Cellular prion protein exacerbates brain demyelination by activating microglia through the TREM2-TYROBP axis in cuprizone-treated animals

Cellular prion protein exacerbates brain demyelination by activating microglia through the TREM2-TYROBP axis in cuprizone-treated animals | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Cellular prion protein exacerbates brain demyelination by activating microglia through the TREM2-TYROBP axis in cuprizone-treated animals Qing Li, Pengcheng Huang, Jinqiong Zhan, Hancun Yi, Zihao Zhang, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7704970/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background The cellular prion protein (PrP C ), widely recognized for its role in prion diseases, is highly expressed in the central nervous system (CNS). While it has been reported to link to demyelination in the peripheral nervous system, the function of PrP C in CNS demyelination remains unclear. Methods We explored the role of PrP C in cuprizone-induced demyelination using wild-type and two PrP-deficient mouse models. Results We observed significant upregulation of PrP C within demyelinating lesions of wild-type mice fed with cuprizone. In contrast, mice lacking PrP C ( Prnp -KO) or with deletion of its octapeptide repeat region (OPR) ( Prnp -OPR de ) exhibited markedly reduced myelin loss and oligodendrocyte death, evidenced by luxol fast blue staining, myelin basic protein examination, and detection of OLIG2. RNA sequencing analysis indicated that this protection was associated with attenuated microglial activation and a downregulation of the TREM2-TYROBP signaling pathway. Accordingly, compared to wild-type mice, microglia-mediated neuroinflammatory responses were substantially reduced in Prnp -KO and Prnp -OPR de mice. Together, these findings demonstrate that PrP C exacerbates CNS demyelination by promoting microglia activation via the TREM2-TYROBP axis, and further identify OPR as a critical domain responsible for this neurotoxic activity. Conclusions These findings reveal a novel pathogenic mechanism for PrP C in CNS demyelination and suggest that targeting PrP C or its OPR may offer new therapeutic opportunities for demyelinating disorders. Multiple sclerosis demyelination prion protein PrPC microglia TREM2 TYROBP neuroinflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Multiple sclerosis (MS) is a chronic inflammatory disorder of the central nervous system (CNS) and a leading cause of non-traumatic neurological disability in adults[ 1 – 3 ]. The disease is characterized by demyelination and axonal loss, resulting in impaired neural conduction. Although existing immunomodulatory therapies can modulate both peripheral and central immune responses, their ability to slow MS progression remains limited[ 4 , 5 ]. Thus, there is a critical need to identify novel disease-driving mechanisms intrinsic to the CNS. Disease progression in MS is fueled by persistent neuroinflammation and inadequate remyelination, wherein a toxic inflammatory microenvironment together with inhibitory signals prevent the differentiation of oligodendrocyte progenitor cells (OPCs) and compromise myelin repair[ 6 – 8 ]. In this process, microglia play a pivotal role, as their chronic activation not only perpetuates demyelination but also contributes significantly to neuronal injury[ 9 , 10 ]. The cellular prion protein (PrP C ), encoded by the PRNP gene, is best known for its central role in prion diseases, wherein its misfolded scrapie isoform (PrP Sc ) propagates and drives neurodegeneration[ 11 , 12 ]. Beyond its involvement in prion disorders, PrP C has also been implicated in neuroinflammation[ 13 – 16 ] and is essential for maintaining myelination in the peripheral nervous system (PNS)[ 17 – 19 ]. This is supported by observations of progressive peripheral demyelination observed in PRNP knockout mice, goats carrying PRNP mutations, and a human patient with pathogenic PRNP mutations[ 20 ]. Notably, PrP C is upregulated in the CNS of mice with experimental autoimmune encephalomyelitis (EAE)[ 21 ], a widely used model of MS, raising the possibility that PrP C may also contribute to demyelination within the CNS—a role that remains largely unexplored. The cuprizone (CPZ) dietary model, which induces reproducible demyelination in defined CNS regions, serves as a useful tool to address this question. CPZ acts as a copper chelator and may interact with the copper-binding N-terminal OPR region of PrP C [ 22 – 25 ]. Despite these indications, the specific contribution of PrP C to the pathogenesis of MS and related demyelinating disorders remains poorly understood. In this study, we used the CPZ-induced demyelination model to investigate the role of PrP C . Our results showed that PrP C expression is upregulated in the corpus callosum and cerebellum following CPZ challenge. Moreover, genetic ablation of PrP C or specific deletion of its OPR domain markedly alleviated demyelination. We further demonstrated that this protective effect is mediated by suppression of the microglia TREM2-TYROBP signaling axis, resulting in attenuated neuroinflammation. These findings identify PrP C as a critical promoter of CNS demyelination and highlight the TREM2-TYROBP axis as a potential therapeutic target for reducing neuroinflammation in MS. Materials and methods Animals C57BL/6J wild-type (WT) mice were obtained from the specific pathogen-free breeding facility at Nanchang University. PrP C -null ( Prnp -KO) and octapeptide repeat-deleted ( Prnp -OPR de ) mice on a C57BL/6J background were generated previously[ 26 ]. The Prnp -KO mice lack the genomic region spanning loci 23–230, while the OPR-deletion mice carry a deletion from loci 51 to 90. All animals were housed in individually ventilated cages under a 12-h light/dark cycles with ad libitum access to food and water, and were acclimated for 7 days prior to experimental. All experimental procedures were approved by the Research Ethics Committee of the First Affiliated Hospital of Nanchang University (Approval No. CDYFY-IACUC-202505GR027) and conducted in accordance with the Guidelines for the Welfare and Ethical Review of Laboratory Animals in China. Every effort was made to minimize animal suffering and distress. Agarose in DNA gel electrophoresis Agarose in DNA gel electrophoresis DNA fragments were separated and visualized by agarose gel electrophoresis. Briefly, a 2.0% agarose gel was prepared by dissolving agarose powder (Uelandy, China) in 1 × TAE buffer containing a nucleic acid staining dye. DNA samples were mixed with 6 × DNA loading dye and loaded into the wells of the submerged gel. The primer sequences used were as follows: Prnp Forward: TGGCGAACCTTGGCTACTG, Prnp Reverse: GTGCTGCTTGATGGTGATATTGA. A DNA molecular weight marker was loaded alongside the samples for size estimation. Electrophoresis was carried out until the loading dye front had migrated an appropriate distance (typically two-thirds to three-quarters of the gel length). After electrophoresis, the gel was carefully removed from the tank and visualized under ultraviolet (UV) light using a gel documentation system. Digital images were captured for further analysis. Additionally, DNA samples were subjected to Sanger sequencing analysis to distinguish between Prnp -OPR de and Prnp -KO genotypes. Cuprizone administration Male mice aged 6–8 weeks (n = 110) were fed a diet containing 0.4% cuprizone (Sigma-Aldrich, USA) mixed into standard powdered rodent chow for 6 weeks to induce demyelination[ 27 ]. The control mice received the same chow without cuprizone. Body weight was recorded once per week throughout the feeding period. During the fifth week, behavioral tests were conducted. At the end of the sixth week, following cuprizone treatment, all mice were euthanized and brain tissues were collected for subsequent analysis. Experimental autoimmune encephalomyelitis (EAE) induction Female mice aged 6–8-weeks were immunized via subcutaneous (s.c) injection at four sites (50 µl per site) with an emulsion containing 200 µg MOG 35 − 55 (GL Biochemistry, China) and incomplete Freund’s adjuvant (Sigma, USA) at a 1:1 ratio, supplemented with 4 mg/ml heat-killed Mycobacterium tuberculosis (Biolead, China). Two injection sites were located along the midline of the upper back between the shoulders, and two on either side of the midline on the lower back. In addition, mice received 200 ng of pertussis toxin (List Biological Lab) intraperitoneally (i.p.) on days 0 and 2 post-immunization. Body weight was monitored daily, and clinical disease scores were assessed based on a standardized scale from 0 to 5 as previously described[ 28 , 29 ]: 0, no symptoms; 0.5, distal tail weakness; 1.0, complete tail paralysis; 1.5, tail weakness and mildly impaired righting reflex; 2.0, gait ataxia and markedly impaired righting reflex; 2.5, severe bilateral hindlimb paresis; 3.0, complete hindlimb paralysis; 3.5, complete hindlimb paralysis with mild forelimb weakness; 4.0, hindlimb paralysis and forelimb paresis; 4.5, paralysis of both hindlimbs and forelimbs; 5, moribund or deceased. Immunized control mice received emulsion without MOG 35 − 55 . All mice were euthanized on day 30, and lumbar spinal cords were collected for analysis. SH-SY5Y cells culture and cuprizone treatment The human SH-SY5Y neuroblastoma cell line were obtained from Wuhan Procell Life Science and Technology Co., LTD. Cells were maintained in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12; 1:1; Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin/streptomycin (Sigma-Aldrich, Germany), at 37°C in a humidified atmosphere of 95% air and 5% CO₂. Due to the low solubility of cuprizone in aqueous solutions, it was dissolved in 0.1% DMSO to prepare a 100 mM stock solution. SH-SY5Y cells were then treated with various concentrations of cuprizone (0, 20, 40, 60, 80, and 100 µM) for 24 hours[ 30 ]. Following treatment, cells were harvested for subsequent Western blot and immunofluorescence analyses. Open Field Test (OFT) Motor activity was assessed using an open field test box (50 × 50 × 40 cm). Each mouse was placed in the center of the arena under dim lighting and allowed to explore freely for 15 min. All sessions were recorded via an infrared camera mounted above the box. Locomotor activity and time spent in the center zone were analyzed using AnyMaze software. The arena was cleaned thoroughly with 75% ethanol between trials and dried prior to each test. Elevated Plus Maze (EPM) The elevated plus maze (EPM) apparatus consisted of two open arms (44 × 12 cm) and two enclosed arms (44 × 12 cm), connected by a central square platform (12 × 12 cm). The entire maze was elevated 50 cm above the floor. Each mouse was placed in the central area facing an open arm and allowed to explore freely for 5 minutes. The time spent in the open arms was recorded and analyzed using AnyMaze software. The maze was cleaned with 75% ethanol and thoroughly dried after each trial. Rotarod Test (RT) Mice were acclimatized in the testing room for 15 minutes prior to the experiment. Each mouse was placed on the rod initially rotating at a constant speed of 4 rpm. After a 1-minute habituation period, the rotation speed increased uniformly from 4 rpm to 40 rpm over a 5-minute period. The latency to fall was recorded for each trial. Each mouse performed three trials with at least 15 minutes between trials. The maximum duration per trial was set to 300 seconds. The final fall latency was calculated as the average of the three trials. The rod was cleaned with 75% ethanol between trials. Histology analysis Mice were anesthetized with pentobarbitone and transcardially perfused with ice-cold PBS (0.01 M, pH 7.4). The brain and spinal cord were then carefully removed, followed by perfusion with 4% paraformaldehyde and post-fixation overnight in the same solution. Paraffin-embedded sections (4 µm) of brain and lumbar spinal cord tissues were prepared and stained with Luxol fast blue (LFB) to assess demyelination[ 31 ]. Additionally, spinal cord sections were stained with hematoxylin and eosin (H&E) to evaluate inflammatory infiltration. Immunohistochemistry and immunofluorescence staining Brain paraffin sections were deparaffinized in xylene and subjected to antigen retrieved using EDTA. For immunohistochemistry, sections were blocked with 5% bovine serum albumin in PBS for 60 minutes, followed by incubation with primary antibodies against myelin basic protein (MBP; 1:2000, #78896, CST, USA) and PrP C (1:30, sc-47730, Santa Cruz, USA) for one hour at 37°C. Additional immunohistochemical staining was performed for TYROBP (1:1000, ab283679, Abcam, USA). After PBS washes, sections were incubated with appropriate biotinylated secondary antibody. Signals were developed DAB substrate (Elabscience, China), scanned with an HS6 system, and quantified based on mean intensity using Image-Pro Plus software. For immunofluorescence, sections were permeabilized with 0.3% Triton X-100 (Solarbio, China) in PBS for 30 minutes and blocked in QuickBlock™ blocking buffer (Beyotime, China) for 2 hours at room temperature. Sections were then incubated with the following primary antibodies overnight at 4°C: mouse anti-PrP C (1:30, sc-47730, Santa Cruz, USA), rabbit anti-IBA1 (1:1000, 019-19741, Wako, Japan), rabbit anti-GFAP (1:1000, ab7260, Abcam, UK), goat anti-PDGFR-α (1:50, AF1062, R&D Systems, USA), rabbit anti-CC1 (1:100, ab16794, Abcam, USA), rabbit anti-MBP (1:100, #78869, CST, USA), mouse anti-IBA1 (1:100, ab283319, Abcam, USA), sheep anti-TREM2 (1:100, AF1729, R&D Systems, USA), rabbit anti-TYROBP (1:50, ab283679, Abcam, USA),mouse anti-NLRP3 (1:50, 68102, Proteintech, USA), rabbit anti-NF-κB (1:100, 10745, Proteintech, USA), and mouse anti-TLR4 (1:100, 66350, Proteintech, USA). After PBS washes, sections were incubated for 2 hours at RT with Alexa Fluor 488-, 594-, or 647-conjugated secondary antibodies (1:1000, Thermo Fisher), including anti-rabbit IgG, anti-mouse IgG, anti-sheep IgG, and anti-goat IgG. Finally, sections were counterstained with DAPI (1:1000, Thermo Fisher) for 10 minutes at RT. Images were acquired using a Leica confocal microscope, and co-localization analysis was performed. Mean fluorescence intensity (MFI) was quantified with ImageJ, focusing on myelinated regions such as the corpus callosum and cerebellum. Quantitative real-time PCR Total RNA was extracted using TRIzol reagent (Sigma-Aldrich, Germany) according to the manufacturer's protocol. cDNA was synthesized from the extracted RNA using a cDNA Reverse Transcriptase Kit (Vazyme Biotech, China). The concentrations of RNA and cDNA were determined using a Nanodrop spectrophotometer (Thermo Fisher, USA). Quantitative real-time PCR was performed using corresponding primers (Table 1 ) with SYBR Green Master Mix (Vazyme Biotech, China) on a Bio-Rad real-time PCR system (USA). The thermal cycling conditions consisted of an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 60 sec. The relative mRNA expression levels were normalized to GAPDH and analyzed using the 2^(-ΔΔCt) method. All reactions were performed in triplicate. Table 1 Primers for real-time polymerase chain reaction Gene Primer Prnp Forward: GTCCCAGGCCTATTACGACG Reverse: ATGCGAAGGAACAAGCAGGA Trem2 Forward: AGCACCTCCAGGCAGGTTT Reverse: TTGATTCCTTGGAAAGAGGAGGA Tyrobp Forward: CCCAAGATGCGACTGTTCTTC Reverse: GTCCCTTGACCTCGGGAGA Tnf-α Forward: CAGGCGGTGCCTATGTCTC Reverse: CGATCACCCCGAAGTTCAGTAG Cd32 Forward: AATCCTGCCGTTCCTACTGATC Reverse: GTGTCACCGTGTCTTCCTTGAG Cd86 Forward: GACCGTTGTGTGTGTTCTGG Reverse: GATGAGCAGCATCACAAGGA Cd206 Forward: CAAGGAAGGTTGGCATTTGT Reverse: CCTTTCAGTCCTTTGCAAGC Arg1 Forward: TCACCTGAGCTTTGATGTCG Reverse: CTGAAAGGAGCCCTGTCTTG Ym1/2 Forward: CAGGGTAATGAGTGGGTTGG Reverse: CACGGCACCTCCTAAATTGT Gapdh Forward: TGGCCTTCCGTGTTCCTAC Reverse: GAGTTGCTGTTGAAGTCGCA Western blotting The corpus callosum and cerebellar tissues were carefully dissected from the brain on ice and homogenized by sonication in RIPA lysis buffer (Beyotime, China) containing PMSF. The same procedure was applied to cuprizone-treated SH-SY5Y neuroblastoma cell. The lysates were centrifuged at 12,000 rpm for 10 min, and the supernatants were collected for protein quantification using a BCA assay kit (Beyotime, China). Protein samples were separated by SDS-PAGE and transferred onto PVDF membranes (Millipore, USA). The membranes were incubated with the following primary antibodies: rabbit anti-PrP C (1:4000, SC57-05, Invitrogen, USA), rabbit anti-MBP (1:1000, #78869, CST, USA), rabbit anti-Olig2 (1:1000, #65915, CST, USA), mouse anti-β-Tubulin (1:5000, 66240, Proteintech, USA), mouse anti-β-Actin (1:1000, TA-09, ZSGB-BIO, China), rabbit anti-TREM2 (1:1000, 27599, Proteintech, USA), rabbit anti-TYROBP (1:1000, ab283679, Abcam, USA), rabbit anti-TNF-α (1:1000, 346654, Zenbio, China) and rabbit anti-IL-6R (1:1000, ab271042, Abcam, USA). Subsequently, the membranes were incubated with anti-rabbit or anti-mouse HRP-conjugated secondary antibody (Gene-Protein-Link, China) for 2 hours at room temperature. Signal detection was performed using a ChemiDoc™ imaging system (Bio-Rad, USA), and relative protein levels were quantified with ImageJ software. RNA sequencing and data processing Total RNA was extracted with TRIzol reagent (Sigma-Aldrich, Germany) following the manufacturer’s instructions. RNA purity and concentration were measured using a NanoDrop spectrophotometer (Thermo Fisher, USA), and RNA integrity was assessed with an Agilent 2100 Bioanalyzer (Agilent Technologies, USA). Sequencing libraries were prepared using the VAHTS Universal V10 RNA-seq Library Prep Kit (Premixed Version) according to the manufacturer’s protocol. Transcriptome sequencing and subsequent bioinformatic analyses were performed by OE Biotech Co., Ltd. (Shanghai, China). The libraries were sequenced on an Illumina NovaSeq 6000 platform to generate 150 bp paired-end reads. Gene expression levels were quantified as FPKM, and read counts per gene were obtained using HTSeq. Principal component analysis (PCA) was carried out with R (v3.2.0) to assess biological reproducibility among samples. Differential gene expression analysis was performed using DESeq2, with significantly differentially expressed genes (DEGs) defined as those with a p value 1. Functional enrichment analysis of DEGs was conducted based on the hypergeometric distribution for KEGG pathways and WikiPathways using R (v3.2.0). Significant enriched terms were identified and visualized through heatmaps, volcano plots, and bubble diagrams generated in R. Gene Set Enrichment Analysis (GSEA) was performed using GSEA software, which evaluated whether predefined gene sets were enriched at the extremes (top or bottom) of a ranked list of genes ordered by differential expression between sample groups. Enzyme-linked immunosorbent assay (ELISA) After 6 weeks of cuprizone feeding, mice were anesthetized and peripheral blood was collected via retro-orbital bleeding. The blood samples were centrifuged at 3600 rpm to isolate plasma. Plasma levels of M-CSF and IFN-γ were measured using commercial mouse ELISA kits (NEOBIOSCIENCE) according to the manufacturer’s instructions. Absorbance was read at 450 nm for each well. LPS-induced neuroinflammation Mice in the lipopolysaccharide (LPS)-induced inflammation model group received daily intraperitoneal injections of 1 mg/kg LPS (E. coli O55:B5, MCE HY-D1056) for five consecutive days. Control mice were injected intraperitoneally with an equal volume of sterile saline. On day 6 after the treatment, all animals were euthanized under sodium pentobarbital anesthesia. Brain tissues were carefully dissected and snap-frozen for storage at -80°C. Statistical analysis The data in the figures are presented as mean ± SEM. Statistical analyses were conducted using GraphPad Prism software. Comparisons between two independent groups with normal distribution were performed using the unpaired Student’s t-test. For multiple group comparisons, one-way or two-way ANOVA was applied, followed by Tukey’s multiple comparisons test. A p-value of less than 0.05 (p < 0.05) was considered statistically significant. Results PrP C is upregulated in the CNS demyelinating model in mice Previous studies have reported elevated levels of PrP C in mouse model and patients with kidney disease, suggesting a potential role of PrP C in disease pathogenesis[ 32 , 33 ] However, its expression in the CNS demyelinating disorders remains unclear. To explore the possible involvement of PrP C in demyelination, we employed a mouse model of CNS demyelination induced by dietary administration of cuprizone (Fig. 1 A). Treated mice exhibited significant weight loss after 6 week compared with controls (20.11 g ± 0.60 in CPZ vs. 24.41 g ± 0.43 in CON) (Fig. 1 B). LFB staining revealed extensive demyelination in myelin-rich regions such as the corpus callosum (Cc) (2.4 ± 0.24 in CPZ vs. 0.40 ± 0.24 in CON) and cerebellum (Cb) (2.0 ± 0.32 in CPZ vs. 0.20 ± 0.20 in CON) of cuprizone-treated mice (Fig. 1 C and 1 D), confirming successful model establishment. Furthermore, immunohistochemical analysis demonstrated increased PrP C expression in demyelinated Cc (CPZ vs. CON, p = 0.0312) and Cb (CPZ vs. CON, p = 0.0204) of the cuprizone group (Fig. 1 E, 1 F). Consistent with protein findings, RT-qPCR indicated upregulation of Prnp mRNA expression in the same regions (CPZ vs. CON, p = 0.0045 in Cc; CPZ vs. CON, p = 0.0494 in Cb) (Fig. 1 G). To verify whether the elevated expression of PrP C is a common feature in demyelinating disease, we employed an EAE mouse model (Fig. S1 A). EAE mice exhibited significant weight loss (19.24 g ± 0.17 in EAE vs. 20.50 g ± 0.06 in CON) (Fig. S1 B) and increased clinical scores (0.67 ± 0.18 in EAE vs. 0.00 ± 0.00 in CON) (Fig. S1 C) after 30 days immunization. H&E staining revealed inflammatory cell infiltration in the lumbar spinal cord (Fig. S1 D), while LFB staining showed evident demyelination (1.5 ± 0.29 in EAE vs. 0.00 ± 0.00 in CON) (Fig. S1 E and S1F). Western blotting analysis further confirmed upregulated PrP C expression in the lumbar spinal cord of EAE mice (EAE vs. CON, p = 0.0111) (Fig. S1 G and S1H). Additionally, we treated SH-SY5Y neuroblastoma cells with different concentrations of cuprizone (Fig. S1 I). Immunofluorescence analysis indicated a marked increase in PrP C expression following cuprizone exposure (Fig. 1 J), which was corroborated by Western blotting (0 µM vs. 20 µM, p = 0.0040; 0 µM vs. 40 µM, p = 0.0003; 0 µM vs. 60 µM, p = 0.0003; 0 µM vs. 80 µM, p = 0.0017; 0 µM vs. 100 µM, p = 0.0079) (Fig. 1 K and 1 L). These results consistently demonstrate that PrP C expression is upregulated in cuprizone-treated mice and cultured cells as well as EAE mice, further supporting its potential involvement in demyelinating pathologies. Prnp knockout and OPR-deletion mitigate CPZ-induced CNS demyelination The above results indicate that PrP C may play a role in CNS demyelination. Given that cuprizone act as a copper ion chelator and that the OPR region of PrP C serves as a copper-binding domain, we sought to investigate whether genetic deletion of Prnp or specific deletion of the OPR region influences cuprizone-induced demyelination. To this end, we subjected wild-type (WT), Prnp -KO, and Prnp -OPR de mice (Fig. S2) to a 0.4% cuprizone diet for 6 weeks. Weekly monitoring of body weight revealed significant weight loss in all groups beginning from the first week of cuprizone exposure (WT: 20.08 g ± 1.35 in CPZ vs. 21.50 g ± 0.15 in CON; Prnp -OPR de : 21.28 g ± 0.87 in CPZ vs. 22.16 g ± 0.80 in CON; Prnp -KO: 22.28 g ± 0.18 in CPZ vs. 22.76 g ± 0.86 in CON). Notably, both male and female Prnp- KO and Prnp -OPR de mice showed attenuated weight loss compared to their WT counterparts (Fig. 2 A and Fig. S3A). Behavioral assessment related to anxiety and motor function indicated that cuprizone treatment did not significantly alter anxiety-like behaviors (time spent in the center or open arms) or motor performance (total distance moved or latency to fall (Fig. S4). To validate myelin loss, we performed LFB staining, which specifically binds to myelin. The results demonstrated reduced demyelination in both the Cc and Cb of cuprizone-fed Prnp -KO and Prnp -OPR de mice compared to wild-type controls (Fig. 2 B and 2 C; Fig. S3B and S3C). We further employed IHC staining for myelin basic protein (MBP) in the CNS, which revealed significantly higher MBP expression in the Cc and Cb of Prnp- KO and Prnp -OPR de mice following cuprizone treatment (Fig. 2 D and 2 E, Fig. S3D and S3E). Consistent with the IHC findings, western blotting analysis also confirmed higher MBP protein levels in the mutant mice (Fig. 2 F and 2 G). Together, these multidimensional analyses indicate that either genetic knockout of Prnp or specific deletion of the OPR region markedly attenuates cuprizone-induced demyelination in the CNS. Prnp knockout and OPR-deletion reduce CPZ-induced oligodendrocyte loss Oligodendrocytes are responsible for myelination in the CNS. Previous studies have reported oligodendrocyte death and myelin loss in cuprizone-fed animal models[ 27 ]. OPCs identified by platelet-derived growth factor receptor alpha (PDGFR-α), can differentiate into mature oligodendrocytes (marked by CC1) to replenish the oligodendrocyte population and facilitate remyelination, particularly within demyelinated regions[ 34 ]. Given that consistent phenotypic changes were observed across genders in prior weight loss and myelin assessments, the following investigations focused primarily on male mice. To evaluate oligodendrocyte loss in cuprizone-induced demyelination, we analyzed Olig2 (an oligodendrocyte marker) protein levels in the Cc and Cb of mice by Western blotting. The results showed a significant reduction in Olig2 levels in cuprizone-treated wild-type (WT) mice. In contrast, both Prnp -KO and Prnp -OPR de mice exhibited attenuated loss of Olig2 following cuprizone exposure (Fig. 3 A and 3 B), suggesting that PrP C may participate in cuprizone-induced oligodendrocyte death and myelin loss. Immunofluorescence staining for CC1 (Fig. 3 C and 3 D) and PDGFR-α (Fig. 3 E and 3 F) further revealed lineage-specific responses. Cuprizone-treated WT mice showed pronounced depletion of CC1 + cell accompanied by an accumulation of PDGFR-α + cell accumulation in both the Cc and Cb, indicating impaired OPCs differentiation, oligodendrocyte loss and compensatory migration of OPCs to demyelination areas. In contrast, cuprizone-treated Prnp- KO and Prnp -OPR de mice maintained higher numbers of CC1 + cells and showed a reduction in PDGFR-α + cells. These results suggest that the absence of PrP C or deletion of its OPR region plays a role in the differentiation of OPCs into functional mature oligodendrocytes, reduces oligodendrocyte death, and ultimately preserves myelinating cells, thereby mitigating demyelination. Microglial activation is less intense in Prnp knockout and OPR-deletion mice than in wild-type mice To further elucidate the molecular mechanisms through which Prnp knockout and OPR deletion alleviate cuprizone-induced demyelination and oligodendrocyte loss, we performed RNA sequencing (RNA-seq) on brain tissues from WT, Prnp- KO, and Prnp -OPR de mice fed a cuprizone diet under RNase-free conditions (Fig. 4 A). WikiPathways enrichment analysis of differentially expressed genes revealed significant alterations in macrophage-related functions and microglial activation pathways (Fig. 4 B). Larger and darker bubbles represented more pronounced differences between groups, with pathway annotations indicating the direction of gene enrichment. Microglia, which account for approximately 10% of CNS cells, are resident immune macrophages that defend neural tissue against infection, support repair, and regulate neuroinflammatory responses[ 35 – 39 ]. Subsequent IBA1 IHC staining—a specific marker for microglia—showed pronounced microglial activation in the Cc of cuprizone-fed WT mice, which was markedly attenuated in Prnp -KO and Prnp -OPR de mice (Fig. 4 C and 4 D). Activated microglia exhibited characteristic morphological changes including increased cell density, enlarged somata, and shortened / retracted processes. We also observed differential activation of astrocytes, as indicated by GFAP staining (Fig. S5A and S5B). Furthermore, microglial activation was predominantly localized to demyelinated regions such as the Cc and Cb (Fig. 4 E). These distinct patterns of glial activation suggest that the absence of PrP C or its OPR region mitigates cuprizone-induced demyelination by attenuating microglial and astrocytic activation. TREM2 expression is significantly upregulated in WT than in Prnp knockout and OPR-deletion mice Based on the above findings, we further investigated the role of microglia in cuprizone-induced demyelination. Previous studies have shown that TREM2 (Triggering Receptor Expressed on Myeloid Cells 2) plays multifaceted roles in microglial activation[ 40 – 42 ], particularly in regulating the expression and release of inflammatory factors and balancing neuroprotective versus neurotoxic responses. We therefore hypothesized that PrP c may exacerbate cuprizone-induced demyelination by modulating TREM2-dependent microglial signaling. GO analysis of RNA-seq data presented in the volcano plot (Fig. 5 A) revealed that Trem2 was significantly more upregulated in cuprizone-fed WT mice compared to Prnp -KO and Prnp -OPR de mice, suggesting that PrP C may critically influence microglial activation. We subsequently assessed Trem2 expression at both mRNA and protein levels. RT-qPCR confirmed pronounced in the Cc and Cb of cuprizone-treated WT mice (Fig. 5 B). Consistent with the transcriptional data, both Prnp knockout and OPR deletion suppressed Trem2 mRNA expression, a trend also reflected at the protein level as shown by western blotting (Fig. 5 C and 5 D). To examine the relationship between TREM2 expression and microglial activation, we performed dual IHC staining for IBA1 and TREM2. In WT mice exposed to cuprizone, IBA1 and TREM2 showed clear co-localization in the Cc and Cb, with overlapping fluorescence signals (Fig. 5 E and 5 F). In contrast, no such co-localization was observed in Prnp -KO and Prnp -OPR de mice. Additionally, co-staining for GFAP and TREM2 revealed no spatial overlap in any of the genotypes (Fig. S5C, S5D), confirming that TREM2 activation is restricted to microglia rather than astrocytes. These results suggest that PrP C exacerbates CNS demyelination by promoting TREM2-mediated microglial activation. Conversely, Prnp knockout and OPR deletion suppress TREM2 expression, attenuates microglial activation, and ultimately alleviates myelin damage. TREM2-TYROBP axis expression is downregulated in mice with Prnp knockout and OPR deletion Since the cytoplasmic tail of TREM2 lacks intrinsic signaling motifs, it depends on an associated signal-transducing subunit to propagate activation signals[ 43 ]. TREM2 functions through its interaction with the TYROBP-mediated signaling pathway[ 44 ]. TYROBP (also known as DAP12), a type I transmembrane adaptor protein involved in immune signaling[ 45 ], has a molecular weight of approximately 12 kDa and consists of 113 amino acids[ 46 ]. After confirming TREM2 expression during microglial activation, we further examined TYROBP expression. RNA-seq heatmap analysis of microglial activation-associated genes showed that both TYROBP and TREM2 were significantly downregulated in Prnp -KO and Prnp -OPR de mice (Fig. 6 A). Consistent with this, RT-qPCR analysis revealed a marked upregulation of Tyrobp mRNA levels in WT mice compared to Prnp -KO and Prnp -OPR de mice fed with cuprizone (Fig. 6 , B). A similar trend was observed at the protein level: western blotting analysis demonstrated reduced TYROBP expression in the mutant mice (Fig. 6 C and 6 D), which was further corroborated by immunohistochemical staining showing decreased TYROBP in cuprizone-fed Prnp -KO and Prnp -OPR de mice (Fig. S6A and S6B). To investigate potential interactions among TYROBP, TREM2, and microglia, we constructed a protein-protein interaction (PPI) network based on RNA-seq data. As shown in Fig. 6 E, the PPI network revealed a direct interaction between TREM2 and TYROBP. Upregulated and downregulated genes are represented by red and blue nodes, respectively, with circle sizes reflecting their connectivity. To further validate the TREM2-TYROBP molecular axis, we performed triple immunofluorescence staining, which showed co-localization of IBA1, TREM2, and TYROBP in the Cc and Cb. Overlapping fluorescence signals were observed at identical pixel distances (Fig. 6 F and 6 G). In contrast, no such co-localization was detected in cuprizone-fed Prnp -KO or Prnp -OPR de mice, demonstrating that microglial activation is associated with coordinated expression of TREM2 and TYROBP. NF-κB and TLR4 pathway activation is inhibited in mice with Prnp knockout and OPR deletion Previous studies have suggested that microglial activation involves TREM2 signaling through TYROBP, which activates the protein tyrosine kinase ERK and subsequently triggers downstream signaling via the nuclear factor kappa-B (NF-κB) and toll-like receptor 4 (TLR4) pathways[ 47 ]. These pathways play critical roles in mediating downstream molecular effects during microglial activation. Our KEGG pathway enrichment analysis of transcriptomic data (Fig. S7A) revealed significant differences in the expression of genes related to NF-κB and TLR4 pathway activation among experimental groups. Furthermore, immunofluorescence staining showed markedly increased positivity for NF-κB (Fig. S7B and S7C) and TLR4 (Fig. S7D and S7E) in demyelinated regions of cuprizone-WT mice. In contrast, Prnp -KO and Prnp -OPR de mice treated with cuprizone exhibited significantly reduced expression of both NF-κB and TLR4. These results indicate that Prnp knockout and OPR deletion suppress the activation of NF-κB and TLR4 pathways, which may contribute to reduced myelin damage. Neuroinflammation responses are attenuated in mice with Prnp knockout and OPR deletion In the cuprizone-induced demyelination mouse model, neuroinflammation driven by microglial activation is a key mechanism underlying myelin damage[ 27 , 48 ]. To further investigate neuroinflammatory responses, we analyzed the mRNA expression of pro- and anti-inflammatory factors. Pro-inflammatory factors, including TNF-α , CD32 , CD86 (Fig. 7 A), were significantly downregulated in cuprizone-fed Prnp -KO and Prnp -OPR de mice compared to WT mice. In contrast, anti-inflammatory factors such as CD206 , YM1/2 , Arg1 (Fig. 7 A) were markedly upregulated in the same mutants. Western blotting analysis further confirmed reduced protein levels of TNF-α (Fig. 7 B and 7 C) and IL-6 (Fig. 7 D and 7 E) in cuprizone-treated Prnp -KO and Prnp -OPR de mice. NLRP3 (NOD-like receptor thermal protein domain-containing protein 3), which is activated during infection or inflammation and forms the inflammasome complex to promote cytokine production, also showed significantly lower expression in Prnp -KO and Prnp -OPR de mice following cuprizone treatment, as evidenced by immunofluorescence (Fig. 7 F and 7 G). ELISA of mouse plasma revealed decreased levels of macrophage colony-stimulating factor (M-CSF) and interferon-γ (IFN-γ) in cuprizone-fed Prnp -KO, and Prnp -OPR de mice (Fig. 7 H). To directly assess the role of PrP C in neuroinflammation, we intraperitoneally injected lipopolysaccharide (LPS) to induce CNS inflammation in WT and Prnp -KO mice. WT mice showed significantly increased IL-6R expression following LPS challenge on day 6, whereas Prnp -KO mice exhibited attenuated IL-6R induction (Fig. 7 I and 7 J). Together, these results demonstrate that Prnp knockout and OPR deletion alleviate myelin damage by reducing neuroinflammation in the CNS. Discussion Our study uncovers a novel pathophysiologic role of PrP C in CNS demyelination. We show that the absence of PrP C , or specific deletion of its OPR region, confers robust protection against myelin damage. This protection is mediated by the suppression of the microglial TREM2-TYROBP signaling axis, leading to a reduced neuroinflammatory response. We initially observed a substantial upregulation of PrP C in the CNS of CPZ-treated mice, consistent with its reported elevation in EAE and other CNS insults such as cerebral ischemia[ 21 , 49 – 51 ]. This suggests a potential broader role for PrP C in the pathogenesis of neurological disorders. Notably, genetic deletion of PrP C or its OPR domain preserved myelin integrity and reduced oligodendrocyte loss. This indicates that PrP C , contrary to its suggested beneficial role in PNS myelination[ 17 , 19 ], acts as a promoter of CNS demyelination. This dichotomy may stem from fundamental differences between oligodendrocytes and Schwann cells[ 52 ]. Our results align with reported pathogenic roles of PrP C in conditions like renal fibrosis and myopathy, which are linked to its phase separation properties[ 33 , 53 ]. Furthermore, evidence that anti-OPR antibodies reverse myelin damage in other contexts[ 54 , 55 ] strongly implicates the OPR region as a key mediator of neurotoxicity. The neurotoxicity mediated by PrP C overexpression appears distinct from infectious prion diseases, instead resembling a "PrP proteinopathy" driven by a toxic gain-of-function[ 56 ]. While PrP C 's biological function remains enigmatic, it is known that aberrant cross-linking can trigger rapid apoptosis[ 57 ], suggesting it can shift from a protective to a toxic molecule under certain conditions. A central finding of our work is that the demyelinating effect of PrP C is microglia-dependent. We propose a mechanism whereby elevated PrP C upregulates the TREM2-TYROBP axis, a key immune regulator. This in turn triggers pro-inflammatory cytokine production via NF-κB and TLR4 pathways, culminating in inflammatory demyelination. This aligns with studies showing that misfolded PrP activates neuroinflammation through TREM2 and that PrP C silencing dampens the microglial response. Importantly, our data identify the OPR region as the critical toxic domain within PrP C . As a copper-binding site, this region may induce endoplasmic reticulum stress and apoptosis; an imbalance in copper homeostasis could be a contributing factor. Several limitations must be acknowledged. These findings are currently confined to animal models, and validation in human clinical samples is essential. Furthermore, the precise conformational changes in PrP C that trigger its toxic gain-of-function require further investigation. Future research should also explore the potential role of PrP C in remyelination. In conclusion, our study establishes PrP C as a pivotal promoter of CNS demyelination. It functions by upregulating the microglial TREM2-TYROBP axis, driving a neuroinflammatory cascade that leads to myelin destruction. The octapeptide repeat region of PrP C is identified as a critical mediator of this toxicity, presenting a promising target for novel therapeutic strategies in demyelinating diseases like multiple sclerosis. Abbreviations CNS: central nervous system CPZ: cuprizone Cc: corpus callosum Cb: cerebellum EAE: experimental autoimmune encephalomyelitis EPM: elevated plus maze H&E: hematoxylin and eosin IFN-γ: interferon-γ IHC: immunohistochemistry LFB: luxol fast blue LPS: lipopolysaccharide MBP: myelin basic protein M-CSF: macrophage colony-stimulating factor MFI: mean fluorescence intensity MS: multiple sclerosis NLRP3: NOD-like receptor thermal protein domain-containing protein 3 NF-κB: nuclear factor kappa-B OPR: octapeptide repeat region OPCs: oligodendrocyte progenitor cells OFT: open field test PrP C : cellular prion protein PNS: peripheral nervous system PPI: protein-protein interaction PDGFR-α: platelet-derived growth factor receptor alpha RT: rotarod test TREM2: Triggering Receptor Expressed on Myeloid Cells 2 TLR4: toll-like receptor 4 Declarations Author information Qing Li, Pengcheng Huan and Jinqiong Zhan contributed equally to this work. Authors and Affiliations Institute of Neurology and Department of Neurology, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, Nanchang 330006, Jiangxi Province, China Qing Li, Pengcheng Huang, Hancun Yi, Zihao Zhang, Daojun Hong, Xiaomu Wu, Wen-Quan Zou Jiangxi Mental Hospital & Affiliated Mental Hospital, Jiangxi Medical College, Nanchang University, Nanchang 330029, Jiangxi, China Jinqiong Zhan, Yuanjian Yang Department of Neurology, The First Hospital of Jilin University, Changchun, China Pingping Shen Institute of Nuclear Medicine Molecular Imaging, Binzhou Medical University Hospital, Binzhou 256603, Shandong Province, China Yanming Wang Beijing Institute for Brain Research, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, 102206, China Jiyan Ma Chinese Institute for Brain Research, Beijing, 102206, China Jiyan Ma Jiangxi Provincial Institute of Neurology, Nanchang 330006, Jiangxi Province, China Xiaomu Wu Contributions W.Q.Z. conceived, designed, and supervised the study. Q.L. did all experiments and data analyses. Q.L., P.H. and H.Y. prepared mice. J.M. provided Prnp -KO and Prnp -OPR de mice. Z.Z. and P.S. participated in data analysis. J.Z. and Y.Y. helped animal care and breeding. Q.L. wrote the first version of the manuscript. W.Q.Z. and P.H. reviewed and made major revision. Y.W. compared brain pathology with brain imaging. W.Q.Z., Y.Y., D.H. and X.W. contributed to the funding acquisition for the study. All authors critically reviewed, revised, and approved the final version of the manuscript. Corresponding authors Correspondence to Wen-Quan Zou, Xiaomu Wu or Jiyan Ma. Ethics Declarations Ethics approval and consent to participate All animal experimental protocols were approved by the Ethics Committee for Animal Experimentation of the First Affiliated Hospital of Nanchang University (approval number: CDYFY-IACUC-202505GR027) and followed the National Institutes of Health (NIH) guidelines for the care and use of laboratory animals. Consent for publication Not applicable. Competing interests The authors declare that they have no conflict of interest. Additional information Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Funding This work was partially supported by the startup package and developmental funds of the First Affiliated Hospital of Nanchang University (#500021001, #500021002), National Natural Science Foundation (NSFC) (82471499) to WQZ, and Jiangxi Key Laboratory of Neurological Diseases (2024SSY06072) to DH and WQZ, as well as NSFC (82271557) to YY. Acknowledgement The authors wanted to thank Yifan Wang and Jin Lin for their experiment supports. Data Availability All datasets generated and/or analyzed during the current study are available from the last corresponding author on reasonable request. References Lassmann H: Multiple Sclerosis Pathology . Cold Spring Harbor perspectives in medicine 2018, 8 (3). Oh J, Vidal-Jordana A, Montalban X: Multiple sclerosis: clinical aspects . Curr Opin Neurol 2018, 31 (6):752-759. Bierhansl L, Hartung HP, Aktas O, Ruck T, Roden M, Meuth SG: Thinking outside the box: non-canonical targets in multiple sclerosis . Nature reviews Drug discovery 2022, 21 (8):578-600. Koch-Henriksen N, Magyari M: Apparent changes in the epidemiology and severity of multiple sclerosis . Nature reviews Neurology 2021, 17 (11):676-688. Healy LM, Stratton JA, Kuhlmann T, Antel J: The role of glial cells in multiple sclerosis disease progression . Nature reviews Neurology 2022, 18 (4):237-248. Ghorbani S, Yong VW: The extracellular matrix as modifier of neuroinflammation and remyelination in multiple sclerosis . Brain : a journal of neurology 2021, 144 (7):1958-1973. Maheshwari A, Janssens K, Bogie J, Van Den Haute C, Struys T, Lambrichts I, Baekelandt V, Stinissen P, Hendriks JJ, Slaets H et al : Local overexpression of interleukin-11 in the central nervous system limits demyelination and enhances remyelination . Mediators of inflammation 2013, 2013 :685317. Liñares D, Taconis M, Maña P, Correcha M, Fordham S, Staykova M, Willenborg DO: Neuronal nitric oxide synthase plays a key role in CNS demyelination . The Journal of neuroscience : the official journal of the Society for Neuroscience 2006, 26 (49):12672-12681. Kwon HS, Koh SH: Neuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes . Transl Neurodegener 2020, 9 (1):42. Lyman M, Lloyd DG, Ji X, Vizcaychipi MP, Ma D: Neuroinflammation: the role and consequences . Neuroscience research 2014, 79 :1-12. Prusiner SB: Prions . Proceedings of the National Academy of Sciences of the United States of America 1998, 95 (23):13363-13383. Sigurdson CJ, Bartz JC, Glatzel M: Cellular and Molecular Mechanisms of Prion Disease . Annual review of pathology 2019, 14 :497-516. Lu ZY, Baker CA, Manuelidis L: New molecular markers of early and progressive CJD brain infection . Journal of cellular biochemistry 2004, 93 (4):644-652. Mariante RM, Nóbrega A, Martins RAP, Areal RB, Bellio M, Linden R: Neuroimmunoendocrine regulation of the prion protein in neutrophils . The Journal of biological chemistry 2012, 287 (42):35506-35515. Ding T, Zhou X, Kouadir M, Shi F, Yang Y, Liu J, Wang M, Yin X, Yang L, Zhao D: Cellular prion protein participates in the regulation of inflammatory response and apoptosis in BV2 microglia during infection with Mycobacterium bovis . Journal of molecular neuroscience : MN 2013, 51 (1):118-126. Wu GR, Mu TC, Gao ZX, Wang J, Sy MS, Li CY: Prion protein is required for tumor necrosis factor α (TNFα)-triggered nuclear factor κB (NF-κB) signaling and cytokine production . The Journal of biological chemistry 2017, 292 (46):18747-18759. Bremer J, Baumann F, Tiberi C, Wessig C, Fischer H, Schwarz P, Steele AD, Toyka KV, Nave KA, Weis J et al : Axonal prion protein is required for peripheral myelin maintenance . Nat Neurosci 2010, 13 (3):310-318. Nishida N, Tremblay P, Sugimoto T, Shigematsu K, Shirabe S, Petromilli C, Erpel SP, Nakaoke R, Atarashi R, Houtani T et al : A mouse prion protein transgene rescues mice deficient for the prion protein gene from purkinje cell degeneration and demyelination . Laboratory investigation; a journal of technical methods and pathology 1999, 79 (6):689-697. Skedsmo FS, Malachin G, Våge DI, Hammervold MM, Salvesen Ø, Ersdal C, Ranheim B, Stafsnes MH, Bartosova Z, Bruheim P et al : Demyelinating polyneuropathy in goats lacking prion protein . FASEB journal : official publication of the Federation of American Societies for Experimental Biology 2020, 34 (2):2359-2375. Piazza M, Prior TW, Khalsa PS, Appleby B: A case report of genetic prion disease with two different PRNP variants . Molecular genetics & genomic medicine 2020, 8 (3):e1134. Williams SK, Fairless R, Weise J, Kalinke U, Schulz-Schaeffer W, Diem R: Neuroprotective effects of the cellular prion protein in autoimmune optic neuritis . The American journal of pathology 2011, 178 (6):2823-2831. van Rheede T, Smolenaars MM, Madsen O, de Jong WW: Molecular evolution of the mammalian prion protein . Molecular biology and evolution 2003, 20 (1):111-121. Brown DR, Qin K, Herms JW, Madlung A, Manson J, Strome R, Fraser PE, Kruck T, von Bohlen A, Schulz-Schaeffer W et al : The cellular prion protein binds copper in vivo . Nature 1997, 390 (6661):684-687. Stöckel J, Safar J, Wallace AC, Cohen FE, Prusiner SB: Prion protein selectively binds copper (II) ions . Biochemistry 1998, 37 (20):7185-7193. Viles JH, Cohen FE, Prusiner SB, Goodin DB, Wright PE, Dyson HJ: Copper binding to the prion protein: structural implications of four identical cooperative binding sites . Proceedings of the National Academy of Sciences of the United States of America 1999, 96 (5):2042-2047. Zhang Y, Yan R, Zhang X, Ma J: Disease-Associated Q159X Mutant Prion Protein Is Sufficient to Cause Fatal Degenerative Disease in Mice . Molecular neurobiology 2024, 61 (12):10517-10528. Zirngibl M, Assinck P, Sizov A, Caprariello AV, Plemel JR: Oligodendrocyte death and myelin loss in the cuprizone model: an updated overview of the intrinsic and extrinsic causes of cuprizone demyelination . Mol Neurodegener 2022, 17 (1):34. Luoqian J, Yang W, Ding X, Tuo QZ, Xiang Z, Zheng Z, Guo YJ, Li L, Guan P, Ayton S et al : Ferroptosis promotes T-cell activation-induced neurodegeneration in multiple sclerosis . Cellular & molecular immunology 2022, 19 (8):913-924. Wang M, Caryotakis SE, Smith GG, Nguyen AV, Pleasure DE, Soulika AM: CSF1R antagonism results in increased supraspinal infiltration in EAE . J Neuroinflammation 2024, 21 (1):103. Jeffries MA, McLane LE, Khandker L, Mather ML, Evangelou AV, Kantak D, Bourne JN, Macklin WB, Wood TL: mTOR Signaling Regulates Metabolic Function in Oligodendrocyte Precursor Cells and Promotes Efficient Brain Remyelination in the Cuprizone Model . The Journal of neuroscience: the official journal of the Society for Neuroscience 2021, 41 (40):8321-8337. Lin J, Lan L, Wang D, Qiu B, Fan Y: Cerebral Venous Collagen Remodeling in a Modified White Matter Lesions Animal Model . Neuroscience 2017, 367 :72-84. Bignon Y, Poindessous V, Lazareth H, Passet B, Vilotte JL, Djouadi F, Mouillet-Richard S, Pallet N: The cellular prion protein is a stress protein secreted by renal tubular cells and a urinary marker of kidney injury . Cell Death Dis 2020, 11 (4):243. Long T, Lu Y, Ma Y, Song Y, Yi X, Chen X, Zhou M, Ma J, Chen J, Liu Z et al : Condensation of cellular prion protein promotes renal fibrosis through the TBK1-IRF3 signaling axis . Science translational medicine 2025, 17 (794):eadj9095. Xiao Y, Czopka T: Myelination-independent functions of oligodendrocyte precursor cells in health and disease . Nat Neurosci 2023, 26 (10):1663-1669. Rivest S: Regulation of innate immune responses in the brain . Nat Rev Immunol 2009, 9 (6):429-439. Ransohoff RM, Perry VH: Microglial physiology: unique stimuli, specialized responses . Annu Rev Immunol 2009, 27 :119-145. Tremblay M, Stevens B, Sierra A, Wake H, Bessis A, Nimmerjahn A: The role of microglia in the healthy brain . The Journal of neuroscience : the official journal of the Society for Neuroscience 2011, 31 (45):16064-16069. Schirmer L, Schafer DP, Bartels T, Rowitch DH, Calabresi PA: Diversity and Function of Glial Cell Types in Multiple Sclerosis . Trends in immunology 2021, 42 (3):228-247. Singh S, Metz I, Amor S, van der Valk P, Stadelmann C, Brück W: Microglial nodules in early multiple sclerosis white matter are associated with degenerating axons . Acta Neuropathol 2013, 125 (4):595-608. Zheng H, Jia L, Liu CC, Rong Z, Zhong L, Yang L, Chen XF, Fryer JD, Wang X, Zhang YW et al : TREM2 Promotes Microglial Survival by Activating Wnt/β-Catenin Pathway . The Journal of neuroscience : the official journal of the Society for Neuroscience 2017, 37 (7):1772-1784. Cantoni C, Bollman B, Licastro D, Xie M, Mikesell R, Schmidt R, Yuede CM, Galimberti D, Olivecrona G, Klein RS et al : TREM2 regulates microglial cell activation in response to demyelination in vivo . Acta Neuropathol 2015, 129 (3):429-447. Lee CYD, Daggett A, Gu X, Jiang LL, Langfelder P, Li X, Wang N, Zhao Y, Park CS, Cooper Y et al : Elevated TREM2 Gene Dosage Reprograms Microglia Responsivity and Ameliorates Pathological Phenotypes in Alzheimer's Disease Models . Neuron 2018, 97 (5):1032-1048.e1035. Molloy EJ: Triggering Receptor Expressed on Myeloid Cells (TREM) family and the application of its antagonists . Recent patents on anti-infective drug discovery 2009, 4 (1):51-56. Quan DN, Cooper MD, Potter JL, Roberts MH, Cheng H, Jarvis GA: TREM-2 binds to lipooligosaccharides of Neisseria gonorrhoeae and is expressed on reproductive tract epithelial cells . Mucosal immunology 2008, 1 (3):229-238. Turnbull IR, Colonna M: Activating and inhibitory functions of DAP12 . Nat Rev Immunol 2007, 7 (2):155-161. Lanier LL, Corliss BC, Wu J, Leong C, Phillips JH: Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells . Nature 1998, 391 (6668):703-707. Mecca C, Giambanco I, Donato R, Arcuri C: Microglia and Aging: The Role of the TREM2-DAP12 and CX3CL1-CX3CR1 Axes . Int J Mol Sci 2018, 19 (1). Shao Y, Chen C, Zhu T, Sun Z, Li S, Gong L, Dong X, Shen W, Zeng L, Xie Y et al : TRPM2 contributes to neuroinflammation and cognitive deficits in a cuprizone-induced multiple sclerosis model via NLRP3 inflammasome . Neurobiol Dis 2021, 160 :105534. McLennan NF, Brennan PM, McNeill A, Davies I, Fotheringham A, Rennison KA, Ritchie D, Brannan F, Head MW, Ironside JW et al : Prion protein accumulation and neuroprotection in hypoxic brain damage . The American journal of pathology 2004, 165 (1):227-235. Weise J, Crome O, Sandau R, Schulz-Schaeffer W, Bähr M, Zerr I: Upregulation of cellular prion protein (PrPc) after focal cerebral ischemia and influence of lesion severity . Neurosci Lett 2004, 372 (1-2):146-150. Shyu WC, Lin SZ, Chiang MF, Ding DC, Li KW, Chen SF, Yang HI, Li H: Overexpression of PrPC by adenovirus-mediated gene targeting reduces ischemic injury in a stroke rat model . The Journal of neuroscience : the official journal of the Society for Neuroscience 2005, 25 (39):8967-8977. Nave KA, Werner HB: Myelination of the nervous system: mechanisms and functions . Annual review of cell and developmental biology 2014, 30 :503-533. Tao J, Zeng Y, Dai B, Liu Y, Pan X, Wang LQ, Chen J, Zhou Y, Lu Z, Xie L et al : Excess PrP(C) inhibits muscle cell differentiation via miRNA-enhanced liquid-liquid phase separation implicated in myopathy . Nat Commun 2023, 14 (1):8131. Scalabrino G, Veber D: Myelin damage due to local quantitative abnormalities in normal prion levels: evidence from subacute combined degeneration and multiple sclerosis . Journal of neurology 2014, 261 (8):1451-1460. Scalabrino G, Mutti E, Veber D, Rodriguez Menendez V, Novembrino C, Calligaro A, Tredici G: The octapeptide repeat PrP(C) region and cobalamin-deficient polyneuropathy of the rat . Muscle Nerve 2011, 44 (6):957-967. Harris DA, True HL: New insights into prion structure and toxicity . Neuron 2006, 50 (3):353-357. Mouillet-Richard S, Ermonval M, Chebassier C, Laplanche JL, Lehmann S, Launay JM, Kellermann O: Signal transduction through prion protein . Science 2000, 289 (5486):1925-1928. Additional Declarations No competing interests reported. Supplementary Files LietalSupplementarymaterials24Sept2025.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7704970","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":528909368,"identity":"8b8cd3ad-f27f-40c9-910d-2b6f77d1bd81","order_by":0,"name":"Qing Li","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Li","suffix":""},{"id":528909369,"identity":"0c06e09d-40b0-46b1-aa44-a752060dabd8","order_by":1,"name":"Pengcheng Huang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Pengcheng","middleName":"","lastName":"Huang","suffix":""},{"id":528909370,"identity":"d3b8c2b4-cd43-49f0-aa28-084d44270da3","order_by":2,"name":"Jinqiong Zhan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jinqiong","middleName":"","lastName":"Zhan","suffix":""},{"id":528909371,"identity":"3b514e38-9e96-48e4-be50-ef8b3155e76c","order_by":3,"name":"Hancun Yi","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Hancun","middleName":"","lastName":"Yi","suffix":""},{"id":528909372,"identity":"965e8c21-ba0b-4ca6-a003-4835bc36cbe6","order_by":4,"name":"Zihao Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zihao","middleName":"","lastName":"Zhang","suffix":""},{"id":528909373,"identity":"573b7a8b-8514-4085-8928-c7aace804c46","order_by":5,"name":"Pingping Shen","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Pingping","middleName":"","lastName":"Shen","suffix":""},{"id":528909374,"identity":"bfc85639-05ed-43a5-baf1-2b2333cf1ff1","order_by":6,"name":"Yuanjian Yang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yuanjian","middleName":"","lastName":"Yang","suffix":""},{"id":528909375,"identity":"e9ad10de-29e4-4396-8ae9-7ae00caba3f5","order_by":7,"name":"Yanming Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yanming","middleName":"","lastName":"Wang","suffix":""},{"id":528909376,"identity":"f1f76416-50f5-4d62-9842-87e330b54dd7","order_by":8,"name":"Daojun Hong","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Daojun","middleName":"","lastName":"Hong","suffix":""},{"id":528909377,"identity":"400bf8f1-13e6-4445-a810-caade50543cd","order_by":9,"name":"Jiyan Ma","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Jiyan","middleName":"","lastName":"Ma","suffix":""},{"id":528909378,"identity":"bdf70501-9185-4c4d-8fe9-dc975769ac2f","order_by":10,"name":"Xiaomu Wu","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xiaomu","middleName":"","lastName":"Wu","suffix":""},{"id":528909379,"identity":"41b6d188-e178-4819-a112-02340f7168ee","order_by":11,"name":"Wenquan Zou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYHAD5gMQ+gDxWtgSSNbCY0CcFoPjvQdv89TcseeXyPn24GcbgxzfjQTGzwX4tJw5l2zNc+wZs+SM3O2GvW0MxpI3EpilZ+DRYnYjx0yah+0wm8GN3G3SjG0MiRtuJLAx8+DTcv8NUMu/wzwGN3KegbTUE9Zyg8dMmrftsARQCxtIS4IBIS32Z3KMLef2HTaQ7HlmJtlzTsJw5pmHzdL4tEi2nzG88ebbYXt+9uRnEj/KbOT5jicf/IxPCwhIoLEZGwhoQNUyCkbBKBgFowATAACKz0edFP4EOAAAAABJRU5ErkJggg==","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Wenquan","middleName":"","lastName":"Zou","suffix":""}],"badges":[],"createdAt":"2025-09-24 14:53:50","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7704970/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7704970/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93565041,"identity":"a2ea52a5-e86d-4f02-927d-645ac023183c","added_by":"auto","created_at":"2025-10-15 08:22:03","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23317845,"visible":true,"origin":"","legend":"","description":"","filename":"LietalPrPCuprizoneDemyelination24Sept2025Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/7d469290306b7a9692247e91.docx"},{"id":93566230,"identity":"81da80c5-5ac6-4260-8a43-6f10ab5823ef","added_by":"auto","created_at":"2025-10-15 08:30:04","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12140,"visible":true,"origin":"","legend":"","description":"","filename":"c272f2759a4a4a1e8b711fa2beb81df2.json","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/18b7500adaeff0b452d7e81d.json"},{"id":93566227,"identity":"5188c984-9cf2-40e2-8a5b-3153f5c2527a","added_by":"auto","created_at":"2025-10-15 08:30:04","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5650394,"visible":true,"origin":"","legend":"","description":"","filename":"LietalSupplementarymaterials24Sept2025.docx","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/12f9cdcb1ae697f8f81fb999.docx"},{"id":93565034,"identity":"8f1e0c0f-c11d-406b-a543-d3958b11cf26","added_by":"auto","created_at":"2025-10-15 08:22:02","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":176422,"visible":true,"origin":"","legend":"","description":"","filename":"c272f2759a4a4a1e8b711fa2beb81df21enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/98ecec626339a6879e8e432e.xml"},{"id":93565054,"identity":"a0bd839d-66ec-4619-b60e-b7ed5aa365d9","added_by":"auto","created_at":"2025-10-15 08:22:03","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3107434,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/a43e3a36435b29c5f1d0cc30.jpeg"},{"id":93565061,"identity":"5835d71e-0f7a-4d38-b812-a7a6afdfa95d","added_by":"auto","created_at":"2025-10-15 08:22:04","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3352330,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/54d813457a37ffbdde42a313.jpeg"},{"id":93565065,"identity":"a2a288f5-95dc-4531-b806-0ed2b297ed7a","added_by":"auto","created_at":"2025-10-15 08:22:04","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3984412,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/cd727e2fefc53e070c38cdca.jpeg"},{"id":93565066,"identity":"c44a46b8-7ec2-438a-97ce-d611e8a7d0bf","added_by":"auto","created_at":"2025-10-15 08:22:04","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3449444,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/4a1d55fd854ca7dd44213f36.jpeg"},{"id":93565069,"identity":"730ab0bd-b4d3-446d-bef0-7ecbe99bfd7e","added_by":"auto","created_at":"2025-10-15 08:22:04","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3036040,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/d488496ca7396ded58679606.jpeg"},{"id":93565072,"identity":"76760adc-e603-4ae4-a240-ee854222cbed","added_by":"auto","created_at":"2025-10-15 08:22:05","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3747164,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/6eb15ec43e7c6cf1bbde93bf.jpeg"},{"id":93565056,"identity":"782d7287-7894-440a-8e43-cb2eeb2a82f4","added_by":"auto","created_at":"2025-10-15 08:22:04","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2500744,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/29f06d3cede93b03c393261e.jpeg"},{"id":93566229,"identity":"314ca17f-5eb8-4365-9b15-7db9ec0de16a","added_by":"auto","created_at":"2025-10-15 08:30:04","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":340676,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/90d74396a5c57c0e1bc479bc.png"},{"id":93566233,"identity":"cd1b0243-0ee5-401e-b0c4-20a6b65a70bb","added_by":"auto","created_at":"2025-10-15 08:30:05","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":357665,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/e0097694a5682c50ecdda9f2.png"},{"id":93566232,"identity":"241886d7-e33e-4387-945e-171b68b87197","added_by":"auto","created_at":"2025-10-15 08:30:04","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":478608,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/edf9f2b2e6b6823349d75d3e.png"},{"id":93566231,"identity":"9e174c37-3e14-4733-898e-0e6aee3632c3","added_by":"auto","created_at":"2025-10-15 08:30:04","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":460944,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/12e970d7942ee10dc46f489a.png"},{"id":93565074,"identity":"1d912d2d-70f2-474b-bf0d-d9b88b0d5403","added_by":"auto","created_at":"2025-10-15 08:22:05","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":367297,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/d432442edf06307c53b178a2.png"},{"id":93566226,"identity":"4eb42cc0-e013-409d-b2bd-a8398de5ac72","added_by":"auto","created_at":"2025-10-15 08:30:03","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":425244,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/7dfb93373e1c4972ac2e94da.png"},{"id":93565050,"identity":"f47bba4e-2d68-4288-93fc-58a4b6b0450b","added_by":"auto","created_at":"2025-10-15 08:22:03","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":288750,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/b8ca6722d61dc8e7bb8f8b03.png"},{"id":93565062,"identity":"ae6a6332-14d7-4631-89a0-d43a7a1dfdc9","added_by":"auto","created_at":"2025-10-15 08:22:04","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":176670,"visible":true,"origin":"","legend":"","description":"","filename":"c272f2759a4a4a1e8b711fa2beb81df21structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/003c0b3bcb2bad67aded6d7f.xml"},{"id":93566228,"identity":"19a58b86-f6ca-457d-9aa8-8fc6dc4035b5","added_by":"auto","created_at":"2025-10-15 08:30:04","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":192574,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/9fdbd01c46e92b55c7fdc449.html"},{"id":93565051,"identity":"f2db9acd-143d-49fb-9cef-b8c9d7c04395","added_by":"auto","created_at":"2025-10-15 08:22:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1364217,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePrP\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003eC\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e is up-regulated in mouse model of demyelination induced by cuprizone. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Experimental timeline: mice were fed a 0.4% cuprizone (CPZ) or control (CON) diet for 6 weeks. (\u003cstrong\u003eB\u003c/strong\u003e) Mean body weight of CPZ- or CON-treated mice 5 mice/group. Two-way ANOVA with Sidak’s multiple comparisons test was used. (\u003cstrong\u003eC\u003c/strong\u003e) Representative LFB staining of sagittal brain sections from the corpus callosum (Cc) and cerebellum (Cb), showing demyelination. The red rectangle indicates the enlarged area in overview images. The black dashed line outlines the Cc. Scale bars = 50 μm (Cc) and 100 μm (Cb). (\u003cstrong\u003eD\u003c/strong\u003e) Demyelination scores based on the following criteria: 0, normal, 1, disordered nerve fibers, 2, formation of distinct vacuoles, 3, disappearance of myelin fibers. 5 mice/group. (\u003cstrong\u003eE\u003c/strong\u003e) Representative immunohistochemical staining of PrP\u003csup\u003eC\u003c/sup\u003e in Cc and Cb. The red rectangle indicates the enlarged area in overview images. The black dashed line indicates the Cc. Scale bars = 50 μm. (\u003cstrong\u003eF\u003c/strong\u003e) Densitometric quantification of PrP\u003csup\u003eC\u003c/sup\u003e staining intensity N = 5 mice/group. (\u003cstrong\u003eG\u003c/strong\u003e) \u003cem\u003ePrnp\u003c/em\u003e mRNA levels in Cc and Cb tissues at week 6, measured by RT‑qPCR 6 mice/group. Data are represented as means ± SEM. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001; ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001. Unpaired \u003cem\u003et\u003c/em\u003e test was used for panels (\u003cstrong\u003eD\u003c/strong\u003e), (\u003cstrong\u003eF\u003c/strong\u003e), and (\u003cstrong\u003eG\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/bd24891d18c3b01da90129af.png"},{"id":93565067,"identity":"3a045a99-dc06-44a1-a109-b22e5904f05b","added_by":"auto","created_at":"2025-10-15 08:22:04","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1665005,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockout and OPR-deletion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePrnp\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mitigates demyelination induced by cuprizone in mice.\u003c/strong\u003e \u003cem\u003ePrnp\u003c/em\u003e-KO (knockout), \u003cem\u003ePrnp\u003c/em\u003e-OPR (OPR-deletion), and \u003cem\u003ePrnp\u003c/em\u003e-WT (wild-type) mice were fed a CPZ or CON diet for 6 weeks. (\u003cstrong\u003eA\u003c/strong\u003e) Mean body weight of male mice across genotypes. 7–26 mice/group. Two-way ANOVA with Tukey’s multiple comparisons test. (\u003cstrong\u003eB\u003c/strong\u003e) Representative LFB staining of sagittal brain sections from the Cc and Cb, showing myelination. The red rectangle indicates the enlarged area in overview images. The black dashed line outlines the Cc. Scale bars = 50 μm (Cc) and 100 μm (Cb). (\u003cstrong\u003eC\u003c/strong\u003e) Demyelination scores in Cc and Cb based on LFB staining. (\u003cstrong\u003eD\u003c/strong\u003e) Representative immunohistochemical staining of MBP in Cc and Cb. The red rectangle indicates the enlarged area in overview images. The black dashed line indicates the Cc. Scale bars = 50 μm (Cc) and 100 μm (Cb). 8–11 mice/group. (\u003cstrong\u003eE\u003c/strong\u003e) Densitometric quantification of MBP staining intensity in Cc and Cb. 8–11 mice/group. Western blotting (\u003cstrong\u003eF\u003c/strong\u003e) and quantification (\u003cstrong\u003eG\u003c/strong\u003e) of MBP protein levels in Cc and Cb. 5–6 mice/per group. Data are represented as means ± SEM. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001; ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001. One-way ANOVA with Tukey’s multiple comparisons test was used panels (\u003cstrong\u003eC\u003c/strong\u003e), (\u003cstrong\u003eE\u003c/strong\u003e) and (\u003cstrong\u003eG\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/670afc9cf7d29736b9aba9df.png"},{"id":93565049,"identity":"fe246363-f427-414c-9695-df97e835b4ae","added_by":"auto","created_at":"2025-10-15 08:22:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2166586,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockout and OPR-deletion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePrnp\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e reduce the death of oligodendrocytes in CPZ-treated mice.\u003c/strong\u003eWestern blotting (\u003cstrong\u003eA\u003c/strong\u003e) and quantification (\u003cstrong\u003eB\u003c/strong\u003e) of the oligodendrocyte marker Olig2 in Cc and Cb tissues from CON- or CPZ-treated mice. 4–6 mice/group. (\u003cstrong\u003eC\u003c/strong\u003e) Representative immunofluorescence staining of the mature oligodendrocytes marker CC1 (red) in Cc and Cb. Nuclei were stained with DAPI (blue). Scale bars = 100 μm. (\u003cstrong\u003eD\u003c/strong\u003e) Quantification of CC1 mean fluorescence intensity (MFI) in Cc and Cb. 4 mice/group. (\u003cstrong\u003eE\u003c/strong\u003e) Representative immunofluorescence staining of oligodendrocyte precursor cells marker PDGFR-α (green) in Cc and Cb. Nuclei were stained with DAPI (blue). Scale bars = 50 μm. (\u003cstrong\u003eF\u003c/strong\u003e) Quantification of PDGFR-α MFI in Cc and Cb. 5 mice/group. Data are represented as means ± SEM. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001; ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001. One-way ANOVA with Tukey’s multiple comparisons test was used for panels (\u003cstrong\u003eB\u003c/strong\u003e), (\u003cstrong\u003eD\u003c/strong\u003e) and (\u003cstrong\u003eF\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/1618090077ff137509ea223b.png"},{"id":93565040,"identity":"b9de0add-1213-42b2-8b50-6896c68cbe96","added_by":"auto","created_at":"2025-10-15 08:22:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2079293,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockout and OPR-deletion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePrnp\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e alleviates the activation of microglia in CPZ-treated mice.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Experimental workflow for transcriptomic sequencing of brain tissues from CPZ-treated mice. (\u003cstrong\u003eB\u003c/strong\u003e) WikiPathways bubble chart analysis of differentially expressed genes, showing significant alterations in microglial activation when comparing CPZ-treated vs. CON-treated WT mice, CPZ-treated OPR-deletion vs. WT mice, and CPZ-treated KO vs. WT mice. (\u003cstrong\u003eC\u003c/strong\u003e) Representative immunofluorescence staining of the microglia marker IBA1 (green) in the Cc and Cb. Nuclei were stained with DAPI (blue). Scale bars = 20 μm (Cc) and 100 μm (Cb). (\u003cstrong\u003eD\u003c/strong\u003e) Quantification of IBA1 mean fluorescence intensity (MFI) in Cc and Cb. 6 mice/group. One-way ANOVA with Tukey’s multiple comparisons test was used. (\u003cstrong\u003eE\u003c/strong\u003e) Representative dual immunofluorescence staining of IBA1 (green) and MBP (red) in Cc and Cb. Nuclei were stained with DAPI (blue). Scale bars = 50 μm (Cc) and 100 μm (Cb). Data represent means ± SEM. **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/18d32b9a7e09cc5a15b933a4.png"},{"id":93565058,"identity":"65dca146-9691-419c-b918-12dc93de17a0","added_by":"auto","created_at":"2025-10-15 08:22:04","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1883154,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTREM2 up-expression in CPZ-treated mice is ablated by knockout and OPR-deletion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePrnp\u003c/strong\u003e\u003c/em\u003e. (\u003cstrong\u003eA\u003c/strong\u003e) Volcano plots from RNA-seq analysis depicting differentially expressed genes (DEGs) in CPZ-treated mice. GO analysis of DEGs shows higher (red) or lower (blue) \u003cem\u003eTrem2\u003c/em\u003e expression in brain tissues from CPZ- vs. CON-treated WT mice, CPZ-treated OPR-deletion vs. WT mice, and CPZ-treated KO vs. WT mice. (\u003cstrong\u003eB\u003c/strong\u003e) \u003cem\u003eTrem2\u003c/em\u003e mRNA levels in Cc and Cb of CPZ- or CON-treated mice, measured by RT‑qPCR 5 mice/group. Western blotting (\u003cstrong\u003eC\u003c/strong\u003e) and quantification (\u003cstrong\u003eD\u003c/strong\u003e) of TREM2 protein in Cc and Cb tissues. 4–6 mice/group. (\u003cstrong\u003eE\u003c/strong\u003e) Representative dual immunofluorescence staining of TREM2 (green) and IBA1 (red) in Cc and Cb. The red rectangle highlights regions of IBA1 and TREM2 co-localization. Nuclei were stained with DAPI (blue). Scale bars = 20 μm (Cc) and 100 μm (Cb). (\u003cstrong\u003eF\u003c/strong\u003e) Spatial overlap of IBA1 and TREM2 fluorescence signals in CPZ-treated WT mice. Co-localization was analyzed using Leica confocal imaging software. Data are represented as means ± SEM. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001. One-way ANOVA with Tukey’s multiple comparisons test was used for panels (\u003cstrong\u003eB\u003c/strong\u003e) and (\u003cstrong\u003eD\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/04f1d7125bc4d2d3b1a92ce8.png"},{"id":93565038,"identity":"28f6e069-1294-4707-996d-b161abb973d0","added_by":"auto","created_at":"2025-10-15 08:22:02","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2310975,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockout and OPR-deletion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePrnp\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e inhibit the expression of the TREM2-TYROBP molecular axis associated with microglial activation. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Heatmap indicating significant expression changes of TREM2 and TYROBP during microglial activation across groups. Rows indicate \u003cem\u003eZ\u003c/em\u003e scores calculated for each group. (\u003cstrong\u003eB\u003c/strong\u003e) mRNA abundance of TYROBP in the Cc and Cb of CPZ-treated mice, measured by RT-qPCR. 5 mice/group. Western blotting (\u003cstrong\u003eC\u003c/strong\u003e) and quantification (\u003cstrong\u003eD\u003c/strong\u003e) of TYROBP protein in Cc and Cb tissues. 5–6 mice/group. (\u003cstrong\u003eE\u003c/strong\u003e) Protein interaction network between TREM2 and TYROBP. Bold lines represent interactions; red and blue indicate up- and down-regulation, respectively. (\u003cstrong\u003eF\u003c/strong\u003e) Representative ternary immunofluorescence staining of TREM2 (green), TYROBP (red) and IBA1 (yellow) in Cc and Cb. The red rectangle highlights regions of TREM2, TYROBP, and IBA1 co-localization. Nuclei were stained with DAPI (blue). Scale bars = 20 μm (Cc) and 100 μm (Cb). (\u003cstrong\u003eG\u003c/strong\u003e) Spatial overlap of fluorescence signals for TREM2, TYROBP, and IBA1 in WT mice. Co-localization was analyzed using Leica confocal imaging software. Data are represented as means ± SEM. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001; ****\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.0001. One-way ANOVA with Tukey’s multiple comparisons test was used for panels (\u003cstrong\u003eB\u003c/strong\u003e), (\u003cstrong\u003eC\u003c/strong\u003e) and (\u003cstrong\u003eD\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/b6108f5e4b639fce13255071.png"},{"id":93566225,"identity":"d920eac2-6e22-4ae2-893b-9486d69ce3e2","added_by":"auto","created_at":"2025-10-15 08:30:03","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1831403,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCPZ-associated neuroinflammation is attenuated by knockout and OPR-deletion of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ePrnp. \u003c/strong\u003e\u003c/em\u003e(\u003cstrong\u003eA\u003c/strong\u003e) mRNA expression levels of pro-inflammatory cytokines (\u003cem\u003eTnf-α\u003c/em\u003e, \u003cem\u003eCd32\u003c/em\u003e, and \u003cem\u003eCd86\u003c/em\u003e) and anti-inflammatory cytokines (\u003cem\u003eCd206\u003c/em\u003e, \u003cem\u003eYm1/2\u003c/em\u003e, and \u003cem\u003eArg1\u003c/em\u003e) in the corpus callosum of CPZ- or CON-treated mice, measured by RT-qPCR. 5–6 mice/group. Western blotting (\u003cstrong\u003eB\u003c/strong\u003e) and quantification (\u003cstrong\u003eC\u003c/strong\u003e) of TNF-α protein in the corpus callosum. 5 mice/group. Western blotting (\u003cstrong\u003eD\u003c/strong\u003e) and quantification (\u003cstrong\u003eE\u003c/strong\u003e) of IL-6R protein in the corpus callosum. 5 mice/group. (\u003cstrong\u003eF\u003c/strong\u003e) Representative immunofluorescence staining of NLRP3 (green) in the Cc and Cb. Nuclei were stained with DAPI (blue). Scale bars = 50 μm (Cc) and 100 μm (Cb). (\u003cstrong\u003eG\u003c/strong\u003e) Quantification of the NLRP3 MFI in Cc and Cb. 5 mice/group. (\u003cstrong\u003eH\u003c/strong\u003e)ELISA measuring M-CSF and IFN-γ concentrations in peripheral blood, 5 mice/group. Western blotting (\u003cstrong\u003eI\u003c/strong\u003e) and quantification (\u003cstrong\u003eJ\u003c/strong\u003e) of IL-6R protein in mice following LPS challenge. 3 mice/group. Data are represented as means ± SEM. *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05; **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01; ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001; ****\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.0001. One-way ANOVA with Tukey’s multiple comparisons test was used for panels (\u003cstrong\u003eA\u003c/strong\u003e), (\u003cstrong\u003eC\u003c/strong\u003e), (\u003cstrong\u003eE\u003c/strong\u003e), (\u003cstrong\u003eG\u003c/strong\u003e), (\u003cstrong\u003eH\u003c/strong\u003e) and (\u003cstrong\u003eJ\u003c/strong\u003e).\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/55ae92f84c3e7730dbe95e37.png"},{"id":93566723,"identity":"b76c89c2-d71b-4f24-a952-908c5f069e35","added_by":"auto","created_at":"2025-10-15 08:38:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16835636,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/317c9ace-daba-451f-950a-b9b5018cd960.pdf"},{"id":93565055,"identity":"4372f113-bc6a-4cef-b5a3-a29137f12f89","added_by":"auto","created_at":"2025-10-15 08:22:04","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":5650394,"visible":true,"origin":"","legend":"","description":"","filename":"LietalSupplementarymaterials24Sept2025.docx","url":"https://assets-eu.researchsquare.com/files/rs-7704970/v1/039b1287381098200742227c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Cellular prion protein exacerbates brain demyelination by activating microglia through the TREM2-TYROBP axis in cuprizone-treated animals","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMultiple sclerosis (MS) is a chronic inflammatory disorder of the central nervous system (CNS) and a leading cause of non-traumatic neurological disability in adults[\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The disease is characterized by demyelination and axonal loss, resulting in impaired neural conduction. Although existing immunomodulatory therapies can modulate both peripheral and central immune responses, their ability to slow MS progression remains limited[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Thus, there is a critical need to identify novel disease-driving mechanisms intrinsic to the CNS. Disease progression in MS is fueled by persistent neuroinflammation and inadequate remyelination, wherein a toxic inflammatory microenvironment together with inhibitory signals prevent the differentiation of oligodendrocyte progenitor cells (OPCs) and compromise myelin repair[\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In this process, microglia play a pivotal role, as their chronic activation not only perpetuates demyelination but also contributes significantly to neuronal injury[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe cellular prion protein (PrP\u003csup\u003eC\u003c/sup\u003e), encoded by the \u003cem\u003ePRNP\u003c/em\u003e gene, is best known for its central role in prion diseases, wherein its misfolded scrapie isoform (PrP\u003csup\u003eSc\u003c/sup\u003e) propagates and drives neurodegeneration[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Beyond its involvement in prion disorders, PrP\u003csup\u003eC\u003c/sup\u003e has also been implicated in neuroinflammation[\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] and is essential for maintaining myelination in the peripheral nervous system (PNS)[\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. This is supported by observations of progressive peripheral demyelination observed in \u003cem\u003ePRNP\u003c/em\u003e knockout mice, goats carrying \u003cem\u003ePRNP\u003c/em\u003e mutations, and a human patient with pathogenic \u003cem\u003ePRNP\u003c/em\u003e mutations[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Notably, PrP\u003csup\u003eC\u003c/sup\u003e is upregulated in the CNS of mice with experimental autoimmune encephalomyelitis (EAE)[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], a widely used model of MS, raising the possibility that PrP\u003csup\u003eC\u003c/sup\u003e may also contribute to demyelination within the CNS\u0026mdash;a role that remains largely unexplored.\u003c/p\u003e\u003cp\u003eThe cuprizone (CPZ) dietary model, which induces reproducible demyelination in defined CNS regions, serves as a useful tool to address this question. CPZ acts as a copper chelator and may interact with the copper-binding N-terminal OPR region of PrP\u003csup\u003eC\u003c/sup\u003e[\u003cspan additionalcitationids=\"CR23 CR24\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Despite these indications, the specific contribution of PrP\u003csup\u003eC\u003c/sup\u003e to the pathogenesis of MS and related demyelinating disorders remains poorly understood.\u003c/p\u003e\u003cp\u003eIn this study, we used the CPZ-induced demyelination model to investigate the role of PrP\u003csup\u003eC\u003c/sup\u003e. Our results showed that PrP\u003csup\u003eC\u003c/sup\u003e expression is upregulated in the corpus callosum and cerebellum following CPZ challenge. Moreover, genetic ablation of PrP\u003csup\u003eC\u003c/sup\u003e or specific deletion of its OPR domain markedly alleviated demyelination. We further demonstrated that this protective effect is mediated by suppression of the microglia TREM2-TYROBP signaling axis, resulting in attenuated neuroinflammation. These findings identify PrP\u003csup\u003eC\u003c/sup\u003e as a critical promoter of CNS demyelination and highlight the TREM2-TYROBP axis as a potential therapeutic target for reducing neuroinflammation in MS.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eAnimals\u003c/h2\u003e\u003cp\u003eC57BL/6J wild-type (WT) mice were obtained from the specific pathogen-free breeding facility at Nanchang University. PrP\u003csup\u003eC\u003c/sup\u003e-null (\u003cem\u003ePrnp\u003c/em\u003e-KO) and octapeptide repeat-deleted (\u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e) mice on a C57BL/6J background were generated previously[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The \u003cem\u003ePrnp\u003c/em\u003e-KO mice lack the genomic region spanning loci 23\u0026ndash;230, while the OPR-deletion mice carry a deletion from loci 51 to 90. All animals were housed in individually ventilated cages under a 12-h light/dark cycles with ad libitum access to food and water, and were acclimated for 7 days prior to experimental. All experimental procedures were approved by the Research Ethics Committee of the First Affiliated Hospital of Nanchang University (Approval No. CDYFY-IACUC-202505GR027) and conducted in accordance with the Guidelines for the Welfare and Ethical Review of Laboratory Animals in China. Every effort was made to minimize animal suffering and distress.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eAgarose in DNA gel electrophoresis\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eAgarose in DNA gel electrophoresis\u003c/div\u003e\u003cp\u003eDNA fragments were separated and visualized by agarose gel electrophoresis. Briefly, a 2.0% agarose gel was prepared by dissolving agarose powder (Uelandy, China) in 1 \u0026times; TAE buffer containing a nucleic acid staining dye. DNA samples were mixed with 6 \u0026times; DNA loading dye and loaded into the wells of the submerged gel. The primer sequences used were as follows: \u003cem\u003ePrnp\u003c/em\u003e Forward: TGGCGAACCTTGGCTACTG, \u003cem\u003ePrnp\u003c/em\u003e Reverse: GTGCTGCTTGATGGTGATATTGA. A DNA molecular weight marker was loaded alongside the samples for size estimation. Electrophoresis was carried out until the loading dye front had migrated an appropriate distance (typically two-thirds to three-quarters of the gel length). After electrophoresis, the gel was carefully removed from the tank and visualized under ultraviolet (UV) light using a gel documentation system. Digital images were captured for further analysis. Additionally, DNA samples were subjected to Sanger sequencing analysis to distinguish between \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e and \u003cem\u003ePrnp\u003c/em\u003e-KO genotypes.\u003c/p\u003e\n\u003ch3\u003eCuprizone administration\u003c/h3\u003e\n\u003cp\u003eMale mice aged 6\u0026ndash;8 weeks (n\u0026thinsp;=\u0026thinsp;110) were fed a diet containing 0.4% cuprizone (Sigma-Aldrich, USA) mixed into standard powdered rodent chow for 6 weeks to induce demyelination[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The control mice received the same chow without cuprizone. Body weight was recorded once per week throughout the feeding period. During the fifth week, behavioral tests were conducted. At the end of the sixth week, following cuprizone treatment, all mice were euthanized and brain tissues were collected for subsequent analysis.\u003c/p\u003e\n\u003ch3\u003eExperimental autoimmune encephalomyelitis (EAE) induction\u003c/h3\u003e\n\u003cp\u003eFemale mice aged 6\u0026ndash;8-weeks were immunized via subcutaneous (s.c) injection at four sites (50 \u0026micro;l per site) with an emulsion containing 200 \u0026micro;g MOG\u003csub\u003e35\u0026thinsp;\u0026minus;\u0026thinsp;55\u003c/sub\u003e (GL Biochemistry, China) and incomplete Freund\u0026rsquo;s adjuvant (Sigma, USA) at a 1:1 ratio, supplemented with 4 mg/ml heat-killed \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (Biolead, China). Two injection sites were located along the midline of the upper back between the shoulders, and two on either side of the midline on the lower back. In addition, mice received 200 ng of pertussis toxin (List Biological Lab) intraperitoneally (i.p.) on days 0 and 2 post-immunization. Body weight was monitored daily, and clinical disease scores were assessed based on a standardized scale from 0 to 5 as previously described[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]: 0, no symptoms; 0.5, distal tail weakness; 1.0, complete tail paralysis; 1.5, tail weakness and mildly impaired righting reflex; 2.0, gait ataxia and markedly impaired righting reflex; 2.5, severe bilateral hindlimb paresis; 3.0, complete hindlimb paralysis; 3.5, complete hindlimb paralysis with mild forelimb weakness; 4.0, hindlimb paralysis and forelimb paresis; 4.5, paralysis of both hindlimbs and forelimbs; 5, moribund or deceased. Immunized control mice received emulsion without MOG\u003csub\u003e35\u0026thinsp;\u0026minus;\u0026thinsp;55\u003c/sub\u003e. All mice were euthanized on day 30, and lumbar spinal cords were collected for analysis.\u003c/p\u003e\n\u003ch3\u003eSH-SY5Y cells culture and cuprizone treatment\u003c/h3\u003e\n\u003cp\u003eThe human SH-SY5Y neuroblastoma cell line were obtained from Wuhan Procell Life Science and Technology Co., LTD. Cells were maintained in Dulbecco\u0026rsquo;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F-12; 1:1; Gibco, USA) supplemented with 10% fetal bovine serum (Gibco, USA) and 1% penicillin/streptomycin (Sigma-Aldrich, Germany), at 37\u0026deg;C in a humidified atmosphere of 95% air and 5% CO₂. Due to the low solubility of cuprizone in aqueous solutions, it was dissolved in 0.1% DMSO to prepare a 100 mM stock solution. SH-SY5Y cells were then treated with various concentrations of cuprizone (0, 20, 40, 60, 80, and 100 \u0026micro;M) for 24 hours[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Following treatment, cells were harvested for subsequent Western blot and immunofluorescence analyses.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eOpen Field Test (OFT)\u003c/h2\u003e\u003cp\u003eMotor activity was assessed using an open field test box (50 \u0026times; 50 \u0026times; 40 cm). Each mouse was placed in the center of the arena under dim lighting and allowed to explore freely for 15 min. All sessions were recorded via an infrared camera mounted above the box. Locomotor activity and time spent in the center zone were analyzed using AnyMaze software. The arena was cleaned thoroughly with 75% ethanol between trials and dried prior to each test.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eElevated Plus Maze (EPM)\u003c/h3\u003e\n\u003cp\u003eThe elevated plus maze (EPM) apparatus consisted of two open arms (44 \u0026times; 12 cm) and two enclosed arms (44 \u0026times; 12 cm), connected by a central square platform (12 \u0026times; 12 cm). The entire maze was elevated 50 cm above the floor. Each mouse was placed in the central area facing an open arm and allowed to explore freely for 5 minutes. The time spent in the open arms was recorded and analyzed using AnyMaze software. The maze was cleaned with 75% ethanol and thoroughly dried after each trial.\u003c/p\u003e\n\u003ch3\u003eRotarod Test (RT)\u003c/h3\u003e\n\u003cp\u003eMice were acclimatized in the testing room for 15 minutes prior to the experiment. Each mouse was placed on the rod initially rotating at a constant speed of 4 rpm. After a 1-minute habituation period, the rotation speed increased uniformly from 4 rpm to 40 rpm over a 5-minute period. The latency to fall was recorded for each trial. Each mouse performed three trials with at least 15 minutes between trials. The maximum duration per trial was set to 300 seconds. The final fall latency was calculated as the average of the three trials. The rod was cleaned with 75% ethanol between trials.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eHistology analysis\u003c/h2\u003e\u003cp\u003eMice were anesthetized with pentobarbitone and transcardially perfused with ice-cold PBS (0.01 M, pH 7.4). The brain and spinal cord were then carefully removed, followed by perfusion with 4% paraformaldehyde and post-fixation overnight in the same solution. Paraffin-embedded sections (4 \u0026micro;m) of brain and lumbar spinal cord tissues were prepared and stained with Luxol fast blue (LFB) to assess demyelination[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Additionally, spinal cord sections were stained with hematoxylin and eosin (H\u0026amp;E) to evaluate inflammatory infiltration.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eImmunohistochemistry and immunofluorescence staining\u003c/h2\u003e\u003cp\u003eBrain paraffin sections were deparaffinized in xylene and subjected to antigen retrieved using EDTA. For immunohistochemistry, sections were blocked with 5% bovine serum albumin in PBS for 60 minutes, followed by incubation with primary antibodies against myelin basic protein (MBP; 1:2000, #78896, CST, USA) and PrP\u003csup\u003eC\u003c/sup\u003e (1:30, sc-47730, Santa Cruz, USA) for one hour at 37\u0026deg;C. Additional immunohistochemical staining was performed for TYROBP (1:1000, ab283679, Abcam, USA). After PBS washes, sections were incubated with appropriate biotinylated secondary antibody. Signals were developed DAB substrate (Elabscience, China), scanned with an HS6 system, and quantified based on mean intensity using Image-Pro Plus software.\u003c/p\u003e\u003cp\u003eFor immunofluorescence, sections were permeabilized with 0.3% Triton X-100 (Solarbio, China) in PBS for 30 minutes and blocked in QuickBlock\u0026trade; blocking buffer (Beyotime, China) for 2 hours at room temperature. Sections were then incubated with the following primary antibodies overnight at 4\u0026deg;C: mouse anti-PrP\u003csup\u003eC\u003c/sup\u003e (1:30, sc-47730, Santa Cruz, USA), rabbit anti-IBA1 (1:1000, 019-19741, Wako, Japan), rabbit anti-GFAP (1:1000, ab7260, Abcam, UK), goat anti-PDGFR-α (1:50, AF1062, R\u0026amp;D Systems, USA), rabbit anti-CC1 (1:100, ab16794, Abcam, USA), rabbit anti-MBP (1:100, #78869, CST, USA), mouse anti-IBA1 (1:100, ab283319, Abcam, USA), sheep anti-TREM2 (1:100, AF1729, R\u0026amp;D Systems, USA), rabbit anti-TYROBP (1:50, ab283679, Abcam, USA),mouse anti-NLRP3 (1:50, 68102, Proteintech, USA), rabbit anti-NF-κB (1:100, 10745, Proteintech, USA), and mouse anti-TLR4 (1:100, 66350, Proteintech, USA). After PBS washes, sections were incubated for 2 hours at RT with Alexa Fluor 488-, 594-, or 647-conjugated secondary antibodies (1:1000, Thermo Fisher), including anti-rabbit IgG, anti-mouse IgG, anti-sheep IgG, and anti-goat IgG. Finally, sections were counterstained with DAPI (1:1000, Thermo Fisher) for 10 minutes at RT. Images were acquired using a Leica confocal microscope, and co-localization analysis was performed. Mean fluorescence intensity (MFI) was quantified with ImageJ, focusing on myelinated regions such as the corpus callosum and cerebellum.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eQuantitative real-time PCR\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted using TRIzol reagent (Sigma-Aldrich, Germany) according to the manufacturer's protocol. cDNA was synthesized from the extracted RNA using a cDNA Reverse Transcriptase Kit (Vazyme Biotech, China). The concentrations of RNA and cDNA were determined using a Nanodrop spectrophotometer (Thermo Fisher, USA). Quantitative real-time PCR was performed using corresponding primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) with SYBR Green Master Mix (Vazyme Biotech, China) on a Bio-Rad real-time PCR system (USA). The thermal cycling conditions consisted of an initial denaturation at 95\u0026deg;C for 10 min, followed by 40 cycles of 95\u0026deg;C for 15 sec and 60\u0026deg;C for 60 sec. The relative mRNA expression levels were normalized to GAPDH and analyzed using the 2^(-ΔΔCt) method. All reactions were performed in triplicate.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimers for real-time polymerase chain reaction\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ePrnp\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: GTCCCAGGCCTATTACGACG\u003c/p\u003e\u003cp\u003eReverse: ATGCGAAGGAACAAGCAGGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTrem2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: AGCACCTCCAGGCAGGTTT\u003c/p\u003e\u003cp\u003eReverse: TTGATTCCTTGGAAAGAGGAGGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTyrobp\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: CCCAAGATGCGACTGTTCTTC\u003c/p\u003e\u003cp\u003eReverse: GTCCCTTGACCTCGGGAGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eTnf-α\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: CAGGCGGTGCCTATGTCTC\u003c/p\u003e\u003cp\u003eReverse: CGATCACCCCGAAGTTCAGTAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCd32\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: AATCCTGCCGTTCCTACTGATC\u003c/p\u003e\u003cp\u003eReverse: GTGTCACCGTGTCTTCCTTGAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCd86\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: GACCGTTGTGTGTGTTCTGG\u003c/p\u003e\u003cp\u003eReverse: GATGAGCAGCATCACAAGGA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eCd206\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: CAAGGAAGGTTGGCATTTGT\u003c/p\u003e\u003cp\u003eReverse: CCTTTCAGTCCTTTGCAAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eArg1\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: TCACCTGAGCTTTGATGTCG\u003c/p\u003e\u003cp\u003eReverse: CTGAAAGGAGCCCTGTCTTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eYm1/2\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: CAGGGTAATGAGTGGGTTGG\u003c/p\u003e\u003cp\u003eReverse: CACGGCACCTCCTAAATTGT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGapdh\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: TGGCCTTCCGTGTTCCTAC\u003c/p\u003e\u003cp\u003eReverse: GAGTTGCTGTTGAAGTCGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eWestern blotting\u003c/h2\u003e\u003cp\u003eThe corpus callosum and cerebellar tissues were carefully dissected from the brain on ice and homogenized by sonication in RIPA lysis buffer (Beyotime, China) containing PMSF. The same procedure was applied to cuprizone-treated SH-SY5Y neuroblastoma cell. The lysates were centrifuged at 12,000 rpm for 10 min, and the supernatants were collected for protein quantification using a BCA assay kit (Beyotime, China). Protein samples were separated by SDS-PAGE and transferred onto PVDF membranes (Millipore, USA). The membranes were incubated with the following primary antibodies: rabbit anti-PrP\u003csup\u003eC\u003c/sup\u003e (1:4000, SC57-05, Invitrogen, USA), rabbit anti-MBP (1:1000, #78869, CST, USA), rabbit anti-Olig2 (1:1000, #65915, CST, USA), mouse anti-β-Tubulin (1:5000, 66240, Proteintech, USA), mouse anti-β-Actin (1:1000, TA-09, ZSGB-BIO, China), rabbit anti-TREM2 (1:1000, 27599, Proteintech, USA), rabbit anti-TYROBP (1:1000, ab283679, Abcam, USA), rabbit anti-TNF-α (1:1000, 346654, Zenbio, China) and rabbit anti-IL-6R (1:1000, ab271042, Abcam, USA). Subsequently, the membranes were incubated with anti-rabbit or anti-mouse HRP-conjugated secondary antibody (Gene-Protein-Link, China) for 2 hours at room temperature. Signal detection was performed using a ChemiDoc\u0026trade; imaging system (Bio-Rad, USA), and relative protein levels were quantified with ImageJ software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eRNA sequencing and data processing\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted with TRIzol reagent (Sigma-Aldrich, Germany) following the manufacturer\u0026rsquo;s instructions. RNA purity and concentration were measured using a NanoDrop spectrophotometer (Thermo Fisher, USA), and RNA integrity was assessed with an Agilent 2100 Bioanalyzer (Agilent Technologies, USA). Sequencing libraries were prepared using the VAHTS Universal V10 RNA-seq Library Prep Kit (Premixed Version) according to the manufacturer\u0026rsquo;s protocol. Transcriptome sequencing and subsequent bioinformatic analyses were performed by OE Biotech Co., Ltd. (Shanghai, China).\u003c/p\u003e\u003cp\u003eThe libraries were sequenced on an Illumina NovaSeq 6000 platform to generate 150 bp paired-end reads. Gene expression levels were quantified as FPKM, and read counts per gene were obtained using HTSeq.\u0026nbsp;Principal component analysis (PCA) was carried out with R (v3.2.0) to assess biological reproducibility among samples. Differential gene expression analysis was performed using DESeq2, with significantly differentially expressed genes (DEGs) defined as those with a \u003cem\u003ep\u003c/em\u003e value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log\u003csub\u003e2\u003c/sub\u003e(fold change) | \u0026gt;1.\u003c/p\u003e\u003cp\u003eFunctional enrichment analysis of DEGs was conducted based on the hypergeometric distribution for KEGG pathways and WikiPathways using R (v3.2.0). Significant enriched terms were identified and visualized through heatmaps, volcano plots, and bubble diagrams generated in R. Gene Set Enrichment Analysis (GSEA) was performed using GSEA software, which evaluated whether predefined gene sets were enriched at the extremes (top or bottom) of a ranked list of genes ordered by differential expression between sample groups.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e\u003cp\u003eAfter 6 weeks of cuprizone feeding, mice were anesthetized and peripheral blood was collected via retro-orbital bleeding. The blood samples were centrifuged at 3600 rpm to isolate plasma. Plasma levels of M-CSF and IFN-γ were measured using commercial mouse ELISA kits (NEOBIOSCIENCE) according to the manufacturer\u0026rsquo;s instructions. Absorbance was read at 450 nm for each well.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eLPS-induced neuroinflammation\u003c/h2\u003e\u003cp\u003eMice in the lipopolysaccharide (LPS)-induced inflammation model group received daily intraperitoneal injections of 1 mg/kg LPS (E. coli O55:B5, MCE HY-D1056) for five consecutive days. Control mice were injected intraperitoneally with an equal volume of sterile saline. On day 6 after the treatment, all animals were euthanized under sodium pentobarbital anesthesia. Brain tissues were carefully dissected and snap-frozen for storage at -80\u0026deg;C.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eThe data in the figures are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Statistical analyses were conducted using GraphPad Prism software. Comparisons between two independent groups with normal distribution were performed using the unpaired Student\u0026rsquo;s t-test. For multiple group comparisons, one-way or two-way ANOVA was applied, followed by Tukey\u0026rsquo;s multiple comparisons test. A p-value of less than 0.05 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) was considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003ePrP\u003csup\u003eC\u003c/sup\u003e is upregulated in the CNS demyelinating model in mice\u003c/h2\u003e\u003cp\u003ePrevious studies have reported elevated levels of PrP\u003csup\u003eC\u003c/sup\u003e in mouse model and patients with kidney disease, suggesting a potential role of PrP\u003csup\u003eC\u003c/sup\u003e in disease pathogenesis[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] However, its expression in the CNS demyelinating disorders remains unclear. To explore the possible involvement of PrP\u003csup\u003eC\u003c/sup\u003e in demyelination, we employed a mouse model of CNS demyelination induced by dietary administration of cuprizone (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Treated mice exhibited significant weight loss after 6 week compared with controls (20.11 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60 in CPZ vs. 24.41 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43 in CON) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). LFB staining revealed extensive demyelination in myelin-rich regions such as the corpus callosum (Cc) (2.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24 in CPZ vs. 0.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24 in CON) and cerebellum (Cb) (2.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32 in CPZ vs. 0.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20 in CON) of cuprizone-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), confirming successful model establishment. Furthermore, immunohistochemical analysis demonstrated increased PrP\u003csup\u003eC\u003c/sup\u003e expression in demyelinated Cc (CPZ vs. CON, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0312) and Cb (CPZ vs. CON, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0204) of the cuprizone group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Consistent with protein findings, RT-qPCR indicated upregulation of \u003cem\u003ePrnp\u003c/em\u003e mRNA expression in the same regions (CPZ vs. CON, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0045 in Cc; CPZ vs. CON, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0494 in Cb) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo verify whether the elevated expression of PrP\u003csup\u003eC\u003c/sup\u003e is a common feature in demyelinating disease, we employed an EAE mouse model (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). EAE mice exhibited significant weight loss (19.24 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17 in EAE vs. 20.50 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 in CON) (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB) and increased clinical scores (0.67\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18 in EAE vs. 0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00 in CON) (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC) after 30 days immunization. H\u0026amp;E staining revealed inflammatory cell infiltration in the lumbar spinal cord (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD), while LFB staining showed evident demyelination (1.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29 in EAE vs. 0.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.00 in CON) (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eE and S1F). Western blotting analysis further confirmed upregulated PrP\u003csup\u003eC\u003c/sup\u003e expression in the lumbar spinal cord of EAE mice (EAE vs. CON, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0111) (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eG and S1H).\u003c/p\u003e\u003cp\u003eAdditionally, we treated SH-SY5Y neuroblastoma cells with different concentrations of cuprizone (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eI). Immunofluorescence analysis indicated a marked increase in PrP\u003csup\u003eC\u003c/sup\u003e expression following cuprizone exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ), which was corroborated by Western blotting (0 \u0026micro;M vs. 20 \u0026micro;M, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0040; 0 \u0026micro;M vs. 40 \u0026micro;M, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0003; 0 \u0026micro;M vs. 60 \u0026micro;M, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0003; 0 \u0026micro;M vs. 80 \u0026micro;M, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0017; 0 \u0026micro;M vs. 100 \u0026micro;M, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0079) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eK and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eL). These results consistently demonstrate that PrP\u003csup\u003eC\u003c/sup\u003e expression is upregulated in cuprizone-treated mice and cultured cells as well as EAE mice, further supporting its potential involvement in demyelinating pathologies.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePrnp\u003c/b\u003e \u003cb\u003eknockout and OPR-deletion mitigate CPZ-induced CNS demyelination\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe above results indicate that PrP\u003csup\u003eC\u003c/sup\u003e may play a role in CNS demyelination. Given that cuprizone act as a copper ion chelator and that the OPR region of PrP\u003csup\u003eC\u003c/sup\u003e serves as a copper-binding domain, we sought to investigate whether genetic deletion of \u003cem\u003ePrnp\u003c/em\u003e or specific deletion of the OPR region influences cuprizone-induced demyelination. To this end, we subjected wild-type (WT), \u003cem\u003ePrnp\u003c/em\u003e-KO, and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice (Fig. S2) to a 0.4% cuprizone diet for 6 weeks. Weekly monitoring of body weight revealed significant weight loss in all groups beginning from the first week of cuprizone exposure (WT: 20.08 g\u0026thinsp;\u0026plusmn;\u0026thinsp;1.35 in CPZ vs. 21.50 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15 in CON; \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e: 21.28 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.87 in CPZ vs. 22.16 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.80 in CON; \u003cem\u003ePrnp\u003c/em\u003e-KO: 22.28 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18 in CPZ vs. 22.76 g\u0026thinsp;\u0026plusmn;\u0026thinsp;0.86 in CON). Notably, both male and female \u003cem\u003ePrnp-\u003c/em\u003eKO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice showed attenuated weight loss compared to their WT counterparts (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and Fig. S3A). Behavioral assessment related to anxiety and motor function indicated that cuprizone treatment did not significantly alter anxiety-like behaviors (time spent in the center or open arms) or motor performance (total distance moved or latency to fall (Fig. S4).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo validate myelin loss, we performed LFB staining, which specifically binds to myelin. The results demonstrated reduced demyelination in both the Cc and Cb of cuprizone-fed \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice compared to wild-type controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC; Fig. S3B and S3C). We further employed IHC staining for myelin basic protein (MBP) in the CNS, which revealed significantly higher MBP expression in the Cc and Cb of \u003cem\u003ePrnp-\u003c/em\u003eKO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice following cuprizone treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, Fig. S3D and S3E). Consistent with the IHC findings, western blotting analysis also confirmed higher MBP protein levels in the mutant mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Together, these multidimensional analyses indicate that either genetic knockout of \u003cem\u003ePrnp\u003c/em\u003e or specific deletion of the OPR region markedly attenuates cuprizone-induced demyelination in the CNS.\u003c/p\u003e\u003cp\u003e\u003cb\u003ePrnp\u003c/b\u003e \u003cb\u003eknockout and OPR-deletion reduce CPZ-induced oligodendrocyte loss\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOligodendrocytes are responsible for myelination in the CNS. Previous studies have reported oligodendrocyte death and myelin loss in cuprizone-fed animal models[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. OPCs identified by platelet-derived growth factor receptor alpha (PDGFR-α), can differentiate into mature oligodendrocytes (marked by CC1) to replenish the oligodendrocyte population and facilitate remyelination, particularly within demyelinated regions[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Given that consistent phenotypic changes were observed across genders in prior weight loss and myelin assessments, the following investigations focused primarily on male mice.\u003c/p\u003e\u003cp\u003eTo evaluate oligodendrocyte loss in cuprizone-induced demyelination, we analyzed Olig2 (an oligodendrocyte marker) protein levels in the Cc and Cb of mice by Western blotting. The results showed a significant reduction in Olig2 levels in cuprizone-treated wild-type (WT) mice. In contrast, both \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice exhibited attenuated loss of Olig2 following cuprizone exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), suggesting that PrP\u003csup\u003eC\u003c/sup\u003e may participate in cuprizone-induced oligodendrocyte death and myelin loss.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eImmunofluorescence staining for CC1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) and PDGFR-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF) further revealed lineage-specific responses. Cuprizone-treated WT mice showed pronounced depletion of CC1\u003csup\u003e+\u003c/sup\u003e cell accompanied by an accumulation of PDGFR-α\u003csup\u003e+\u003c/sup\u003e cell accumulation in both the Cc and Cb, indicating impaired OPCs differentiation, oligodendrocyte loss and compensatory migration of OPCs to demyelination areas. In contrast, cuprizone-treated \u003cem\u003ePrnp-\u003c/em\u003eKO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice maintained higher numbers of CC1\u003csup\u003e+\u003c/sup\u003e cells and showed a reduction in PDGFR-α\u003csup\u003e+\u003c/sup\u003e cells. These results suggest that the absence of PrP\u003csup\u003eC\u003c/sup\u003e or deletion of its OPR region plays a role in the differentiation of OPCs into functional mature oligodendrocytes, reduces oligodendrocyte death, and ultimately preserves myelinating cells, thereby mitigating demyelination.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMicroglial activation is less intense in\u003c/b\u003e \u003cb\u003ePrnp\u003c/b\u003e \u003cb\u003eknockout and OPR-deletion mice than in wild-type mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo further elucidate the molecular mechanisms through which \u003cem\u003ePrnp\u003c/em\u003e knockout and OPR deletion alleviate cuprizone-induced demyelination and oligodendrocyte loss, we performed RNA sequencing (RNA-seq) on brain tissues from WT, \u003cem\u003ePrnp-\u003c/em\u003eKO, and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice fed a cuprizone diet under RNase-free conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). WikiPathways enrichment analysis of differentially expressed genes revealed significant alterations in macrophage-related functions and microglial activation pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Larger and darker bubbles represented more pronounced differences between groups, with pathway annotations indicating the direction of gene enrichment.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eMicroglia, which account for approximately 10% of CNS cells, are resident immune macrophages that defend neural tissue against infection, support repair, and regulate neuroinflammatory responses[\u003cspan additionalcitationids=\"CR36 CR37 CR38\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Subsequent IBA1 IHC staining\u0026mdash;a specific marker for microglia\u0026mdash;showed pronounced microglial activation in the Cc of cuprizone-fed WT mice, which was markedly attenuated in \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Activated microglia exhibited characteristic morphological changes including increased cell density, enlarged somata, and shortened / retracted processes. We also observed differential activation of astrocytes, as indicated by GFAP staining (Fig. S5A and S5B). Furthermore, microglial activation was predominantly localized to demyelinated regions such as the Cc and Cb (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). These distinct patterns of glial activation suggest that the absence of PrP\u003csup\u003eC\u003c/sup\u003e or its OPR region mitigates cuprizone-induced demyelination by attenuating microglial and astrocytic activation.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTREM2 expression is significantly upregulated in WT than in\u003c/b\u003e \u003cb\u003ePrnp\u003c/b\u003e \u003cb\u003eknockout and OPR-deletion mice\u003c/b\u003e\u003c/p\u003e\u003cp\u003eBased on the above findings, we further investigated the role of microglia in cuprizone-induced demyelination. Previous studies have shown that TREM2 (Triggering Receptor Expressed on Myeloid Cells 2) plays multifaceted roles in microglial activation[\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], particularly in regulating the expression and release of inflammatory factors and balancing neuroprotective versus neurotoxic responses. We therefore hypothesized that PrP\u003csup\u003ec\u003c/sup\u003e may exacerbate cuprizone-induced demyelination by modulating TREM2-dependent microglial signaling.\u003c/p\u003e\u003cp\u003eGO analysis of RNA-seq data presented in the volcano plot (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA) revealed that \u003cem\u003eTrem2\u003c/em\u003e was significantly more upregulated in cuprizone-fed WT mice compared to \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice, suggesting that PrP\u003csup\u003eC\u003c/sup\u003e may critically influence microglial activation. We subsequently assessed \u003cem\u003eTrem2\u003c/em\u003e expression at both mRNA and protein levels. RT-qPCR confirmed pronounced in the Cc and Cb of cuprizone-treated WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Consistent with the transcriptional data, both \u003cem\u003ePrnp\u003c/em\u003e knockout and OPR deletion suppressed \u003cem\u003eTrem2\u003c/em\u003e mRNA expression, a trend also reflected at the protein level as shown by western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo examine the relationship between TREM2 expression and microglial activation, we performed dual IHC staining for IBA1 and TREM2. In WT mice exposed to cuprizone, IBA1 and TREM2 showed clear co-localization in the Cc and Cb, with overlapping fluorescence signals (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). In contrast, no such co-localization was observed in \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice. Additionally, co-staining for GFAP and TREM2 revealed no spatial overlap in any of the genotypes (Fig. S5C, S5D), confirming that TREM2 activation is restricted to microglia rather than astrocytes.\u003c/p\u003e\u003cp\u003eThese results suggest that PrP\u003csup\u003eC\u003c/sup\u003e exacerbates CNS demyelination by promoting TREM2-mediated microglial activation. Conversely, \u003cem\u003ePrnp\u003c/em\u003e knockout and OPR deletion suppress TREM2 expression, attenuates microglial activation, and ultimately alleviates myelin damage.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTREM2-TYROBP axis expression is downregulated in mice with\u003c/b\u003e \u003cb\u003ePrnp\u003c/b\u003e \u003cb\u003eknockout and OPR deletion\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSince the cytoplasmic tail of TREM2 lacks intrinsic signaling motifs, it depends on an associated signal-transducing subunit to propagate activation signals[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. TREM2 functions through its interaction with the TYROBP-mediated signaling pathway[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. TYROBP (also known as DAP12), a type I transmembrane adaptor protein involved in immune signaling[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], has a molecular weight of approximately 12 kDa and consists of 113 amino acids[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. After confirming TREM2 expression during microglial activation, we further examined TYROBP expression. RNA-seq heatmap analysis of microglial activation-associated genes showed that both TYROBP and TREM2 were significantly downregulated in \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Consistent with this, RT-qPCR analysis revealed a marked upregulation of \u003cem\u003eTyrobp\u003c/em\u003e mRNA levels in WT mice compared to \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice fed with cuprizone (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, B). A similar trend was observed at the protein level: western blotting analysis demonstrated reduced TYROBP expression in the mutant mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD), which was further corroborated by immunohistochemical staining showing decreased TYROBP in cuprizone-fed \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice (Fig. S6A and S6B).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo investigate potential interactions among TYROBP, TREM2, and microglia, we constructed a protein-protein interaction (PPI) network based on RNA-seq data. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE, the PPI network revealed a direct interaction between TREM2 and TYROBP. Upregulated and downregulated genes are represented by red and blue nodes, respectively, with circle sizes reflecting their connectivity. To further validate the TREM2-TYROBP molecular axis, we performed triple immunofluorescence staining, which showed co-localization of IBA1, TREM2, and TYROBP in the Cc and Cb. Overlapping fluorescence signals were observed at identical pixel distances (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). In contrast, no such co-localization was detected in cuprizone-fed \u003cem\u003ePrnp\u003c/em\u003e-KO or \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice, demonstrating that microglial activation is associated with coordinated expression of TREM2 and TYROBP.\u003c/p\u003e\u003cp\u003e\u003cb\u003eNF-κB and TLR4 pathway activation is inhibited in mice with\u003c/b\u003e \u003cb\u003ePrnp\u003c/b\u003e \u003cb\u003eknockout and OPR deletion\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePrevious studies have suggested that microglial activation involves TREM2 signaling through TYROBP, which activates the protein tyrosine kinase ERK and subsequently triggers downstream signaling via the nuclear factor kappa-B (NF-κB) and toll-like receptor 4 (TLR4) pathways[\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. These pathways play critical roles in mediating downstream molecular effects during microglial activation. Our KEGG pathway enrichment analysis of transcriptomic data (Fig. S7A) revealed significant differences in the expression of genes related to NF-κB and TLR4 pathway activation among experimental groups. Furthermore, immunofluorescence staining showed markedly increased positivity for NF-κB (Fig. S7B and S7C) and TLR4 (Fig. S7D and S7E) in demyelinated regions of cuprizone-WT mice. In contrast, \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice treated with cuprizone exhibited significantly reduced expression of both NF-κB and TLR4. These results indicate that \u003cem\u003ePrnp\u003c/em\u003e knockout and OPR deletion suppress the activation of NF-κB and TLR4 pathways, which may contribute to reduced myelin damage.\u003c/p\u003e\u003cp\u003e\u003cb\u003eNeuroinflammation responses are attenuated in mice with\u003c/b\u003e \u003cb\u003ePrnp\u003c/b\u003e \u003cb\u003eknockout and OPR deletion\u003c/b\u003e\u003c/p\u003e\u003cp\u003eIn the cuprizone-induced demyelination mouse model, neuroinflammation driven by microglial activation is a key mechanism underlying myelin damage[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. To further investigate neuroinflammatory responses, we analyzed the mRNA expression of pro- and anti-inflammatory factors. Pro-inflammatory factors, including \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eCD32\u003c/em\u003e, \u003cem\u003eCD86\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), were significantly downregulated in cuprizone-fed \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice compared to WT mice. In contrast, anti-inflammatory factors such as \u003cem\u003eCD206\u003c/em\u003e, \u003cem\u003eYM1/2\u003c/em\u003e, \u003cem\u003eArg1\u003c/em\u003e(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA) were markedly upregulated in the same mutants. Western blotting analysis further confirmed reduced protein levels of TNF-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC) and IL-6 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE) in cuprizone-treated \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice. NLRP3 (NOD-like receptor thermal protein domain-containing protein 3), which is activated during infection or inflammation and forms the inflammasome complex to promote cytokine production, also showed significantly lower expression in \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice following cuprizone treatment, as evidenced by immunofluorescence (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG). ELISA of mouse plasma revealed decreased levels of macrophage colony-stimulating factor (M-CSF) and interferon-γ (IFN-γ) in cuprizone-fed \u003cem\u003ePrnp\u003c/em\u003e-KO, and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eH). To directly assess the role of PrP\u003csup\u003eC\u003c/sup\u003e in neuroinflammation, we intraperitoneally injected lipopolysaccharide (LPS) to induce CNS inflammation in WT and \u003cem\u003ePrnp\u003c/em\u003e-KO mice. WT mice showed significantly increased IL-6R expression following LPS challenge on day 6, whereas \u003cem\u003ePrnp\u003c/em\u003e-KO mice exhibited attenuated IL-6R induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eI and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eJ). Together, these results demonstrate that \u003cem\u003ePrnp\u003c/em\u003e knockout and OPR deletion alleviate myelin damage by reducing neuroinflammation in the CNS.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur study uncovers a novel pathophysiologic role of PrP\u003csup\u003eC\u003c/sup\u003e in CNS demyelination. We show that the absence of PrP\u003csup\u003eC\u003c/sup\u003e, or specific deletion of its OPR region, confers robust protection against myelin damage. This protection is mediated by the suppression of the microglial TREM2-TYROBP signaling axis, leading to a reduced neuroinflammatory response.\u003c/p\u003e\u003cp\u003eWe initially observed a substantial upregulation of PrP\u003csup\u003eC\u003c/sup\u003e in the CNS of CPZ-treated mice, consistent with its reported elevation in EAE and other CNS insults such as cerebral ischemia[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan additionalcitationids=\"CR50\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. This suggests a potential broader role for PrP\u003csup\u003eC\u003c/sup\u003e in the pathogenesis of neurological disorders. Notably, genetic deletion of PrP\u003csup\u003eC\u003c/sup\u003e or its OPR domain preserved myelin integrity and reduced oligodendrocyte loss. This indicates that PrP\u003csup\u003eC\u003c/sup\u003e, contrary to its suggested beneficial role in PNS myelination[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], acts as a promoter of CNS demyelination. This dichotomy may stem from fundamental differences between oligodendrocytes and Schwann cells[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Our results align with reported pathogenic roles of PrP\u003csup\u003eC\u003c/sup\u003e in conditions like renal fibrosis and myopathy, which are linked to its phase separation properties[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Furthermore, evidence that anti-OPR antibodies reverse myelin damage in other contexts[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] strongly implicates the OPR region as a key mediator of neurotoxicity. The neurotoxicity mediated by PrP\u003csup\u003eC\u003c/sup\u003e overexpression appears distinct from infectious prion diseases, instead resembling a \"PrP proteinopathy\" driven by a toxic gain-of-function[\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. While PrP\u003csup\u003eC\u003c/sup\u003e's biological function remains enigmatic, it is known that aberrant cross-linking can trigger rapid apoptosis[\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], suggesting it can shift from a protective to a toxic molecule under certain conditions.\u003c/p\u003e\u003cp\u003eA central finding of our work is that the demyelinating effect of PrP\u003csup\u003eC\u003c/sup\u003e is microglia-dependent. We propose a mechanism whereby elevated PrP\u003csup\u003eC\u003c/sup\u003e upregulates the TREM2-TYROBP axis, a key immune regulator. This in turn triggers pro-inflammatory cytokine production via NF-κB and TLR4 pathways, culminating in inflammatory demyelination. This aligns with studies showing that misfolded PrP activates neuroinflammation through TREM2 and that PrP\u003csup\u003eC\u003c/sup\u003e silencing dampens the microglial response. Importantly, our data identify the OPR region as the critical toxic domain within PrP\u003csup\u003eC\u003c/sup\u003e. As a copper-binding site, this region may induce endoplasmic reticulum stress and apoptosis; an imbalance in copper homeostasis could be a contributing factor.\u003c/p\u003e\u003cp\u003eSeveral limitations must be acknowledged. These findings are currently confined to animal models, and validation in human clinical samples is essential. Furthermore, the precise conformational changes in PrP\u003csup\u003eC\u003c/sup\u003e that trigger its toxic gain-of-function require further investigation. Future research should also explore the potential role of PrP\u003csup\u003eC\u003c/sup\u003e in remyelination.\u003c/p\u003e\u003cp\u003eIn conclusion, our study establishes PrP\u003csup\u003eC\u003c/sup\u003e as a pivotal promoter of CNS demyelination. It functions by upregulating the microglial TREM2-TYROBP axis, driving a neuroinflammatory cascade that leads to myelin destruction. The octapeptide repeat region of PrP\u003csup\u003eC\u003c/sup\u003e is identified as a critical mediator of this toxicity, presenting a promising target for novel therapeutic strategies in demyelinating diseases like multiple sclerosis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCNS: central nervous system\u003c/p\u003e\n\u003cp\u003eCPZ: cuprizone\u003c/p\u003e\n\u003cp\u003eCc: corpus callosum\u003c/p\u003e\n\u003cp\u003eCb: cerebellum\u003c/p\u003e\n\u003cp\u003eEAE: experimental autoimmune encephalomyelitis\u003c/p\u003e\n\u003cp\u003eEPM: elevated plus maze\u003c/p\u003e\n\u003cp\u003eH\u0026amp;E: hematoxylin and eosin\u003c/p\u003e\n\u003cp\u003eIFN-\u0026gamma;: interferon-\u0026gamma;\u003c/p\u003e\n\u003cp\u003eIHC: immunohistochemistry\u003c/p\u003e\n\u003cp\u003eLFB: luxol fast blue\u003c/p\u003e\n\u003cp\u003eLPS: lipopolysaccharide\u003c/p\u003e\n\u003cp\u003eMBP: myelin basic protein\u003c/p\u003e\n\u003cp\u003eM-CSF: macrophage colony-stimulating factor\u003c/p\u003e\n\u003cp\u003eMFI: mean fluorescence intensity\u003c/p\u003e\n\u003cp\u003eMS: multiple sclerosis\u003c/p\u003e\n\u003cp\u003eNLRP3: NOD-like receptor thermal protein domain-containing protein 3\u003c/p\u003e\n\u003cp\u003eNF-\u0026kappa;B: nuclear factor kappa-B\u003c/p\u003e\n\u003cp\u003eOPR: octapeptide repeat region\u003c/p\u003e\n\u003cp\u003eOPCs: oligodendrocyte progenitor cells\u003c/p\u003e\n\u003cp\u003eOFT: open field test\u003c/p\u003e\n\u003cp\u003ePrP\u003csup\u003eC\u003c/sup\u003e: cellular prion protein\u003c/p\u003e\n\u003cp\u003ePNS: peripheral nervous system\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ePPI: protein-protein interaction\u003c/p\u003e\n\u003cp\u003ePDGFR-\u0026alpha;: platelet-derived growth factor receptor alpha\u003c/p\u003e\n\u003cp\u003eRT: rotarod test\u003c/p\u003e\n\u003cp\u003eTREM2: Triggering Receptor Expressed on Myeloid Cells 2\u003c/p\u003e\n\u003cp\u003eTLR4: toll-like receptor 4\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eAuthor information\u003c/h2\u003e\u003cp\u003eQing Li, Pengcheng Huan and Jinqiong Zhan contributed equally to this work.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003cp\u003eInstitute of Neurology and Department of Neurology, The First Affiliated Hospital, Jiangxi Medical College, Nanchang University, Nanchang 330006, Jiangxi Province, China\u003c/p\u003e\u003cp\u003eQing Li, Pengcheng Huang, Hancun Yi, Zihao Zhang, Daojun Hong, Xiaomu Wu, Wen-Quan Zou\u003c/p\u003e\u003cp\u003eJiangxi Mental Hospital \u0026amp; Affiliated Mental Hospital, Jiangxi Medical College, Nanchang University, Nanchang 330029, Jiangxi, China\u003c/p\u003e\u003cp\u003eJinqiong Zhan, Yuanjian Yang\u003c/p\u003e\u003cp\u003eDepartment of Neurology, The First Hospital of Jilin University, Changchun, China\u003c/p\u003e\u003cp\u003ePingping Shen\u003c/p\u003e\u003cp\u003eInstitute of Nuclear Medicine Molecular Imaging, Binzhou Medical University Hospital, Binzhou 256603, Shandong Province, China\u003c/p\u003e\u003cp\u003eYanming Wang\u003c/p\u003e\u003cp\u003eBeijing Institute for Brain Research, Chinese Academy of Medical Sciences \u0026amp; Peking Union Medical College, Beijing, 102206, China\u003c/p\u003e\u003cp\u003eJiyan Ma\u003c/p\u003e\u003cp\u003eChinese Institute for Brain Research, Beijing, 102206, China\u003c/p\u003e\u003cp\u003eJiyan Ma\u003c/p\u003e\u003cp\u003eJiangxi Provincial Institute of Neurology, Nanchang 330006, Jiangxi Province, China\u003c/p\u003e\u003cp\u003eXiaomu Wu\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003cp\u003eW.Q.Z. conceived, designed, and supervised the study. Q.L. did all experiments and data analyses. Q.L., P.H. and H.Y. prepared mice. J.M. provided \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice. Z.Z. and P.S. participated in data analysis. J.Z. and Y.Y. helped animal care and breeding. Q.L. wrote the first version of the manuscript. W.Q.Z. and P.H. reviewed and made major revision. Y.W. compared brain pathology with brain imaging. W.Q.Z., Y.Y., D.H. and X.W. contributed to the funding acquisition for the study. All authors critically reviewed, revised, and approved the final version of the manuscript.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCorresponding authors\u003c/strong\u003e\u003cp\u003eCorrespondence to Wen-Quan Zou, Xiaomu Wu or Jiyan Ma.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003e\u003cb\u003eEthics Declarations\u003c/b\u003e\u003c/h2\u003e\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003cp\u003e All animal experimental protocols were approved by the Ethics Committee for Animal Experimentation of the First Affiliated Hospital of Nanchang University (approval number: CDYFY-IACUC-202505GR027) and followed the National Institutes of Health (NIH) guidelines for the care and use of laboratory animals.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cp\u003eNot applicable.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eAdditional information\u003c/h2\u003e\u003cp\u003ePublisher\u0026rsquo;s Note\u003c/p\u003e\u003cp\u003eSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis work was partially supported by the startup package and developmental funds of the First Affiliated Hospital of Nanchang University (#500021001, #500021002), National Natural Science Foundation (NSFC) (82471499) to WQZ, and Jiangxi Key Laboratory of Neurological Diseases (2024SSY06072) to DH and WQZ, as well as NSFC (82271557) to YY.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors wanted to thank Yifan Wang and Jin Lin for their experiment supports.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll datasets generated and/or analyzed during the current study are available from the last corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLassmann H: \u003cstrong\u003eMultiple Sclerosis Pathology\u003c/strong\u003e. \u003cem\u003eCold Spring Harbor perspectives in medicine \u003c/em\u003e2018, \u003cstrong\u003e8\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eOh J, Vidal-Jordana A, Montalban X: \u003cstrong\u003eMultiple sclerosis: clinical aspects\u003c/strong\u003e. \u003cem\u003eCurr Opin Neurol \u003c/em\u003e2018, \u003cstrong\u003e31\u003c/strong\u003e(6):752-759.\u003c/li\u003e\n\u003cli\u003eBierhansl L, Hartung HP, Aktas O, Ruck T, Roden M, Meuth SG: \u003cstrong\u003eThinking outside the box: non-canonical targets in multiple sclerosis\u003c/strong\u003e. \u003cem\u003eNature reviews Drug discovery \u003c/em\u003e2022, \u003cstrong\u003e21\u003c/strong\u003e(8):578-600.\u003c/li\u003e\n\u003cli\u003eKoch-Henriksen N, Magyari M: \u003cstrong\u003eApparent changes in the epidemiology and severity of multiple sclerosis\u003c/strong\u003e. \u003cem\u003eNature reviews Neurology \u003c/em\u003e2021, \u003cstrong\u003e17\u003c/strong\u003e(11):676-688.\u003c/li\u003e\n\u003cli\u003eHealy LM, Stratton JA, Kuhlmann T, Antel J: \u003cstrong\u003eThe role of glial cells in multiple sclerosis disease progression\u003c/strong\u003e. \u003cem\u003eNature reviews Neurology \u003c/em\u003e2022, \u003cstrong\u003e18\u003c/strong\u003e(4):237-248.\u003c/li\u003e\n\u003cli\u003eGhorbani S, Yong VW: \u003cstrong\u003eThe extracellular matrix as modifier of neuroinflammation and remyelination in multiple sclerosis\u003c/strong\u003e. \u003cem\u003eBrain : a journal of neurology \u003c/em\u003e2021, \u003cstrong\u003e144\u003c/strong\u003e(7):1958-1973.\u003c/li\u003e\n\u003cli\u003eMaheshwari A, Janssens K, Bogie J, Van Den Haute C, Struys T, Lambrichts I, Baekelandt V, Stinissen P, Hendriks JJ, Slaets H\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eLocal overexpression of interleukin-11 in the central nervous system limits demyelination and enhances remyelination\u003c/strong\u003e. \u003cem\u003eMediators of inflammation \u003c/em\u003e2013, \u003cstrong\u003e2013\u003c/strong\u003e:685317.\u003c/li\u003e\n\u003cli\u003eLi\u0026ntilde;ares D, Taconis M, Ma\u0026ntilde;a P, Correcha M, Fordham S, Staykova M, Willenborg DO: \u003cstrong\u003eNeuronal nitric oxide synthase plays a key role in CNS demyelination\u003c/strong\u003e. \u003cem\u003eThe Journal of neuroscience : the official journal of the Society for Neuroscience \u003c/em\u003e2006, \u003cstrong\u003e26\u003c/strong\u003e(49):12672-12681.\u003c/li\u003e\n\u003cli\u003eKwon HS, Koh SH: \u003cstrong\u003eNeuroinflammation in neurodegenerative disorders: the roles of microglia and astrocytes\u003c/strong\u003e. \u003cem\u003eTransl Neurodegener \u003c/em\u003e2020, \u003cstrong\u003e9\u003c/strong\u003e(1):42.\u003c/li\u003e\n\u003cli\u003eLyman M, Lloyd DG, Ji X, Vizcaychipi MP, Ma D: \u003cstrong\u003eNeuroinflammation: the role and consequences\u003c/strong\u003e. \u003cem\u003eNeuroscience research \u003c/em\u003e2014, \u003cstrong\u003e79\u003c/strong\u003e:1-12.\u003c/li\u003e\n\u003cli\u003ePrusiner SB: \u003cstrong\u003ePrions\u003c/strong\u003e. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America \u003c/em\u003e1998, \u003cstrong\u003e95\u003c/strong\u003e(23):13363-13383.\u003c/li\u003e\n\u003cli\u003eSigurdson CJ, Bartz JC, Glatzel M: \u003cstrong\u003eCellular and Molecular Mechanisms of Prion Disease\u003c/strong\u003e. \u003cem\u003eAnnual review of pathology \u003c/em\u003e2019, \u003cstrong\u003e14\u003c/strong\u003e:497-516.\u003c/li\u003e\n\u003cli\u003eLu ZY, Baker CA, Manuelidis L: \u003cstrong\u003eNew molecular markers of early and progressive CJD brain infection\u003c/strong\u003e. \u003cem\u003eJournal of cellular biochemistry \u003c/em\u003e2004, \u003cstrong\u003e93\u003c/strong\u003e(4):644-652.\u003c/li\u003e\n\u003cli\u003eMariante RM, N\u0026oacute;brega A, Martins RAP, Areal RB, Bellio M, Linden R: \u003cstrong\u003eNeuroimmunoendocrine regulation of the prion protein in neutrophils\u003c/strong\u003e. \u003cem\u003eThe Journal of biological chemistry \u003c/em\u003e2012, \u003cstrong\u003e287\u003c/strong\u003e(42):35506-35515.\u003c/li\u003e\n\u003cli\u003eDing T, Zhou X, Kouadir M, Shi F, Yang Y, Liu J, Wang M, Yin X, Yang L, Zhao D: \u003cstrong\u003eCellular prion protein participates in the regulation of inflammatory response and apoptosis in BV2 microglia during infection with Mycobacterium bovis\u003c/strong\u003e. \u003cem\u003eJournal of molecular neuroscience : MN \u003c/em\u003e2013, \u003cstrong\u003e51\u003c/strong\u003e(1):118-126.\u003c/li\u003e\n\u003cli\u003eWu GR, Mu TC, Gao ZX, Wang J, Sy MS, Li CY: \u003cstrong\u003ePrion protein is required for tumor necrosis factor \u0026alpha; (TNF\u0026alpha;)-triggered nuclear factor \u0026kappa;B (NF-\u0026kappa;B) signaling and cytokine production\u003c/strong\u003e. \u003cem\u003eThe Journal of biological chemistry \u003c/em\u003e2017, \u003cstrong\u003e292\u003c/strong\u003e(46):18747-18759.\u003c/li\u003e\n\u003cli\u003eBremer J, Baumann F, Tiberi C, Wessig C, Fischer H, Schwarz P, Steele AD, Toyka KV, Nave KA, Weis J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAxonal prion protein is required for peripheral myelin maintenance\u003c/strong\u003e. \u003cem\u003eNat Neurosci \u003c/em\u003e2010, \u003cstrong\u003e13\u003c/strong\u003e(3):310-318.\u003c/li\u003e\n\u003cli\u003eNishida N, Tremblay P, Sugimoto T, Shigematsu K, Shirabe S, Petromilli C, Erpel SP, Nakaoke R, Atarashi R, Houtani T\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eA mouse prion protein transgene rescues mice deficient for the prion protein gene from purkinje cell degeneration and demyelination\u003c/strong\u003e. \u003cem\u003eLaboratory investigation; a journal of technical methods and pathology \u003c/em\u003e1999, \u003cstrong\u003e79\u003c/strong\u003e(6):689-697.\u003c/li\u003e\n\u003cli\u003eSkedsmo FS, Malachin G, V\u0026aring;ge DI, Hammervold MM, Salvesen \u0026Oslash;, Ersdal C, Ranheim B, Stafsnes MH, Bartosova Z, Bruheim P\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eDemyelinating polyneuropathy in goats lacking prion protein\u003c/strong\u003e. \u003cem\u003eFASEB journal : official publication of the Federation of American Societies for Experimental Biology \u003c/em\u003e2020, \u003cstrong\u003e34\u003c/strong\u003e(2):2359-2375.\u003c/li\u003e\n\u003cli\u003ePiazza M, Prior TW, Khalsa PS, Appleby B: \u003cstrong\u003eA case report of genetic prion disease with two different PRNP variants\u003c/strong\u003e. \u003cem\u003eMolecular genetics \u0026amp; genomic medicine \u003c/em\u003e2020, \u003cstrong\u003e8\u003c/strong\u003e(3):e1134.\u003c/li\u003e\n\u003cli\u003eWilliams SK, Fairless R, Weise J, Kalinke U, Schulz-Schaeffer W, Diem R: \u003cstrong\u003eNeuroprotective effects of the cellular prion protein in autoimmune optic neuritis\u003c/strong\u003e. \u003cem\u003eThe American journal of pathology \u003c/em\u003e2011, \u003cstrong\u003e178\u003c/strong\u003e(6):2823-2831.\u003c/li\u003e\n\u003cli\u003evan Rheede T, Smolenaars MM, Madsen O, de Jong WW: \u003cstrong\u003eMolecular evolution of the mammalian prion protein\u003c/strong\u003e. \u003cem\u003eMolecular biology and evolution \u003c/em\u003e2003, \u003cstrong\u003e20\u003c/strong\u003e(1):111-121.\u003c/li\u003e\n\u003cli\u003eBrown DR, Qin K, Herms JW, Madlung A, Manson J, Strome R, Fraser PE, Kruck T, von Bohlen A, Schulz-Schaeffer W\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe cellular prion protein binds copper in vivo\u003c/strong\u003e. \u003cem\u003eNature \u003c/em\u003e1997, \u003cstrong\u003e390\u003c/strong\u003e(6661):684-687.\u003c/li\u003e\n\u003cli\u003eSt\u0026ouml;ckel J, Safar J, Wallace AC, Cohen FE, Prusiner SB: \u003cstrong\u003ePrion protein selectively binds copper (II) ions\u003c/strong\u003e. \u003cem\u003eBiochemistry \u003c/em\u003e1998, \u003cstrong\u003e37\u003c/strong\u003e(20):7185-7193.\u003c/li\u003e\n\u003cli\u003eViles JH, Cohen FE, Prusiner SB, Goodin DB, Wright PE, Dyson HJ: \u003cstrong\u003eCopper binding to the prion protein: structural implications of four identical cooperative binding sites\u003c/strong\u003e. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America \u003c/em\u003e1999, \u003cstrong\u003e96\u003c/strong\u003e(5):2042-2047.\u003c/li\u003e\n\u003cli\u003eZhang Y, Yan R, Zhang X, Ma J: \u003cstrong\u003eDisease-Associated Q159X Mutant Prion Protein Is Sufficient to Cause Fatal Degenerative Disease in Mice\u003c/strong\u003e. \u003cem\u003eMolecular neurobiology \u003c/em\u003e2024, \u003cstrong\u003e61\u003c/strong\u003e(12):10517-10528.\u003c/li\u003e\n\u003cli\u003eZirngibl M, Assinck P, Sizov A, Caprariello AV, Plemel JR: \u003cstrong\u003eOligodendrocyte death and myelin loss in the cuprizone model: an updated overview of the intrinsic and extrinsic causes of cuprizone demyelination\u003c/strong\u003e. \u003cem\u003eMol Neurodegener \u003c/em\u003e2022, \u003cstrong\u003e17\u003c/strong\u003e(1):34.\u003c/li\u003e\n\u003cli\u003eLuoqian J, Yang W, Ding X, Tuo QZ, Xiang Z, Zheng Z, Guo YJ, Li L, Guan P, Ayton S\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eFerroptosis promotes T-cell activation-induced neurodegeneration in multiple sclerosis\u003c/strong\u003e. \u003cem\u003eCellular \u0026amp; molecular immunology \u003c/em\u003e2022, \u003cstrong\u003e19\u003c/strong\u003e(8):913-924.\u003c/li\u003e\n\u003cli\u003eWang M, Caryotakis SE, Smith GG, Nguyen AV, Pleasure DE, Soulika AM: \u003cstrong\u003eCSF1R antagonism results in increased supraspinal infiltration in EAE\u003c/strong\u003e. \u003cem\u003eJ Neuroinflammation \u003c/em\u003e2024, \u003cstrong\u003e21\u003c/strong\u003e(1):103.\u003c/li\u003e\n\u003cli\u003eJeffries MA, McLane LE, Khandker L, Mather ML, Evangelou AV, Kantak D, Bourne JN, Macklin WB, Wood TL: \u003cstrong\u003emTOR Signaling Regulates Metabolic Function in Oligodendrocyte Precursor Cells and Promotes Efficient Brain Remyelination in the Cuprizone Model\u003c/strong\u003e. \u003cem\u003eThe Journal of neuroscience: the official journal of the Society for Neuroscience \u003c/em\u003e2021, \u003cstrong\u003e41\u003c/strong\u003e(40):8321-8337.\u003c/li\u003e\n\u003cli\u003eLin J, Lan L, Wang D, Qiu B, Fan Y: \u003cstrong\u003eCerebral Venous Collagen Remodeling in a Modified White Matter Lesions Animal Model\u003c/strong\u003e. \u003cem\u003eNeuroscience \u003c/em\u003e2017, \u003cstrong\u003e367\u003c/strong\u003e:72-84.\u003c/li\u003e\n\u003cli\u003eBignon Y, Poindessous V, Lazareth H, Passet B, Vilotte JL, Djouadi F, Mouillet-Richard S, Pallet N: \u003cstrong\u003eThe cellular prion protein is a stress protein secreted by renal tubular cells and a urinary marker of kidney injury\u003c/strong\u003e. \u003cem\u003eCell Death Dis \u003c/em\u003e2020, \u003cstrong\u003e11\u003c/strong\u003e(4):243.\u003c/li\u003e\n\u003cli\u003eLong T, Lu Y, Ma Y, Song Y, Yi X, Chen X, Zhou M, Ma J, Chen J, Liu Z\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eCondensation of cellular prion protein promotes renal fibrosis through the TBK1-IRF3 signaling axis\u003c/strong\u003e. \u003cem\u003eScience translational medicine \u003c/em\u003e2025, \u003cstrong\u003e17\u003c/strong\u003e(794):eadj9095.\u003c/li\u003e\n\u003cli\u003eXiao Y, Czopka T: \u003cstrong\u003eMyelination-independent functions of oligodendrocyte precursor cells in health and disease\u003c/strong\u003e. \u003cem\u003eNat Neurosci \u003c/em\u003e2023, \u003cstrong\u003e26\u003c/strong\u003e(10):1663-1669.\u003c/li\u003e\n\u003cli\u003eRivest S: \u003cstrong\u003eRegulation of innate immune responses in the brain\u003c/strong\u003e. \u003cem\u003eNat Rev Immunol \u003c/em\u003e2009, \u003cstrong\u003e9\u003c/strong\u003e(6):429-439.\u003c/li\u003e\n\u003cli\u003eRansohoff RM, Perry VH: \u003cstrong\u003eMicroglial physiology: unique stimuli, specialized responses\u003c/strong\u003e. \u003cem\u003eAnnu Rev Immunol \u003c/em\u003e2009, \u003cstrong\u003e27\u003c/strong\u003e:119-145.\u003c/li\u003e\n\u003cli\u003eTremblay M, Stevens B, Sierra A, Wake H, Bessis A, Nimmerjahn A: \u003cstrong\u003eThe role of microglia in the healthy brain\u003c/strong\u003e. \u003cem\u003eThe Journal of neuroscience : the official journal of the Society for Neuroscience \u003c/em\u003e2011, \u003cstrong\u003e31\u003c/strong\u003e(45):16064-16069.\u003c/li\u003e\n\u003cli\u003eSchirmer L, Schafer DP, Bartels T, Rowitch DH, Calabresi PA: \u003cstrong\u003eDiversity and Function of Glial Cell Types in Multiple Sclerosis\u003c/strong\u003e. \u003cem\u003eTrends in immunology \u003c/em\u003e2021, \u003cstrong\u003e42\u003c/strong\u003e(3):228-247.\u003c/li\u003e\n\u003cli\u003eSingh S, Metz I, Amor S, van der Valk P, Stadelmann C, Br\u0026uuml;ck W: \u003cstrong\u003eMicroglial nodules in early multiple sclerosis white matter are associated with degenerating axons\u003c/strong\u003e. \u003cem\u003eActa Neuropathol \u003c/em\u003e2013, \u003cstrong\u003e125\u003c/strong\u003e(4):595-608.\u003c/li\u003e\n\u003cli\u003eZheng H, Jia L, Liu CC, Rong Z, Zhong L, Yang L, Chen XF, Fryer JD, Wang X, Zhang YW\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTREM2 Promotes Microglial Survival by Activating Wnt/\u0026beta;-Catenin Pathway\u003c/strong\u003e. \u003cem\u003eThe Journal of neuroscience : the official journal of the Society for Neuroscience \u003c/em\u003e2017, \u003cstrong\u003e37\u003c/strong\u003e(7):1772-1784.\u003c/li\u003e\n\u003cli\u003eCantoni C, Bollman B, Licastro D, Xie M, Mikesell R, Schmidt R, Yuede CM, Galimberti D, Olivecrona G, Klein RS\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTREM2 regulates microglial cell activation in response to demyelination in vivo\u003c/strong\u003e. \u003cem\u003eActa Neuropathol \u003c/em\u003e2015, \u003cstrong\u003e129\u003c/strong\u003e(3):429-447.\u003c/li\u003e\n\u003cli\u003eLee CYD, Daggett A, Gu X, Jiang LL, Langfelder P, Li X, Wang N, Zhao Y, Park CS, Cooper Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eElevated TREM2 Gene Dosage Reprograms Microglia Responsivity and Ameliorates Pathological Phenotypes in Alzheimer\u0026apos;s Disease Models\u003c/strong\u003e. \u003cem\u003eNeuron \u003c/em\u003e2018, \u003cstrong\u003e97\u003c/strong\u003e(5):1032-1048.e1035.\u003c/li\u003e\n\u003cli\u003eMolloy EJ: \u003cstrong\u003eTriggering Receptor Expressed on Myeloid Cells (TREM) family and the application of its antagonists\u003c/strong\u003e. \u003cem\u003eRecent patents on anti-infective drug discovery \u003c/em\u003e2009, \u003cstrong\u003e4\u003c/strong\u003e(1):51-56.\u003c/li\u003e\n\u003cli\u003eQuan DN, Cooper MD, Potter JL, Roberts MH, Cheng H, Jarvis GA: \u003cstrong\u003eTREM-2 binds to lipooligosaccharides of Neisseria gonorrhoeae and is expressed on reproductive tract epithelial cells\u003c/strong\u003e. \u003cem\u003eMucosal immunology \u003c/em\u003e2008, \u003cstrong\u003e1\u003c/strong\u003e(3):229-238.\u003c/li\u003e\n\u003cli\u003eTurnbull IR, Colonna M: \u003cstrong\u003eActivating and inhibitory functions of DAP12\u003c/strong\u003e. \u003cem\u003eNat Rev Immunol \u003c/em\u003e2007, \u003cstrong\u003e7\u003c/strong\u003e(2):155-161.\u003c/li\u003e\n\u003cli\u003eLanier LL, Corliss BC, Wu J, Leong C, Phillips JH: \u003cstrong\u003eImmunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells\u003c/strong\u003e. \u003cem\u003eNature \u003c/em\u003e1998, \u003cstrong\u003e391\u003c/strong\u003e(6668):703-707.\u003c/li\u003e\n\u003cli\u003eMecca C, Giambanco I, Donato R, Arcuri C: \u003cstrong\u003eMicroglia and Aging: The Role of the TREM2-DAP12 and CX3CL1-CX3CR1 Axes\u003c/strong\u003e. \u003cem\u003eInt J Mol Sci \u003c/em\u003e2018, \u003cstrong\u003e19\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eShao Y, Chen C, Zhu T, Sun Z, Li S, Gong L, Dong X, Shen W, Zeng L, Xie Y\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTRPM2 contributes to neuroinflammation and cognitive deficits in a cuprizone-induced multiple sclerosis model via NLRP3 inflammasome\u003c/strong\u003e. \u003cem\u003eNeurobiol Dis \u003c/em\u003e2021, \u003cstrong\u003e160\u003c/strong\u003e:105534.\u003c/li\u003e\n\u003cli\u003eMcLennan NF, Brennan PM, McNeill A, Davies I, Fotheringham A, Rennison KA, Ritchie D, Brannan F, Head MW, Ironside JW\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003ePrion protein accumulation and neuroprotection in hypoxic brain damage\u003c/strong\u003e. \u003cem\u003eThe American journal of pathology \u003c/em\u003e2004, \u003cstrong\u003e165\u003c/strong\u003e(1):227-235.\u003c/li\u003e\n\u003cli\u003eWeise J, Crome O, Sandau R, Schulz-Schaeffer W, B\u0026auml;hr M, Zerr I: \u003cstrong\u003eUpregulation of cellular prion protein (PrPc) after focal cerebral ischemia and influence of lesion severity\u003c/strong\u003e. \u003cem\u003eNeurosci Lett \u003c/em\u003e2004, \u003cstrong\u003e372\u003c/strong\u003e(1-2):146-150.\u003c/li\u003e\n\u003cli\u003eShyu WC, Lin SZ, Chiang MF, Ding DC, Li KW, Chen SF, Yang HI, Li H: \u003cstrong\u003eOverexpression of PrPC by adenovirus-mediated gene targeting reduces ischemic injury in a stroke rat model\u003c/strong\u003e. \u003cem\u003eThe Journal of neuroscience : the official journal of the Society for Neuroscience \u003c/em\u003e2005, \u003cstrong\u003e25\u003c/strong\u003e(39):8967-8977.\u003c/li\u003e\n\u003cli\u003eNave KA, Werner HB: \u003cstrong\u003eMyelination of the nervous system: mechanisms and functions\u003c/strong\u003e. \u003cem\u003eAnnual review of cell and developmental biology \u003c/em\u003e2014, \u003cstrong\u003e30\u003c/strong\u003e:503-533.\u003c/li\u003e\n\u003cli\u003eTao J, Zeng Y, Dai B, Liu Y, Pan X, Wang LQ, Chen J, Zhou Y, Lu Z, Xie L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eExcess PrP(C) inhibits muscle cell differentiation via miRNA-enhanced liquid-liquid phase separation implicated in myopathy\u003c/strong\u003e. \u003cem\u003eNat Commun \u003c/em\u003e2023, \u003cstrong\u003e14\u003c/strong\u003e(1):8131.\u003c/li\u003e\n\u003cli\u003eScalabrino G, Veber D: \u003cstrong\u003eMyelin damage due to local quantitative abnormalities in normal prion levels: evidence from subacute combined degeneration and multiple sclerosis\u003c/strong\u003e. \u003cem\u003eJournal of neurology \u003c/em\u003e2014, \u003cstrong\u003e261\u003c/strong\u003e(8):1451-1460.\u003c/li\u003e\n\u003cli\u003eScalabrino G, Mutti E, Veber D, Rodriguez Menendez V, Novembrino C, Calligaro A, Tredici G: \u003cstrong\u003eThe octapeptide repeat PrP(C) region and cobalamin-deficient polyneuropathy of the rat\u003c/strong\u003e. \u003cem\u003eMuscle Nerve \u003c/em\u003e2011, \u003cstrong\u003e44\u003c/strong\u003e(6):957-967.\u003c/li\u003e\n\u003cli\u003eHarris DA, True HL: \u003cstrong\u003eNew insights into prion structure and toxicity\u003c/strong\u003e. \u003cem\u003eNeuron \u003c/em\u003e2006, \u003cstrong\u003e50\u003c/strong\u003e(3):353-357.\u003c/li\u003e\n\u003cli\u003eMouillet-Richard S, Ermonval M, Chebassier C, Laplanche JL, Lehmann S, Launay JM, Kellermann O: \u003cstrong\u003eSignal transduction through prion protein\u003c/strong\u003e. \u003cem\u003eScience \u003c/em\u003e2000, \u003cstrong\u003e289\u003c/strong\u003e(5486):1925-1928.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Multiple sclerosis, demyelination, prion protein, PrPC, microglia, TREM2, TYROBP, neuroinflammation","lastPublishedDoi":"10.21203/rs.3.rs-7704970/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7704970/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eThe cellular prion protein (PrP\u003csup\u003eC\u003c/sup\u003e), widely recognized for its role in prion diseases, is highly expressed in the central nervous system (CNS). While it has been reported to link to demyelination in the peripheral nervous system, the function of PrP\u003csup\u003eC\u003c/sup\u003e in CNS demyelination remains unclear.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eWe explored the role of PrP\u003csup\u003eC\u003c/sup\u003e in cuprizone-induced demyelination using wild-type and two PrP-deficient mouse models.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eWe observed significant upregulation of PrP\u003csup\u003eC\u003c/sup\u003e within demyelinating lesions of wild-type mice fed with cuprizone. In contrast, mice lacking PrP\u003csup\u003eC\u003c/sup\u003e (\u003cem\u003ePrnp\u003c/em\u003e-KO) or with deletion of its octapeptide repeat region (OPR) (\u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e) exhibited markedly reduced myelin loss and oligodendrocyte death, evidenced by luxol fast blue staining, myelin basic protein examination, and detection of OLIG2. RNA sequencing analysis indicated that this protection was associated with attenuated microglial activation and a downregulation of the TREM2-TYROBP signaling pathway. Accordingly, compared to wild-type mice, microglia-mediated neuroinflammatory responses were substantially reduced in \u003cem\u003ePrnp\u003c/em\u003e-KO and \u003cem\u003ePrnp\u003c/em\u003e-OPR\u003csup\u003ede\u003c/sup\u003e mice. Together, these findings demonstrate that PrP\u003csup\u003eC\u003c/sup\u003e exacerbates CNS demyelination by promoting microglia activation via the TREM2-TYROBP axis, and further identify OPR as a critical domain responsible for this neurotoxic activity.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eThese findings reveal a novel pathogenic mechanism for PrP\u003csup\u003eC\u003c/sup\u003e in CNS demyelination and suggest that targeting PrP\u003csup\u003eC\u003c/sup\u003e or its OPR may offer new therapeutic opportunities for demyelinating disorders.\u003c/p\u003e","manuscriptTitle":"Cellular prion protein exacerbates brain demyelination by activating microglia through the TREM2-TYROBP axis in cuprizone-treated animals","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-15 08:21:55","doi":"10.21203/rs.3.rs-7704970/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a8b679dd-a7c2-4ea1-82bd-c0b0973413c5","owner":[],"postedDate":"October 15th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-15T08:21:55+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-15 08:21:55","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7704970","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7704970","identity":"rs-7704970","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}