Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal

Morphological and Molecular Characterization of... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/13-1088" }, "headline": "Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal", "datePublished": "2024-09-24T16:38:07", "dateModified": "2025-03-05T15:24:57", "author": [ { "@type": "Person", "name": "Puja Jaiswal" }, { "@type": "Person", "name": "Ram B. Khadka" }, { "@type": "Person", "name": "Aashaq Hussain Bhat" }, { "@type": "Person", "name": "Suraj Baidya" }, { "@type": "Person", "name": "Arvind Kumar Keshari" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": " Background Trichoderma spp. hold significant potential as biocontrol agents in agriculture due to their antagonistic properties against plant pathogens. The study aimed to characterize and identify Trichoderma isolates from rhizospheric regions of vegetable crops. Methods In this study, Trichoderma isolates were collected from rhizospheric soil samples of vegetable crops from different ecological zones and were selected for comprehensive morphological and molecular characterization. The isolates were visually assessed for colony color, growth pattern, aerial mycelium presence, phialide and conidial morphology, and chlamydospore presence. Molecular analysis was employed based on ITS and tef-1α sequences. Diversity indices were also computed for different ecological zones. Results The morphological characteristics and phylogenetic trees for both regions provided a clear species resolution, with four main clades: Harzianum, Viride, Brevicompactum and Longibrachiatum with 12 species T. harzinaum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. atroviride, T. asperellum, T. asperelloides, T. koningii, T. longibrachiatum and T. brevicompactum and nine species as a new country record. Diversity indices indicated that high mountain regions displayed the highest species diversity and evenness (H = 1.724 [0.28], J = 0.84, D = 0.28), followed by hilly regions (H = 1.563 [0.28], J = 0.72, D = 0.28). Plains, on the other hand, exhibited lower species diversity (H = 1.515, J = 0.66, D = 0.33). The calculated species abundance values showed that plains (E = 2.11), mid-hills (E = 1.95), and high mountains (E = 1.99) each had their unique diversity profiles. Notably, T. afroharzianum and T. asperellum were predominant. Conclusions Overall, the study unveiled a rich diversity of Trichoderma species in different agricultural zones of Nepal. These findings shed light on the ecological distribution and diversity of Trichoderma spp., which could have significant implications for sustainable agriculture and biological control strategies. " } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/13-1088/v3", "name": "Morphological and Molecular Characterization of Trichoderma Isolates..." } } ] } Home Browse Morphological and Molecular Characterization of Trichoderma Isolates... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Jaiswal P, Khadka RB, Hussain Bhat A et al. Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.12688/f1000research.153701.3 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Research Article Revised Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] Puja Jaiswal https://orcid.org/0000-0002-1643-1038 1 , Ram B. Khadka https://orcid.org/0000-0002-1810-7493 2 , Aashaq Hussain Bhat 3 , Suraj Baidya 2 , Arvind Kumar Keshari 4 Puja Jaiswal https://orcid.org/0000-0002-1643-1038 1 , Ram B. Khadka https://orcid.org/0000-0002-1810-7493 2 , [...] Aashaq Hussain Bhat 3 , Suraj Baidya 2 , Arvind Kumar Keshari 4 PUBLISHED 05 Mar 2025 Author details Author details 1 Central Department of Zoology, Tribhuvan University, Kirtipur, Kathmandu, Bagmati, 0097, Nepal 2 National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, Bagmati, 5459, Nepal 3 Department of Bioscience, Chandigarh University, Sahibzada Ajit Singh Nagar, Punjab, India 4 Department of Zoology, Patan Multiple Campus, Tribhuvan University, Lalitpur, Bagmati, 0097, Nepal Puja Jaiswal Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Validation, Visualization, Writing – Original Draft Preparation Ram B. Khadka Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Aashaq Hussain Bhat Roles: Writing – Review & Editing Suraj Baidya Roles: Resources, Writing – Review & Editing Arvind Kumar Keshari Roles: Conceptualization, Funding Acquisition, Project Administration, Resources, Supervision, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the Agriculture, Food and Nutrition gateway. Abstract Background Trichoderma spp. hold significant potential as biocontrol agents in agriculture due to their antagonistic properties against plant pathogens. The study aimed to characterize and identify Trichoderma isolates from rhizospheric regions of vegetable crops. Methods In this study, Trichoderma isolates were collected from rhizospheric soil samples of vegetable crops from different ecological zones and were selected for comprehensive morphological and molecular characterization. The isolates were visually assessed for colony color, growth pattern, aerial mycelium presence, phialide and conidial morphology, and chlamydospore presence. Molecular analysis was employed based on ITS and tef-1α sequences. Diversity indices were also computed for different ecological zones. Results The morphological characteristics and phylogenetic trees for both regions provided a clear species resolution, with four main clades: Harzianum, Viride, Brevicompactum and Longibrachiatum with 12 species T. harzinaum , T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi , T. atroviride, T. asperellum, T. asperelloides, T. koningii, T. longibrachiatum and T. brevicompactum and nine species as a new country record. Diversity indices indicated that high mountain regions displayed the highest species diversity and evenness (H = 1.724 [0.28], J = 0.84, D = 0.28), followed by hilly regions (H = 1.563 [0.28], J = 0.72, D = 0.28). Plains, on the other hand, exhibited lower species diversity (H = 1.515, J = 0.66, D = 0.33). The calculated species abundance values showed that plains (E = 2.11), mid-hills (E = 1.95), and high mountains (E = 1.99) each had their unique diversity profiles. Notably, T. afroharzianum and T. asperellum were predominant. Conclusions Overall, the study unveiled a rich diversity of Trichoderma species in different agricultural zones of Nepal. These findings shed light on the ecological distribution and diversity of Trichoderma spp., which could have significant implications for sustainable agriculture and biological control strategies. READ ALL READ LESS Keywords Biocontrol agent; phylogenetic analysis; Rhizospheric region; Species diversity; Nepal Corresponding Author(s) Puja Jaiswal ( [email protected] ) Ram B. Khadka ( [email protected] ) Close Corresponding authors: Puja Jaiswal, Ram B. Khadka Competing interests: No competing interests were disclosed. Grant information: This study was partially funded by the Government of Nepal appropriated to Nepal Agricultural Research Council, and by the Feed the Future Innovation Lab for Horticulture – made possible by the generous support of the American people through the United States Agency for International Development (USAID) under Prime Cooperative Agreement number - 7200AA21LE00003. The contents of this publication are the responsibility of the authors and do not necessarily reflect the views of USAID or the United States Government. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2025 Jaiswal P et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Jaiswal P, Khadka RB, Hussain Bhat A et al. Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.12688/f1000research.153701.3 ) First published: 24 Sep 2024, 13 :1088 ( https://doi.org/10.12688/f1000research.153701.1 ) Latest published: 05 Mar 2025, 13 :1088 ( https://doi.org/10.12688/f1000research.153701.3 ) Revised Amendments from Version 2 The references and citations have been changed; unreliable references have been removed and more reliable citations have been added. Comments and feedback provided by reviewers have been incorporated to improve the flow of the manuscript. The references and citations have been changed; unreliable references have been removed and more reliable citations have been added. Comments and feedback provided by reviewers have been incorporated to improve the flow of the manuscript. See the authors' detailed response to the review by Yunus Korkom See the authors' detailed response to the review by Eder Marques See the authors' detailed response to the review by Raja Asad Ali Khan READ REVIEWER RESPONSES Introduction The genus Trichoderma comprises a highly diverse group of soil dwelling fungi, demonstrating remarkable versatility. These fungi are known for their rapid growth and adaptability, colonizing various habitats from forest soils to agricultural fields. Within this genus, a wide array of strains exhibits significant potential for various applications, including biological control as biopesticides, biofertilizers, soil enhancers and promoters of crop growth. 1 , 2 Furthermore, Trichoderma isolates have the capacity to stimulate plant defense mechanisms, a phenomenon extensively documented in studies conducted by various researchers. 3 – 6 The Trichoderma genus was originally proposed by Persoon in Germany in 1794, more than two centuries ago, and their potential as bioagents was first documented by Weindling in 1932. 7 To date, over 250 Trichoderma species have been identified in soil environments worldwide. 8 Trichoderma species can be readily isolated from soil using various conventional methods, thanks to their adaptability to diverse conditions, ranging from deserts and wetlands to the Himalayan regions. However, the most effective method for isolating Trichoderma spp. is from rhizospheric soil samples. 9 A comprehensive understanding of Trichoderma biodiversity is crucial for harnessing the full potential of this genus in various biological applications. Previous surveys that investigated Trichoderma diversity in specific geographical regions have primarily focused on isolates obtained from soil samples. These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 Cerrado, 12 China, 13 , 14 South-East Asia, 15 India, 16 Egypt, 17 Iran, 18 Philippines, 19 Europe, 20 Canary Islands, 21 Sardinia, 22 South America, 23 and Turkey. 24 The potential of Trichoderma species as biological control agents (BCAs) has been under investigation for over 70 years, and more recently, these species have become commercially available. 25 , 26 Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions. 27 – 31 Trichoderma deploys diverse mechanisms, including antibiosis, competition for nutrients and space, mycoparasitism, production of antimicrobial compounds, induction of plant defense responses and enzymatic hydrolysis, to manifest its biocontrol activity. 32 These capabilities not only help in managing diseases but also promote plant growth and resilience. Nepal’s agriculture is dominated by smallholder farmers with limited access to modern agricultural inputs such as chemical pesticides and fertilizers. The country’s diverse agro-ecological zones present both opportunities and challenges for crop production. Trichoderma , with its versatile role in crop production, offers eco-friendly and cost-effective solutions to challenges like biotic stresses (diseases and pests) and abiotic stresses (drought and cold). Additionally, it addresses issues of low soil fertility, particularly in hilly regions, by strengthening plant root systems to improve nutrient and soil absorption. Therefore, identifying native Trichoderma isolates that are better adapted to the local environment, thrive better in local soil conditions, and exhibit versatile capabilities in suppressing multiple stresses in crops is critically important for the successful commercial application of Trichoderma in Nepal. The native isolates of Trichoderma can effectively suppress soil-borne pathogens and improve plant health. Despite the recognized benefits, the commercialization and widespread adoption of Trichoderma -based products in Nepal remain limited. While specific data on the quantity of commercial Trichoderma products and their usage in Nepal are scarce, efforts are underway to explore and promote their application. For instance, initiatives like the “Initial Scoping for Commercial Marketing of Trichoderma and other Biological Solutions in Nepal” aim to assess and enhance the market potential of these biocontrol agents. However, it is important to note that not all Trichoderma species yield the same effects on crops or pathogens. Given the variability in efficacy among different Trichoderma species and strains, it is crucial to identify and characterize native isolates that are well-adapted to local conditions for their effective application as BCAs and the preservation of isolates as viable commercial products. 26 Such tailored approaches can maximize the benefits of Trichoderma applications, offering eco-friendly and cost-effective solutions to the challenges faced by Nepalese farmers. Traditional methods for identifying Trichoderma species have conventionally relied on morphological characteristics and culture-based approaches. However, owing to the limited and often indistinguishable morphological features shared among Trichoderma species, alongside the increasing recognition of morphologically cryptic species, accurate identification through these methods becomes challenging and can potentially lead to misidentification. 10 , 33 As a result, molecular techniques such as amplification of important taxonomic markers, and sequencing have emerged as indispensable tools for achieving precise species identification. 33 – 36 In the present study, the identification of Trichoderma species at the species level was accomplished by focusing on two key genetic markers: the Internal Transcribed Spacer (ITS) region of rDNA and a partial sequence of the translation elongation factor 1-alpha gene (tef-1α) in addition to classical taxonomy. 37 Recent researches have evaluated the ecological specialization of diversity. Numerous studies have documented the discovery of new isolates and phylogenetic species across various natural ecosystems. 21 , 38 While some studies have been conducted in Nepal, they all have focused on different ecological zones. 39 In contrast, limited attention has been given to studying Trichoderma in agricultural environments. Importantly, such investigations have practical implications, as they highlight the potential of agricultural soil rhizosphere as a rich source of beneficial strains with biocontrol capabilities. Building upon these findings, we propose that the composition, distribution, and genetic structure of Trichoderma spp. in the rhizosphere of vegetable crops along with ecological domains and altitudinal gradients may exhibit significant differences. Confirming these differences will enhance our understanding of Trichoderma ’s biodiversity across distinct biological niches and various altitudinal gradients across the country. Methods Isolation and culture of Trichoderma isolates To isolate Trichoderma , soil samples were collected from different agricultural regions spanning three ecological zones in Nepal: the plain region (80-141 m above sea level), the mid-hill region (1284-1650 m above sea level), and the high mountain region (1800-2500 m above sea level). These regions exhibited variations in altitude and ecological traits, and were recognized for cultivating a range of agricultural crops. The soil samples were collected from vegetable-growing areas within each region, covering eight districts in Nepal, including Sindhupalchok and Solukhumbu districts in the high mountains; Kathmandu, Lalitpur, Bhaktapur and Kavrepalanchok districts in the mid-hills, and Sunsari and Morang in the plains ( Figure 1 ). Figure 1. Map showing soil sampling sites for isolation of Trichoderma isolates. Using a sterile spatula, approximately 200 grams of soil were collected from the rhizospheric zone of crops such as cauliflower, leaf mustard, cabbage, asparagus bean, tomato, cucumber, brinjal, chilly, pumpkin, and okra. These soil samples were carefully placed in clean polythene bags and appropriately labelled. Subsequently, the soil samples were transported to the National Plant Pathology Research Center, Khumaltar, Nepal and stored at 4°C until isolation. For isolation, 10 grams soil samples were suspended in 90 ml of sterile distilled water and mixed using a rotary shaking machine set at 260 × g for 30 minutes to ensure thorough homogenization. 40 To facilitate the isolation, 1 mL aliquots of the soil suspensions were diluted from 10 −1 to 10 −5 onto Trichoderma Selective Media (TSM) using the spread plate technique as described by Askew and Laing. 41 After inoculation, Trichoderma colonies were sub-cultured onto potato dextrose agar (PDA) plates and incubated at 28±2°C for seven days to allow for growth. Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, and colour. Depending on the diversity of colony characteristics, one to two colonies were selected from each sample for pure culture preparation. Each individual isolate was assigned a unique code and stored in a PDA slant for further study. Isolates were then grown on PDA plates for 3-5 days for sporulation. Different dilutions (10 −1 to 10 −3 ) of spore suspension for each isolate were spread on 10% water agar plates and incubated at 28±2°C for 24 hours in the dark to prepare monoconidial cultures. A germinating, isolated single spore was picked up using a sterile needle from the water agar plates and placed on PDA plates to prepare monoconidial culture for each isolate. Spore suspensions were prepared as mentioned earlier and preserved in silica gel for long term storage at -80°C in a deep freezer. 42 Morphological and morphometrical characterization A total of 167 Trichoderma isolates were isolated from various soil samples and preserved using silica gel and were subsequently cultured on PDA plates at 28±2°C for three days. Following the incubation period, cultures with similar morphological characteristics, including growth pattern, diffusible pigments and odor, were observed and sorted into 25 different groups (T1-T25). While most groups consisted of 4 to 5 isolates, T11 and T22 (two larger groups) comprised 20 to 25 isolates each. Within each group, one representative isolate was selected for further study, except for the larger groups where 3 to 5 isolates were chosen for the study. Morphological characteristics such as the aspects of phialides, conidia and chlamydospores were scrutinized under a light microscope (Optika Microscope Italy, B-383PLi) equipped with a camera. To achieve this, Trichoderma isolates were grown on corn meal agar plate for 2-3 days, after which mycelial tips from the colony margin were transferred onto microscope slide and mounted with 3% KOH using sterile glass needles. Subsequently, these specimens were subjected to observation following the flattening and stretching of hyphae with a pair of glass needles. Once suitably prepared, a coverslip was placed over the samples, and any excess liquid was removed using tissue paper. Microscopical measurements and analyses were conducted using the ImageJ software ( https://imagej.en.download.it , LOCI, University of Wisconsin). A total of 30 individual phialides and conidia from each specimen were measured and analyzed. The colony characteristics of Trichoderma isolates were investigated on PDA plates that were incubated at 28°C under dark conditions. Notably, all Trichoderma isolates developed conidia within 4-5 days. Various diffusible pigments were observed, manifesting as distinct colors, which were then compared with the Audrey & Bear Color Chart ( https://audreyandbear.com/products/audrey-bear-color-chart ). Additionally, the presence or absence of a coconut odor was noted following 48 hours of culturing on PDA plates. 43 Molecular characterization of Trichoderma isolates Thirty-three Trichoderma spp. isolates, representing diverse groups based on similarities in morphological traits such as growth patterns and diffusible pigments, were selected from various ecological regions for DNA extraction and molecular characterization ( Figure 2 ). Figure 2. Distribution of Trichoderma species/isolates collected across various ecological regions of Nepal. Approximately, 30-40 mg of mycelium was scraped off from 3–5-day-old colonies cultured on potato dextrose agar (PDA) using sterilized glass slides prior to sporulation for genomic DNA extraction. The obtained mycelia were then ground in liquid nitrogen and DNA extraction was carried out using the Promega Wizard genomic DNA extraction kit (Catalogue No. A1120) following the manufacturer’s instructions (Promega Corporation, Madison, WI). A fragment of rRNA containing the internal transcribed spacer regions was amplified using the primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG). 44 The translation elongation factor 1-alpha gene (tef-1α) was amplified using the primers EF1-728F (CATCGAGAAGTTCGAGAAGG) 45 and TEF1R (GCCATCCTTGGGAGATACCAGC). 10 , 46 , 47 Each PCR reaction (25 μL) comprised 12.5 μL of GoTaq ® Green Master Mix (Promega), 9.5 μL of nuclease-free water, 1 μL of each forward and reverse primer (10 mM), and 1 μL of gDNA. The PCR reactions were performed using a thermocycler (LifeEco Thermal Cycler (BIOER)) with the following settings: For ITS: 1 cycle of 2 minutes at 95°C followed by 34 cycles of 30 seconds at 95°C, 30 seconds at 57°C, 1 minute at 72°C, followed by a final elongation step at 72°C for 5 minutes. For tef-1α: 1 cycle of 5 minutes at 95°C followed by 35 cycles of 45 seconds at 95°C, 45 seconds at 63°C, 1 minute at 72°C, followed by a final elongation step at 72°C for 10 minutes. Amplified PCR products (3 μL) were subjected to electrophoresis (45 minutes, 100 volts) in a 1.0% agarose gel stained with GelGreen ® Nucleic Acid Gel Stain (Biotium, Fremont, CA, USA) alongside a 1 kb DNA ladder (Promega) for size estimation of the amplified bands. The PCR products were purified using the Wizard SV gel and PCR cleanup system (Promega) following the manufacturer’s instructions and were subsequently sequenced using both reverse and forward primers by Sanger sequencing (BGI Solutions Co., Ltd. Tai Po, Hong Kong, China). Phylogenetic relationships Sequences were manually edited using Finch TV 1.4.0 for Windows (Geospiza, https://digitalworldbiology.com/FinchTV ). Consensus sequences of forward and reverse amplicons were created using BioEdit software 48 and deposited in the National Center for Biotechnology Information (NCBI) NCBI under accession numbers (OR140790- OR140818) for ITS rRNA and (OR567133-OR567158) for tef-1α. The BLASTn similarity search program was employed to identify homologous sequences in the NCBI nucleotide database, confirming species-level similarity with the sequence of the isolates. The ITS and tef-1α gene sequences were concatenated using Mesquite software version 2.75. 49 Final alignments were done using Clustal W 2.0 in MEGA X version 10.1 and were used to construct phylogenetic trees using the Maximum Likelihood method with the Kimura 2-parameter (G+I for ITS) and Hasegawa-Kishino-Yano (G+I for tef-1α) models. 50 The choice of the evolution model was made after evaluating individual alignments through a model test (MEGAX software). Bootstrap values were computed with 1,000 replications to assess the statistical support for each branch. Graphical representation and editing of the phylogenetic trees were carried out using the Interactive Tree of Life (v3.5.1). 51 , 52 Analysis of the diversity among Trichoderma species The degree of dominance index, also known as the McNaughton dominance index (Y), was used to quantitatively assess the habitat preference of Trichoderma isolates in different agricultural fields. The dominance values were calculated using the equation: Y = ni fiN where ‘N’ is the total number of Trichoderma isolates, ‘ni’ is the number of the genus (species) i, and ‘fi’ is the frequency with which genus (species) i appears in the samples. A species i is considered dominant when Y > 0.02. 53 Species richness (the total number of species), abundance (the total number of isolates of each species), and diversity were calculated using several ecological indices: the Simpson biodiversity index (D), 54 Shannon’s biodiversity index (H), 55 Pielou species evenness index (J), 56 and Margalef’s abundance index (E). 57 These indices were applied to quantitatively describe the diversity and habitat preferences of Trichoderma species in various agricultural fields across different ecological zones of Nepal. The biological diversity indices were computed numerically using the following equations in Microsoft Excel (Excel 2010 (v14.0)) D = 1 − Σ ni ( ni − 1 ) N ( N − 1 ) H = ΣPi ln Pi where Ni = 1, and Pi = ni N J = H Hmax Where Hmax = InS E = S − 1 ln N In these equations, ‘S’ is the total number of Trichoderma species, ‘N’ is the total number of Trichoderma species isolates, ‘Pi’ is the relative quantity of Trichoderma species ‘i’, and ‘ni’ is the number of isolates of Trichoderma species ‘i’. Results Morphological characterization of single spores of Trichoderma isolates A total of 167 Trichoderma isolates were isolated from soil samples collected from rhizospheric regions of various vegetable crops. Among this collection, 33 Trichoderma isolates were selected based on morphological and microscopic characteristics. The isolates were visually characterized based on phenotypic traits such as colony color (ranging from dark green to cottony whitish green, Plate 1 ), 58 growth pattern, presence or absence of aerial mycelium ( Figure 3a, b ), as well as the shape and size of phialides ( Figure 3c–f ) and conidia ( Figure 3g–i ). Additionally, the presence ( Figure 3j ) or absence of chlamydospores was observed microscopically ( Table 1 ). 59 Isolates from the groups T2, T3, T6, T7, T8, T9, T11, T14, T18, T19, T24 were morphologically and microscopically identified as belonging to the Harzianum clade. Meanwhile, isolates from groups T1, T4, T10, T12, T13, T15, T16, T21, T22, T23, T25 were identified as members of the Viride clade. Isolates from groups T5 and T17 were grouped within Longibrachiatum clade, corresponding to T. longibrachiatum species, while isolates from T20 group were classified within Brevicompactum clade, associated with T. brevicompactum species. Plate 1. Culture of Trichoderma isolates grown in 28±2°c in potato dextrose agar medium. Figure 3. Morphological characteristics of Trichoderma isolates. a, b: with and without aerial mycelium. c–f: different types of phialides. g–i: different types of spores. j: presence of chlamydospores in Trichoderma asperellum. Table 1. Morphological characteristics of Trichoderma isolates isolated from various ecological zones of Nepal. Name of Trichoderma isolates Colony Phialides Conidia Species Molecular clade Form and color Front color Reverse color Aerial mycelium Conidiation Size (μm) Shape Spore width (μm) x Coconut odor Chlamydospore T1 ToT8 Green color concentric rings Green Banana yellow Present Whorl 5.8-9.5 Round 1.9-3.3 Present Absent T. asperellum Viride T2 ST49 green in middle and wooly white periphery Green Banana yellow Absent Whorl 5-8.5 Round 1.6-2.2 absent Absent T. lentiforme Harzianum T3 BaT5 Green and white ring Fern green Banana yellow Absent Whorl 5.1-6.6 Oblong 1.2-2.6 Absent Absent T. afroharzianum Harzianum T4 ToT7 Creamy wooly green colony green Cream Absent Whorl 5.0-7.0 Round 1.4-2.2 Present Absent T. asperelloides Viride T5 PT11 Green and white colony green White Present Whorl 4.9-7.4 Oblong 2-3.3/1.2-1.9 present Present T. longibrachiatum Longibrachiatum T6 DT7 Granular granny smith apple Granny smith apple cream Absent Whorl 6.1-8 Round 1.4-2.9 Absent Present T. harzianum Harzianum T7 NaT2, MT5 Concentric green ring colony Green Sunshine Absent Whorl 5-6.4 Round 1.9-2.6 Absent Present T. afroharzianum, T. azevedoi Harzianum T8 MT8 Concentric ring Sea green Straw Absent Whorl 4.9-7.4 Round 1.2-3.08 absent Not clear T. inhamatum Harzianum T9 PanT1 Sea green concentric ring Sea green Cream Absent Whorl 05-Sep Oblong 2.5-4.1/0.9-1.9 Absent Rarely Present T. camerunense Harzianum T10 ST43 Fern green concentric ring Fern green Canary yellow Present Whorl 5-8.1 Oval 2.2-3.2/1.2-2.9 Present Present T. asperellum Viride T11 ST10, SolT21, MT4, MT30, MT11, BaT9 Fern green concentric ring Fern green Dijon pigment Absent Whorl 4.9-9.5 Round 0.9-1.9 Present Rarely Present T. afroharzianum Harzianum T12 DT22 White center and fern green Fern green Cream Absent Whorl 5.5-7.6 Round 1.02-2.17 Absent Present T. koningii Viride T13 SaT4 Granular fern green ring Fern green Banana yellow Absent Whorl 6.6-11.7 Round 1.2-2.9 Absent Absen T. atroviride Viride T14 SolT24b Concentric granny smith apple colony Granny smith apple green Sand Absent Whorl 4.3-7.9 Round .6-1.7 Absent Present T. afroharzianum Harzianum T15 PanT2 Granular green and white colony Fern green Tangerine Absent Whorl 5.8-10.4 Oblong 1.2-3.8/1.2-1.9 absent Present T. asperelloides Viride T16 MT9 Wooly white colony Fern green Pumpkin orange Present Whorl aggregate 6.3-8.8 Round 1.02-2.9 Absent Rarely present T. asperellum Viride T17 ToT11 Granular fern green colony Fern green Mustard yellow Absent Solitary 5.2-9.9 Oblong 2.3-3.6/0.9-1.9 Absent Absent T. longibrachiatum Longibrachiatum T18 PT13 Wooly white colony White Sunshine Absent Whorl 4.8-6.7 Oblong 2.5-3.6/.9-1.9 Present Present T. afroharzianum Harzianum T19 ST6 Green concentric ring green sunshine Absent Whorl 5.5-7.9 Round .9-1.9 Absent Present T. afroharzianum Harzianum T20 MT15 Sea green ring colony Sea green straw Absent Whorl 7.7-10.6 Round 1.2-2.2 Absent Present T. brevicompactum Brevicompactum T21 KT11, ST20 Fern green colony Fern green Banana yellow Absent Whorl 7-9.6 Round 1.9-4 Absent Present T.asperellum Viride T22 NaT7 Fern green and white granular colony Fern green Canary yellow Absent 2-3in Whorl 6.2-8.8 Round 1.9-3.3 Absent Rarely Present T.asperellum Viride T23 KT6, SolT6b Granular green and white colony Fern green Cream base Absent 2-3 in Whorl 6.8-8.7 Round 1.6-3.3 Present Present T. asperellum Viride T24 ST3 Wooly green colony Green Canary yellow Absent Solitary 6.2-7.7 Round 1.3-2 Absent Present T. afroharzianum Harzianum T25 KT13 Granular green and white colony Fern green white Absent Solitary/2-3whorl 5.5-8.4 Round 1.2-2.9 Absent Present T. asperellum Viride Morphological variations were observed among different groups of Trichoderma isolates ( Table 1 ). 59 Illustrations of colonies grown in PDA Petri plates are shown in Plate 1. 58 Various diffusible pigments were observed, displaying different colors, which were compared to the Audrey & Bear Color Chart ( https://audreyandbear.com/products/audrey-bear-color-chart ). In the Harzianum clade, which includes species such as T. afroharzianum , T. lentiforme , T. camerunense, T. inhamatum and T. azevedoi colonies exhibited 1-2 concentric rings with the production of green-colored conidia . No diffusible pigments were detected in PDA medium, and a coconut odor was also not noticeable. The conidia were oval to oblong and ranged from 0.6-4.1μm. Within the Viride clade , comprising species like T. asperellum, T. asperelloides, T. koningii and T. atroviride colonies on PDA displayed a somewhat granular appearance with green and white regions distributed throughout the plate. No diffusible pigments were detected in the PDA medium, but coconut odor was found in some groups and absent in others ( Table 1 ). 59 The conidia were generally round and ranged from 1-4 μm. The T5 and T17 groups of isolates displayed white mycelium with green pustules and produced yellow diffusible pigments, classifying them within the Longibrachiatum clade. Conidia in this group were oblong and ranged from 2-3.9 μm. Isolates from T20 group were challenging to differentiate and were grouped together, with conidia measuring 1.2-2.2μm. Phialides were flask-shaped in both the Harzianum and Viride clades and were present in whorls in almost all species, except in ST3 ( T. afroharzianum ) and ToT11( T. longibrachiatum ), where they were solitary. The Harzianum clade was found within an altitudinal range of 80-1800 masl, spanning from lowland plains to hilly regions, and was common in both tropical and temperate regions ( Table 2 ). 59 Similarly, the Viride clade were also identified in both tropical and temperate regions, with altitudes ranging from between 90-1475 masl, which was generally lower than that of the Harzianum clade. Isolates of the T20 group ( T. brevicompactum ) were primarily located in lowland plains (at 80 masl), rather than in higher mountain region, whereas T. longibrachiatum was primarily found in mid-hill regions, with altitudes ranging from 1300-1500 masl ( Table 2 ). 59 However, morphological characteristics alone proved insufficient for distinguishing between the various Trichoderma isolates. Therefore, molecular identification was required to differentiate among complex and overlapping Trichoderma isolates. Table 2. Details of selected Trichoderma isolates from different altitudinal regions with their corresponding geographic locations, isolate names and GenBank accession numbers. Species Isolate GPS location Altitude (masl) District Gen bank Accession No. ITS tef-1α T. afroharzianum ST3 26.54N 87.12E 80 Sunsari OR140790 OR567133 T. afroharzianum ST6 26.7N 87.28E 95 Sunsari OR140791 OR567134 T. afroharzianum ST10 26.58N 87.18E 113 Sunsari OR140792 OR567135 T. afroharzianum MT4 26.6N 87.32E 82 Morang OR140793 OR567136 T. afroharzianum MT11 26.46N 87.34E 100 Morang OR140794 OR567137 T. afroharzianum MT30 26.48N 87.27E 80 Morang OR140795 OR567138 T. afroharzianum BaT5 27.69N 85.25E 1360 Kathmandu OR140796 OR567139 T. afroharzianum BaT9 27.69N85.25E 1312 Kathmandu - OR567140 T. afroharzianum NaT2 27.65N 85.51E 1605 Kavrepalanchok OR140797 OR567141 T. afroharzianum PT13 27.59N 85.51E 1510 Kavrepalanchok - OR567142 T. afroharzianum SolT24b 27.44N 86.59E 1800 Solukhumbu OR140798 OR567143 T. lentiforme ST49 26.69N 87.09E 80 Sunsari OR140799 OR567144 T. inhamatum MT8 26.56N 87.49E 127 Morang OR140800 OR567145 T. camerunense PanT1 27.63N 85.55E 975 Kavrepalanchok OR1407801 OR567146 T. asperellum ST20 26.65N 87.28E 113 Sunsari OR1407802 OR567147 T. asperellum ST43 26.55N 87.12E 92 Sunsari OR1407803 OR567148 T. asperellum MT9 26.66N 87.6E 100 Morang OR1407804 OR567149 T. asperellum KT13 27.66N 85.29E 1413 Kathmandu OR1407805 OR567150 T. asperellum ToT7 27.75N 85.34E 1339 Kathmandu OR1407806 OR567151 T. asperellum ToT8 27.77N 85.33E 1339 Kathmandu OR1407807 OR567152 T. asperelloides PanT2 27.63N 85.61E 925 Kavrepalanchok OR1407808 OR567153 T. asperelloides KT11 27.68N 85.27E 1370 Kathmandu - OR567154 T. atroviride SaT4 27.64N 85.48E 1475 Kavrepalanchok - OR567155 T. brevicompactum MT15 26.49N 87.29E 80 Morang OR140809 OR567156 T. azevedoi MT5 26.49N 87.29E 100 Morang OR140810 OR567157 T. harzianum DT7 27.68N 85.93E 2500 Sindhupalchok OR140811 - T. afroharzianum SolT21 27.54N 86.57E 2300 Solukhumbu OR140812 - T. asperellum KT6 27.68N 85.27E 1335 Kathmandu OR140813 - T. asperellum NaT7 27.65N85.51E 1624 Kavrepalanchok OR140814 - T. asperellum SolT6b 27.52N 86.58E 2365 Solukhumbu OR140815 - T. koningii DT22 27.68N 85.93E 2500 Sindhupalchok OR140816 - T. longibrachiatum ToT11 27.75N 85.33E 1349 Kathmandu OR140817 - T. longibrachiatum PT11 27.59N 85.51E 1520 Kavrepalanchok OR140818 OR567158 Molecular characterization and phylogenetic studies of Trichoderma isolates Trichoderma isolates were further identified using molecular sequencing data of ITS rRNA and tef-1α genes to support our morphological data. Out of 33 strains, PCR and bidirectional sequencing were successfully completed for 29 presumptive isolates by ITS oligonucleotide barcode identification (OR140790-OR140818) and for only of 26 isolates using tef-1α (OR567133-OR567158). The average consensus sequence length for tef-1α was 663 bp, while for the ITS rRNA, it was 646 bp. Nucleotide BLAST analysis and pairwise alignments of the ITS rRNA and tef-1α sequences identified the Trichoderma isolates as belonging to T. harzianum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi , T. atroviride, T. asperellum, T. asperelloides, T. brevicompactum, T. koningii and T. longibrachiatum which shared 97-100% identity match with published sequences in the NCBI database. The phylogenetic tree ( Figure 4 ) based on ITS rRNA unambiguously identified 11 species among the 29 isolates, based on their clustering with reference taxa. The isolates identified in the analysis included T. harzianum, T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi, T. asperellum, T. asperelloides, T. brevicompactum, T. koningii and T. longibrachiatum. Although the ITS rRNA tree could not clearly delimit the species resolution of the isolates MT8, ST49, MT5, and PanT1, however there were clear and distinct resolution of other isolates ( Figure 4 ). The phylogenetic tree ( Figure 5 ) obtained from the tef-1α region identified 10 species among the 26 isolates, which included T. afroharzianum, T. lentiforme, T. inhamatum, T. camerunense, T. azevedoi , T. atroviride, T. asperellum, T. asperelloides, T. longibrachiatum and T. brevicompactum. The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp), produced four distinct, well supported clades with bootstrap values higher than 70%: Harzianum , Viride , Longibrachiatum and Brevicompactum clades ( Figure 6 ). Figure 4. Phylogenetic tree of 29 Trichoderma isolates based on ITS rRNA sequences. Figure 5. Phylogenetic tree of 26 Trichoderma isolates based on tef-1α gene sequences. Figure 6. Phylogenetic tree of 22 Trichoderma isolates based on tef-1α -ITS gene sequences. Thus, based on above three phylogenetic trees, four clades were identified: Harzianum , Viride , Brevicompactum and Longibrachiatum clades. Eighty-five isolates belonged to the Harzianum clade, consisting of T. afroharzianum (64 isolates), T. harzianum (3 isolates), T. lentiforme (1 isolate), T. camerunense (11 isolates T. inhamatum (5 isolates), and T. azevedoi (1 isolate). The Viride clade included 67 isolates, comprising species such as T. asperellum (57 isolates), T. asperelloides (6 isolates), T. atroviride (1 isolate), and T. koningii (3 isolates). The Longibrachiatum clade comprised 11 isolates, all belonging to the T. longibrachiatum. The Brevicompactum clade consisted of 4 isolates, all of which were identified as T. brevicompactum ( Table 3 ). 59 Among these, T. afroharzianum was the most abundant species in this study, followed by T. asperellum. Table 3. List of total number of Trichoderma isolates used for morphological characterization. S. No. Code group No. of isolates present in code group Name of all isolates in code group Number of representative isolates taken Isolates name taken for molecular characterization Species name 1 T1 3 ToT8, NaT6, ST18 1 ToT8 T. asperellum 2 T2 1 ST49 1 ST49 T. lentiforme 3 T3 3 ST7, BaT5, MT39 1 BaT5 T. afroharzianum 4 T4 5 SaT7, ToT7, SolT3, SolT25, ST39a 1 ToT7 T. asperelloides 5 T5 6 ST38, PanT4, PT11, ToT9, PT14, ST8a 1 PT11 T. longibrachiatum 6 T6 3 LaT9, DT7, SolT10 1 DT7 T. harzianum 7 T7 14 NaT2, MT31, SaT6, NaT1, NaT5, ST2 NaT3, MT33, ST49a, SolT12a, ST9, SaT2, MT18, MT5 2 NaT2, MT5 T. afroharzianum, T. azevedoi 8 T8 5 ToT6, SolT26a, ST11, MT8, ToT4 2 MT8 T. inhamatum 9 T9 11 ST40, MT28, MT29, DT19, SolT6a, ST13, PanT1, DolT14, ToT1, ST27, KT2 1 PanT1 T. camerunense 10 T10 7 KT1, ST5, ST46, KT7, ST8b, ST39b, ST43 1 ST43 T. asperellum 11 T11 31 MT2, MT3, BKT4, MT46, BktT8, MT13, SaT1, ToT5, ST24, ST21, BaT9, SaT9, ST25, SolT14a, ST28, MT1, MT4, MT6, PT4, ST22, MT11, MT49, MT30, MT12, ST10, ST23, MT23, SolT21, MT37, MT19, MT48 6 SolT21, ST10, MT30, MT4, BaT9, MT11 T. afroharzianum 12 T12 3 ST1, PT6, DT22 1 DT22 T. koningii 13 T13 1 SaT4 1 SaT4 T. atroviride 14 T14 1 SolT24b 1 SolT24b T. afroharzianum 15 T15 1 PanT2 1 PanT2 T. asperelloides 16 T16 1 MT9 1 MT9 T. asperellum 17 T17 5 PanT6, ST48, ST38, ST19, ToT11 1 ToT11 T. longibrachiatum 18 T18 7 PT13, DT24, DT31, DT26, SolT22, ST50, ST15 1 PT13 T. afroharzianum 19 T19 6 LaT3, ST12, KT12, ST6, ST4, ST23 1 ST6 T. afroharzianum 20 T20 4 MT10, MT14, MT17, MT15 1 MT15 T. brevicompactum 21 T21 27 BaT6, BaT12, ST26, LaT11, DT10, BaT3, MT44, PanT5, DT20, DT11, LaT4, PT5, NaT9, DT39, SolT7, MT24, SolT26b, DolT3, SaT3, ST20, SolT15, DolT23, BktT1, KT11, PanT9, SolT12b, DolT2 3 ST20, KT11 T. asperellum 22 T22 6 ST47, KT4, NaT7, SolT18, ST35, PanT8 1 NaT7 T. asperellum 23 T23 12 MT21, KT6, SolT6b, BktT5, BktT11, ST34, BktT3, DolT18, SolT13, SolT12c, BaT11, LaT12 2 KT6, SolT6b T. asperellum 24 T24 3 BaT1, ST3, MT41 1 ST3 T. afroharzianum 25 T25 1 KT13 1 KT13 T. asperellum Total N = 25 N = 167 N = 33 Analysis of the diversity among Trichoderma species Table 4 shows Simpson’s biodiversity index (D), Shannon’s biodiversity index (H), evenness (J), and the abundance index (E) for various agricultural fields in different ecological zones. The highest species diversity and evennesswere recorded in the high mountain region, with Shannon’s index (H) of 1.724, evenness (J) of 0.84 and Simpson’s index (D) of 0.28). Following this the hilly region which exhibited the Shannon’s index of 1.563, eveness of 0.7 and Simpson’s index of 0.28. In contrast, the plain region had the lowest species diversity with Shannon’s and Simpson’s diversity indices and evenness estimated to be H = 1.515, J=0.66, D = 0.33. The species abundance values were E = 2.11 for the plain, E = 1.95 for mid-hill and E = 1.99 for the high mountain region. The dominance values (Y) of T. afroharzianum T. asperellum , T. camerunense and T. longibrachiatum were 0.04, 0.03, 0.01, and 0.01 respectively and they were classified as the principal species. On average, the diversity values for Trichoderma species were H = 1.61, D = 0.29, J = 0.74, and E= 2.02 ( Table 4 ). Simpson’s index (1-D) and the evenness index were close to 1 in all regions except for the plain region, indicating a very high diversity of Trichoderma species in the major agricultural areas of Nepal. The number of species and isolates, as well as the dominant species of Trichoderma , varied geographically ( Table 5 ) revealing that the mid hill and high mountain regions have a high diversity of Trichoderma species. Table 4. Univariate diversity indices of Trichoderma isolates from different altitudinal region of Nepal. Ecological indices Ecological regions Plain Mid-hill High mountain Average Simpson’s index (D) 0.33 (1-D = 0.67) 0.28 (1-D = 0.72) 0.28 (1-D = 0.72) 0.29 Shannon’s index (H) 1.515 1.563 1.724 1.61 Pielou's evenness (J) 0.66 0.72 0.84 0.74 Abundance index (E) 2.11 1.95 1.99 2.02 Table 5. Details of Trichoderma isolates from different altitudinal regions. Trichoderma Species Number of Trichoderma isolates Plain Mid-hill High altitude Total Trichoderma arfoharzianum 38 18 8 64 Trichoderma asperellum 15 26 16 57 Trichoderma camerunense 5 3 3 11 Trichoderma longibrachiatum 4 6 1 11 Trichoderma asperelloides 1 3 2 6 Trichoderma inhamatum 2 2 1 5 Trichoderma brevicompactum 4 0 0 4 Trichoderma harzianum 0 1 2 3 Trichoderma koningii 1 1 1 3 Trichoderma lentiforme 1 0 0 1 Trichoderma azevedoi 1 0 0 1 Trichoderma atroviride 0 1 0 1 Total 72 61 34 167 Discussion The remarkable biodiversity found in Nepal can be attributed directly to its unique geographical position, which spans a broad spectrum of altitudinal variances and a wide array of climatic conditions. Consequently, Nepal holds a significant position as one of the world’s important biodiversity hotspots. The fungal genus Trichoderma has been extensively studied for its diverse metabolites and their applications in agriculture, industry and health. 6 Its ability to establish beneficial interactions with plants and produce bioactive compounds makes it a valuable resource for sustainable and eco-friendly solutions in multiple sectors. 28 However, there have been very few studies on the diversity of Trichoderma species in Nepal compared to other parts of the world. 10 , 14 , 39 In the present study, the isolates of Trichoderma (n = 167) isolated from soils of different ecological zones were categorized into three clades based on their morphological characterization: Harzianum , Viride and Longibrachiatum. However, some isolates were challenging to differentiate and were not assigned to any specific clade (T20). Our observations in terms of morphological characterization align with the previous studies on these species. 42 , 60 The use of a single method for identifying Trichoderma species can present challenges and potential issues. To address this concern, Bissett proposed integration of both morphological and molecular studies. 61 This combined approach allows for a more comprehensive and accurate species-level classification within Trichoderma spp. In our study, species were identified following previous studies that utilized ITS and tef-1α sequencing. 62 Using molecular approaches, we were able to clearly identify some cryptic species, and we also distinguished isolates that could not be identified solely based on morphological features. Trichoderma species are typically identified through gene sequence analysis, with the generally accepted practice being the use of two gene sequences. However, recent studies suggest that the identification of new Trichoderma species may require the analysis of at least three DNA gene sequences. 63 , 64 In this particular study, 33 Trichoderma isolates were selected from a pool of 167 isolates isolated from soil samples that were collected from various regions of Nepal. To identify these isolates, we analyzed two DNA gene sequences: the ITS rRNA and the tef-1α genes. This analysis involved comparing the obtained sequences with those available in the NCBI database using BLASTn analysis. It has been observed that relying solely on individual gene sequences, such as ITS rRNA or tef-1α , is insufficient for accurately distinguishing all Trichoderma species. The phylogenetic analysis using ITS rRNA and tef-1α regions revealed significant insights into the diversity and taxonomy of Trichoderma isolates. The ITS tree identified 11 species among 29 isolates, clustering most with reference taxa; however, it could not resolve species for four isolates (MT8, ST49, MT5, and PanT1), indicating its limitations for closely related species. In contrast, the tef-1α tree identified 10 species among 26 isolates, offering better resolution, particularly for closely related taxa such as T. atroviride and T. asperelloides . The maximum likelihood tree, based on a concatenated dataset (ITS + tef-1α), provided the most robust results, forming four well-supported clades: Harzianum , Viride , Longibrachiatum , and Brevicompactum . This approach demonstrated the enhanced resolution achieved by integrating multiple markers, confirming species boundaries and phylogenetic relationships. These findings emphasize the complementary roles of ITS and tef-1α in species identification and highlight the importance of combined datasets for accurate classification. Future work can expand on these results using whole-genome sequencing to further refine taxonomy and explore functional diversity. As a result, we used a combination of ITS rRNA and tef-1α gene sequences, for a more comprehensive understanding of Trichoderma species distribution. In BLASTn searches, ITS sequences did not provide sufficient resolution of Trichoderma phylogeny for some species, such as the T. harzianum complex. However, the concatenated dataset (ITS-tef-1α) produced four well-supported clades. The resulting tree grouped together the same or closely related species into distinct clades. The comparison of test and conference taxa aligned with earlier reports. 13 , 65 , 66 The findings revealed similarities among Trichoderma species, with the out-group sequence of Fusarium oxysporum forming dissimilar clusters. Although tef-1α sequencing provided a clear picture of Trichoderma phylogeny, the predominant species complex ( T. harzianum complex) comprises multiple cryptic species. 67 , 68 The T. harzianum complex has undergone significant revision in recent times, resulting in the classification of T. harzianum into 14 distinct species. 69 , 70 In this research, we conducted a comprehensive examination of the diversity of indigenous Trichoderma species found in the rhizospheric soil across different districts of Nepal, taking into account variations in altitude. We assessed Trichoderma species diversity, which is defined as the product of the evenness and the number of species, using the Shannon biodiversity index -H. 55 To evaluate the dominance of individual species, we calculated Simpson’s diversity index, 54 which indicates the probability that two randomly selected species from a given ecosystem will belong to different categories. We also used Margalef’s abundance index to assess species richness and the Pielou index to determine the evenness of the Trichoderma population. The diversity and occurrence of Trichoderma species reported from different agroclimatic zones of Nepal, namely, the plain (80-141 masl), mid-hill (1284-1650 masl), and high mountain (1800-2500 masl) regions, clearly indicate that climatic topography and soil type are major factors influencing the distribution of Trichoderma species. The present study aimed to assess the suitably of several widely used diversity indices for various types of statistical analyses. We conducted both simple and multifaceted statistical analyses to determine if certain indices were better suited for specific types of analyses. Notably, Simpson’s index(1-D) and the evenness index approached 1 in the mid-hill and high mountain regions, except in the plain region. This observation suggests a remarkably high diversity of Trichoderma species in the major agricultural areas of Nepal, particularly in the mid-hill and high mountain regions. This is obvious that mountains and hills have high climatic diversity due to latitudinal variation compared to plain and harbor higher diversity of Trichoderma species compared to plain. These findings underscore the substantial diversity of Trichoderma species in these specific regions. Interestingly, Shannon’s index yielded quite similar values (~1.5) in the plain and mid-hill regions, which could be attributed to the extensive disturbance caused by human activities in both regions. The results of this study indicate that Trichoderma spp. diversity and habitat preference can serve as natural indicators of rhizosphere soil health. Moreover, our findings align with the research conducted by Ma 53 in Chinese grasslands of China and Mulatu 71 in Ethiopian coffee ecosystems. This diversity analysis of Trichoderma strains will facilitate the improved identification of Trichoderma species with biocontrol mechanisms, which can, in turn, contribute to the development of suitable bioformulations in sustainable agriculture. The number of Trichoderma species and isolates, as well as the dominant species, varied significantly across different geographical regions. The plain region (80-141 masl) encompasses two districts, Sunsari and Morang. In this region, we identified a total of six different species of Trichoderma : T. afroharzianum, T. lentiforme, T. inhamatum, T. asperellum, T. brevicompactum and T. azevedoi. We found a total of 72 isolates in the plain region, with T. afroharzianum (38 isolates) being the dominant species. The mid-hill region (1284-1650 masl) includes four main districts: Kathmandu, Lalitpur, Bhaktapur, and Kavrepalnchok. Here we identified six different types of Trichoderma species: T. afroharzianum, T. camerunense , T . longibrachiatum, T. asperellum, T. asperelloides and T. atroviride with total of 61 isolates. In the mid-hill region, T. asperellum (26 isolates) was the dominant species. The high mountain region (1800-2500 masl) comprises two districts, Solukhumbu and Sindhupalchok. In this region, we found only four Trichoderma species: T. harzianum, T. afroharzianum, T. asperellum and T. koningii , with a total of 34 isolates. In this region, T. asperellum (16 isolates) was the dominant species. The presence of these Trichoderma species in the rhizospheric soils of vegetables in Nepal can be attributed to the diverse ecological substrates and climate conditions in the country’s vegetable crop growing areas. Our results suggest that these areas provide an optimal environment for the survival and colonization of a diverse group of Trichoderma species. Trichoderma afroharzianum (39.0%) was found to be the most widely distributed and abundant species in our study. The occurrence of Trichoderma species is influenced by various factors, including metabolic diversity, reproductive capabilities, substrate availability and the competitive abilities of Trichoderma isolates in natural ecosystems. In the present, we identified nine new country record of Trichoderma species: T. afroharzianum T. harzianum, T. lentiforme, T. inhamatum, T. camerunense, T. atroviride, T. brevicompactum, T. longibrachiatum and T. azevedoi. However, these species have previously been described in regions across the world, including America, 68 , 72 , 73 Asia, 10 , 16 , 17 Africa 9 , 35 , 71 and European Mediterranean countries. 25 , 46 During this study, we reisolated some species, including T. asperellum , T. asperelloides and T. koningii , along with nine additional species. However, two previously reported species, T. rugulosum and T. lixii were not found in this study. 10 , 39 The Harzianum clade contained economically important species such as T. harzianum, T. afroharzianum, T. camerenunse, T. lentiforme and T. inhamatum , which are used in agriculture as biological control agents. The Viride clade included T. asperellum, T. asperelloides , T. koningii and T. atroviride. The Longibrachiatum clade consisted of T. longibrachiatum , while the Brevicompactum clade with T. brevicompactum. T. longibrachiatum has high optimal and maximum growth temperatures and exhibits yellow reverse pigmentation due to the production of secondary metabolites such as pyrone. T. brevicompactum is utilized in the production of various antimicrobial substances, offering significant agricultural, health, and environmental benefits. In this study, we obtained isolates of T. harzianum , T. afroharzianum , T. inhamatum , T. lentiforme , T. azevedoi , T. camerunense, T. asperellum , T. asperelloides , T. atroviride , T. koningii , T. longibrachiatum , and T. brevicompactum from various crop ecosystems. Notably, T. afroharzianum and T. asperellum were most widely distributed species in our study. However, previous studies in crop ecosystems in Nepal have reported T. asperellum and T. asperelloides as the most widely distributed species of this genus. 39 It is worth noting that among these reported species, only T. asperellum , T. asperelloides and T. koningii have been previously documented in Nepal. 10 , 39 Conclusion This study presents novel findings regarding the presence of Trichoderma species in the Himalayan foothills of Nepal at different altitudes in previously unexplored geographic regions. However, it is important to note that our observations provide only a limited glimpse into the overall diversity of Trichoderma in Nepal. Despite being recognized as a biodiversity hotspot, fungal diversity in this region remains poorly understood. To gain a more comprehensive understanding, further investigations involving the isolation of Trichoderma from various substrates like forest areas and high-altitude areas in Nepal are highly recommended. Such endeavors are likely to unveil a multitude of additional species, some of which may be previously unknown. These new discovered taxa hold significant potential for various biotechnological applications and can contribute to further advancements in this field. Author information Authors and Affiliations Puja Jaiswal Central Department of Zoology, Tribhuvan University, Kirtipur, Nepal Ram B. Khadka and Suraj Baidya National Plant Pathology Research Center, Nepal Agricultural Research Council, Khumaltar, Nepal Aashaq Hussain Bhat Department of Bioscience, University Centre for Research and Development, Chandigarh University, Punjab, India Arvind Kumar Keshari Department of Zoology, Patan Multiple Campus, Tribhuvan University, Lalitpur, Nepal Author’s contributions Puja Jaiswal conceptualized, did data curation, formal analysis, investigation, methodology, validation and writing original draft. Ram Bahadur Khadka worked on conceptualization, formal analysis, investigation, methodology, project administration, resources, supervision, and validation of the study. Suraj Baidya helped with writing, review and editing the manuscript. Aashaq Hussain Bhat did formal analysis, validation and writing, review and editing the manuscript. Arvind Kumar Keshari conceptualization, project administration, resources, supervision, validation, writing, review and editing the manuscript. All authors read and agree to the final draft of the paper. Ethics and consent The present study didn’t involve the use of human and animals so ethical approval and consent were not required. Data availability Underlying data The sequencing data are available on the NCBI Genbank webpage Morphological and Molecular Characterization of Native Trichoderma isolates from Nepal (OR140790- OR140818; OR567133-OR567158) NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140790; https://www.ncbi.nlm.nih.gov/nuccore/OR140790 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140791; https://www.ncbi.nlm.nih.gov/nuccore/OR140791 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140792; https://www.ncbi.nlm.nih.gov/nuccore/OR140792 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140793; https://www.ncbi.nlm.nih.gov/nuccore/OR140793 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140794; https://www.ncbi.nlm.nih.gov/nuccore/OR140794 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140795; https://www.ncbi.nlm.nih.gov/nuccore/OR140795 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140796; https://www.ncbi.nlm.nih.gov/nuccore/OR140796 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140797; https://www.ncbi.nlm.nih.gov/nuccore/OR140797 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140798; https://www.ncbi.nlm.nih.gov/nuccore/OR140798 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140799; https://www.ncbi.nlm.nih.gov/nuccore/OR140799 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140800; https://www.ncbi.nlm.nih.gov/nuccore/OR140800 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR1407801; https://www.ncbi.nlm.nih.gov/nuccore/OR1407801 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR1407802; https://www.ncbi.nlm.nih.gov/nuccore/OR1407802 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR1407803; https://www.ncbi.nlm.nih.gov/nuccore/OR1407803 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR1407804; https://www.ncbi.nlm.nih.gov/nuccore/OR1407804 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR1407805; https://www.ncbi.nlm.nih.gov/nuccore/OR1407805 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR1407806; https://www.ncbi.nlm.nih.gov/nuccore/OR1407806 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR1407807; https://www.ncbi.nlm.nih.gov/nuccore/OR1407807 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR1407808; https://www.ncbi.nlm.nih.gov/nuccore/OR1407808 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140809; https://www.ncbi.nlm.nih.gov/nuccore/OR140809 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140810; https://www.ncbi.nlm.nih.gov/nuccore/OR140810 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140811; https://www.ncbi.nlm.nih.gov/nuccore/OR140811 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140812; https://www.ncbi.nlm.nih.gov/nuccore/OR140812 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140813; https://www.ncbi.nlm.nih.gov/nuccore/OR140813 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140814; https://www.ncbi.nlm.nih.gov/nuccore/OR140814 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140815; https://www.ncbi.nlm.nih.gov/nuccore/OR140815 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140816; https://www.ncbi.nlm.nih.gov/nuccore/OR140816 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140817; https://www.ncbi.nlm.nih.gov/nuccore/OR140817 59 NCBI: Trichoderma Internal Transcribed Spacer RNA (ITS): Accession number OR140818; https://www.ncbi.nlm.nih.gov/nuccore/OR140818 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1): Accession number OR567133; https://www.ncbi.nlm.nih.gov/nuccore/OR567133 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567134; https://www.ncbi.nlm.nih.gov/nuccore/OR567134 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567135; https://www.ncbi.nlm.nih.gov/nuccore/OR567135 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567136; https://www.ncbi.nlm.nih.gov/nuccore/OR567136 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567137; https://www.ncbi.nlm.nih.gov/nuccore/OR567137 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567138; https://www.ncbi.nlm.nih.gov/nuccore/OR567138 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567139; https://www.ncbi.nlm.nih.gov/nuccore/OR567139 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567140; https://www.ncbi.nlm.nih.gov/nuccore/OR567140 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567141; https://www.ncbi.nlm.nih.gov/nuccore/OR567141 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567142; https://www.ncbi.nlm.nih.gov/nuccore/OR567142 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567143; https://www.ncbi.nlm.nih.gov/nuccore/OR567143 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567144; https://www.ncbi.nlm.nih.gov/nuccore/OR567144 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567145; https://www.ncbi.nlm.nih.gov/nuccore/OR567145 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567146; https://www.ncbi.nlm.nih.gov/nuccore/OR567146 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567147; https://www.ncbi.nlm.nih.gov/nuccore/OR567147 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567148; https://www.ncbi.nlm.nih.gov/nuccore/OR567148 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567149; https://www.ncbi.nlm.nih.gov/nuccore/OR567149 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567150; https://www.ncbi.nlm.nih.gov/nuccore/OR567150 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567151; https://www.ncbi.nlm.nih.gov/nuccore/OR567151 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567152; https://www.ncbi.nlm.nih.gov/nuccore/OR567152 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567153; https://www.ncbi.nlm.nih.gov/nuccore/OR567153 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567154; https://www.ncbi.nlm.nih.gov/nuccore/OR567154 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567155; https://www.ncbi.nlm.nih.gov/nuccore/OR567155 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567156; https://www.ncbi.nlm.nih.gov/nuccore/OR567156 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1v): Accession number OR567157; https://www.ncbi.nlm.nih.gov/nuccore/OR567157 59 NCBI: Trichoderma DNA sequence of translation elongation factor 1α (tef-1α): Accession number OR567158; https://www.ncbi.nlm.nih.gov/nuccore/OR567158 59 Extended data Figshare: Morphological and molecular characterization of Trichoderma isolates from vegetable crop rhizospheres in Nepal; Plate 1. Culture of Trichoderma isolates grown in 28±2°c in potato dextrose agar medium; https://doi.org/10.6084/m9.figshare.26405059.v1 58 Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0) Figshare: Morphological and molecular characterization of Trichoderma isolates from vegetable crop rhizospheres in Nepal; https://doi.org/10.6084/m9.figshare.26380360.v1 59 Data are avalilable under the terms of the Creative Commons Attribution 4.0 Internasional license (CC-BY 4.0) Acknowledgements Authors would like to acknowledge NARC-National Plant Pathology Research Center for providing laboratory facilities, and members of NARC- Molecular Plant Pathology Lab for the support to conduct the research. References 1. Yobo KS: Biological control and plant growth promotion by selected Trichoderma and Bacillus species. Ph.D. Thesis. Discipline of Plant Pathology, School of Applied Environmental Sciences, Faculty of Science and Agriculture. University of KwaZulu-Natal, Pietermaritzburg, Republic of South Africa.2005. 2. Mukhtar T, Hussain MA, Kayani MZ: Biocontrol potential of Pasteuria penetrans, Pochonia chlamydosporia, Paecilomyces lilacinus and Trichoderma harzianum against Meloidogyne incognita in okra. Phytopathol. Mediterr. 2013; 52 : 66–76. Publisher Full Text 3. Chinheya CC: Use of Trichoderma and Bacillus isolates as seed treatments against the root knot nematode, Meloidogyne javanica (Chitwood). Ph.D. Thesis. Discipline of Plant Pathology, School of Agriculture, Earth and Environmental Science, College of Agriculture, Engineering and Science University of KwaZulu-Natal, Pietermaritzburg, South Africa.2015. 4. Al-Hazmi AS, Javeed M: Effects of different inoculums densities of Trichoderma harzianum and Trichoderma viride against Meloidogyne javanica on tomato. Saudi. J. Biol. Sci. 2016; 23 (2): 288–292. PubMed Abstract | Publisher Full Text | Free Full Text 5. Ghazanfar MU, Raza M, Raza W, et al. : Trichoderma a potential as biocontrol agent, its exploitation agent in agriculture: A review. Plant Prot. 2018; 02 (03): 109–135. 6. Manjur Shah M, Afiya H: Identification and isolation of Trichoderma spp. - Their significance in agriculture, human health, industrial and environmental application. Trichoderma-The Most Widely Used Fungicide. IntechOpen; 2019. Publisher Full Text 7. Pandya JR, Sabalpara AN, Chowda SK: Trichoderma : a particular weapon for biocontrol of phytopathogens. J. Agric. Techno. 2011; 7 (5): 1119–1187. 1686-9141. 8. Li J, Wu Y, Chen K, et al. : Trichoderma cyanodichotomus sp. nov., a new soil-inhabiting species with a potential for biological control. Can. J. Microbiol. 2018; 64 (12): 1020–1029. PubMed Abstract | Publisher Full Text 9. Sadfi-Zouaui N, Chaabani S, Rouaissi M, et al. : Analysis of the diversity of Trichoderma spp. in soil horizons using digested ITS regions. Ann. Microbiol. 2009; 59 (3): 459–463. Publisher Full Text 10. Kullnig C, Szakacs G, Kubicek CP: Molecular identification of Trichoderma species from Russia, Siberia and the Himalaya. Mycol. Res. 2000; 104 (9): 1117–1125. Publisher Full Text 11. Naher L, Syawani N, Ameiza N, et al. : Trichoderma species diversity in rhizosphere soils and potential antagonism with Fusarium oxysporum. Biosci. 2000; 35 (1): 13–26. Publisher Full Text 12. Silva J, Marques E, Menezes J, et al. : Population density of Trichoderma fungi in natural environments and agrosystems of a Cerrado area. Biota Neotrop. 2020; 20 (4). 13. Zhang CL, Druzhinina IS, Kubicek CP, et al. : Trichoderma biodiversity in China: evidence for a North to South distribution of species in East Asia. FEMS Microbiol. Lett. 2005; 251 (2): 251–257. PubMed Abstract | Publisher Full Text 14. Sun RY, Liu ZC, Fu K, et al. : Trichoderma biodiversity in China. J. Appl. Genet. 2012; 53 : 343–354. PubMed Abstract | Publisher Full Text 15. Kubicek CP, Bissett J, Druzhinina IS, et al. : Genetic and metabolic diversity of Trichoderma : A case study on South-East Asian isolates. Fungal Genet. Biol. 2003; 38 : 310–319. PubMed Abstract | Publisher Full Text 16. Kamala T, Indira Devi S, Chandradev Sharma K, et al. : Phylogeny and taxonomical investigation of Trichoderma spp. from Indian region of Indo-Burma biodiversity hot spot region with special reference to Manipur. Biomed. Res. Int. 2015; 2015 : 21. PubMed Abstract | Publisher Full Text | Free Full Text 17. Gherbawy Y, Hussein NA, Al-Qurashi AA: Molecular characterization of Trichoderma populations isolated from soil of Taif City, Saudi Arabia. Int. J. Curr. Microbiol. App. Sci. 2014; 3 (9): 1059–1071. 18. Naeimi S, Khodaparast S, Javan-Nikkhah M, et al. : Species pattern and phylogenetic relationships of Trichoderma strains in rice fields of southern Caspian Sea, Iran. Cereal Res. Commun. 2011; 39 : 560–568. Publisher Full Text 19. Sebumpan R, Guiritan KR, Suan M, et al. : Morphological and molecular identification of Trichoderma asperellum isolated from a dragon fruit farm in the southern Philippines and its pathogenicity against the larvae of the super worm, Zophobas morio (Fabricius, 1776) (Coleoptera: Tenebrionidae). Egypt. J. Biol. Pest. Control. 2022; 32 : 47. Publisher Full Text 20. Wuczkowski M, Druzhinina I, Gherbawy Y, et al. : Species pattern and genetic diversity of Trichoderma in a mid-European, primeval floodplain-forest. Microbiol. Res. 2003; 158 : 125–133. PubMed Abstract | Publisher Full Text 21. Zachow C, Berg C, Muller H, et al. : Fungal diversity in the rhizosphere of endemic plant species of Tenerife (Canary Islands): relationship to vegetation zones and environmental factors. ISME J. 2009; 3 : 79–92. PubMed Abstract | Publisher Full Text 22. Migheli Q, Balmas V, Komon-Zelazowska M, et al. : Soils of a Mediterranean hot spot of biodiversity and endemism (Sardinia, Tyrrhenian Islands) are inhabited by pan-European, invasive species of Hypocrea/Trichoderma. Environ. Microbiol. 2009; 11 : 35–46. PubMed Abstract | Publisher Full Text 23. Hoyos-Carvajal L, Orduz S, Bissett J: Genetic and metabolic biodiversity of Trichoderma from Colombia and adjacent neotropic regions. Fungal Genet. Biol. 2009; 46 : 615–631. PubMed Abstract | Publisher Full Text 24. Korkom Y, Yıldız A: First report of Trichoderma guizhouense isolated from soil in Türkiye. J. Plant Dis. Prot. 2024; 131 (2):619–625. Publisher Full Text 25. Hermosa R, Grondona I, Iturriaga E, et al. : Molecular characterization and identification of biocontrol isolates of Trichoderma spp. Appl. Environ. Microbiol. 2000; 66 : 1890–1898. PubMed Abstract | Publisher Full Text | Free Full Text 26. Alvarado-Marchena L, Rivera-Mendez W: Molecular identification of Trichoderma spp. in garlic and onion fields and in vitro antagonism trials on Sclerotium cepivorum. Rev. Bras. Ciênc. Solo. 2016; 40 : e0150454. Publisher Full Text 27. Siddiqui IA, Muhammad AZ, Syed JZ, et al. : Use of Trichoderma species in the Control of Meloidogyne javanica root knot nematode in okra and mungbean. Pak. J. Biol. Sci. 2001; 4 (7): 846–848. Publisher Full Text 28. Abd Al-Fattah AD, Sikora RA: Use of Trichoderma harzianum and Trichoderma viride for the biological control of Meloidogyne incognita on tomato. Jordan J. Biol. Sci. 2007; 3 : 297. 29. Javeed MT, Al-Hazmi AS, Molan YY: Antagonistic effects of some indigenous isolates of Trichoderma spp. against Meloidogyne javanica . Pak. J. Nematol. 2016; 34 (2): 183–191. Publisher Full Text 30. Korkom Y, Yildiz A: Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. J. Plant Pathol. 2022; 104 (2):671–682. Publisher Full Text 31. Marques E, Martins I, Cunha M, et al. : New isolates of Trichoderma antagonistic to Sclerotinia sclerotiorum . Biota Neotrop. 2016; 16 (3). 32. Mascarin GM, Bonfim Junior MF, Filho JV: Trichoderma harzianum reduces population of Meloidogyne incognita in cucumber plants under greenhouse conditions. J. Entomol. Nematol. 2012; 4 (6): 54–57. Publisher Full Text 33. Rai S, Kashyap PL, Kumar S, et al. : Identification, characterization and phylogenetic analysis of antifungal Trichoderma from tomato rhizosphere. Springerplus. 2016; 5 : 1939. PubMed Abstract | Publisher Full Text | Free Full Text 34. Bogumil A, Paszt LS, Lisek A, et al. : Identification of new Trichoderma strains with antagonistic activity against Botrytis cinerea. Folia. Hortic. 2016; 25 (2): 123–132. 35. du Plessis IL , Druzhinina IS, Atanasova L, et al. : The diversity of Trichoderma species from soil in South Africa, with five new additions. Mycologia. 2016; 110 (3): 559–583. PubMed Abstract | Publisher Full Text 36. Vasumathi S, Eraivan Arutkani K, Nakkeeran S: Biodiversity and molecular characterization of Trichoderma spp. and exploring its synergistic action for the management of cucumber damping off incited by Pythium aphanidermatum. J. Pure Appl. Microbiol. 2017; 11 (1): 487–497. Publisher Full Text 37. Haque Z, Iqbal MS, Ahmad A, et al. : Molecular Characterization of Trichoderma spp. Isolates by Internal Transcribed Spacer (ITS) region sequencing technique and its use as a biocontrol agent. Open Biotechnol. J. 2020; 14 : 70–77. Publisher Full Text 38. Kormoczi P, Manczinger L, Sajben-Nagy E, et al. : Screening of Trichoderma strains isolated from rhizosphere samples for laccase production. RARD. 2013; 2 (1): 325–330. 39. Khadka RB, Rotondo F, Miller SA: The pursuit in Nepal of native Trichoderma spp. for plant disease biocontrol. PhytoFront. 2022; 2 : 242–256. Publisher Full Text 40. Gil SV, Pastor S, March G: Quantitative isolation of biocontrol agents Trichoderma spp ., Gliocladium spp. and Actinomycetes from soil with culture media. Microbiol. Res. 2009; 164 (2): 196–205. PubMed Abstract | Publisher Full Text 41. Askew DJ, Laing MD: An adapted selective medium for the quantitative isolation of Trichoderma species. Plant Pathol. 1993; 42 : 686–690. Publisher Full Text 42. Samuels GJ, Hebbar PK: Trichoderma: Identification and Agricultural Applications. St. Paul: APS Press; 2015. 43. Hamrouni R, Molinet J, Miche L, et al. : Production of coconut aroma in solid-state cultivation: Screening and identification of Trichoderma strains for 6-pentyl-alphapyrone and conidia production. J. Chem. 2019; 2019 : 1–7. Publisher Full Text 44. White TJ, Bruns T, Lee S, et al. : Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols. Academic Press; 1989. Publisher Full Text 45. Carbone I, Kohn LM: A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia. 1999; 91 (3): 553–556. Publisher Full Text 46. Blaszczyk L, Popiel D, Chelkowsk J, et al. : Species diversity of Trichoderma in Poland. J. Appl. Genet. 2011; 52 : 233–243. Epub 2011 Apr 5. PubMed Abstract | Publisher Full Text | Free Full Text 47. Samuels GJ, Dodd SL, Gams W, et al. : Trichoderma species associated with the green mold epidemic of commercially grown Agaricus bisporus. Mycologia. 2002; 94 : 146–170. PubMed Abstract | Publisher Full Text 48. Hall TA: BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999; 41 : 95–98. 49. Maddison WP, Maddison DR: Mesquite: A modular system for evolutionary analysis.2019. Version 3.61. Reference Source 50. Tamura K, Nei M: Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 2019; 10 (10): 512–526. PubMed Abstract | Publisher Full Text 51. Chevenet F, Brun C, Banuls AL, et al. : TreeDyn: Towards dynamic graphics and annotations for analyses of trees. BMC. Bioinformatics. 2006; 7 : 439. PubMed Abstract | Publisher Full Text | Free Full Text 52. Letunic I, Bork P: Interactive tree of life (iTOL) v3: an online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 2016; 44 (W1): W242–W245. PubMed Abstract | Publisher Full Text | Free Full Text 53. Ma J, Tsegaye E, Li M, et al. : Biodiversity of Trichoderma from grassland and forest ecosystems in Northern Xinjiang, China. Biotech. 2020; 10 : 362. PubMed Abstract | Publisher Full Text | Free Full Text 54. Simpson EH: Measurement of diversity. Nature. 1949; 163 : 688–688. Publisher Full Text 55. Shannon CE: A Mathematical theory of communication. Bell. Syst. Techn. 1948; 27 : 379–423. Publisher Full Text 56. Pielou EC: The measurement of diversity in different types of biological collections. J. Theor. Biol. 1966; 13 : 131–144. Publisher Full Text 57. Margalef R: Information theory in biology. Gen. Syst. Yearbook. 1958; 3 : 36–71. 58. Jaiswal P, Khadka R, Bhat AH, et al. : Plate 1. Culture of Trichoderma isolates grown in 28±2°c in potato dextrose agar medium. figshare. Figure. 2024. Publisher Full Text 59. Jaiswal P, Khadka RB, Bhat AH, et al. : Data sheet. Dataset. figshare. 2024. Publisher Full Text 60. Chandra Sekhar Y, Khayum Ahammed S, Prasad TNVKV, et al. : Identification of Trichoderma species based on morphological characters isolated from the rhizosphere of groundnut ( Arachis hypogaea L). Int. J. Sci. Environ. Technol. 2017; 6 (3): 2056–2063. 61. Bissett J: A revision of the genus Trichoderma. III. section Pachybasium. Can. J. Bot. 2011; 69 : 2373–2417. Publisher Full Text 62. Saravanakumar K, Wang MH: Isolation and molecular identification of Trichoderma species from wetland soil and their antagonistic activity against phytopathogens. Physiol. Mol. Plant Pathol. 2020; 109 : 101458. Publisher Full Text 63. Fanelli F, Liuzzi VC, Logrieco AF, et al. : Genomic characterization of Trichoderma atrobrunneum ( T. harzianum species complex) ITEM 908: Insight into the genetic endowment of a multi-target biocontrol strain. BMC Genomics. 2018; 19 (1): 662. PubMed Abstract | Publisher Full Text | Free Full Text 64. Sun J, Pei Y, Li E, et al. : A new species of Trichoderma hypoxylon harbours abundant secondary metabolites. Sci. Rep. 2016; 6 (1): 37369. PubMed Abstract | Publisher Full Text | Free Full Text 65. Jaklitsch WM, Voglmayr H: Biodiversity of Trichoderma (Hypocreaceae) in Southern Europe and Macronesia. Stud. Mycol. 2015; 80 : 1–87. PubMed Abstract | Publisher Full Text | Free Full Text 66. Saravanakumar K, Yu C, Dou K, et al. : Biodiversity of Trichoderma community in the tidal flats and wetland of southeastern China. PLoS One. 2016; 11 (12): e0168020. PubMed Abstract | Publisher Full Text | Free Full Text 67. Chaverri P, Castlebury LA, Samuels GJ, et al. : Multilocus phylogenetic structure within the Trichoderma harzianum / Hypocrea lixii complex. Mol. Phylogenet. Evol. 2003; 27 : 302–313. PubMed Abstract | Publisher Full Text 68. Druzhinina IS, Kubicek CP, Komon-Zelazowska M, et al. : The Trichoderma harzianum demon: complex speciation history resulting in coexistence of hypothetical biological species, recent agamo species and numerous relict lineages. BMC Evol. Biol. 2010; 10 : 94. PubMed Abstract | Publisher Full Text | Free Full Text 69. Li QR, Tan P, Jiang YL, et al. : A novel Trichoderma species isolated from soil in Guizhou, T. guizhouense . Mycol. Prog. 2013; 12 : 167–172. Publisher Full Text 70. Chaverri P, Branco-Rocha F, Jaklitsch W, et al. : Systematics of the Trichoderma harzianum species complex and the re-identification of commercial biocontrol strains. Mycologia. 2015; 107 : 558–590. PubMed Abstract | Publisher Full Text | Free Full Text 71. Mulatu A, Megersa N, Abena T, et al. : Biodiversity of the genus Trichoderma in the rhizosphere of coffee ( Coffea arabica ) plants in Ethiopia and their potential use in biocontrol of coffee wilt disease. Crops. 2022; 2 (2): 120–141. Publisher Full Text 72. Castle A, Speranzini D, Rghei N, et al. : Morphological and molecular identification of Trichoderma isolates on North American mushroom farms. Appl. Environ. Microbiol. 1998; 64 (1): 133–137. PubMed Abstract | Publisher Full Text | Free Full Text 73. Chaverri P, Samuels GJ: Hypocrea/Trichoderma (Ascomycota, Hypocreales, Hypocreaceae): species with green ascospores. Stud. Mycol. 2003; 48 : 1–116. Comments on this article Comments (0) Version 3 VERSION 3 PUBLISHED 24 Sep 2024 ADD YOUR COMMENT Comment Author details Author details 1 Central Department of Zoology, Tribhuvan University, Kirtipur, Kathmandu, Bagmati, 0097, Nepal 2 National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, Bagmati, 5459, Nepal 3 Department of Bioscience, Chandigarh University, Sahibzada Ajit Singh Nagar, Punjab, India 4 Department of Zoology, Patan Multiple Campus, Tribhuvan University, Lalitpur, Bagmati, 0097, Nepal Puja Jaiswal Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Validation, Visualization, Writing – Original Draft Preparation Ram B. Khadka Roles: Conceptualization, Data Curation, Formal Analysis, Funding Acquisition, Investigation, Methodology, Project Administration, Resources, Software, Supervision, Validation, Visualization, Writing – Original Draft Preparation, Writing – Review & Editing Aashaq Hussain Bhat Roles: Writing – Review & Editing Suraj Baidya Roles: Resources, Writing – Review & Editing Arvind Kumar Keshari Roles: Conceptualization, Funding Acquisition, Project Administration, Resources, Supervision, Writing – Review & Editing Competing interests No competing interests were disclosed. Grant information This study was partially funded by the Government of Nepal appropriated to Nepal Agricultural Research Council, and by the Feed the Future Innovation Lab for Horticulture – made possible by the generous support of the American people through the United States Agency for International Development (USAID) under Prime Cooperative Agreement number - 7200AA21LE00003. The contents of this publication are the responsibility of the authors and do not necessarily reflect the views of USAID or the United States Government. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (3) version 3 Revised Published: 05 Mar 2025, 13:1088 https://doi.org/10.12688/f1000research.153701.3 version 2 Revised Published: 09 Jan 2025, 13:1088 https://doi.org/10.12688/f1000research.153701.2 version 1 Published: 24 Sep 2024, 13:1088 https://doi.org/10.12688/f1000research.153701.1 Copyright © 2025 Jaiswal P et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Jaiswal P, Khadka RB, Hussain Bhat A et al. Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.12688/f1000research.153701.3 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 09 Jan 2025 Revised Views 0 Cite How to cite this report: Korkom Y. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.176431.r357675 ) The direct URL for this report is: https://f1000research.com/articles/13-1088/v2#referee-response-357675 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 27 Jan 2025 Yunus Korkom , Aydın Adnan Menderes University, Aydin, Turkey Approved VIEWS 0 https://doi.org/10.5256/f1000research.176431.r357675 I have no new ... Continue reading READ ALL I have no new comments in this article. Competing Interests: No competing interests were disclosed. Reviewer Expertise: Trichoderma, plant pathology, biological control, soil-borne diseases, fruit diseases, endophytic fungi, fungal pathogens, I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Korkom Y. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.176431.r357675 ) The direct URL for this report is: https://f1000research.com/articles/13-1088/v2#referee-response-357675 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Marques E. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.176431.r359924 ) The direct URL for this report is: https://f1000research.com/articles/13-1088/v2#referee-response-359924 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 24 Jan 2025 Eder Marques , Federal University of Goiás, Campus Samambaia, Goiânia, Brazil Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.176431.r359924 The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Abstract – diversify repeated keywords Introduction Some references do not relate to ... Continue reading READ ALL The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Abstract – diversify repeated keywords Introduction Some references do not relate to the idea for which they were cited. It would be interesting to replace them (check observations in the text) Describe a little more the genus Trichoderma and its importance for the world and Nepal. Are there data on the quantity of commercial products and their use, in form, for example, in the country? Methodology Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. I was unable to find information regarding the plants from which the rhizospheric soil samples were collected. Morphological and cultural characteristics are not usable characteristics in the identification of Trichoderma, perhaps try to concatenate and discuss with molecular phylogeny. Baysian inference should be done, in addition to ML. Which equipment is used at that temperature (-40ºC)? Provide more detail about the statistical analysis software and versions used for diversity index calculations. Results Concatenation of morphological and molecular information. Figure 3. Does it mention different types of conidia, what about them? Shape, size? Describe! Plate 1: Unclear photos, fungus does not appear to have sporulated (no color). Figure 4: Expand the tree, it is not possible to visually differentiate the branches/clades. Figure 6. Describe a little better in the caption. Concatenated phylogeny? Correct italics in inappropriate places. The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Is the work clearly and accurately presented and does it cite the current literature? No Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Silva J, Marques E, Menezes J, Silva J, et al.: Population density of Trichoderma fungi in natural environments and agrosystems of a Cerrado area. Biota Neotropica . 2020; 20 (4). Publisher Full Text 2. Marques E, Martins I, Cunha M, Lima M, et al.: New isolates of Trichoderma antagonistic to Sclerotinia sclerotiorum. Biota Neotropica . 2016; 16 (3). Publisher Full Text Competing Interests: No competing interests were disclosed. Reviewer Expertise: Prospecting for Trichoderma for biological control. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Marques E. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.176431.r359924 ) The direct URL for this report is: https://f1000research.com/articles/13-1088/v2#referee-response-359924 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 05 Mar 2025 Ram Khadka , National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal 05 Mar 2025 Author Response Reviewer 3 The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Response: We sincerely appreciate your time and effort in ... Continue reading Reviewer 3 The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Response: We sincerely appreciate your time and effort in reviewing our manuscript and for providing insightful suggestions to improve its quality. Abstract – diversify repeated keywords Response: Thank you for your suggestion. However, "diversity indices" is a technical term essential to maintaining the accuracy and context of our study. Replacing it with alternative terms might alter the intended meaning, so we have retained it. Introduction Some references do not relate to the idea for which they were cited. It would be interesting to replace them (check observations in the text) Describe a little more the genus Trichoderma and its importance for the world and Nepal. Are there data on the quantity of commercial products and their use, in form, for example, in the country? Response: We appreciate this valuable feedback. We have carefully reviewed and updated the references to ensure their relevance. Additionally, we have expanded the introduction on the importance of Trichoderma , in Nepal, including available data on its commercial applications in the country. Methodology Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response: Thank you for your suggestion. We have now included a clear explanation in the first paragraph of the "Molecular Characterization of Trichoderma Isolates" subsection, detailing the criteria used for selecting 33 isolates for molecular characterization. I was unable to find information regarding the plants from which the rhizospheric soil samples were collected. Response: The soil samples were collected from the rhizosphere of ten different crop species. This information has been clearly stated in the Methodology section. Morphological and cultural characteristics are not usable characteristics in the identification of Trichoderma, perhaps try to concatenate and discuss with molecular phylogeny. Response: We acknowledge the reviewer's concern. While molecular techniques provide a more precise identification, morphological characteristics, despite their limitations, remain valuable for selecting superior-performing isolates. We have revised the discussion to better integrate morphological data with molecular phylogeny. Baysian inference should be done, in addition to ML. Response: We appreciate the suggestion regarding Bayesian inference. Upon analysis, we observed that both the Maximum Likelihood (ML) and Bayesian Inference (BI) trees exhibit highly similar topologies, with no significant differences in clade support or branching patterns. However, if the reviewer suggests additional statistical comparisons or specific analyses, we would be happy to incorporate them. Which equipment is used at that temperature (-40ºC)? Response: The isolates were stored in a deep freezer at -40°C. This has now been clarified in the text. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were calculated numerically using the provided equations in Microsoft Excel (Excel 2010, v14.0). This information has been explicitly stated in the manuscript. Results Concatenation of morphological and molecular information. Response: We appreciate this suggestion and have improved the integration of morphological and molecular data to enhance clarity and consistency in our findings. Figure 3. Does it mention different types of conidia, what about them? Shape, size? Describe! Response: Yes, Figure 3 depicts different types of conidia. Their shape and size are detailed in Table 1. Plate 1: Unclear photos, fungus does not appear to have sporulated (no color). Response: We put both upside and inverted plates together to show the variations in conidial color, metabolite production and presence or absence of aerial mycelia. Figure 4: Expand the tree, it is not possible to visually differentiate the branches/clades. Response: We appreciate the suggestion and have revised Figures 4 and 5 to enhance clarity and improve branch differentiation. Figure 6. Describe a little better in the caption. Concatenated phylogeny? Response: We have refined the caption while adhering to the journal’s guideline of a 15-word limit. Correct italics in inappropriate places. Response: We have thoroughly reviewed the manuscript and corrected all instances of incorrect italicization. The work expands the knowledge about the diversity of Trichoderma in Nepal, however, some suggestions were made to improve the study. Response: We sincerely appreciate the reviewer’s thoughtful comments, which have helped us refine and improve the manuscript. Is the work clearly and accurately presented and does it cite the current literature? No Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Silva J, Marques E, Menezes J, Silva J, et al.: Population density of Trichoderma fungi in natural environments and agrosystems of a Cerrado area. Biota Neotropica . 2020; 20 (4). Publisher Full Text 2. Marques E, Martins I, Cunha M, Lima M, et al.: New isolates of Trichoderma antagonistic to Sclerotinia sclerotiorum. Biota Neotropica . 2016; 16 (3). Publisher Full Text Response: These above references are cited in the text as 12 and 31. Reviewer 3 The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Response: We sincerely appreciate your time and effort in reviewing our manuscript and for providing insightful suggestions to improve its quality. Abstract – diversify repeated keywords Response: Thank you for your suggestion. However, "diversity indices" is a technical term essential to maintaining the accuracy and context of our study. Replacing it with alternative terms might alter the intended meaning, so we have retained it. Introduction Some references do not relate to the idea for which they were cited. It would be interesting to replace them (check observations in the text) Describe a little more the genus Trichoderma and its importance for the world and Nepal. Are there data on the quantity of commercial products and their use, in form, for example, in the country? Response: We appreciate this valuable feedback. We have carefully reviewed and updated the references to ensure their relevance. Additionally, we have expanded the introduction on the importance of Trichoderma , in Nepal, including available data on its commercial applications in the country. Methodology Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response: Thank you for your suggestion. We have now included a clear explanation in the first paragraph of the "Molecular Characterization of Trichoderma Isolates" subsection, detailing the criteria used for selecting 33 isolates for molecular characterization. I was unable to find information regarding the plants from which the rhizospheric soil samples were collected. Response: The soil samples were collected from the rhizosphere of ten different crop species. This information has been clearly stated in the Methodology section. Morphological and cultural characteristics are not usable characteristics in the identification of Trichoderma, perhaps try to concatenate and discuss with molecular phylogeny. Response: We acknowledge the reviewer's concern. While molecular techniques provide a more precise identification, morphological characteristics, despite their limitations, remain valuable for selecting superior-performing isolates. We have revised the discussion to better integrate morphological data with molecular phylogeny. Baysian inference should be done, in addition to ML. Response: We appreciate the suggestion regarding Bayesian inference. Upon analysis, we observed that both the Maximum Likelihood (ML) and Bayesian Inference (BI) trees exhibit highly similar topologies, with no significant differences in clade support or branching patterns. However, if the reviewer suggests additional statistical comparisons or specific analyses, we would be happy to incorporate them. Which equipment is used at that temperature (-40ºC)? Response: The isolates were stored in a deep freezer at -40°C. This has now been clarified in the text. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were calculated numerically using the provided equations in Microsoft Excel (Excel 2010, v14.0). This information has been explicitly stated in the manuscript. Results Concatenation of morphological and molecular information. Response: We appreciate this suggestion and have improved the integration of morphological and molecular data to enhance clarity and consistency in our findings. Figure 3. Does it mention different types of conidia, what about them? Shape, size? Describe! Response: Yes, Figure 3 depicts different types of conidia. Their shape and size are detailed in Table 1. Plate 1: Unclear photos, fungus does not appear to have sporulated (no color). Response: We put both upside and inverted plates together to show the variations in conidial color, metabolite production and presence or absence of aerial mycelia. Figure 4: Expand the tree, it is not possible to visually differentiate the branches/clades. Response: We appreciate the suggestion and have revised Figures 4 and 5 to enhance clarity and improve branch differentiation. Figure 6. Describe a little better in the caption. Concatenated phylogeny? Response: We have refined the caption while adhering to the journal’s guideline of a 15-word limit. Correct italics in inappropriate places. Response: We have thoroughly reviewed the manuscript and corrected all instances of incorrect italicization. The work expands the knowledge about the diversity of Trichoderma in Nepal, however, some suggestions were made to improve the study. Response: We sincerely appreciate the reviewer’s thoughtful comments, which have helped us refine and improve the manuscript. Is the work clearly and accurately presented and does it cite the current literature? No Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Silva J, Marques E, Menezes J, Silva J, et al.: Population density of Trichoderma fungi in natural environments and agrosystems of a Cerrado area. Biota Neotropica . 2020; 20 (4). Publisher Full Text 2. Marques E, Martins I, Cunha M, Lima M, et al.: New isolates of Trichoderma antagonistic to Sclerotinia sclerotiorum. Biota Neotropica . 2016; 16 (3). Publisher Full Text Response: These above references are cited in the text as 12 and 31. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 05 Mar 2025 Ram Khadka , National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal 05 Mar 2025 Author Response Reviewer 3 The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Response: We sincerely appreciate your time and effort in ... Continue reading Reviewer 3 The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Response: We sincerely appreciate your time and effort in reviewing our manuscript and for providing insightful suggestions to improve its quality. Abstract – diversify repeated keywords Response: Thank you for your suggestion. However, "diversity indices" is a technical term essential to maintaining the accuracy and context of our study. Replacing it with alternative terms might alter the intended meaning, so we have retained it. Introduction Some references do not relate to the idea for which they were cited. It would be interesting to replace them (check observations in the text) Describe a little more the genus Trichoderma and its importance for the world and Nepal. Are there data on the quantity of commercial products and their use, in form, for example, in the country? Response: We appreciate this valuable feedback. We have carefully reviewed and updated the references to ensure their relevance. Additionally, we have expanded the introduction on the importance of Trichoderma , in Nepal, including available data on its commercial applications in the country. Methodology Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response: Thank you for your suggestion. We have now included a clear explanation in the first paragraph of the "Molecular Characterization of Trichoderma Isolates" subsection, detailing the criteria used for selecting 33 isolates for molecular characterization. I was unable to find information regarding the plants from which the rhizospheric soil samples were collected. Response: The soil samples were collected from the rhizosphere of ten different crop species. This information has been clearly stated in the Methodology section. Morphological and cultural characteristics are not usable characteristics in the identification of Trichoderma, perhaps try to concatenate and discuss with molecular phylogeny. Response: We acknowledge the reviewer's concern. While molecular techniques provide a more precise identification, morphological characteristics, despite their limitations, remain valuable for selecting superior-performing isolates. We have revised the discussion to better integrate morphological data with molecular phylogeny. Baysian inference should be done, in addition to ML. Response: We appreciate the suggestion regarding Bayesian inference. Upon analysis, we observed that both the Maximum Likelihood (ML) and Bayesian Inference (BI) trees exhibit highly similar topologies, with no significant differences in clade support or branching patterns. However, if the reviewer suggests additional statistical comparisons or specific analyses, we would be happy to incorporate them. Which equipment is used at that temperature (-40ºC)? Response: The isolates were stored in a deep freezer at -40°C. This has now been clarified in the text. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were calculated numerically using the provided equations in Microsoft Excel (Excel 2010, v14.0). This information has been explicitly stated in the manuscript. Results Concatenation of morphological and molecular information. Response: We appreciate this suggestion and have improved the integration of morphological and molecular data to enhance clarity and consistency in our findings. Figure 3. Does it mention different types of conidia, what about them? Shape, size? Describe! Response: Yes, Figure 3 depicts different types of conidia. Their shape and size are detailed in Table 1. Plate 1: Unclear photos, fungus does not appear to have sporulated (no color). Response: We put both upside and inverted plates together to show the variations in conidial color, metabolite production and presence or absence of aerial mycelia. Figure 4: Expand the tree, it is not possible to visually differentiate the branches/clades. Response: We appreciate the suggestion and have revised Figures 4 and 5 to enhance clarity and improve branch differentiation. Figure 6. Describe a little better in the caption. Concatenated phylogeny? Response: We have refined the caption while adhering to the journal’s guideline of a 15-word limit. Correct italics in inappropriate places. Response: We have thoroughly reviewed the manuscript and corrected all instances of incorrect italicization. The work expands the knowledge about the diversity of Trichoderma in Nepal, however, some suggestions were made to improve the study. Response: We sincerely appreciate the reviewer’s thoughtful comments, which have helped us refine and improve the manuscript. Is the work clearly and accurately presented and does it cite the current literature? No Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Silva J, Marques E, Menezes J, Silva J, et al.: Population density of Trichoderma fungi in natural environments and agrosystems of a Cerrado area. Biota Neotropica . 2020; 20 (4). Publisher Full Text 2. Marques E, Martins I, Cunha M, Lima M, et al.: New isolates of Trichoderma antagonistic to Sclerotinia sclerotiorum. Biota Neotropica . 2016; 16 (3). Publisher Full Text Response: These above references are cited in the text as 12 and 31. Reviewer 3 The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Response: We sincerely appreciate your time and effort in reviewing our manuscript and for providing insightful suggestions to improve its quality. Abstract – diversify repeated keywords Response: Thank you for your suggestion. However, "diversity indices" is a technical term essential to maintaining the accuracy and context of our study. Replacing it with alternative terms might alter the intended meaning, so we have retained it. Introduction Some references do not relate to the idea for which they were cited. It would be interesting to replace them (check observations in the text) Describe a little more the genus Trichoderma and its importance for the world and Nepal. Are there data on the quantity of commercial products and their use, in form, for example, in the country? Response: We appreciate this valuable feedback. We have carefully reviewed and updated the references to ensure their relevance. Additionally, we have expanded the introduction on the importance of Trichoderma , in Nepal, including available data on its commercial applications in the country. Methodology Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response: Thank you for your suggestion. We have now included a clear explanation in the first paragraph of the "Molecular Characterization of Trichoderma Isolates" subsection, detailing the criteria used for selecting 33 isolates for molecular characterization. I was unable to find information regarding the plants from which the rhizospheric soil samples were collected. Response: The soil samples were collected from the rhizosphere of ten different crop species. This information has been clearly stated in the Methodology section. Morphological and cultural characteristics are not usable characteristics in the identification of Trichoderma, perhaps try to concatenate and discuss with molecular phylogeny. Response: We acknowledge the reviewer's concern. While molecular techniques provide a more precise identification, morphological characteristics, despite their limitations, remain valuable for selecting superior-performing isolates. We have revised the discussion to better integrate morphological data with molecular phylogeny. Baysian inference should be done, in addition to ML. Response: We appreciate the suggestion regarding Bayesian inference. Upon analysis, we observed that both the Maximum Likelihood (ML) and Bayesian Inference (BI) trees exhibit highly similar topologies, with no significant differences in clade support or branching patterns. However, if the reviewer suggests additional statistical comparisons or specific analyses, we would be happy to incorporate them. Which equipment is used at that temperature (-40ºC)? Response: The isolates were stored in a deep freezer at -40°C. This has now been clarified in the text. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were calculated numerically using the provided equations in Microsoft Excel (Excel 2010, v14.0). This information has been explicitly stated in the manuscript. Results Concatenation of morphological and molecular information. Response: We appreciate this suggestion and have improved the integration of morphological and molecular data to enhance clarity and consistency in our findings. Figure 3. Does it mention different types of conidia, what about them? Shape, size? Describe! Response: Yes, Figure 3 depicts different types of conidia. Their shape and size are detailed in Table 1. Plate 1: Unclear photos, fungus does not appear to have sporulated (no color). Response: We put both upside and inverted plates together to show the variations in conidial color, metabolite production and presence or absence of aerial mycelia. Figure 4: Expand the tree, it is not possible to visually differentiate the branches/clades. Response: We appreciate the suggestion and have revised Figures 4 and 5 to enhance clarity and improve branch differentiation. Figure 6. Describe a little better in the caption. Concatenated phylogeny? Response: We have refined the caption while adhering to the journal’s guideline of a 15-word limit. Correct italics in inappropriate places. Response: We have thoroughly reviewed the manuscript and corrected all instances of incorrect italicization. The work expands the knowledge about the diversity of Trichoderma in Nepal, however, some suggestions were made to improve the study. Response: We sincerely appreciate the reviewer’s thoughtful comments, which have helped us refine and improve the manuscript. Is the work clearly and accurately presented and does it cite the current literature? No Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Silva J, Marques E, Menezes J, Silva J, et al.: Population density of Trichoderma fungi in natural environments and agrosystems of a Cerrado area. Biota Neotropica . 2020; 20 (4). Publisher Full Text 2. Marques E, Martins I, Cunha M, Lima M, et al.: New isolates of Trichoderma antagonistic to Sclerotinia sclerotiorum. Biota Neotropica . 2016; 16 (3). Publisher Full Text Response: These above references are cited in the text as 12 and 31. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 24 Sep 2024 Views 0 Cite How to cite this report: Khan RAA. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.168625.r331288 ) The direct URL for this report is: https://f1000research.com/articles/13-1088/v1#referee-response-331288 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 25 Nov 2024 Raja Asad Ali Khan , School of Breeding and Multiplication (Sanya Institute of Breeding and Multiplication), Hainan University, YaZhou, China Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.168625.r331288 The manuscript provides insights into the diversity of Trichoderma species in agricultural zones across Nepal, integrating morphological and molecular approaches. The research is robust and presents significant findings with potential applications in sustainable agriculture. However, a few minor revisions are ... Continue reading READ ALL The manuscript provides insights into the diversity of Trichoderma species in agricultural zones across Nepal, integrating morphological and molecular approaches. The research is robust and presents significant findings with potential applications in sustainable agriculture. However, a few minor revisions are recommended to enhance clarity and overall quality. Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context. Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Provide more detail about the statistical analysis software and versions used for diversity index calculations. In Table 1, consider aligning the morphological features with molecular clades for easier interpretation. Expand the discussion on the discrepancies observed between ITS and tef-1α sequencing results, emphasizing their implications for species identification. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: Mycology, Biocontrol I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Khan RAA. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.168625.r331288 ) The direct URL for this report is: https://f1000research.com/articles/13-1088/v1#referee-response-331288 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 09 Jan 2025 Ram Khadka , National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal 09 Jan 2025 Author Response Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context. Response: We really appreciate your valuable time to read and provide ... Continue reading Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context. Response: We really appreciate your valuable time to read and provide highly constructive feedback to improve the manuscript. As per the suggestions, the practical implication of Trichoderma in small-scale farmers’ perspectives in Nepal has been added. Please check the fourth paragraph in the introduction section. Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response : Thank you for the suggestion, the sentence has been added to the first paragraph of the “Method” section in the “Molecular characterization of Trichoderma isolates” subsection to clarify the selection criteria for 33 isolates for molecular characterization. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were computed numerically using the given equations in Microsoft Excel (Excel 2010 (v14.0)). This has been explained. In Table 1, consider aligning the morphological features with molecular clades for easier interpretation. Response: Thank you for the comments, the species indicated in Table 1 are identified through molecular characterization, and the molecular clade group has been added to the table. Please check Table 1. Expand the discussion on the discrepancies observed between ITS and tef-1α sequencing results, emphasizing their implications for species identification. Response: Thanks for the suggestions, a paragraph has been added in discussion section. Please see fourth paragraph in discussion section. Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context. Response: We really appreciate your valuable time to read and provide highly constructive feedback to improve the manuscript. As per the suggestions, the practical implication of Trichoderma in small-scale farmers’ perspectives in Nepal has been added. Please check the fourth paragraph in the introduction section. Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response : Thank you for the suggestion, the sentence has been added to the first paragraph of the “Method” section in the “Molecular characterization of Trichoderma isolates” subsection to clarify the selection criteria for 33 isolates for molecular characterization. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were computed numerically using the given equations in Microsoft Excel (Excel 2010 (v14.0)). This has been explained. In Table 1, consider aligning the morphological features with molecular clades for easier interpretation. Response: Thank you for the comments, the species indicated in Table 1 are identified through molecular characterization, and the molecular clade group has been added to the table. Please check Table 1. Expand the discussion on the discrepancies observed between ITS and tef-1α sequencing results, emphasizing their implications for species identification. Response: Thanks for the suggestions, a paragraph has been added in discussion section. Please see fourth paragraph in discussion section. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 09 Jan 2025 Ram Khadka , National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal 09 Jan 2025 Author Response Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context. Response: We really appreciate your valuable time to read and provide ... Continue reading Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context. Response: We really appreciate your valuable time to read and provide highly constructive feedback to improve the manuscript. As per the suggestions, the practical implication of Trichoderma in small-scale farmers’ perspectives in Nepal has been added. Please check the fourth paragraph in the introduction section. Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response : Thank you for the suggestion, the sentence has been added to the first paragraph of the “Method” section in the “Molecular characterization of Trichoderma isolates” subsection to clarify the selection criteria for 33 isolates for molecular characterization. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were computed numerically using the given equations in Microsoft Excel (Excel 2010 (v14.0)). This has been explained. In Table 1, consider aligning the morphological features with molecular clades for easier interpretation. Response: Thank you for the comments, the species indicated in Table 1 are identified through molecular characterization, and the molecular clade group has been added to the table. Please check Table 1. Expand the discussion on the discrepancies observed between ITS and tef-1α sequencing results, emphasizing their implications for species identification. Response: Thanks for the suggestions, a paragraph has been added in discussion section. Please see fourth paragraph in discussion section. Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context. Response: We really appreciate your valuable time to read and provide highly constructive feedback to improve the manuscript. As per the suggestions, the practical implication of Trichoderma in small-scale farmers’ perspectives in Nepal has been added. Please check the fourth paragraph in the introduction section. Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response : Thank you for the suggestion, the sentence has been added to the first paragraph of the “Method” section in the “Molecular characterization of Trichoderma isolates” subsection to clarify the selection criteria for 33 isolates for molecular characterization. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were computed numerically using the given equations in Microsoft Excel (Excel 2010 (v14.0)). This has been explained. In Table 1, consider aligning the morphological features with molecular clades for easier interpretation. Response: Thank you for the comments, the species indicated in Table 1 are identified through molecular characterization, and the molecular clade group has been added to the table. Please check Table 1. Expand the discussion on the discrepancies observed between ITS and tef-1α sequencing results, emphasizing their implications for species identification. Response: Thanks for the suggestions, a paragraph has been added in discussion section. Please see fourth paragraph in discussion section. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Korkom Y. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.168625.r327961 ) The direct URL for this report is: https://f1000research.com/articles/13-1088/v1#referee-response-327961 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 04 Oct 2024 Yunus Korkom , Aydın Adnan Menderes University, Aydin, Turkey Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.168625.r327961 Dear Author, The article is well written. But it would be even better with some suggestions below. Best regards, Comments Introduction “These surveys have been conducted in various locations, including Russia and the ... Continue reading READ ALL Dear Author, The article is well written. But it would be even better with some suggestions below. Best regards, Comments Introduction “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 China, 12 , 13 South-East Asia, 14 India, 15 Egypt, 16 Iran, 17 Philippines, 18 Europe, 19 Canary Islands, 20 Sardinia 21 and South America. 22” The following studies conducted in Turkey can be added here. Korkom, Y., & Yıldız, A. (2024). First report of Trichoderma guizhouense isolated from soil in Türkiye. Journal of Plant Diseases and Protection , 131 (2), 619-625. “Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions. 25–27 ” Korkom, Y., & Yildiz, A. (2022). Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. Journal of Plant Pathology , 104 (2), 671-682. Methods Isolation and culture of Trichoderma isolates “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for development and growth.” should replaced with “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for growth.” “Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, odour and colour.” The odour is not a characteristic feature used to distinguish Trichoderma species and should be removed. “the Audrey & Bear Color Chart (https://www.audrey and bear.com)” When the given link is opened in the browser, an irrelevant page opens. Molecular characterization of Trichoderma isolates “colonies cultured on potato dextrose agar (PDA) using sterilized” should be replaced with “colonies cultured on PDA using sterilized” “Promega Wizard genomic DNA extraction kit” catalogue number should be added. “the internal transcribed spacer” should be replaced with “the internal transcribed spacer (ITS)” Phylogenetic relationships “in the NCBI” should be replaced with “in The National Center for Biotechnology Information (NCBI)” Results Morphological characterization of single spores of Trichoderma isolates “the Audrey & Bear Color Chart (https://www.audreyandbear.com)” When the given link is opened in the browser, an irrelevant page opens. “The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp),” Were the concatenated dataset of 26 isolates used here or 29 isolates? (Figure 6) Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Not applicable Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Korkom Y, Yıldız A: First report of Trichoderma guizhouense isolated from soil in Türkiye. Journal of Plant Diseases and Protection . 2024; 131 (2): 619-625 Publisher Full Text 2. Korkom Y, Yildiz A: Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. Journal of Plant Pathology . 2022; 104 (2): 671-682 Publisher Full Text Competing Interests: No competing interests were disclosed. Reviewer Expertise: Trichoderma, plant pathology, biological control, soil-borne diseases, fruit diseases, endophytic fungi, fungal pathogens, I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Korkom Y. Reviewer Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.168625.r327961 ) The direct URL for this report is: https://f1000research.com/articles/13-1088/v1#referee-response-327961 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 09 Jan 2025 Ram Khadka , National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal 09 Jan 2025 Author Response Comments Introduction “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 China, 12 , 13 South-East Asia, 14 India, 15 Egypt, 16 Iran, 17 Philippines, 18 Europe, 19 Canary Islands, 20 Sardinia 21 and South America. 22” The following studies conducted in Turkey can be added here. ... Continue reading Comments Introduction “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 China, 12 , 13 South-East Asia, 14 India, 15 Egypt, 16 Iran, 17 Philippines, 18 Europe, 19 Canary Islands, 20 Sardinia 21 and South America. 22” The following studies conducted in Turkey can be added here. Korkom, Y., & Yıldız, A. (2024). First report of Trichoderma guizhouense isolated from soil in Türkiye. Journal of Plant Diseases and Protection , 131 (2), 619-625. “Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions. 25–27 ” Korkom, Y., & Yildiz, A. (2022). Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. Journal of Plant Pathology , 104 (2), 671-682. Response: As per the recommendation both the studies are cited as 23 ad 29 . Methods Isolation and culture of Trichoderma isolates “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for development and growth.” should replaced with “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for growth.” Response: As per suggestion sentence is corrected. “Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, odour and colour.” The odour is not a characteristic feature used to distinguish Trichoderma species and should be removed. Response: We have removed odour as suggested. “the Audrey & Bear Color Chart (https://www.audrey and bear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart Molecular characterization of Trichoderma isolates “colonies cultured on potato dextrose agar (PDA) using sterilized” should be replaced with “colonies cultured on PDA using sterilized” “Promega Wizard genomic DNA extraction kit” catalogue number should be added. Response: We have added catalogue number as Catalogue No. A1120. “the internal transcribed spacer” should be replaced with “the internal transcribed spacer (ITS)” Phylogenetic relationships “in the NCBI” should be replaced with “in The National Center for Biotechnology Information (NCBI)” Response: Both the above suggestions are incorporated. Results Morphological characterization of single spores of Trichoderma isolates “the Audrey & Bear Color Chart (https://www.audreyandbear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart “The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp),” Were the concatenated dataset of 26 isolates used here or 29 isolates? (Figure 6) Response: For the concatenation dataset of 22 isolates were used. Comments Introduction “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 China, 12 , 13 South-East Asia, 14 India, 15 Egypt, 16 Iran, 17 Philippines, 18 Europe, 19 Canary Islands, 20 Sardinia 21 and South America. 22” The following studies conducted in Turkey can be added here. Korkom, Y., & Yıldız, A. (2024). First report of Trichoderma guizhouense isolated from soil in Türkiye. Journal of Plant Diseases and Protection , 131 (2), 619-625. “Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions. 25–27 ” Korkom, Y., & Yildiz, A. (2022). Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. Journal of Plant Pathology , 104 (2), 671-682. Response: As per the recommendation both the studies are cited as 23 ad 29 . Methods Isolation and culture of Trichoderma isolates “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for development and growth.” should replaced with “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for growth.” Response: As per suggestion sentence is corrected. “Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, odour and colour.” The odour is not a characteristic feature used to distinguish Trichoderma species and should be removed. Response: We have removed odour as suggested. “the Audrey & Bear Color Chart (https://www.audrey and bear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart Molecular characterization of Trichoderma isolates “colonies cultured on potato dextrose agar (PDA) using sterilized” should be replaced with “colonies cultured on PDA using sterilized” “Promega Wizard genomic DNA extraction kit” catalogue number should be added. Response: We have added catalogue number as Catalogue No. A1120. “the internal transcribed spacer” should be replaced with “the internal transcribed spacer (ITS)” Phylogenetic relationships “in the NCBI” should be replaced with “in The National Center for Biotechnology Information (NCBI)” Response: Both the above suggestions are incorporated. Results Morphological characterization of single spores of Trichoderma isolates “the Audrey & Bear Color Chart (https://www.audreyandbear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart “The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp),” Were the concatenated dataset of 26 isolates used here or 29 isolates? (Figure 6) Response: For the concatenation dataset of 22 isolates were used. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 09 Jan 2025 Ram Khadka , National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal 09 Jan 2025 Author Response Comments Introduction “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 China, 12 , 13 South-East Asia, 14 India, 15 Egypt, 16 Iran, 17 Philippines, 18 Europe, 19 Canary Islands, 20 Sardinia 21 and South America. 22” The following studies conducted in Turkey can be added here. ... Continue reading Comments Introduction “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 China, 12 , 13 South-East Asia, 14 India, 15 Egypt, 16 Iran, 17 Philippines, 18 Europe, 19 Canary Islands, 20 Sardinia 21 and South America. 22” The following studies conducted in Turkey can be added here. Korkom, Y., & Yıldız, A. (2024). First report of Trichoderma guizhouense isolated from soil in Türkiye. Journal of Plant Diseases and Protection , 131 (2), 619-625. “Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions. 25–27 ” Korkom, Y., & Yildiz, A. (2022). Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. Journal of Plant Pathology , 104 (2), 671-682. Response: As per the recommendation both the studies are cited as 23 ad 29 . Methods Isolation and culture of Trichoderma isolates “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for development and growth.” should replaced with “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for growth.” Response: As per suggestion sentence is corrected. “Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, odour and colour.” The odour is not a characteristic feature used to distinguish Trichoderma species and should be removed. Response: We have removed odour as suggested. “the Audrey & Bear Color Chart (https://www.audrey and bear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart Molecular characterization of Trichoderma isolates “colonies cultured on potato dextrose agar (PDA) using sterilized” should be replaced with “colonies cultured on PDA using sterilized” “Promega Wizard genomic DNA extraction kit” catalogue number should be added. Response: We have added catalogue number as Catalogue No. A1120. “the internal transcribed spacer” should be replaced with “the internal transcribed spacer (ITS)” Phylogenetic relationships “in the NCBI” should be replaced with “in The National Center for Biotechnology Information (NCBI)” Response: Both the above suggestions are incorporated. Results Morphological characterization of single spores of Trichoderma isolates “the Audrey & Bear Color Chart (https://www.audreyandbear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart “The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp),” Were the concatenated dataset of 26 isolates used here or 29 isolates? (Figure 6) Response: For the concatenation dataset of 22 isolates were used. Comments Introduction “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 China, 12 , 13 South-East Asia, 14 India, 15 Egypt, 16 Iran, 17 Philippines, 18 Europe, 19 Canary Islands, 20 Sardinia 21 and South America. 22” The following studies conducted in Turkey can be added here. Korkom, Y., & Yıldız, A. (2024). First report of Trichoderma guizhouense isolated from soil in Türkiye. Journal of Plant Diseases and Protection , 131 (2), 619-625. “Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions. 25–27 ” Korkom, Y., & Yildiz, A. (2022). Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. Journal of Plant Pathology , 104 (2), 671-682. Response: As per the recommendation both the studies are cited as 23 ad 29 . Methods Isolation and culture of Trichoderma isolates “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for development and growth.” should replaced with “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for growth.” Response: As per suggestion sentence is corrected. “Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, odour and colour.” The odour is not a characteristic feature used to distinguish Trichoderma species and should be removed. Response: We have removed odour as suggested. “the Audrey & Bear Color Chart (https://www.audrey and bear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart Molecular characterization of Trichoderma isolates “colonies cultured on potato dextrose agar (PDA) using sterilized” should be replaced with “colonies cultured on PDA using sterilized” “Promega Wizard genomic DNA extraction kit” catalogue number should be added. Response: We have added catalogue number as Catalogue No. A1120. “the internal transcribed spacer” should be replaced with “the internal transcribed spacer (ITS)” Phylogenetic relationships “in the NCBI” should be replaced with “in The National Center for Biotechnology Information (NCBI)” Response: Both the above suggestions are incorporated. Results Morphological characterization of single spores of Trichoderma isolates “the Audrey & Bear Color Chart (https://www.audreyandbear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart “The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp),” Were the concatenated dataset of 26 isolates used here or 29 isolates? (Figure 6) Response: For the concatenation dataset of 22 isolates were used. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Comments on this article Comments (0) Version 3 VERSION 3 PUBLISHED 24 Sep 2024 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 3 Version 3 (revision) 05 Mar 25 Version 2 (revision) 09 Jan 25 read read Version 1 24 Sep 24 read read Yunus Korkom , Aydın Adnan Menderes University, Aydin, Turkey Raja Asad Ali Khan , Hainan University, YaZhou, China Eder Marques , Federal University of Goiás, Campus Samambaia, Brazil Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Korkom Y. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 27 Jan 2025 | for Version 2 Yunus Korkom , Aydın Adnan Menderes University, Aydin, Turkey 0 Views copyright © 2025 Korkom Y. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions I have no new comments in this article. Competing Interests No competing interests were disclosed. Reviewer Expertise Trichoderma, plant pathology, biological control, soil-borne diseases, fruit diseases, endophytic fungi, fungal pathogens, I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Korkom Y. Peer Review Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.176431.r357675) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1088/v2#referee-response-357675 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2025 Marques E. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 24 Jan 2025 | for Version 2 Eder Marques , Federal University of Goiás, Campus Samambaia, Goiânia, Brazil 0 Views copyright © 2025 Marques E. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Abstract – diversify repeated keywords Introduction Some references do not relate to the idea for which they were cited. It would be interesting to replace them (check observations in the text) Describe a little more the genus Trichoderma and its importance for the world and Nepal. Are there data on the quantity of commercial products and their use, in form, for example, in the country? Methodology Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. I was unable to find information regarding the plants from which the rhizospheric soil samples were collected. Morphological and cultural characteristics are not usable characteristics in the identification of Trichoderma, perhaps try to concatenate and discuss with molecular phylogeny. Baysian inference should be done, in addition to ML. Which equipment is used at that temperature (-40ºC)? Provide more detail about the statistical analysis software and versions used for diversity index calculations. Results Concatenation of morphological and molecular information. Figure 3. Does it mention different types of conidia, what about them? Shape, size? Describe! Plate 1: Unclear photos, fungus does not appear to have sporulated (no color). Figure 4: Expand the tree, it is not possible to visually differentiate the branches/clades. Figure 6. Describe a little better in the caption. Concatenated phylogeny? Correct italics in inappropriate places. The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Is the work clearly and accurately presented and does it cite the current literature? No Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Silva J, Marques E, Menezes J, Silva J, et al.: Population density of Trichoderma fungi in natural environments and agrosystems of a Cerrado area. Biota Neotropica . 2020; 20 (4). Publisher Full Text 2. Marques E, Martins I, Cunha M, Lima M, et al.: New isolates of Trichoderma antagonistic to Sclerotinia sclerotiorum. Biota Neotropica . 2016; 16 (3). Publisher Full Text Competing Interests No competing interests were disclosed. Reviewer Expertise Prospecting for Trichoderma for biological control. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 05 Mar 2025 Ram Khadka, National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal Reviewer 3 The work expands the knowledge about the diversity of Trichoderma in Nepal, however some suggestions were made to improve the study. Response: We sincerely appreciate your time and effort in reviewing our manuscript and for providing insightful suggestions to improve its quality. Abstract – diversify repeated keywords Response: Thank you for your suggestion. However, "diversity indices" is a technical term essential to maintaining the accuracy and context of our study. Replacing it with alternative terms might alter the intended meaning, so we have retained it. Introduction Some references do not relate to the idea for which they were cited. It would be interesting to replace them (check observations in the text) Describe a little more the genus Trichoderma and its importance for the world and Nepal. Are there data on the quantity of commercial products and their use, in form, for example, in the country? Response: We appreciate this valuable feedback. We have carefully reviewed and updated the references to ensure their relevance. Additionally, we have expanded the introduction on the importance of Trichoderma , in Nepal, including available data on its commercial applications in the country. Methodology Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response: Thank you for your suggestion. We have now included a clear explanation in the first paragraph of the "Molecular Characterization of Trichoderma Isolates" subsection, detailing the criteria used for selecting 33 isolates for molecular characterization. I was unable to find information regarding the plants from which the rhizospheric soil samples were collected. Response: The soil samples were collected from the rhizosphere of ten different crop species. This information has been clearly stated in the Methodology section. Morphological and cultural characteristics are not usable characteristics in the identification of Trichoderma, perhaps try to concatenate and discuss with molecular phylogeny. Response: We acknowledge the reviewer's concern. While molecular techniques provide a more precise identification, morphological characteristics, despite their limitations, remain valuable for selecting superior-performing isolates. We have revised the discussion to better integrate morphological data with molecular phylogeny. Baysian inference should be done, in addition to ML. Response: We appreciate the suggestion regarding Bayesian inference. Upon analysis, we observed that both the Maximum Likelihood (ML) and Bayesian Inference (BI) trees exhibit highly similar topologies, with no significant differences in clade support or branching patterns. However, if the reviewer suggests additional statistical comparisons or specific analyses, we would be happy to incorporate them. Which equipment is used at that temperature (-40ºC)? Response: The isolates were stored in a deep freezer at -40°C. This has now been clarified in the text. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were calculated numerically using the provided equations in Microsoft Excel (Excel 2010, v14.0). This information has been explicitly stated in the manuscript. Results Concatenation of morphological and molecular information. Response: We appreciate this suggestion and have improved the integration of morphological and molecular data to enhance clarity and consistency in our findings. Figure 3. Does it mention different types of conidia, what about them? Shape, size? Describe! Response: Yes, Figure 3 depicts different types of conidia. Their shape and size are detailed in Table 1. Plate 1: Unclear photos, fungus does not appear to have sporulated (no color). Response: We put both upside and inverted plates together to show the variations in conidial color, metabolite production and presence or absence of aerial mycelia. Figure 4: Expand the tree, it is not possible to visually differentiate the branches/clades. Response: We appreciate the suggestion and have revised Figures 4 and 5 to enhance clarity and improve branch differentiation. Figure 6. Describe a little better in the caption. Concatenated phylogeny? Response: We have refined the caption while adhering to the journal’s guideline of a 15-word limit. Correct italics in inappropriate places. Response: We have thoroughly reviewed the manuscript and corrected all instances of incorrect italicization. The work expands the knowledge about the diversity of Trichoderma in Nepal, however, some suggestions were made to improve the study. Response: We sincerely appreciate the reviewer’s thoughtful comments, which have helped us refine and improve the manuscript. Is the work clearly and accurately presented and does it cite the current literature? No Is the study design appropriate and is the work technically sound? Partly Are sufficient details of methods and analysis provided to allow replication by others? Partly If applicable, is the statistical analysis and its interpretation appropriate? I cannot comment. A qualified statistician is required. Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Silva J, Marques E, Menezes J, Silva J, et al.: Population density of Trichoderma fungi in natural environments and agrosystems of a Cerrado area. Biota Neotropica . 2020; 20 (4). Publisher Full Text 2. Marques E, Martins I, Cunha M, Lima M, et al.: New isolates of Trichoderma antagonistic to Sclerotinia sclerotiorum. Biota Neotropica . 2016; 16 (3). Publisher Full Text Response: These above references are cited in the text as 12 and 31. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Marques E. Peer Review Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.176431.r359924) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1088/v2#referee-response-359924 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Khan R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 25 Nov 2024 | for Version 1 Raja Asad Ali Khan , School of Breeding and Multiplication (Sanya Institute of Breeding and Multiplication), Hainan University, YaZhou, China 0 Views copyright © 2024 Khan R. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions The manuscript provides insights into the diversity of Trichoderma species in agricultural zones across Nepal, integrating morphological and molecular approaches. The research is robust and presents significant findings with potential applications in sustainable agriculture. However, a few minor revisions are recommended to enhance clarity and overall quality. Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context. Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Provide more detail about the statistical analysis software and versions used for diversity index calculations. In Table 1, consider aligning the morphological features with molecular clades for easier interpretation. Expand the discussion on the discrepancies observed between ITS and tef-1α sequencing results, emphasizing their implications for species identification. Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Yes Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise Mycology, Biocontrol I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 09 Jan 2025 Ram Khadka, National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal Expand briefly on the practical implications of Trichoderma spp. for small-scale farmers in Nepal, considering the local agricultural context. Response: We really appreciate your valuable time to read and provide highly constructive feedback to improve the manuscript. As per the suggestions, the practical implication of Trichoderma in small-scale farmers’ perspectives in Nepal has been added. Please check the fourth paragraph in the introduction section. Clarify the criteria used for selecting representative isolates from the initial pool of 167 isolates. This will improve reproducibility. Response : Thank you for the suggestion, the sentence has been added to the first paragraph of the “Method” section in the “Molecular characterization of Trichoderma isolates” subsection to clarify the selection criteria for 33 isolates for molecular characterization. Provide more detail about the statistical analysis software and versions used for diversity index calculations. Response: The biological diversity indices were computed numerically using the given equations in Microsoft Excel (Excel 2010 (v14.0)). This has been explained. In Table 1, consider aligning the morphological features with molecular clades for easier interpretation. Response: Thank you for the comments, the species indicated in Table 1 are identified through molecular characterization, and the molecular clade group has been added to the table. Please check Table 1. Expand the discussion on the discrepancies observed between ITS and tef-1α sequencing results, emphasizing their implications for species identification. Response: Thanks for the suggestions, a paragraph has been added in discussion section. Please see fourth paragraph in discussion section. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Khan RAA. Peer Review Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.168625.r331288) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1088/v1#referee-response-331288 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Korkom Y. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 04 Oct 2024 | for Version 1 Yunus Korkom , Aydın Adnan Menderes University, Aydin, Turkey 0 Views copyright © 2024 Korkom Y. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Dear Author, The article is well written. But it would be even better with some suggestions below. Best regards, Comments Introduction “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 China, 12 , 13 South-East Asia, 14 India, 15 Egypt, 16 Iran, 17 Philippines, 18 Europe, 19 Canary Islands, 20 Sardinia 21 and South America. 22” The following studies conducted in Turkey can be added here. Korkom, Y., & Yıldız, A. (2024). First report of Trichoderma guizhouense isolated from soil in Türkiye. Journal of Plant Diseases and Protection , 131 (2), 619-625. “Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions. 25–27 ” Korkom, Y., & Yildiz, A. (2022). Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. Journal of Plant Pathology , 104 (2), 671-682. Methods Isolation and culture of Trichoderma isolates “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for development and growth.” should replaced with “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for growth.” “Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, odour and colour.” The odour is not a characteristic feature used to distinguish Trichoderma species and should be removed. “the Audrey & Bear Color Chart (https://www.audrey and bear.com)” When the given link is opened in the browser, an irrelevant page opens. Molecular characterization of Trichoderma isolates “colonies cultured on potato dextrose agar (PDA) using sterilized” should be replaced with “colonies cultured on PDA using sterilized” “Promega Wizard genomic DNA extraction kit” catalogue number should be added. “the internal transcribed spacer” should be replaced with “the internal transcribed spacer (ITS)” Phylogenetic relationships “in the NCBI” should be replaced with “in The National Center for Biotechnology Information (NCBI)” Results Morphological characterization of single spores of Trichoderma isolates “the Audrey & Bear Color Chart (https://www.audreyandbear.com)” When the given link is opened in the browser, an irrelevant page opens. “The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp),” Were the concatenated dataset of 26 isolates used here or 29 isolates? (Figure 6) Is the work clearly and accurately presented and does it cite the current literature? Yes Is the study design appropriate and is the work technically sound? Yes Are sufficient details of methods and analysis provided to allow replication by others? Yes If applicable, is the statistical analysis and its interpretation appropriate? Not applicable Are all the source data underlying the results available to ensure full reproducibility? Yes Are the conclusions drawn adequately supported by the results? Yes References 1. Korkom Y, Yıldız A: First report of Trichoderma guizhouense isolated from soil in Türkiye. Journal of Plant Diseases and Protection . 2024; 131 (2): 619-625 Publisher Full Text 2. Korkom Y, Yildiz A: Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. Journal of Plant Pathology . 2022; 104 (2): 671-682 Publisher Full Text Competing Interests No competing interests were disclosed. Reviewer Expertise Trichoderma, plant pathology, biological control, soil-borne diseases, fruit diseases, endophytic fungi, fungal pathogens, I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 09 Jan 2025 Ram Khadka, National Plant Pathology Research Centre, Nepal Agricultural Research Council, Lalitpur, 5459, Nepal Comments Introduction “These surveys have been conducted in various locations, including Russia and the Siberian Himalayas, 10 , 11 China, 12 , 13 South-East Asia, 14 India, 15 Egypt, 16 Iran, 17 Philippines, 18 Europe, 19 Canary Islands, 20 Sardinia 21 and South America. 22” The following studies conducted in Turkey can be added here. Korkom, Y., & Yıldız, A. (2024). First report of Trichoderma guizhouense isolated from soil in Türkiye. Journal of Plant Diseases and Protection , 131 (2), 619-625. “Certain Trichoderma species have been successfully utilized as BCAs, showcasing their antagonistic mechanisms to mitigate damage caused by soil-borne pathogens, both in greenhouse and open field conditions. 25–27 ” Korkom, Y., & Yildiz, A. (2022). Evaluation of biocontrol potential of native Trichoderma isolates against charcoal rot of strawberry. Journal of Plant Pathology , 104 (2), 671-682. Response: As per the recommendation both the studies are cited as 23 ad 29 . Methods Isolation and culture of Trichoderma isolates “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for development and growth.” should replaced with “After inoculation, Trichoderma colonies were sub cultured onto potato dextrose agar (PDA) plates and incubated at 28°C for seven days to allow for growth.” Response: As per suggestion sentence is corrected. “Colonies have key characteristics that can be used to identify them as Trichoderma including growth pattern, growth speed, odour and colour.” The odour is not a characteristic feature used to distinguish Trichoderma species and should be removed. Response: We have removed odour as suggested. “the Audrey & Bear Color Chart (https://www.audrey and bear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart Molecular characterization of Trichoderma isolates “colonies cultured on potato dextrose agar (PDA) using sterilized” should be replaced with “colonies cultured on PDA using sterilized” “Promega Wizard genomic DNA extraction kit” catalogue number should be added. Response: We have added catalogue number as Catalogue No. A1120. “the internal transcribed spacer” should be replaced with “the internal transcribed spacer (ITS)” Phylogenetic relationships “in the NCBI” should be replaced with “in The National Center for Biotechnology Information (NCBI)” Response: Both the above suggestions are incorporated. Results Morphological characterization of single spores of Trichoderma isolates “the Audrey & Bear Color Chart (https://www.audreyandbear.com)” When the given link is opened in the browser, an irrelevant page opens. Response: The link is corrected as https://audreyandbear.com/products/audrey-bear-color-chart “The maximum likelihood phylogenetic tree, based on the concatenated dataset ITS and tef-1α (1352 bp),” Were the concatenated dataset of 26 isolates used here or 29 isolates? (Figure 6) Response: For the concatenation dataset of 22 isolates were used. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Korkom Y. Peer Review Report For: Morphological and Molecular Characterization of Trichoderma Isolates from Vegetable Crop Rhizospheres in Nepal [version 3; peer review: 1 approved, 2 approved with reservations] . F1000Research 2025, 13 :1088 ( https://doi.org/10.5256/f1000research.168625.r327961) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/13-1088/v1#referee-response-327961 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "Morphological and Molecular Characterization...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/13-1088/v3" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/13-1088/v3&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/13-1088/v3" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Jaiswal P et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/13-1088/v3/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/13-1088", templates : { twitter : "Morphological and Molecular Characterization of Trichoderma Isolates.... Jaiswal P et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/13-1088/v3" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/153701/178434") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "178434"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "369664": 0, "358029": 0, "358028": 0, "358031": 0, "358030": 0, "358027": 0, "331285": 0, "358036": 0, "331284": 0, "331287": 0, "331286": 0, "358033": 0, "358032": 0, "358035": 0, "331283": 0, "358034": 0, "331282": 0, "327965": 0, "327964": 0, "327967": 0, "327966": 0, "331289": 0, "327961": 23, "331288": 17, "327963": 0, "331291": 0, "327962": 0, "331290": 0, "327969": 0, "327968": 0, "327970": 0, "357676": 0, "357675": 13, "361917": 0, "361916": 0, "361919": 0, "361918": 0, "361925": 0, "361924": 0, "361921": 0, "361920": 0, "361923": 0, "361922": 0, "331363": 0, "340077": 0, "340076": 0, "359919": 0, "359918": 0, "340078": 0, "340075": 0, "359924": 14, "359927": 0, "359926": 0, "359921": 0, "359920": 0, "359923": 0, "359922": 0, "369663": 0, "369662": 0, "359928": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "2c3134dd-18f4-4ee6-a47a-1922263001cf"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });