Therapy: Bacterial natural compounds with anti-inflammatory and immunomodulatory properties (mini review). 2020:3787\u0026ndash;801.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng J-Y, Wu X-Q, He W-J, Liao X, Tang M. Nie X-QJJoAR: Targeting DNA methylation and demethylation in diabetic foot ulcers. 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Hu J, Zhang Y, Yan K, Zhang M, Li Y, Huang X, Tang J, Yao T, Wang DJF, et al. Identification and characterization of toll-like receptor genes in silver pomfret (Pampus argenteus) and their involvement in the host immune response to Photobacterium damselae subsp. Damselae Nocardia seriolae Infect. 2023;141:109071.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeixeira HS, Zhao J, Kazmierski E, Kinane DF, Benakanakere MRJC. TLR3-Dependent activation of TLR2 endogenous ligands via the MyD88 signaling pathway augments the innate immune response. 2020, 9(8):1910.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou K, Wu Z-X, Chen X-Y, Wang J-Q, Zhang D, Xiao C, Zhu D, Koya JB, Wei L, Li et al. JJSt : Microbiota in health and diseases. 2022, 7(1):135.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLasorsa F, Rutigliano M, Milella M, Ferro M, Pandolfo SD, Crocetto F, Simone S, Gesualdo L, Battaglia M. Ditonno PJIJoMS: Complement System and the Kidney: Its Role in Renal Diseases, Kidney Transplantation and Renal Cell Carcinoma. 2023, 24(22):16515.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKajal A, Ankur G, Jagriti SJIJARBS. Isolation and identification of Lactobacilli bacteria from raw cow milk in local region of Agra. 2017, 4(11):98\u0026ndash;102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharpe ME. Identification of the lactic acid bacteria. 1979.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTserovska L, Stefanova S, Yordanova T. Identification of lactic acid bacteria isolated from katyk, goat\u0026rsquo;s milk and cheese. 2002.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBelmok A, Rodrigues-Oliveira T, Lopes F, Kr\u0026uuml;ger R, Kyaw CJBJB. The influence of primer choice on archaeal phylogenetic analyses based on 16S rRNA gene PCR. 2021, 83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui Y, Qu XJTFS. Technology: Genetic mechanisms of prebiotic carbohydrate metabolism in lactic acid bacteria: Emphasis on Lacticaseibacillus casei and Lacticaseibacillus paracasei as flexible, diverse and outstanding prebiotic carbohydrate starters. 2021, 115:486\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFelis GE, Dellaglio FJC. Taxonomy of lactobacilli and bifidobacteria. 2007, 8(2):44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang E, Fan L, Yan J, Jiang Y, Doucette C, Fillmore S. Walker BJAe: Influence of culture media, pH and temperature on growth and bacteriocin production of bacteriocinogenic lactic acid bacteria. 2018, 8(1):1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgbankpe AJ, Dougnon TV, Balarabe R, Deguenon E, Baba-Moussa LJVW. In vitro assessment of antibacterial activity from Lactobacillus spp. strains against virulent Salmonella species isolated from slaughter animals in Benin. 2019, 12(12):1951.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJomehzadeh N, Javaherizadeh H, Amin M, Saki M, Al-Ouqaili MT, Hamidi H, Seyedmahmoudi M. Gorjian ZJIJoID: Isolation and identification of potential probiotic Lactobacillus species from feces of infants in southwest Iran. 2020, 96:524\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi P, Gu Q, Yang L, Yu Y, Wang YJF. Characterization of extracellular vitamin B12 producing Lactobacillus plantarum strains and assessment of the probiotic potentials. 2017, 234:494\u0026ndash;501.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamiloglu S, Sari G, Ozdal T, Capanoglu EJFF. Guidelines for cell viability assays. 2020, 1(3):332\u0026ndash;349.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuleiman WB, Shehata RM, Younis AM. In vitro assessment of multipotential therapeutic importance of Hericium erinaceus mushroom extracts using different solvents. Bioresources Bioprocess. 2022;9(1):1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugihara A, Van Avermaete F, Roelant E, Punjabi U, De Neubourg DJEJoO, Gynecology, Biology R. The role of sperm DNA fragmentation testing in predicting intra-uterine insemination outcome: A systematic review and meta-analysis. 2020, 244:8\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Naggar HA, Bashar MA, Rady I, El-Wetidy MS, Suleiman WB, Al-Otibi FO, Al-Rashed SA, Abd El-Maoula LM, Salem E-SS, Attia EM, et al. Two red sea sponge extracts (Negombata magnifica and Callyspongia siphonella) induced anticancer and antimicrobial activity. Appl Sci. 2022;12(3):1400.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMajtnerova P, Capek J, Petira F, Handl J. Rousar TJSr: Quantitative spectrofluorometric assay detecting nuclear condensation and fragmentation in intact cells. 2021, 11(1):11921.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAidoo DB, Konja D, Henneh IT, Ekor MJIJI. Protective effect of bergapten against human erythrocyte hemolysis and protein denaturation in vitro. 2021, 2021.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang P, Ouyang Q, Zhai T, Sun J, Wu J, Qin F, Zhang N, Yue S, Yang X, Zhang HJN. An inflammation-targeted nanoparticle with bacteria forced release of polymyxin B for pneumonia therapy. 2022, 14(41):15291\u0026ndash;304.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAkmal U, Ghori I, Elasbali AM, Alharbi B, Farid A, Alamri AS, Muzammal M, Asdaq SMB, Naiel MA, Ghazanfar SJF. Probiotic and antioxidant potential of the Lactobacillus spp. Isolated from artisanal fermented pickles. 2022, 8(7):328.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuleiman WB, Helal EE-H. Chemical constituents and potential pleiotropic activities of Foeniculum vulgare (Fennel) ethanolic extract; in vitro approach. Egypt J Chem. 2022;65(7):617\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhedr M, Youssef FS, El-Kattan N, Abozahra MS, Selim MN, Yousef A, Khalil KM. Mekky AEJJoGE, Biotechnology: FolE gene expression for folic acid productivity from optimized and characterized probiotic Lactobacillus delbrueckii. 2023, 21(1):169.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdel Ghany Elrahmany HM, Ali AA, El-Batawy OI, Khedr M, Hassan MAJEJC. Genetic engineering of UV-mutated Bifidobacterium longum and Lactobacillus acidophilus in relation to folic acid and Anti-inflammatory productivity. 2023, 66(13):983\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang J, Zhang G, Peng M, Tan S, Ge S, Yang X, Liang Y, Wen Z, Xie L, Zhou TJAM. Bionic regulators break the ecological niche of pathogenic bacteria for modulating dysregulated microbiome in colitis. 2022, 34(39):2204650.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnsari F, Bahadori A, Samakkhah SA, Pirouzian HR, Pourjafar H. Probiotic Lactic Acid Bacteria: Taxonomy, Properties and Benefits. Handbook of Food Bioactive Ingredients: Properties and Applications. Springer; 2023. pp. 1\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eForouhandeh H, Vahed SZ, Hejazi M, Nahaei M, Dibavar MAJCRB. Isolation and phenotypic characterization of lactobacillus species from various dairy products. 2010, 3(2):84\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMithun S, Dipak V, Sheela SJIJS, Publications R. Isolation and Identification of lactobacilli from raw milk samples obtained from Aarey Milk Colony. 2015, 5(4):1\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoulon S, Chemardin P, Gueguen Y, Arnaud A. Galzy PJAb, biotechnology: Purification and characterization of an intracellular β-glucosidase from Lactobacillus casei ATCC 393. 1998, 74:105\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVillena MA, Iranzo JF\u0026Uacute;, Gundllapalli SB, Otero RRC, P\u0026eacute;rez AIBJE, Technology M. Characterization of an exocellular β-glucosidase from Debaryomyces pseudopolymorphus. 2006, 39(2):229\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Araujo Ribeiro GC, de Assis SAJPB. Biotechnology: β-glucosidases from Saccharomyces cerevisiae: production, protein precipitation, characterization, and application in the enzymatic hydrolysis of delignified sugarcane bagasse. 2024:1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBowers EM, Ragland LO, Byers LDJBBA-P, Proteomics. Salt effects on β-glucosidase: pH-profile narrowing. 2007, 1774(12):1500\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSestelo A, Poza M. Villa TJWJoM, Biotechnology: β-Glucosidase activity in a Lactobacillus plantarum wine strain. 2004, 20:633\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrimaldi A, Bartowsky E, Jiranek VJJAM. Screening of Lactobacillus spp. and Pediococcus spp. for glycosidase activities that are important in oenology. 2005, 99(5):1061\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsman AG, Avula B, Katragunta K, Ali Z, Chittiboyina AG, Khan IAJM. Elderberry Extracts: Characterization of the Polyphenolic Chemical Composition, Quality Consistency, Safety, Adulteration, and Attenuation of Oxidative Stress-and Inflammation-Induced Health Disorders. 2023, 28(7):3148.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin P, Ren B, Wang XC, Jin X, Shi XJWR. Mechanism of microbial metabolic responses and ecological system conversion under different nitrogen conditions in sewers. 2020, 186:116312.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpano G, Rinaldi A, Ugliano M, Moio L, Beneduce L, Massa SJJAM. A β-glucosidase gene isolated from wine Lactobacillus plantarum is regulated by abiotic stresses. 2005, 98(4):855\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDamaso MCT, Andrade CM, Pereira NJBJM Jr. Production and properties of the cellulase-free xylanase from Thermomyces lanuginosus IOC-4145. 2002, 33:333\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan X-H, Cheng Y-Y, Ye Z-L, Lin R-C, Qian Z-ZJACA. Multiple chromatographic fingerprinting and its application to the quality control of herbal medicines. 2006, 555(2):217\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang Y-C, Liu Y-J, He G-R, Cao Y-W, Bi M-M, Song M, Yang P-P, Xu L-F, Ming JJA. Comprehensive analysis of secondary metabolites in the extracts from different lily bulbs and their antioxidant ability. 2021, 10(10):1634.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAggarwal G, Sharma M, Singh R, Sharma UJSNPC. Plant-based natural product chemistry: An overview of the multistep journey involved in scientific validation of traditional knowledge. 2024, 80:327\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasike K, Stander MA, de Villiers AJJP, Analysis B. Recent applications of ion mobility spectrometry in natural product research. 2021, 195:113846.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaini N, Lather V, Gahlawat SKJA-CAMC. Exploring Phytochemicals from Himalayan Medicinal Plants as Novel Therapeutic Agents. 2022, 22(9):1674\u0026ndash;98.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamjane H, Bahorun T, Ramasawmy B, Ramful-Baboolall D, Boodia N, Aruoma OI, Neergheen VSJAJB, Sciences P. Exploration of the potential of terrestrial and marine biodiversity for the development of local nutraceutical products: a case for mauritius. 2021, 1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBunse M, Daniels R, Gr\u0026uuml;ndemann C, Heilmann J, Kammerer DR, Keusgen M, Lindequist U, Melzig MF, Morlock GE. Schulz HJFiP: Essential oils as multicomponent mixtures and their potential for human health and well-being. 2022, 13:956541.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrinivasulu C, Ramgopal M, Ramanjaneyulu G, Anuradha C, Kumar CSJB. Pharmacotherapy: Syringic acid (SA)\u0026ndash;a review of its occurrence, biosynthesis, pharmacological and industrial importance. 2018, 108:547\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePragasam SJ, Venkatesan V, Rasool MJI. Immunomodulatory and anti-inflammatory effect of p-coumaric acid, a common dietary polyphenol on experimental inflammation in rats. 2013, 36:169\u0026ndash;76.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpeisky H, Shahidi F, Costa de Camargo A, Fuentes JJA. Revisiting the oxidation of flavonoids: Loss, conservation or enhancement of their antioxidant properties. 2022, 11(1):133.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHowlader P, Ghosh AK, Islam SS, Bir J, Banu GRJAI. Antiviral activity of Cynodon dactylon on white spot syndrome virus (WSSV)-infected shrimp: an attempt to mitigate risk in shrimp farming. 2020, 28:1725\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDahiya D, Nigam PSJM. The gut microbiota influenced by the intake of probiotics and functional foods with prebiotics can sustain wellness and alleviate certain ailments like gut-inflammation and colon-cancer. 2022, 10(3):665.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGomes S, Teixeira-Guedes C, Silva E, Baltazar F, Preto AJF. Function: Colon microbiota modulation by dairy-derived diet: New strategy for prevention and treatment of colorectal cancer. 2022, 13(18):9183\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVidoni C, Ferraresi A, Secomandi E, Vallino L, Dhanasekaran DN, Isidoro C. Epigenetic targeting of autophagy for cancer prevention and treatment by natural compounds. In: \u003cem\u003eSeminars in cancer biology: 2020\u003c/em\u003e. Elsevier: 34\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi S, Kim Y, Han K, You S, Oh S, Kim SJLAM. Effects of Lactobacillus strains on cancer cell proliferation and oxidative stress in vitro. 2006, 42(5):452\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMingyi Y, Belwal T, Devkota HP, Li L, Luo ZJTiFS. Technology: Trends of utilizing mushroom polysaccharides (MPs) as potent nutraceutical components in food and medicine: A comprehensive review. 2019, 92:94\u0026ndash;110.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOuyang Y, Qiu Y, Liu Y, Zhu R, Chen Y, El-Seedi HR, Chen X, Zhao CJFRI. Cancer-fighting potentials of algal polysaccharides as nutraceuticals. 2021, 147:110522.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaleki-Kakelar H, Dehghani J, Barzegari A, Barar J, Shirmohamadi M, Sadeghi J, Omidi YJBB. Lactobacillus plantarum induces apoptosis in gastric cancer cells via modulation of signaling pathways in Helicobacter pylori. 2020, 10(2):65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmdekar S, Roy P, Singh V, Kumar A, Singh R, Sharma, PJIjoi. Anti-inflammatory activity of lactobacillus on carrageenan-induced paw edema in male wistar rats. 2012, 2012.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGanji-Arjenaki M, Rafieian‐Kopaei MJJ. Probiotics are a good choice in remission of inflammatory bowel diseases: A meta analysis and systematic review. 2018, 233(3):2091\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTarannum N, Hossain TJ, Ali F, Das T, Dhar K, Nafiz IHJL. Antioxidant, antimicrobial and emulsification properties of exopolysaccharides from lactic acid bacteria of bovine milk: Insights from biochemical and genomic analysis. 2023, 186:115263.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdrabo MA-RA, Hassan SWM, Ibrahim HA, Abdul-Raouf UMJJ. Optimization of exopolysaccharides production from marine Pseudomonas mendocina AB1 with emphasis on different valuable applications. 2019, 7:7\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorchers A, Selmi C, Meyers F, Keen C, Gershwin M. Probiotics and immunity. J Gastroenterol. 2009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHofeld BC, Puppala VK, Tyagi S, Ahn KW, Anger A, Jia S, Salzman NH, Hessner MJ, Widlansky MEJSR. Lactobacillus plantarum 299v probiotic supplementation in men with stable coronary artery disease suppresses systemic inflammation. 2021, 11(1):3972.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunteanu IG, Apetrei CJIJMS. Analytical methods used in determining antioxidant activity: A review. 2021, 22(7):3380.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi ShengYu LS, Zhao YuJuan ZY, Zhang Li ZL, Zhang Xue ZX, Huang Li HL, Li Da LD. Niu ChunHua NC, Yang ZhenNai YZ, Wang Qiang WQ: Antioxidant activity of Lactobacillus plantarum strains isolated from traditional Chinese fermented foods. 2012.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBenattouche Z, Bouhadi D, Raho, GBJIjofs. Antioxidant and antibacterial activities of exopolysaccharides produced by lactic acid bacteria isolated from yogurt. 2018, 7(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRolfe RDJTJon. The role of probiotic cultures in the control of gastrointestinal health. 2000, 130(2):S396\u0026ndash;402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen F, Chen J, Chen Q, Yang L, Yin J, Li Y, Huang XJA. Lactobacillus delbrueckii protected intestinal integrity, alleviated intestinal oxidative damage, and activated toll-like receptor\u0026ndash;Bruton\u0026rsquo;s tyrosine kinase\u0026ndash;nuclear factor erythroid 2-related factor 2 pathway in weaned piglets challenged with lipopolysaccharide. 2021, 10(3):468.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Antineoplastic, Anti-oxidant, Anti-inflammatory, DNA fragmentation, Lactobacillus plantarum","lastPublishedDoi":"10.21203/rs.3.rs-4302290/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4302290/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProbiotic bacteria are emerging as promising biotherapeutic agents and environmentally friendly alternatives to antibiotics. They play crucial roles as antioxidants and anti-inflammatory agents, all while minimizing adverse side effects. A significant portion of lactic acid bacteria (LAB), known for their human health benefits, are derived from milk and have been utilized in biotherapeutic applications or for producing valuable metabolites (nutraceuticals). However, the specific role of milk-associated LAB in biotherapeutics remains underexplored. To address this, eight milk product samples were randomly selected from a market in Egypt, diluted, and then cultured anaerobically on MRS agar. From these samples, 16 suspected LAB isolates were obtained and underwent rapid preliminary identification. Among these isolates, the \u003cem\u003eLactobacillus plantarum\u003c/em\u003e strain (OQ547261.1) was identified and shown to exhibit strong antioxidant activity. This activity was evaluated using the DPPH assay at various concentrations, ranging from 1000 to 1.95 \u0026micro;g/mL. The results revealed that \u003cem\u003eL. plantarum\u003c/em\u003e displayed notable antioxidant activities of 71.8% and 93.8% at concentrations of 125\u0026ndash;1000 \u0026micro;g/mL, respectively. In contrast, lower concentrations of 7.81, 3.9, and 1.95 \u0026micro;g/mL showed activities of 45.1%, 34.2%, and 27.2%, respectively, compared to ascorbic acid (the standard reference drug). The anti-inflammatory efficacy of \u003cem\u003eL. plantarum\u003c/em\u003e was evaluated based on its capability to prevent hemolysis induced by hypotonic conditions in a laboratory setting. At a concentration of 1000 \u0026micro;g/mL, \u003cem\u003eL. plantarum\u003c/em\u003e managed to reduce hemolysis by 97.7%, nearly matching the 99.5% inhibition rate achieved by the standard drug, indomethacin, at an identical concentration. Moreover, \u003cem\u003eL. plantarum\u003c/em\u003e exhibited high hemolytic activity at 100 \u0026micro;g/mL (14.3%), which decreased to 1.4% at 1000 \u0026micro;g/mL. Analysis using high-performance liquid chromatography (HPLC) determined the presence of polyphenolic compounds in \u003cem\u003eL. plantarum\u003c/em\u003e, showing an abundance of phenolic acids and flavonoids. Real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) demonstrated that \u003cem\u003eL. plantarum\u003c/em\u003e increased gene expression of the inflammatory marker TLR2 by 133%, and cellular oxidation markers SOD1 and SOD2 by 65% and 74.2%, respectively, while suppressing CRP expression by 33.3%. These results underscore \u003cem\u003eL. plantarum's\u003c/em\u003e exceptional anti-inflammatory and antioxidant activities. Furthermore, \u003cem\u003eL. plantarum\u003c/em\u003e induces cancer cell death through necrotic nuclear DNA fragmentation. These findings suggest that \u003cem\u003eL. plantarum\u003c/em\u003e is not only suitable for nutraceutical production but also holds potential as a probiotic strain. Future research should focus on enhancing the capacity of this strain across various industries and fostering innovation in multiple fields.\u003c/p\u003e","manuscriptTitle":"Antineoplastic with DNA fragmentation assay and anti-oxidant, anti- inflammatory with gene expression activity of Lactobacillus plantarum isolated From local Egyptian milk products","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-23 05:19:20","doi":"10.21203/rs.3.rs-4302290/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-15T16:01:15+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-23T14:40:45+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-20T06:13:11+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-15T13:16:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"272218061229077257435612663208644526799","date":"2024-06-15T12:52:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"4939060831183294716240770352143734421","date":"2024-06-15T12:32:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"22675150773747329037987073247982076436","date":"2024-06-15T10:49:01+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-15T10:32:20+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-05-22T07:32:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-14T18:02:01+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-14T18:02:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Microbiology","date":"2024-04-21T23:55:57+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b575faff-25e0-4f6b-a64e-8239b86bfccd","owner":[],"postedDate":"May 23rd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-11-04T16:29:17+00:00","versionOfRecord":{"articleIdentity":"rs-4302290","link":"https://doi.org/10.1186/s12866-024-03576-y","journal":{"identity":"bmc-microbiology","isVorOnly":false,"title":"BMC Microbiology"},"publishedOn":"2024-10-29 16:20:35","publishedOnDateReadable":"October 29th, 2024"},"versionCreatedAt":"2024-05-23 05:19:20","video":"","vorDoi":"10.1186/s12866-024-03576-y","vorDoiUrl":"https://doi.org/10.1186/s12866-024-03576-y","workflowStages":[]},"version":"v1","identity":"rs-4302290","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4302290","identity":"rs-4302290","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.