Genetic engineering of elite indica rice with cry2Ac gene to impart insect resistance | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genetic engineering of elite indica rice with cry2Ac gene to impart insect resistance Raviraj Banakar, Udayasuriyan V, Duraialagaraja Sudhakar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9131602/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Crystal proteins from Bacillus thuringiensis ( Bt ) have potential insecticidal properties. Heterologous expression of genes encoding Cry proteins in plants can impart resistance to insects, thus, providing a sustainable and cost-effective solution for insect pest management. Therefore, we have transformed popular elite indica rice cultivar ASD16 with a construct harbouring a cry2Ac gene driven by constitutive CaMV35S promoter, selectable marker hygromycin phosphotransferase ( hpt ) gene and scorable marker gusA gene. A total of ninety-nine independent putative transgenic plants were regenerated with the transformation frequency ranging between 5 and 38%. Sixty six out of 70 putative transformants tested for the presence of cry2Ac gene by PCR were found to be positive. However, when the plants were subjected to insect bioassay, none of them showed insect mortality. This could possibly be due to undetectable level of expression of cry2Ac gene which may require optimization of GC content and use of suitable promoters to drive the expression of transgenes. Bacillus thuringienesis rice Cry2Ac insect resistance codon optimization transformation Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Rice is staple crop for more than half of the global population [ 1 , 2 ]. Globally rice is grown in 164 million hectares covering 118 countries [ 3 ]. Since majority of the rice is produced and consumed in Asia, particularly in India and China, any short fall in production, due to biotic and abiotic factors will have a huge impact on global rice production and consumption [ 3 ]. Hence, overcoming biotic and abiotic stresses in rice production system is important for global food and nutritional security. About 37% of the crops around the world are lost due to pest and diseases, out of which insect pest alone accounts for 13% [ 4 ]. Among all the pests and diseases, insect pests are major threat to the rice production in many rice growing countries. The major insect pests of rice in major rice growing areas are, yellow stem borer (YSB; Scirpophaga incertulas Walker), striped stem borer (SSB; Chilo suppressalis Walker) (Lepidoptera; Pyralidae), rice leaf folder (RLF; Cnaphalocrocus medinalis) [ 5 , 6 ]. YSB alone causes more than 10 million tonnes losses and 50% of the insecticides used in the rice ecosystem are targeted towards the same [ 7 ]. Occasional outbreak of RLF can cause around 60 to 90% of the loss [ 8 ]. Insect pest management by chemical pesticides has brought about considerable protection but these chemical pesticides are expensive. Furthermore, frequent use of these management strategies results in increase of cost of production, environmental degradation, ill effect on human health, eradication of beneficial insects and development of pesticide resistant insects [ 9 , 10 ]. In contrast to conventional insect control methods genetic engineering of plants for insect resistance is a long term, sustainable and cost-effective approach [ 11 ]. Different insecticidal genes used for the control of insect pests include protease inhibitors, lectins, amylase inhibitors and δ-endotoxins ( Bt gene) produced by the soil bacterium Bacillus thuringiensis. Among them Bt gene offers a greater scope for controlling insect pests [ 9 ]. Substantial progress has been made by introducing crystal insecticides protein genes from the Bt into several crops, such as maize and cotton [ 12 – 14 ]. Engineered rice plants containing Bt genes have been reported previously [ 15 – 18 ]. In the present study, an attempt was made to generate transgenic elite elite indica rice cultivar ASD16 expressing cry2Ac gene to provide protection against lepidopteron pests. Materials and Methods Plasmid for plant transformation The construct, pS2AcP7 (based on pCAMBIA1301; Fig. 1 ) harboring cry2Ac gene hygromycin resistance gene ( hph ) as plant selectable marker and gusA gene as reporter gene was used in transformation experiments. Transcription of both Cry2Ac and hpt genes is driven by CaMV 35S promoter and terminated by CaMV35S terminator, whereas gusA transcription is driven by CaMV35S promoter and terminated by Agrobacterium tumefaciens nos terminator. Plasmid DNA isolation and construct confirmation Five milliliters of E. coli DH5α cells harbouring pS2AcP7 was grown overnight at 37°C and plasmid DNA was isolated from this culture using GenElute™ plasmid mini prep kit (Catalog # PLN 70; Sigma-Aldrich, USA) following manufacturer’s instructions. Restriction analysis was carried out to check the integrity of plasmid pS2AcP7. Restriction digestion of plasmid DNA was done as per the standard procedures [ 19 ] using restriction endonuclease, Pst I (MBA, Fermentas) in an appropriate buffer at 37°C for 1 h. The digested product was analyzed on a 0.8% agarose gel. PCR was performed with plasmid DNA to confirm the presence of cry2Ac and gusA genes using cry2Ac and gusA specific primers respectively, with appropriate positive and negative controls. For gusA gene forward primer (5’ GGTGGGAAAGCGCGTTACAAG 3’) and reverse primer (5’ GTTTACGCGTTGCTTCCGCCA 3’) were used to amplify 1.2 kb internal sequence of gusA gene. Temperature profile used for amplification was as follows: pre-incubation at 94°C for 5 min leading to 40 cycles of melting at 94°C for 45 s, annealing at 62°C for 1 min and synthesis at 72°C for 1 min followed by extension at 72°C for 5 min. Ten microlitres of the amplified product was used for electrophoretic analysis on 1% agarose gel. For cry2Ac gene forward primer (5’ ATGAACACCGTGCTCAACAAC 3’) and reverse primer (5’TGGTACTTGAAGAGGGACCAG 3’) were used to amplify 800 bp internal sequence. Temperature profile used for amplification was as follows: pre-incubation at 94°C for 5 min leading to 29 cycles of melting at 94°C for 1 min, annealing at 65°C for 40 s and synthesis at 72°C for 1 min followed by extension at 72°C for 10 min. Ten micro litres of the amplified product was used for electrophoretic analysis on 1% agarose gel. Biolistic transformation of rice Gold particles of size 0.9 µm dia (BioRad, USA) were used as microcarriers to deliver the genes harboured on the plasmids into target tissues. Ten micrograms of pS2AcP7 were used for coating 5 mg of gold particles. The plasmid DNA (10 µg of pS2AcP7) was mixed with 100 µl of sterile XHO buffer (30 µl of 5M Nacl + 5 µl of 2M Tris pH 8.0 in 965 µl of distilled water) and the mixture was added to the microfuge tube containing 5 mg of gold and mixed well by brief vortexing. To this, 100 µl of 0.1 M spermidine was added and mixed by vortexing. This was followed by addition of 100 µl of 25% PEG (1300–1600) and vortexing. Finally, 100 µl of 2.5 M CaCl 2 added to the mixture drop by drop whilst vortexing. This was followed by vortexing of the mixture for 10 min. The mixture was then pulsed for 30 s at 4000 rpm and the supernatant discarded. The pellet was resuspended in absolute ethanol and centrifuged for 30 s at 4000 rpm. The supernatant was discarded and the pellet resuspended in 1 ml of absolute ethanol and sonicated briefly. The gold ethanol suspension was stored in -20°C. Immature seeds were collected 12–14 d after pollination from an elite cultivar, ASD16 grown at Paddy Breeding Station, Department of Rice, Centre for Plant Breeding and Genetics, Tamil Nadu Agricultural University, Coimbatore and used in the transformation experiments. After the removal of glumes, the immature seeds were surface sterilized with sterile double distilled water twice followed by 70% ethanol for two minutes. Subsequent sterilization was done with 0.1% HgCl 2 for four min followed by three to five washes with sterile distilled water. Embryos were excised aseptically under a microscope (ZEISS, Germany or Leica, Switzerland) and placed on CC callus proliferation (CC medium containing 2 mg/l 2, 4-D) medium (Table S1 -2), with scutellar region facing up. The plates containing embryos were incubated in dark for 2 d at 25 ± 2°C. Four hours prior to bombardment, the embryos were transferred to CC osmoticum medium supplemented with mannitol and sorbitol, each at 36.4 g/l (Table S1 -2). The embryos were arranged in a 1 cm dia circle, each embryo was kept independently without touching each other at the centre of the Petri plate in such a way that their scutellar region was perfectly facing up. About 16 µl of gold suspension was placed at the centre of the macro carrier and allowed to dry for 2–3 min. Then, the explants were bombarded twice using PDS- 1000/He biolistic particle delivery system at four hours interval using rupture discs with 1100 pounds per square inch (psi) specification at 25 inches of Hg vaccum. Four hours after the second bombardment, the bombarded embryos were transferred to CC callus proliferation medium and incubated in dark at 25 ± 2°C for 2 d. Two days after bombardment, immature embryos were transferred to selection medium (CC callus proliferation medium containing 2 mg/l 2, 4-D and 30 mg/l hygromycin B, Table S1 -2) and incubated in dark at 25 ± 2°C. The germinating shoots of bombarded embryos were removed after 5–6 d of culturing on the selection plate. After 15 days, the calli on selection medium were subcultured onto a fresh selection medium containing 30 mg/l hygromycin B. The embryos under second and third selection were incubated under dark at 25 ± 2°C for 2 wk. Embryogenic calli lines after three rounds of selection were transferred to CC regeneration medium (Table S1 -2) with 30 mg/l hygromycin B and incubated at 25 ± 2°C with a photoperiod of 16 h for the regeneration of shoots. The emerging shoot buds were transferred to Petri plates containing half strength MS medium (Table S3) containing hygromycin B (30 mg/l) for rooting. Well grown plants were transferred to jam bottles containing half strength MS Medium with 30 mg/l hygromycin B. The rooted plants were transferred to potting mixture and maintained in transgenic greenhouse. Hoagland’s solution (Table S4) was applied at 10 days interval for the supply of nutrients to the plants. Histochemical GUS analysis Transient GUS assay was carried with a few randomly selected embryos 48 h after second bombardment. The embryos were incubated overnight in X-Gluc staining solution (Supplementary information 1) at 37°C. Stable GUS expression assay was carried out with the calli (after two or three rounds of selection) and leaf, roots, immature seed and immature zygotic embryo of putative transgenic plants. The tissues were incubated in a solution containing X-Gluc at 37°C overnight. Molecular analysis of T0 transgenic plants Total DNA was extracted from a small leaf bit excised from the regenerated plants. The leaf bit was homogenized in 300 µl of extraction buffer (200 mM Tris-HCl, pH 7.5, 200 mM NaCl, 25 mM EDTA and 10% SDS) and centrifuged at 12000 rpm for 10 min. Supernatant was precipitated with ice cold isopropanol. The supernatant was discarded after centrifugation and the pellet dried for 15 min, dissolved in 30 µl of 0.1X TE buffer. The presence of cry2Ac and hph gene in DNA samples from putative transgenic plants was analyzed by PCR as previously described. Insect Bioassay Rice leaf folder larvae were collected from infested rice fields at Paddy Breeding Station, TNAU. Transgenic leaf tissues were collected from greenhouse grown T 0 transgenic rice plants. Leaf tissues were washed twice in sterile water, placed in Petri plates containing 0.8% Agar. Rice leaf folder larvae (five in number with six replicates) were left to feed for 24 hours. Larval feeding and leaf damage was assessed. Leaf tissue collected from non-transgenic counterpart was used as control. Results Confirmation of pS2AcP7 plasmid containing Cry2Ac-hpt and gusA gene Construct pS2AcP7 containing insecticidal crystal protein cry2Ac gene, plant selectable marker hygromycin phospho transferase ( hpt ) gene, and scorable marker gusA genes (Fig. 1 a) was used in transformation experiments. Restriction digestion of pS2AcP7 with Pst I resulted in release of 2.6 kbp cry2Ac expression cassette (Fig. 1 b). Similarly, PCR amplification by primer pairs located in the cry2Ac coding sequence amplified 800 bp-long internal sequence of cry2Ac gene in pS2AcP7 (Fig. 1 c). In addition, presence of gusA gene was confirmed by PCR (Fig. 1 d), indicating the intactness of pS2AcP7. Biolistic transformation of ASD16 Particle bombardment experiments were carried out using immature embryos of ASD16 as explants with pS2AcP7 harbouring cry2Ac gene (Fig. 2 a-c). After 48 h of bombardment, a few randomly selected embryos exhibited transient GUS expression after an overnight incubation in X-Gluc solution at 37°C (Fig. 3 a). The embryogenic calli obtained from immature embryos after bombardment were sub-cultured twice or thrice on selection medium at 2-week intervals. Hygromycin resistant embryogenic calli on selection media grew well, whereas untransformed calli turned necrotic and later dried (Fig. 2 d, e). At the end of three rounds of hygromycin selection, 147 calli lines of ASD16 were obtained (Table 1 ). Among them 54 calli lines were randomly analyzed for GUS expression and all of them showed GUS expression (Table 2 , Fig. 3 b-representative image). The embryogenic calli obtained after three rounds of selection were transferred to regeneration medium for shoot induction. Calli placed on regeneration medium showed greening within 6–8 d. The well-developed shoots were separated carefully and transferred to rooting medium for root induction (Fig. 2 f – h). Totally 99 T0 plants were regenerated with regeneration frequency ranging from 7 to 42% (Table 1 ). Multiple plants derived from a single embryo were regarded as siblings of a single event. These plants were transferred to the soil and grown till maturity. PCR and histochemical GUS assay Histochemical (GUS) analysis with leaf bit showed stable GUS expression in all the 99 plants (Table 1 ; Fig. 3 c-representative figure showing gus expression). In addition, roots, immature seeds and zygotic embryos isolated from putative transgenic plants, when incubated overnight in X-gluc solution, exhibited blue staining (Fig. 3 d-f) representative figure showing gus expression), indicating stable GUS expression in all parts of the plant tested. In addition, the PCR assay for the presence of cry2Ac gene carried out in seventy T0 plants, sixty-six plants were found to be positive for cry2Ac with the transformation frequency ranging from 5 to 38% (Fig. 4 -representative image for PCR amplification). Put together these results suggest that the 7 bombardments of pS2AcP7 had delivered intact gene sequences in majority of the transgenic plants. Insect bioassay To determine whether engineering rice plants with cry2Ac would lead to insect mortality, insect bioassay was conducted using rice leaf folder collected from field. In comparison to the leaf folder larvae fed on wild type rice, the larvae fed on transgenic plants did not differ much for survival, growth and development. This explains that the expression of cry2Ac might not have been enough to cause any effect on the leaf folder larvae. Discussion Pests and diseases are the major limiting factors in rice production. Among insect pests, lepidopteron pests are the major ones in rice producing regions. YSB alone causes a loss of more than 10 million tonnes and accounts for about 50% of the insecticides used in the rice ecosystem [ 7 ]. Use of toxic chemicals not only increases the rice production cost but also causes health hazards to rice farmers as well as deterioration the rice field environment [ 10 ]. Biological control of insects is more popular as it has several advantages over the chemical pesticides. Among various biocontrol agents, B. thuringiensis (Bt) offers greater scope for controlling insect pests [ 9 ]. The introduction of crystal insecticidal protein genes from Bt into several crops through genetic engineering has proved to be effective in controlling insect pest incidence [ 12 ]. Transfer of a synthetic Bt ( cry1Ab ) gene into a IRRI breeding line, IR58 has resulted in an effective control of YSB and SSB, the two most devastating insect pests of rice in Asia [ 20 ]. Transgenic Bt rice variety Tarom Molai, an Iranian aromatic rice developed by the introduction of cry1Ab gene. has shown resistance against stem borer and enhanced yield levels when compared to control Tarom Molai [ 21 ]. However, given difference in growing conditions across rice growing areas developing Bt rice using cultivars of given environment will be of great importance. To this end the local elite cultivar ASD16 was transformed with cry2Ac gene using immature embryos using particle bombardment method as previously described by [ 22 ]. The transient GUS expression in the calli after 48 h of bombardment has demonstrated the efficiency of the system in delivering gene constructs into cells. Stable GUS expression assays performed on randomly selected calli lines that survived two or three rounds of selection on hygromycin B were shown to be positive for the GUS expression. All the regenerated plants were shown to be positive for stable GUS expression, indicating the effectiveness of the hygromycin B selection system in rice. Randomly selected plants which were analyzed for the presence hpt gene through PCR were found to be positive. Out of 70 hpt positive plants tested, 66 plants were found to be positive for cry2Ac. Earlier reports by [ 18 , 23 , 24 , 25 , 26 ] have shown that the biolistic transformation could result in high transformation frequencies with intact expression cassettes. Basmati 370 and M7 expressing novel cry2A gene was developed by biolistic transformation [ 18 ]. Toxin was expressed up to 5% of total leaf protein and the plants expressing moderate to high level of Cry2A toxin caused 100% mortality to RLF. Under field conditions Cry2A toxin expressed at 0.12% of total leaf soluble proteins which was is on par with the commercial Bt cultivars [ 27 ]. No mortality of RLF was observed in the transgenic plants generated in this study. possibly, due to undetectable level of expression which might be due to differences in codon usage in bacteria and plants. It has been shown previously that biolistic transformation often leads to insertion of broken DNA fragments, chromosomal rearrangements and multiple copies of transgenes insertion [ 26 , 28 ]. However, when large number of independent transgenic events are generated, this issue can be minimalized. Since, we have generated close to 100 independent transgenic events, non-mortality of rice leaf folder may not be related to transgene integration pattern. Plant genes are GC rich, whereas Bt proteins are AT rich ([ 29 , 30 ]. The GC content of cry2Ac gene used in the experiment was low. Highly expressed rice genes tend to have more than 60% GC content, and high GC containing gene transcripts tend to be overrepresented in comparison to other transcripts in rice [ 31 , 32 ]. Hence, it appears that there is preference for high GC containing genes in rice. Moreover, higher GC content of Bt genes is preferred for enhanced expression in plants [ 33 , 34 ]. Our results therefore suggest that the lower GC content in cry2Ac could be the reason behind low or minimal expression of Cry2Ac. Conclusion In conclusion, we have shown generation of cry2Ac containing local elite cultivar ASD16. However, the transgenic events generated in this experiment did not impart resistance to rice leaf folder. Going forward cry2Ac sequence need to be optimized for its GC content for expression in plants and expressed under various promoter and terminator combinations to achieve optimal expression of cry2Ac . Doing so will help evolve rice lines with insect resistance ability and in turn improve the productivity of rice. Declarations Acknowledgement RB was supported by Department of Biotechnology, Govt of India fellowship to carry out master’s in biotechnology at Tamil Nadu Agriculture University, India. We also acknowledge Dr. S. Robin. Dr. E. Kokiladevi. Dr. L. Arul, Dr. K.K. Kumar and Dr.N. Balakrishnan, and Dr. Safia Nayeem for their help in conducting this research programme. Funding Funding was not received for this research Author information Department of Plant Molecular Biology and Biotechnology Centre for Plant Molecular Biology and Biotechnology Tamil Nadu Agricultural University, Coimbatore, Tamil Nadu, India. 641003 Raviraj Banakar, Udayasuriyan V, Duraialagaraja Sudhakar Department of Biochemistry and Molecular Biology Oklahoma State University, Stillwater, Oklahoma, USA, 74078 Raviraj Banakar Author contributions RB and DS designed experiments, VU provided plasmids pS2AcP7, RB and DS performed rice transformation, RB performed genotyping, insect bioassay and plant growth care. RB prepared draft of the manuscript, RB, and DS wrote Manuscript with inputs from co-authors. Corresponding author Correspondence to Raviraj Banakar Ethics declaration Ethical approval Not applicable. Consent to participate Not applicable. Consent to publish Not applicable. Clinical trial number Not applicable. Competing interest The authors declare no competing interests. Dual Publication Manuscript is not under consideration elsewhere Data Availability All the data generated is part of the manuscript, further queries can be made to corresponding author. References Tang K, Sun X, Hu Q, Wu A, Lin CH, Lin HJ, Twyman RM, Christou P, Feng T. (2001). Transgenic rice plants expressing the ferredoxin-like protein (AP1) from sweet pepper show enhanced resistance to Xanthomonas oryzae pv. oryzae . Plant Science, 160 , 1035–1042. Sen S, Chakraborty R, Kalita P. Rice—Not just a staple food: A comprehensive review on its phytochemicals and therapeutic potential. Trends Food Sci Technol. 2020;97:265–85. Samal P, Babu SC, Mondal B, Mishra NS. The global rice agriculture towards 2050: An inter-continental perspective. Outlook Agric. 2022;51:164–72. Gatehouse AMR. Biotechnological applications of plant genes in the production of insect resistant crops. In: Clement SL, Quisenberry SS, editors. Global plant genetic resources for insect resistant crops. CRC; 1999. pp. 263–80. Pathak MD, Khan ZR. Insect pests of rice. International Rice Research Institute; 1994. Savary S, Willocquet L, Elazegui FA, Castilla NP, Teng PS. Rice pest constraints in tropical Asia: Quantification of yield losses due to rice pests in a range of production situations. Plant Dis. 2000;84:357–69. Huesing J, English L. The impact of Bt crops on the developing world. AgBioForum. 2004;7:84–95. Yambao EB, Ingrum KT, Rubia EG, Shepard BM. (1993). Case study: Growth and development of rice in response to artificial stem borer infestation. Intercrop Protection (SARP Proceedings) . Shelton AM, Tang JD, Roush RT, Metz TD, Earle ED. Field tests on managing resistance to Bt-engineered plants. Nat Biotechnol. 2000;18:339–42. Pingali PL, Roger PA. Impact of pesticides on farmer health and the rice environment. International Rice Research Institute; 1995. Sanahuja G, Banakar R, Twyman RM, Capell T, Christou P. Bacillus thuringiensis: A century of research, development and commercial applications. Plant Biotechnol J. 2011;9:283–300. Krattiger AF. Insect resistance in crops: A case study of Bacillus thuringiensis (Bt) and its transfer to developing countries. ISAAA Briefs. 2nd ed. ISAAA; 1997. p. 42. Schuler HT, Poppy GM, Denholm I. Insect resistant transgenic plants. Trends Biotechnol. 1998;16:168–75. Wang ZH, Shu QY, Cui HR, Xia YW. The study of insect-resistant plants with Bacillus thuringiensis crystal protein genes. Chin Bull Bot. 1999;16:51–8. Fujimoto H, Itoh K, Yamamoto M, Kyozuka J, Shimamoto K. Insect resistant rice generated by introduction of a modified gene of Bacillus thuringiensis . Bio/Technology. 1993;11:1151–5. Nayak KP, Basu D, Das S, Basu A, Ghosh D, Ramakrishna NA, Ghosh M, Sen SK. (1997). Transgenic elite indica rice plants expressing CryIAc δ-endotoxin of Bacillus thuringiensis are resistant against yellow stem borer ( Scirpophaga incertulas ). Proceedings of the National Academy of Sciences of the USA, 94 , 2111–2116. Tu J, Ona I, Zhang Q, Mew TW, Khush GS, Datta SK. Transgenic rice variety IR72 with Xa21 is resistant to bacterial blight. Theor Appl Genet. 1998;97:31–6. Maqbool SB, Christou P. Multiple traits of agronomic importance in transgenic indica rice plants: Analysis of transgene integration patterns, expression levels and stability. Mol Breeding. 1999;5:471–80. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press; 1989. Wunn J, Kloti A, Burkhardt PK, Biswas GCG, Launis K, Iglesias K, Potrykus I. Transgenic indica rice breeding line IR58 expressing a synthetic cry1Ab gene from Bacillus thuringiensis provides effective insect pest control. Bio/Technology. 1996;14:171–6. ISAAA. The first ten years: Global socio-economic and environmental impacts. ISAAA Brief No. 36; 2006. Christou P, Ford TL, Kofron M. Production of transgenic rice ( Oryza sativa L.) plants from agronomically important indica and japonica varieties via electric discharge particle acceleration of exogenous DNA into immature zygotic embryos. Bio/Technology. 1991;9:957–62. Sudhakar D, Duc LT, Bong BB, Tinjuangjun P, Maqbool SB, Valdez M, Jefferson R, Christou P. An efficient rice transformation system utilising mature seed-derived explants and a portable, inexpensive particle bombardment device. Transgenic Res. 1998;7:289–94. Valdez M, Cabrera-Ponce JL, Sudhakar D, Herrera-Estrella L, Christou P. Transgenic Central American, West African and Asian elite varieties resulting from particle bombardment of foreign DNA into mature seed-derived explants using three different bombardment devices. Ann Botany. 1998;82:795–801. Banakar R, Fernandez AA, Diaz-Benito P, Abadia J, Capell T, Christou P. Phytosiderophores determine thresholds for iron and zinc accumulation in biofortified rice endosperm while inhibiting the accumulation of cadmium. J Exp Bot. 2017;68:4983–95. Banakar R, Eggenberger AL, Lee K, Wright DA, Murugan K, Zarecor S, Lawrence-Dill CJ, Sashital DG, Wang K. High-frequency random DNA insertions upon co-delivery of CRISPR-Cas9 ribonucleoprotein and selectable marker plasmid in rice. Sci Rep. 2019;9:1–13. Bashir K, Husnain T, Fatima T, Latif Z, Mehdi SA, Riazuddin S. Field evaluation and risk assessment of transgenic indica basmati rice. Mol Breeding. 2004;13:301–12. Liu J, Nannas NJ, Fu F, Shi J, Aspinwall B, Parrott WA, et al. Genome-scale sequence disruption following biolistic transformation in rice and maize. Plant Cell. 2019;31:368–83. Li S, Wen N, Lv W, Zhang M, Wang Y, Lang Z. Impact of codon optimization on vip3Aa11 gene expression and insecticidal efficacy in maize. Front Plant Sci. 2025;16:1579465. Li X, Li S, Lang Z, Zhang J, Zhu L, Huang D. Chloroplast-targeted expression of the codon-optimized truncated cry1Ah gene in transgenic tobacco confers a high level of protection against insect pests. Plant Cell Rep. 2013;32:1299–308. Tyagi S, Kabade PG, Gnanapragasam N, Singh UM, Gurjar AKS, Rai A, Sinha P, Kumar A, Singh VK. Codon usage provides insights into the adaptation of rice genes under stress condition. Int J Mol Sci. 2023;24(2):1098. https://doi.org/10.3390/ijms24021098 . Zhao D, Hamilton JP, Hardigan M, Yin D, He T, Vaillancourt B, Reynoso M, Pauluzzi G, Funkhouser S, Cui Y, Bailey-Serres J, Jiang J, Buell CR, Jiang N. (2017). Analysis of ribosome-associated mRNAs in rice reveals the importance of transcript size and GC content in translation. G3: Genes, Genomes, Genetics, 7 (1), 203–219. https://doi.org/10.1534/g3.116.036020 Koul B, Yadav R, Sanyal I, Amla DV. Comparative performance of modified full-length and truncated Bacillus thuringiensis cry1Ac genes in transgenic tomato. SpringerPlus. 2015;4:203. https://doi.org/10.1186/s40064-015-0991-x . Strizhov N, Keller M, Mathur J, Koncz-Kálmán Z, Bosch D, Prudovsky E, Schell J, Sneh B, Koncz C, Zilberstein A. (1996). A synthetic cryIC gene, encoding a Bacillus thuringiensis delta-endotoxin, confers Spodoptera resistance in alfalfa and tobacco. Proceedings of the National Academy of Sciences of the USA, 93 (26), 15012–15017. https://doi.org/10.1073/pnas.93.26.15012 Tables Table 1 and 2 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Tables.docx Supplementaryinfo.doc Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 25 Mar, 2026 Editor assigned by journal 17 Mar, 2026 Submission checks completed at journal 17 Mar, 2026 First submitted to journal 15 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9131602","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":607964600,"identity":"54e25d8f-344c-48a6-8f25-1315ae696dff","order_by":0,"name":"Raviraj Banakar","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYBACAyBmbAAzQRSPDYjReIAULWlgBrFawOAwmMSrxZz97MGPM2ru5fPPSG778EPmvN3a9sNAW2psonFpsezJS5bccKzYcsaNxOaZPTy3k7edSQRqOZaW24BDi8GBHAPJB2wJBgxnDjYz8AC1mB0AamFsOIxby/k3xj8f/EswkAdqYfzDcy7Z7PxDAlpu5JhJbmxLMDA43tjMzMNzwM7sBgFbLGe8MbOc2ZdgYAjSIsOTnGB2A2hLAh6/mPPnGN/s+ZZgIHeY/THj2x47e7Pz6Q8ffKixwakFFTD2MCSCVSYQpRwMfjDYE694FIyCUTAKRgoAADFLZok9Aw/SAAAAAElFTkSuQmCC","orcid":"","institution":"Tamil Nadu Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Raviraj","middleName":"","lastName":"Banakar","suffix":""},{"id":607964601,"identity":"c367b25d-39c2-4881-bbe5-dcca912cf321","order_by":1,"name":"Udayasuriyan V","email":"","orcid":"","institution":"Tamil Nadu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Udayasuriyan","middleName":"","lastName":"V","suffix":""},{"id":607964602,"identity":"853cef54-c194-448a-96fa-5aa04fe231e0","order_by":2,"name":"Duraialagaraja Sudhakar","email":"","orcid":"","institution":"Tamil Nadu Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Duraialagaraja","middleName":"","lastName":"Sudhakar","suffix":""}],"badges":[],"createdAt":"2026-03-16 00:23:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9131602/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9131602/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105227456,"identity":"02ebdfb8-a841-4ae4-a19a-714a27c6332b","added_by":"auto","created_at":"2026-03-23 16:56:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":115152,"visible":true,"origin":"","legend":"\u003cp\u003ePlasmid of pS2AcP7, and molecular characterization. a) Map of pS2AcP7 showing position of restriction enzymes, promoter and terminator sequencesb) Restriction digestion analysis of pS2AcP7 with \u003cem\u003ePst1\u003c/em\u003e c) and d) showing the amplification of \u003cem\u003egusA\u003c/em\u003e and \u003cem\u003ehpt\u003c/em\u003e gene sequences from pS2AcP7 plasmid.\u003c/p\u003e","description":"","filename":"Figure1PDF1.png","url":"https://assets-eu.researchsquare.com/files/rs-9131602/v1/ad3a76a266468b472b6c5817.png"},{"id":105227459,"identity":"20cfb286-d5c2-4cda-8f40-b10cab0a1f91","added_by":"auto","created_at":"2026-03-23 16:56:16","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":818036,"visible":true,"origin":"","legend":"\u003cp\u003eIllustration showing rice transformation from immature embryo isolation, bombardment, selection, regeneration, rooting and hardening,\u003c/p\u003e","description":"","filename":"Figure1PDF2.png","url":"https://assets-eu.researchsquare.com/files/rs-9131602/v1/29ae665a3dd622173bc4373c.png"},{"id":105227454,"identity":"6a081de4-5d7e-41ab-990f-fff0663e4ba8","added_by":"auto","created_at":"2026-03-23 16:56:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1135604,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative\u003cstrong\u003e \u003c/strong\u003eIllustration showing transient and stable gus expression in different rice tissues.\u003c/p\u003e","description":"","filename":"Figure1PDF3.png","url":"https://assets-eu.researchsquare.com/files/rs-9131602/v1/260c5b64a42103c83187bf71.png"},{"id":105227458,"identity":"abec21cf-d035-4262-abda-2f7084c7b2e2","added_by":"auto","created_at":"2026-03-23 16:56:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":265844,"visible":true,"origin":"","legend":"\u003cp\u003eMolecular characterization of transgenic rice plants by PCR amplification of \u003cem\u003ecry2Ac\u003c/em\u003e gene, representative image.\u003c/p\u003e","description":"","filename":"Figure1PDF4.png","url":"https://assets-eu.researchsquare.com/files/rs-9131602/v1/f25746e1e258457c5be228a4.png"},{"id":105227460,"identity":"3bd93e82-740e-4c4d-84b2-1874d47a6377","added_by":"auto","created_at":"2026-03-23 16:56:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3594793,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9131602/v1/86b54c42-0928-4385-bc78-9774f0797887.pdf"},{"id":105227457,"identity":"fa387008-f098-4be4-b553-356f75666d15","added_by":"auto","created_at":"2026-03-23 16:56:10","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":21772,"visible":true,"origin":"","legend":"","description":"","filename":"Tables.docx","url":"https://assets-eu.researchsquare.com/files/rs-9131602/v1/d226999fbf5060af765617ff.docx"},{"id":105227455,"identity":"bc844527-3ca7-4a08-8f43-4af925fbd56c","added_by":"auto","created_at":"2026-03-23 16:56:10","extension":"doc","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":75264,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryinfo.doc","url":"https://assets-eu.researchsquare.com/files/rs-9131602/v1/af00e6a1d24a48d629bef46c.doc"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genetic engineering of elite indica rice with cry2Ac gene to impart insect resistance","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRice is staple crop for more than half of the global population [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Globally rice is grown in 164\u0026nbsp;million hectares covering 118 countries [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Since majority of the rice is produced and consumed in Asia, particularly in India and China, any short fall in production, due to biotic and abiotic factors will have a huge impact on global rice production and consumption [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Hence, overcoming biotic and abiotic stresses in rice production system is important for global food and nutritional security.\u003c/p\u003e \u003cp\u003eAbout 37% of the crops around the world are lost due to pest and diseases, out of which insect pest alone accounts for 13% [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Among all the pests and diseases, insect pests are major threat to the rice production in many rice growing countries. The major insect pests of rice in major rice growing areas are, yellow stem borer (YSB; \u003cem\u003eScirpophaga incertulas\u003c/em\u003e Walker), striped stem borer (SSB; \u003cem\u003eChilo suppressalis\u003c/em\u003e Walker) (Lepidoptera; Pyralidae), rice leaf folder (RLF; \u003cem\u003eCnaphalocrocus medinalis)\u003c/em\u003e [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. YSB alone causes more than 10\u0026nbsp;million tonnes losses and 50% of the insecticides used in the rice ecosystem are targeted towards the same [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Occasional outbreak of RLF can cause around 60 to 90% of the loss [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Insect pest management by chemical pesticides has brought about considerable protection but these chemical pesticides are expensive. Furthermore, frequent use of these management strategies results in increase of cost of production, environmental degradation, ill effect on human health, eradication of beneficial insects and development of pesticide resistant insects [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn contrast to conventional insect control methods genetic engineering of plants for insect resistance is a long term, sustainable and cost-effective approach [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Different insecticidal genes used for the control of insect pests include protease inhibitors, lectins, amylase inhibitors and δ-endotoxins (\u003cem\u003eBt\u003c/em\u003e gene) produced by the soil bacterium \u003cem\u003eBacillus thuringiensis.\u003c/em\u003e Among them Bt gene offers a greater scope for controlling insect pests [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSubstantial progress has been made by introducing crystal insecticides protein genes from the \u003cem\u003eBt\u003c/em\u003e into several crops, such as maize and cotton [\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Engineered rice plants containing Bt genes have been reported previously [\u003cspan additionalcitationids=\"CR16 CR17\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In the present study, an attempt was made to generate transgenic elite elite \u003cem\u003eindica\u003c/em\u003e rice cultivar ASD16 expressing \u003cem\u003ecry2Ac\u003c/em\u003e gene to provide protection against lepidopteron pests.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlasmid for plant transformation\u003c/h2\u003e \u003cp\u003eThe construct, pS2AcP7 (based on pCAMBIA1301; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) harboring \u003cem\u003ecry2Ac\u003c/em\u003e gene hygromycin resistance gene (\u003cem\u003ehph\u003c/em\u003e) as plant selectable marker and \u003cem\u003egusA\u003c/em\u003e gene as reporter gene was used in transformation experiments. Transcription of both \u003cem\u003eCry2Ac and hpt\u003c/em\u003e genes is driven by \u003cem\u003eCaMV 35S\u003c/em\u003e promoter and terminated by \u003cem\u003eCaMV35S\u003c/em\u003e terminator, whereas \u003cem\u003egusA\u003c/em\u003e transcription is driven by \u003cem\u003eCaMV35S\u003c/em\u003e promoter and terminated by \u003cem\u003eAgrobacterium tumefaciens nos\u003c/em\u003e terminator.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePlasmid DNA isolation and construct confirmation\u003c/h3\u003e\n\u003cp\u003eFive milliliters of \u003cem\u003eE. coli\u003c/em\u003e DH5α cells harbouring pS2AcP7 was grown overnight at 37\u0026deg;C and plasmid DNA was isolated from this culture using GenElute\u0026trade; plasmid mini prep kit (Catalog # PLN 70; Sigma-Aldrich, USA) following manufacturer\u0026rsquo;s instructions. Restriction analysis was carried out to check the integrity of plasmid pS2AcP7. Restriction digestion of plasmid DNA was done as per the standard procedures [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] using restriction endonuclease, \u003cem\u003ePst\u003c/em\u003eI (MBA, Fermentas) in an appropriate buffer at 37\u0026deg;C for 1 h. The digested product was analyzed on a 0.8% agarose gel. PCR was performed with plasmid DNA to confirm the presence of \u003cem\u003ecry2Ac\u003c/em\u003e and \u003cem\u003egusA\u003c/em\u003e genes using \u003cem\u003ecry2Ac\u003c/em\u003e and \u003cem\u003egusA\u003c/em\u003e specific primers respectively, with appropriate positive and negative controls. For \u003cem\u003egusA\u003c/em\u003e gene forward primer (5\u0026rsquo; GGTGGGAAAGCGCGTTACAAG 3\u0026rsquo;) and reverse primer (5\u0026rsquo; GTTTACGCGTTGCTTCCGCCA 3\u0026rsquo;) were used to amplify 1.2 kb internal sequence of \u003cem\u003egusA\u003c/em\u003e gene. Temperature profile used for amplification was as follows: pre-incubation at 94\u0026deg;C for 5 min leading to 40 cycles of melting at 94\u0026deg;C for 45 s, annealing at 62\u0026deg;C for 1 min and synthesis at 72\u0026deg;C for 1 min followed by extension at 72\u0026deg;C for 5 min. Ten microlitres of the amplified product was used for electrophoretic analysis on 1% agarose gel. For \u003cem\u003ecry2Ac\u003c/em\u003e gene forward primer (5\u0026rsquo; ATGAACACCGTGCTCAACAAC 3\u0026rsquo;) and reverse primer (5\u0026rsquo;TGGTACTTGAAGAGGGACCAG 3\u0026rsquo;) were used to amplify 800 bp internal sequence. Temperature profile used for amplification was as follows: pre-incubation at 94\u0026deg;C for 5 min leading to 29 cycles of melting at 94\u0026deg;C for 1 min, annealing at 65\u0026deg;C for 40 s and synthesis at 72\u0026deg;C for 1 min followed by extension at 72\u0026deg;C for 10 min. Ten micro litres of the amplified product was used for electrophoretic analysis on 1% agarose gel.\u003c/p\u003e\n\u003ch3\u003eBiolistic transformation of rice\u003c/h3\u003e\n\u003cp\u003eGold particles of size 0.9 \u0026micro;m dia (BioRad, USA) were used as microcarriers to deliver the genes harboured on the plasmids into target tissues. Ten micrograms of pS2AcP7 were used for coating 5 mg of gold particles. The plasmid DNA (10 \u0026micro;g of pS2AcP7) was mixed with 100 \u0026micro;l of sterile XHO buffer (30 \u0026micro;l of 5M Nacl\u0026thinsp;+\u0026thinsp;5 \u0026micro;l of 2M Tris pH 8.0 in 965 \u0026micro;l of distilled water) and the mixture was added to the microfuge tube containing 5 mg of gold and mixed well by brief vortexing. To this, 100 \u0026micro;l of 0.1 M spermidine was added and mixed by vortexing. This was followed by addition of 100 \u0026micro;l of 25% PEG (1300\u0026ndash;1600) and vortexing. Finally, 100 \u0026micro;l of 2.5 M CaCl\u003csub\u003e2\u003c/sub\u003e added to the mixture drop by drop whilst vortexing. This was followed by vortexing of the mixture for 10 min. The mixture was then pulsed for 30 s at 4000 rpm and the supernatant discarded. The pellet was resuspended in absolute ethanol and centrifuged for 30 s at 4000 rpm. The supernatant was discarded and the pellet resuspended in 1 ml of absolute ethanol and sonicated briefly. The gold ethanol suspension was stored in -20\u0026deg;C.\u003c/p\u003e \u003cp\u003eImmature seeds were collected 12\u0026ndash;14 d after pollination from an elite cultivar, ASD16 grown at Paddy Breeding Station, Department of Rice, Centre for Plant Breeding and Genetics, Tamil Nadu Agricultural University, Coimbatore and used in the transformation experiments. After the removal of glumes, the immature seeds were surface sterilized with sterile double distilled water twice followed by 70% ethanol for two minutes. Subsequent sterilization was done with 0.1% HgCl\u003csub\u003e2\u003c/sub\u003e for four min followed by three to five washes with sterile distilled water. Embryos were excised aseptically under a microscope (ZEISS, Germany or Leica, Switzerland) and placed on CC callus proliferation (CC medium containing 2 mg/l 2, 4-D) medium (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e-2), with scutellar region facing up. The plates containing embryos were incubated in dark for 2 d at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C.\u003c/p\u003e \u003cp\u003eFour hours prior to bombardment, the embryos were transferred to CC osmoticum medium supplemented with mannitol and sorbitol, each at 36.4 g/l (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e-2). The embryos were arranged in a 1 cm dia circle, each embryo was kept independently without touching each other at the centre of the Petri plate in such a way that their scutellar region was perfectly facing up. About 16 \u0026micro;l of gold suspension was placed at the centre of the macro carrier and allowed to dry for 2\u0026ndash;3 min. Then, the explants were bombarded twice using PDS- 1000/He biolistic particle delivery system at four hours interval using rupture discs with 1100 pounds per square inch (psi) specification at 25 inches of Hg vaccum. Four hours after the second bombardment, the bombarded embryos were transferred to CC callus proliferation medium and incubated in dark at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C for 2 d.\u003c/p\u003e \u003cp\u003eTwo days after bombardment, immature embryos were transferred to selection medium (CC callus proliferation medium containing 2 mg/l 2, 4-D and 30 mg/l hygromycin B, Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e-2) and incubated in dark at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C. The germinating shoots of bombarded embryos were removed after 5\u0026ndash;6 d of culturing on the selection plate. After 15 days, the calli on selection medium were subcultured onto a fresh selection medium containing 30 mg/l hygromycin B. The embryos under second and third selection were incubated under dark at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C for 2 wk.\u003c/p\u003e \u003cp\u003eEmbryogenic calli lines after three rounds of selection were transferred to CC regeneration medium (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e-2) with 30 mg/l hygromycin B and incubated at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C with a photoperiod of 16 h for the regeneration of shoots. The emerging shoot buds were transferred to Petri plates containing half strength MS medium (Table S3) containing hygromycin B (30 mg/l) for rooting. Well grown plants were transferred to jam bottles containing half strength MS Medium with 30 mg/l hygromycin B. The rooted plants were transferred to potting mixture and maintained in transgenic greenhouse. Hoagland\u0026rsquo;s solution (Table S4) was applied at 10 days interval for the supply of nutrients to the plants.\u003c/p\u003e\n\u003ch3\u003eHistochemical GUS analysis\u003c/h3\u003e\n\u003cp\u003eTransient GUS assay was carried with a few randomly selected embryos 48 h after second bombardment. The embryos were incubated overnight in X-Gluc staining solution (Supplementary information 1) at 37\u0026deg;C. Stable GUS expression assay was carried out with the calli (after two or three rounds of selection) and leaf, roots, immature seed and immature zygotic embryo of putative transgenic plants. The tissues were incubated in a solution containing X-Gluc at 37\u0026deg;C overnight.\u003c/p\u003e\n\u003ch3\u003eMolecular analysis of T0 transgenic plants\u003c/h3\u003e\n\u003cp\u003eTotal DNA was extracted from a small leaf bit excised from the regenerated plants. The leaf bit was homogenized in 300 \u0026micro;l of extraction buffer (200 mM Tris-HCl, pH 7.5, 200 mM NaCl, 25 mM EDTA and 10% SDS) and centrifuged at 12000 rpm for 10 min. Supernatant was precipitated with ice cold isopropanol. The supernatant was discarded after centrifugation and the pellet dried for 15 min, dissolved in 30 \u0026micro;l of 0.1X TE buffer. The presence of \u003cem\u003ecry2Ac\u003c/em\u003e and \u003cem\u003ehph gene\u003c/em\u003e in DNA samples from putative transgenic plants was analyzed by PCR as previously described.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eInsect Bioassay\u003c/h2\u003e \u003cp\u003eRice leaf folder larvae were collected from infested rice fields at Paddy Breeding Station, TNAU. Transgenic leaf tissues were collected from greenhouse grown T\u003csub\u003e0\u003c/sub\u003e transgenic rice plants. Leaf tissues were washed twice in sterile water, placed in Petri plates containing 0.8% Agar. Rice leaf folder larvae (five in number with six replicates) were left to feed for 24 hours. Larval feeding and leaf damage was assessed. Leaf tissue collected from non-transgenic counterpart was used as control.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003eConfirmation of pS2AcP7 plasmid containing Cry2Ac-hpt and gusA gene\u003c/h2\u003e\n \u003cp\u003eConstruct \u003cem\u003epS2AcP7\u003c/em\u003e containing insecticidal crystal protein \u003cem\u003ecry2Ac\u003c/em\u003e gene, plant selectable marker hygromycin phospho transferase (\u003cem\u003ehpt\u003c/em\u003e) gene, and scorable marker \u003cem\u003egusA\u003c/em\u003e genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea) was used in transformation experiments. Restriction digestion of pS2AcP7 with \u003cem\u003ePst\u003c/em\u003eI resulted in release of 2.6 kbp \u003cem\u003ecry2Ac\u003c/em\u003e expression cassette (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Similarly, PCR amplification by primer pairs located in the \u003cem\u003ecry2Ac\u003c/em\u003e coding sequence amplified 800 bp-long internal sequence of \u003cem\u003ecry2Ac\u003c/em\u003e gene in pS2AcP7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). In addition, presence of \u003cem\u003egusA\u003c/em\u003e gene was confirmed by PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed), indicating the intactness of pS2AcP7.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eBiolistic transformation of ASD16\u003c/h2\u003e\n \u003cp\u003eParticle bombardment experiments were carried out using immature embryos of ASD16 as explants with pS2AcP7 harbouring \u003cem\u003ecry2Ac\u003c/em\u003e gene (Fig. \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-c). After 48 h of bombardment, a few randomly selected embryos exhibited transient GUS expression after an overnight incubation in X-Gluc solution at 37\u0026deg;C (Fig. \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). The embryogenic calli obtained from immature embryos after bombardment were sub-cultured twice or thrice on selection medium at 2-week intervals. Hygromycin resistant embryogenic calli on selection media grew well, whereas untransformed calli turned necrotic and later dried (Fig. \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed, e). At the end of three rounds of hygromycin selection, 147 calli lines of ASD16 were obtained (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Among them 54 calli lines were randomly analyzed for GUS expression and all of them showed GUS expression (Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Fig. \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb-representative image). The embryogenic calli obtained after three rounds of selection were transferred to regeneration medium for shoot induction. Calli placed on regeneration medium showed greening within 6\u0026ndash;8 d. The well-developed shoots were separated carefully and transferred to rooting medium for root induction (Fig. \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef \u0026ndash; h). Totally 99 T0 plants were regenerated with regeneration frequency ranging from 7 to 42% (Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Multiple plants derived from a single embryo were regarded as siblings of a single event. These plants were transferred to the soil and grown till maturity.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003ePCR and histochemical GUS assay\u003c/h2\u003e\n \u003cp\u003eHistochemical (GUS) analysis with leaf bit showed stable GUS expression in all the 99 plants (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec-representative figure showing gus expression). In addition, roots, immature seeds and zygotic embryos isolated from putative transgenic plants, when incubated overnight in X-gluc solution, exhibited blue staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed-f) representative figure showing gus expression), indicating stable GUS expression in all parts of the plant tested. In addition, the PCR assay for the presence of \u003cem\u003ecry2Ac\u003c/em\u003e gene carried out in seventy T0 plants, sixty-six plants were found to be positive for \u003cem\u003ecry2Ac\u003c/em\u003e with the transformation frequency ranging from 5 to 38% (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e-representative image for PCR amplification). Put together these results suggest that the \u003cem\u003e7\u003c/em\u003e bombardments of \u003cem\u003epS2AcP7\u003c/em\u003e had delivered intact gene sequences in majority of the transgenic plants.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eInsect bioassay\u003c/h2\u003e\n \u003cp\u003eTo determine whether engineering rice plants with \u003cem\u003ecry2Ac\u003c/em\u003e would lead to insect mortality, insect bioassay was conducted using rice leaf folder collected from field. In comparison to the leaf folder larvae fed on wild type rice, the larvae fed on transgenic plants did not differ much for survival, growth and development. This explains that the expression of \u003cem\u003ecry2Ac\u003c/em\u003e might not have been enough to cause any effect on the leaf folder larvae.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003ePests and diseases are the major limiting factors in rice production. Among insect pests, lepidopteron pests are the major ones in rice producing regions. YSB alone causes a loss of more than 10\u0026nbsp;million tonnes and accounts for about 50% of the insecticides used in the rice ecosystem [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Use of toxic chemicals not only increases the rice production cost but also causes health hazards to rice farmers as well as deterioration the rice field environment [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Biological control of insects is more popular as it has several advantages over the chemical pesticides. Among various biocontrol agents, \u003cem\u003eB. thuringiensis\u003c/em\u003e (Bt) offers greater scope for controlling insect pests [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe introduction of crystal insecticidal protein genes from \u003cem\u003eBt\u003c/em\u003e into several crops through genetic engineering has proved to be effective in controlling insect pest incidence [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Transfer of a synthetic \u003cem\u003eBt\u003c/em\u003e (\u003cem\u003ecry1Ab\u003c/em\u003e) gene into a IRRI breeding line, IR58 has resulted in an effective control of YSB and SSB, the two most devastating insect pests of rice in Asia [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Transgenic Bt rice variety Tarom Molai, an Iranian aromatic rice developed by the introduction of \u003cem\u003ecry1Ab\u003c/em\u003e gene. has shown resistance against stem borer and enhanced yield levels when compared to control Tarom Molai [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, given difference in growing conditions across rice growing areas developing \u003cem\u003eBt\u003c/em\u003e rice using cultivars of given environment will be of great importance. To this end the local elite cultivar ASD16 was transformed with \u003cem\u003ecry2Ac\u003c/em\u003e gene using immature embryos using particle bombardment method as previously described by [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The transient GUS expression in the calli after 48 h of bombardment has demonstrated the efficiency of the system in delivering gene constructs into cells. Stable GUS expression assays performed on randomly selected calli lines that survived two or three rounds of selection on hygromycin B were shown to be positive for the GUS expression. All the regenerated plants were shown to be positive for stable GUS expression, indicating the effectiveness of the hygromycin B selection system in rice. Randomly selected plants which were analyzed for the presence \u003cem\u003ehpt\u003c/em\u003e gene through PCR were found to be positive. Out of 70 \u003cem\u003ehpt\u003c/em\u003e positive plants tested, 66 plants were found to be positive for \u003cem\u003ecry2Ac.\u003c/em\u003e Earlier reports by [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] have shown that the biolistic transformation could result in high transformation frequencies with intact expression cassettes.\u003c/p\u003e \u003cp\u003eBasmati 370 and M7 expressing novel \u003cem\u003ecry2A\u003c/em\u003e gene was developed by biolistic transformation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Toxin was expressed up to 5% of total leaf protein and the plants expressing moderate to high level of Cry2A toxin caused 100% mortality to RLF. Under field conditions Cry2A toxin expressed at 0.12% of total leaf soluble proteins which was is on par with the commercial Bt cultivars [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNo mortality of RLF was observed in the transgenic plants generated in this study. possibly, due to undetectable level of expression which might be due to differences in codon usage in bacteria and plants. It has been shown previously that biolistic transformation often leads to insertion of broken DNA fragments, chromosomal rearrangements and multiple copies of transgenes insertion [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. However, when large number of independent transgenic events are generated, this issue can be minimalized. Since, we have generated close to 100 independent transgenic events, non-mortality of rice leaf folder may not be related to transgene integration pattern. Plant genes are GC rich, whereas Bt proteins are AT rich ([\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The GC content of \u003cem\u003ecry2Ac\u003c/em\u003e gene used in the experiment was low. Highly expressed rice genes tend to have more than 60% GC content, and high GC containing gene transcripts tend to be overrepresented in comparison to other transcripts in rice [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Hence, it appears that there is preference for high GC containing genes in rice. Moreover, higher GC content of Bt genes is preferred for enhanced expression in plants [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Our results therefore suggest that the lower GC content in \u003cem\u003ecry2Ac\u003c/em\u003e could be the reason behind low or minimal expression of Cry2Ac.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, we have shown generation of \u003cem\u003ecry2Ac\u003c/em\u003e containing local elite cultivar ASD16. However, the transgenic events generated in this experiment did not impart resistance to rice leaf folder. Going forward \u003cem\u003ecry2Ac\u003c/em\u003e sequence need to be optimized for its GC content for expression in plants and expressed under various promoter and terminator combinations to achieve optimal expression of \u003cem\u003ecry2Ac\u003c/em\u003e. Doing so will help evolve rice lines with insect resistance ability and in turn improve the productivity of rice.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRB was supported by Department of Biotechnology, Govt of India fellowship to carry out master\u0026rsquo;s in biotechnology at Tamil Nadu Agriculture University, India. We also acknowledge Dr. S. Robin. Dr. E. Kokiladevi. Dr. L. Arul, Dr. K.K. Kumar and Dr.N. Balakrishnan, and Dr. Safia Nayeem for their help in conducting this research programme. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFunding was not received for this research\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDepartment of Plant Molecular Biology and Biotechnology\u003c/p\u003e\n\u003cp\u003eCentre for Plant Molecular Biology and Biotechnology\u003c/p\u003e\n\u003cp\u003eTamil Nadu Agricultural University, Coimbatore, Tamil Nadu, India. 641003\u003c/p\u003e\n\u003cp\u003eRaviraj Banakar, Udayasuriyan V, Duraialagaraja Sudhakar\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDepartment of Biochemistry and Molecular Biology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eOklahoma State University, Stillwater, Oklahoma, USA, 74078\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRaviraj Banakar\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRB and DS designed experiments, VU provided plasmids pS2AcP7, RB and DS performed rice transformation, RB performed genotyping, insect bioassay and plant growth care. RB prepared draft of the manuscript, RB, and DS wrote Manuscript with inputs from co-authors.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Raviraj Banakar\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declaration\u003c/strong\u003e\u003c/p\u003e\n\u003ch3\u003eEthical approval\u003c/h3\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch3\u003eConsent to participate\u003c/h3\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch3\u003eConsent to publish\u003c/h3\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch3\u003eClinical trial number\u003c/h3\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch3\u003eCompeting interest\u003c/h3\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDual Publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eManuscript is not under consideration elsewhere\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the data generated is part of the manuscript, further queries can be made to corresponding author.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eTang K, Sun X, Hu Q, Wu A, Lin CH, Lin HJ, Twyman RM, Christou P, Feng T. (2001). Transgenic rice plants expressing the ferredoxin-like protein (AP1) from sweet pepper show enhanced resistance to \u003cem\u003eXanthomonas oryzae\u003c/em\u003e pv. \u003cem\u003eoryzae\u003c/em\u003e. \u003cem\u003ePlant Science, 160\u003c/em\u003e, 1035\u0026ndash;1042.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSen S, Chakraborty R, Kalita P. Rice\u0026mdash;Not just a staple food: A comprehensive review on its phytochemicals and therapeutic potential. Trends Food Sci Technol. 2020;97:265\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSamal P, Babu SC, Mondal B, Mishra NS. The global rice agriculture towards 2050: An inter-continental perspective. Outlook Agric. 2022;51:164\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGatehouse AMR. Biotechnological applications of plant genes in the production of insect resistant crops. In: Clement SL, Quisenberry SS, editors. Global plant genetic resources for insect resistant crops. CRC; 1999. pp. 263\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePathak MD, Khan ZR. Insect pests of rice. International Rice Research Institute; 1994.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSavary S, Willocquet L, Elazegui FA, Castilla NP, Teng PS. Rice pest constraints in tropical Asia: Quantification of yield losses due to rice pests in a range of production situations. Plant Dis. 2000;84:357\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuesing J, English L. The impact of Bt crops on the developing world. AgBioForum. 2004;7:84\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYambao EB, Ingrum KT, Rubia EG, Shepard BM. (1993). Case study: Growth and development of rice in response to artificial stem borer infestation. \u003cem\u003eIntercrop Protection (SARP Proceedings)\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShelton AM, Tang JD, Roush RT, Metz TD, Earle ED. Field tests on managing resistance to Bt-engineered plants. Nat Biotechnol. 2000;18:339\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePingali PL, Roger PA. Impact of pesticides on farmer health and the rice environment. International Rice Research Institute; 1995.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanahuja G, Banakar R, Twyman RM, Capell T, Christou P. Bacillus thuringiensis: A century of research, development and commercial applications. Plant Biotechnol J. 2011;9:283\u0026ndash;300.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrattiger AF. Insect resistance in crops: A case study of \u003cem\u003eBacillus thuringiensis\u003c/em\u003e (Bt) and its transfer to developing countries. ISAAA Briefs. 2nd ed. ISAAA; 1997. p. 42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchuler HT, Poppy GM, Denholm I. Insect resistant transgenic plants. Trends Biotechnol. 1998;16:168\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang ZH, Shu QY, Cui HR, Xia YW. The study of insect-resistant plants with \u003cem\u003eBacillus thuringiensis\u003c/em\u003e crystal protein genes. Chin Bull Bot. 1999;16:51\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFujimoto H, Itoh K, Yamamoto M, Kyozuka J, Shimamoto K. Insect resistant rice generated by introduction of a modified gene of \u003cem\u003eBacillus thuringiensis\u003c/em\u003e. Bio/Technology. 1993;11:1151\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNayak KP, Basu D, Das S, Basu A, Ghosh D, Ramakrishna NA, Ghosh M, Sen SK. (1997). Transgenic elite indica rice plants expressing CryIAc δ-endotoxin of \u003cem\u003eBacillus thuringiensis\u003c/em\u003e are resistant against yellow stem borer (\u003cem\u003eScirpophaga incertulas\u003c/em\u003e). \u003cem\u003eProceedings of the National Academy of Sciences of the USA, 94\u003c/em\u003e, 2111\u0026ndash;2116.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTu J, Ona I, Zhang Q, Mew TW, Khush GS, Datta SK. Transgenic rice variety IR72 with Xa21 is resistant to bacterial blight. Theor Appl Genet. 1998;97:31\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaqbool SB, Christou P. Multiple traits of agronomic importance in transgenic indica rice plants: Analysis of transgene integration patterns, expression levels and stability. Mol Breeding. 1999;5:471\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSambrook J, Fritsch EF, Maniatis T. Molecular cloning: A laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press; 1989.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWunn J, Kloti A, Burkhardt PK, Biswas GCG, Launis K, Iglesias K, Potrykus I. Transgenic indica rice breeding line IR58 expressing a synthetic cry1Ab gene from \u003cem\u003eBacillus thuringiensis\u003c/em\u003e provides effective insect pest control. Bio/Technology. 1996;14:171\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eISAAA. The first ten years: Global socio-economic and environmental impacts. ISAAA Brief No. 36; 2006.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChristou P, Ford TL, Kofron M. Production of transgenic rice (\u003cem\u003eOryza sativa\u003c/em\u003e L.) plants from agronomically important indica and japonica varieties via electric discharge particle acceleration of exogenous DNA into immature zygotic embryos. Bio/Technology. 1991;9:957\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSudhakar D, Duc LT, Bong BB, Tinjuangjun P, Maqbool SB, Valdez M, Jefferson R, Christou P. An efficient rice transformation system utilising mature seed-derived explants and a portable, inexpensive particle bombardment device. Transgenic Res. 1998;7:289\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValdez M, Cabrera-Ponce JL, Sudhakar D, Herrera-Estrella L, Christou P. Transgenic Central American, West African and Asian elite varieties resulting from particle bombardment of foreign DNA into mature seed-derived explants using three different bombardment devices. Ann Botany. 1998;82:795\u0026ndash;801.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBanakar R, Fernandez AA, Diaz-Benito P, Abadia J, Capell T, Christou P. Phytosiderophores determine thresholds for iron and zinc accumulation in biofortified rice endosperm while inhibiting the accumulation of cadmium. J Exp Bot. 2017;68:4983\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBanakar R, Eggenberger AL, Lee K, Wright DA, Murugan K, Zarecor S, Lawrence-Dill CJ, Sashital DG, Wang K. High-frequency random DNA insertions upon co-delivery of CRISPR-Cas9 ribonucleoprotein and selectable marker plasmid in rice. Sci Rep. 2019;9:1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBashir K, Husnain T, Fatima T, Latif Z, Mehdi SA, Riazuddin S. Field evaluation and risk assessment of transgenic indica basmati rice. Mol Breeding. 2004;13:301\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Nannas NJ, Fu F, Shi J, Aspinwall B, Parrott WA, et al. Genome-scale sequence disruption following biolistic transformation in rice and maize. Plant Cell. 2019;31:368\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi S, Wen N, Lv W, Zhang M, Wang Y, Lang Z. Impact of codon optimization on vip3Aa11 gene expression and insecticidal efficacy in maize. Front Plant Sci. 2025;16:1579465.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Li S, Lang Z, Zhang J, Zhu L, Huang D. Chloroplast-targeted expression of the codon-optimized truncated cry1Ah gene in transgenic tobacco confers a high level of protection against insect pests. Plant Cell Rep. 2013;32:1299\u0026ndash;308.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTyagi S, Kabade PG, Gnanapragasam N, Singh UM, Gurjar AKS, Rai A, Sinha P, Kumar A, Singh VK. Codon usage provides insights into the adaptation of rice genes under stress condition. Int J Mol Sci. 2023;24(2):1098. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms24021098\u003c/span\u003e\u003cspan address=\"10.3390/ijms24021098\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao D, Hamilton JP, Hardigan M, Yin D, He T, Vaillancourt B, Reynoso M, Pauluzzi G, Funkhouser S, Cui Y, Bailey-Serres J, Jiang J, Buell CR, Jiang N. (2017). Analysis of ribosome-associated mRNAs in rice reveals the importance of transcript size and GC content in translation. \u003cem\u003eG3: Genes, Genomes, Genetics, 7\u003c/em\u003e(1), 203\u0026ndash;219. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1534/g3.116.036020\u003c/span\u003e\u003cspan address=\"10.1534/g3.116.036020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoul B, Yadav R, Sanyal I, Amla DV. Comparative performance of modified full-length and truncated \u003cem\u003eBacillus thuringiensis\u003c/em\u003e cry1Ac genes in transgenic tomato. SpringerPlus. 2015;4:203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s40064-015-0991-x\u003c/span\u003e\u003cspan address=\"10.1186/s40064-015-0991-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrizhov N, Keller M, Mathur J, Koncz-K\u0026aacute;lm\u0026aacute;n Z, Bosch D, Prudovsky E, Schell J, Sneh B, Koncz C, Zilberstein A. (1996). A synthetic cryIC gene, encoding a \u003cem\u003eBacillus thuringiensis\u003c/em\u003e delta-endotoxin, confers \u003cem\u003eSpodoptera\u003c/em\u003e resistance in alfalfa and tobacco. \u003cem\u003eProceedings of the National Academy of Sciences of the USA, 93\u003c/em\u003e(26), 15012\u0026ndash;15017. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.93.26.15012\u003c/span\u003e\u003cspan address=\"10.1073/pnas.93.26.15012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 and 2 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"discover-plants","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Plants](https://link.springer.com/journal/44372)","snPcode":"44372","submissionUrl":"https://submission.springernature.com/new-submission/44372/3","title":"Discover Plants","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Bacillus thuringienesis, rice, Cry2Ac, insect resistance, codon optimization, transformation","lastPublishedDoi":"10.21203/rs.3.rs-9131602/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9131602/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCrystal proteins from \u003cem\u003eBacillus thuringiensis\u003c/em\u003e (\u003cem\u003eBt\u003c/em\u003e) have potential insecticidal properties. Heterologous expression of genes encoding Cry proteins in plants can impart resistance to insects, thus, providing a sustainable and cost-effective solution for insect pest management. Therefore, we have transformed popular elite \u003cem\u003eindica\u003c/em\u003e rice cultivar ASD16 with a construct harbouring a \u003cem\u003ecry2Ac\u003c/em\u003e gene driven by constitutive \u003cem\u003eCaMV35S\u003c/em\u003e promoter, selectable marker hygromycin phosphotransferase (\u003cem\u003ehpt\u003c/em\u003e) gene and scorable marker \u003cem\u003egusA\u003c/em\u003e gene. A total of ninety-nine independent putative transgenic plants were regenerated with the transformation frequency ranging between 5 and 38%. Sixty six out of 70 putative transformants tested for the presence of \u003cem\u003ecry2Ac\u003c/em\u003e gene by PCR were found to be positive. However, when the plants were subjected to insect bioassay, none of them showed insect mortality. This could possibly be due to undetectable level of expression of \u003cem\u003ecry2Ac\u003c/em\u003e gene which may require optimization of GC content and use of suitable promoters to drive the expression of transgenes.\u003c/p\u003e","manuscriptTitle":"Genetic engineering of elite indica rice with cry2Ac gene to impart insect resistance","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-23 16:55:54","doi":"10.21203/rs.3.rs-9131602/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-25T04:05:23+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-18T03:58:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-18T03:57:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Discover Plants","date":"2026-03-16T00:12:08+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"discover-plants","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Plants](https://link.springer.com/journal/44372)","snPcode":"44372","submissionUrl":"https://submission.springernature.com/new-submission/44372/3","title":"Discover Plants","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b47a12c6-252f-4504-b06e-755e34d2ed71","owner":[],"postedDate":"March 23rd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-04T22:53:13+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-23 16:55:54","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9131602","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9131602","identity":"rs-9131602","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.