X gene mutations of Hepatitis B virus and impact on chronic hepatitis B infection in CHB three-generations in the family

X gene mutations of Hepatitis B virus and impact on chronic hepatitis B infection in CHB three-generations in the family | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article X gene mutations of Hepatitis B virus and impact on chronic hepatitis B infection in CHB three-generations in the family Malihe naderi, Seyed Masoud Hosseini, Naser Behnampour, Iraj Shahramian, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3403899/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This study focused on detecting mutational patterns in the X-gene of the HBV genome in three-generations of CHB patients. Ninety CHB patients were analyzed, revealing the highest similarity in X-gene sequences between mothers and children in two-generations (79.3%). The N-terminal of the X-gene showed frequent mutations, with notable occurrences at positions C1491G (25%), C1500T (43.4%), G1613T (23.9%), and G1658T (33.4%). Mutations were more prevalent in HBeAg-negative patients, indicating a significant difference ( P-value = 0.03 ). A1762T/G1764A mutations were present in 15.6% of patients, demonstrating significant relevance. These mutational patterns may aid in predicting clinical outcomes and identifying susceptibility to hepatocellular HCC in patients. Figures Figure 1 Introduction HBV is a primary etiological agent for hepatitis on a global scale [ 1 ], with chronic cases leading to end-stage liver diseases like HCC and cirrhosis [ 2 , 3 ]. The prevalence of HBV infection among the Iranian population is approximately 3%, and the progression of related liver disease is influenced by host, viral, and environmental factors [ 4 ]. Mutations in the virus genome, play an important role in the exacerbation of infection [ 5 ]. Some genomic regions, such as the pre-core/BCP, direct repetition sequences, and enhancer II, can interact with the HBV X-gene [ 6 ]. The HBX protein, acts as a versatile non-structural protein with transcriptional transactivator capabilities, influencing both cellular and viral promoters [ 7 ]. It serves as a multifaceted oncoprotein linked to HCC in chronic HBV patients [ 8 ]. Genetic variations in the X-gene , including mutations and genotypic-specific changes during chronic infection [ 9 ], can impact not only the amino acid sequence but also influence other genes and alter HBV expression [ 10 ]. The mutations in the X-gene have broader implications, affecting the physiological functions of the protein and its involvement in biological mechanisms like transcription, signal transduction, apoptosis, and cell proliferation, ultimately influencing disease progression [ 11 , 12 ]. The HBX protein also has the potential to increase a cellular environment conducive to HBV replication by activating host genes associated with inflammation and cell proliferation [ 13 ]. Specific mutations such as C1653T, AG1762/1764TA, T1753C, C1485T, G1613A, and A1383C have been linked to HCC survival, though their functional consequences are unclear [ 14 ]. The presence of the no synonymous mutation C1653T in the EnH II region may modify binding affinity, leading to amino acid substitution in the HBx protein. These alterations are associated with poorer outcomes in HCC [ 15 ]. The double mutation K130M + V131I in the HBx gene increases with liver disease progression [ 16 ], potentially contributing to HCC by stimulating NF-κB activity [ 17 ]. Building upon prior research on mutations in the S gene of HBV in three-generations of CHB patients [ 18 ], the current study focuses on identifying and analyzing X-gene mutational patterns across in CHB patients. Materials and methods According to previous study and in accordance with the inclusion and exclusion criteria [ 18 ], Serum samples were collected from the patients, and after measuring the LFT to study mutations in the X gene, were utilized. Extraction of HBV DNA and Semi-Nested PCR HBV-DNA was extracted from 200µL of serum according to the instructions provided by the manufacturer. The amplification of HBV sequences covering nucleotides 1365–2078 (F1/R1 primers). In the second round, a 713 bp template was used to amplify nucleotides 1365–1881 (F1/R2 primers) [Table 1] [ 19 , 20 ]. DNA Sequencing and mutation analysis According to previous study, the process of identifying mutations and performing analysis included the alignment of nucleotide sequences with the standard sequence of HBV, was done [ 3 , 18 ]. Results The current research examined the HBx gene by sequencing 90 samples from CHB patients [Accession numbers: ON346437-ON346526]. Compared to other groups, the findings of LFT of the three-generation group showed a significant proportion of people with high levels. The study revealed that in the two-generation and intra-familial groups, LFT were generally elevated in HBeAg-positive patients. Within the three-generation group, no statistically significant correlation was observed in terms of the levels of liver enzymes, gender ( P-Value = 0.5 ), and age ( P-Value = 0.06 ) [Table 2 ]. When the sequences of the HBV genome isolated from CHB patients were compared with the reference sequence, it was found that 9.47% of CHB patients didn’t have a mutation in the X-gene ( 3.4%, 15% and 10% in three groups, respectively). The findings of the sequence analysis performed on patients showed that the X-gene has the highest degree of similarity (79.3%) and the lowest mutation rate (20.7%) in mothers and children. The present study identified the co-occurrence of A1762T/G1764A mutations (15.6% in whole of CHB patients) was 6.7% in the three-generation, 20% in the two-generation, and 20% in the intra-familial groups. The statistical analysis exhibited a significant difference ( P-Value = 0.03 ) in the co-occurrence of G1764A/A1762T mutations across three distinct groups. Simultaneous observation of C1766G/G1764T mutations was noted in 13.4%, 15%, and 10% of CHB patients in three groups (P-Value = 0.4). The presence of T1464C was detected in 30% of CHB patients, with a higher prevalence in intra-familial group (35%) compared with two-generation (25%) and three-generation (33.4%) groups (P-Value = 0.02). In addition, G1479A/C1481T double mutation was detected in 6.7%, 10%, and 15% of CHB patients in three-generation, two-generation, and intra-familial groups, respectively (P-Value = 0.04). In addition, the C1500T point mutation was found in 40% of CHB patients, with the highest frequency in the three-generation group (43.4%) compared to the other two groups (P-Value = 0.03) . The three-generation CHB group had significantly higher A1635T (46.7%) and A1635G (20%) point mutations than the other two groups ( P-Value = 0.01, P-Value = 0.04 , respectively). It should be noted that there was no statistically significant relationship between the HBx mutation and increased LFT or age ( P-Value = 0.1 ) [Figure 1]. There were silent mutation A1727G (10% and 20%, respectively) and missense mutation A1727T (30% and 27.5%, respectively) in the HBV DNA sequence of the three-generation and two-generation groups ( P-Value = 0.04, P-Value = 0.03 , respectively). The presence of a triplet mutation, A1762T/G1764A/C1773T, was observed in 12.5% of patients. The study identified additional triplet mutations, specifically C1812T/C1813T /A1814T, which exhibited a lower prevalence of 5% and 1% in the two generations and intra-familial groups, respectively. Mutations were observed with high frequency in groups; however, no statistically significant difference was detected ( P-Value = 0.3 ). The B-cell epitope of HBx protein (aa 26–48) exhibited two mutations, namely C1491G and C1500T. In the two- and three-generation groups, the frequency of these mutations was observed at 25% and 43.4% respectively. The three-generation group also exhibited the highest frequency of mutations (33.4%) in comparison to other groups. The G1613T mutation was observed in 23.9% of population studied [Figure 1], which resulted in the substitution of Glu80 with Asp. Mutations were observed with comparable frequency in both groups; however, the statistical analysis did not reveal any significant difference ( P-Value = 0.2 ). Based on the findings shown in Fig. 1, A1633G (43.4%), C1500T (43.4%), and A1635T (46.7%), mutations had the highest frequency in the three-generation group compared to the other two groups. The rate of mutation occurrence was relatively higher in patients with HBeAg negative ( P-Value = 0.03 ). Discussion Detection of HBx in patients with HCC is a well-known phenomenon that is often associated with the presence of mutations that could contribute to the development of HBV infection [ 19 , 20 ]. HBx proteins lack the C domain, which is essential for the suppressive effects of HBx on cell proliferation, cell growth, transactivation activity, and transformation. However, these proteins inhibit p53-mediated apoptosis and thus contribute to the development of HCC [ 21 , 22 ]. 2.9% of CHB cases were discovered to have deletions or insertions totaling 8bp in the C-terminus of HBx from the cirrhotic group. In addition, 15 distinct deletions, 1762–1768, 1763–1770, 1769–1773, and T1771/A1775, were identified in cirrhotic patients [ 23 ]. In contrast to the above research, it was observed that CHB patients didn’t show any deletion-related mutations, except for C1773T that this particular mutation had 20% frequency in the two-generation group. Our findings are consistent with recent studies [ 23 , 24 ], showing that HBeAg-negative patients are more likely to have deletion and insertion mutations in the C-terminus of HBx . In a separate study, it has been observed that the occurrence of A1762T/G1764A mutation in the C-terminal overlap region of the X-gene with BCP results in the disease progression from the chronic stage to cirrhosis. This is attributed to a change in the amino acid sequence of protein X . Salarnia et al. , demonstrated that the incidence A1762T/G1764A mutation, was higher in individuals with cirrhosis in comparison to those with CHB. The presence of this genetic mutation plays a significant role in the advancement of liver disease toward more critical phases [ 5 ]. Our results are in line with those of many previous studies, Chen et al. [ 16 ], Vazjalali et al. , and Maleki et al. [ 25 , 26 ], who have shown that increased frequency of A1762T/G1764A mutations accelerates disease progression. According to the results of our research, this mutation is more frequent in HBeAg-negative in the two-generation patient. A study carried out by Salarnia et al . identified new mutations within the HBx gene. The N-terminal region, Box α, Enhancer II, and Core promoter of the X-gene have been reported to exhibit various mutations, including C1500T, C1491G, G1658T, and G1613T [ 7 ]. Consistent with the aforementioned investigation, novel mutations were detected in patients. The three-generation group exhibited the highest frequency percentage, with A1635T, A1633G, C1500T, and C1491G mutations being the most commonly reported. The A1635T mutation results (Isoleucine Phenylalanine) in the HBx protein sequence (aa 88-100), which leads to an interaction with the DNA damage binding complex-1, that due to the overlap between NRE and HBx coding sequences. A study by Ghosh et al . showed a higher incidence of A1635T among subjects with cirrhosis (53.85%) compared to subjects with chronic, inactive HBV carriers [27]. Contrary to our findings, this mutation was observed in patients, in the three-generation group. It has been newly documented in several studies that A1727T mutation is a novel predictive marker of the cirrhosis stage among HBV-infected patients [ 7 , 28 ]. Patients with cirrhosis have been found to have a higher incidence of the A1727G mutation, which has been linked to a higher chance of HCC [ 29 ]. The majority of TA1 mutations occur in 1750-1755nt, and this area of the gene has been identified as a potential predictor of HCC [ 30 ]. It was also shown that the T1753C mutation is a potential marker for cirrhosis severity and also it is associated with severe liver disease [ 31 ]. In agreement with the aforementioned mutation studies, we found that the A1727G mutation was present in CHB cases and a statistically significant difference was found between these three groups. The T1753C mutation, an important predictor of the cirrhotic stage, was found with high prevalence in two-generation group. It has been found that specific patterns of HBx mutations can be used as early markers of increased risk of HCC and to predict the clinical outcome of HBV-infected patients. Prior research, exemplified by Xiao et al ., has demonstrated that mutations in the X-region tend to arise during the advanced phases of chronic HBV infection, resulting in serious liver disorders, such as HCC and cirrhosis [ 32 ]. The findings of the current investigation indicate that CHB patients exhibit significant occurrences of double mutations C1481T/G1479A, as well as point mutations A1635T, T1464C, and C1500T. The presence of triple mutations, specifically A1762T/G1764A/C1773T and C1812/C1813T/A1814T, was observed in three groups. C1481T/G1479A mutations were detected in three groups, and a higher prevalence was observed in the two generations and intrafamilial groups. In addition, mothers showed a higher frequency of these mutations compared to their children and grandmothers. In conclusion, the identification and correlation analysis of genomic mutations with clinical complications are crucial for disease management, prognosis, and treatment. These mutations can be utilized for screening high-risk individuals for liver disease, improving diagnostic methods, and refining therapeutic approaches. Additionally, investigating the impact of A1762T/G1764A mutations on different phases of HBV infection, such as HCC, is recommended. Declarations Acknowledgments The present study was derived from a research project for completion of Ph.D. course Shahid Beheshti University and Golestan University of Medical Sciences. Authors' Contribution A.M, S.M.H, I.SH, S.B contributed to study conception. A.M, N.B, M.N contributed to data analysis. M.N performing the experiments. A.M, S.M.H, M.N; Revision: A.M, M.N Reading and confirming the final version of the manuscript. Funding This research received no specific grant during the preparation of this manuscript. Data availability The nucleotide sequences of HBx gene to identify mutations in 90 CHB patient samples in this study were deposited in the GenBank database under accession numbers ON346437 - ON346526. Competing interest statement The authors declare no conflicts of interest. Ethical approval The ethical committee of Golestan University of Medical Sciences granted approval for the study [IR. GOUMS.REC.1399.105]. References Gong DY, Chen EQ, Huang FJ, Leng XH, Cheng X, Tang H (2013) Role and functional domain of hepatitis B virus X protein in regulating HBV transcription and replication in vitro and in vivo. Viruses 5(5): 1261-71. Al-Qahtani AA, Al-Anazi MR, Nazir N, Ghai R, Abdo AA, Sanai FM et al (2017) Hepatitis B virus (HBV) X gene mutations and their association with liver disease progression in HBV-infected patients. Oncotarget 8(62): 105115-105125. Naderi M, Hosseini SM, Besharat S, Behnampour N, Shahramian I, Moradi A (2023) Clinical and virological aspects of core and pre-core mutations in three generations of chronic hepatitis B virus patients. Future Virol. 18(6). Azad AR, Zargar M, Zolfaghari MR, Mohammadbeigi A (2020) The Prevalence of Hepatitis B and D Viruses and Evaluating YMDD Mutation in HBV-Suspected Patients in Qom Province, Iran. Jundishapur J Microbiol 13(2): e100038. Salarnia F, Zhand S, Khodabakhshi B, Tabarraei A, Vakili MA, Javid N, Bazori M, Moradi A (2016) Mutations at Nucleotide 1762, 1764 and 1766 of Hepatitis B Virus X Gene in Patients with Chronic Hepatitis B and Hepatitis B-Related Cirrhosis. Mljgoums 10(1): 31-35. Datta S, Chatterjee S, Veer V, Chakravarty R (2012) Molecular biology of the hepatitis B virus for clinicians. J Clin Exp Hepatol 2(4): 353-65. Salarnia F, Behboudi E, Shahramian I, Moradi A (2022) Novel X gene point mutations in chronic hepatitis B and HBV related cirrhotic patients. Infect Genet Evol 97: 105186. Schollmeier A, Glitscher M, Hildt E (2023) Relevance of HBx for Hepatitis B Virus-Associated Pathogenesis. Int J Mol Sci 24: 4964. Song BC, Cui XJ, Kim HU, Cho YK (2006) Sequential accumulation of the basal core promoter and the precore mutations in the progression of hepatitis B virus-related chronic liver disease. Intervirology 49(5): 266-73. Kreutz C (2002) Molecular, immunological and clinical properties of mutated hepatitis B viruses. J Cell Mol Med 6(1): 113-43. Datta S, Banerjee A, Chandra PK, Biswas A, Panigrahi R, Mahapatra PK et al (2008) Analysis of hepatitis B virus X gene phylogeny, genetic variability and its impact on pathogenesis: implications in Eastern Indian HBV carriers. Virology 382: 190–198. Zhang X, Ding HG (2015) Key role of hepatitis B virus mutation in chronic hepatitis B development to hepatocellular carcinoma. World J Hepatol 7(9): 1282-6. Lee S, Mun HS, Kim H, Lee HK, Kim BJ, Hwang ES et al (2011) Naturally occurring hepatitis B virus X deletions and insertions among Korean chronic patients. J Med Virol 83(1): 65-70. Zhang C, Xie Y, Lai R, Wu J, Guo Z (2022) Nonsynonymous C1653T Mutation of Hepatitis B Virus X Gene Enhances Malignancy of Hepatocellular Carcinoma Cells. J Hepatocell Carcinoma 9: 367-377. Li SK, Ho SF, Tsui KW, Fung KP, Waye MY (2008) Identification of functionally important amino acid residues in the mitochondria targeting sequence of hepatitis B virus X protein. Virology 381(1): 81-8. Chen CH, Lee CM, Lu SN, Changchien CS, Eng HL, Huang CM et al (2005) Clinical significance of hepatitis B virus (HBV) genotypes and precore and core promoter mutations affecting HBV e antigen expression in Taiwan. J Clin Microbiol 43(12): 6000-6. Lee JH, Han KH, Lee JM, Park JH, Kim HS (2011) Impact of hepatitis B virus (HBV) x gene mutations on hepatocellular carcinoma development in chronic HBV infection. Clin Vaccine Immunol 18(6): 914-21. Naderi M, Hosseini SM, Behnampour N, Shahramian I, Moradi A (2023) Mutations in the S gene of hepatitis B virus in three generations of patients with chronic hepatitis B. Virus Genes 59(5): 662-669. Lazarevic I (2014) Clinical implications of hepatitis B virus mutations: recent advances. World J Gastroenterol 20(24): 7653-64. Bouchard MJ, Schneider RJ (2004) The enigmatic X gene of hepatitis B virus. J Virol 78: 12725–34. Mukherji A, Janbandhu VC, Kumar V (2007) HBx-dependent cell cycle deregulation involves interaction with cyclin E/A-cdk2 complex and destabilization of p27Kip1. Biochem J 401(1): 247-56. Ma NF, Lau SH, Hu L, Xie D, Wu J, Yang J et al (2008) COOH-terminal truncated HBV X protein plays key role in hepatocarcinogenesis. Clin Cancer Res 14(16): 5061-8. Salarnia F, Besharat S, Zhand S, Javid N, Khodabakhshi B, Moradi A (2017) Mutations in Hepatitis-B X-Gene Region: Chronic Hepatitis-B versus Cirrhosis. J Clin Diagn Res 11(3): OC31-OC34. Fujiwara K, Tanaka Y, Paulon E, Orito E, Sugiyama M, Ito K et al (2005) Novel type of hepatitis B virus mutation: replacement mutation involving a hepatocyte nuclear factor 1 binding site tandem repeat in chronic hepatitis B virus genotype E. J Virol 79(22): 14404-10. Vaezjalali M, Rezaee H, Goudarzi H (2013) HBV S Gene Premature Stop Codon in Strains from Middle Eastern Patients. Arch Clin Infect Dis 8(1): 3-7. Malik A, Singhal DK, Albanyan A, Husain SA, Kar P (2012) Hepatitis B virus gene mutations in liver diseases: a report from New Delhi. PLoS One 7(6): e39028. Ghosh S, Mondal RK, Banerjee P, Nandi M, Sarkar S, Das K et al (2012) Tracking the naturally occurring mutations across the full-length genome of hepatitis B virus of genotype D in different phases of chronic e-antigen-negative infection. Clin Microbiol Infect 18(10): E412-8. Yin J, Xie J, Liu S, Zhang H, Han L, Lu W et al (2011) Association between the various mutations in viral core promoter region to different stages of hepatitis B, ranging of asymptomatic carrier state to hepatocellular carcinoma. Am J Gastroenterol 106(1): 81-92. Khan A, Al Balwi MA, Tanaka Y, Hajeer A, Sanai FM, Al Abdulkarim I et al (2013) Novel point mutations and mutational complexes in the enhancer II, core promoter and precore regions of hepatitis B virus genotype D1 associated with hepatocellular carcinoma in Saudi Arabia. Int J Cancer 133(12): 2864-71. Lee D, Lyu H, Chung YH, Kim JA, Mathews P, Jaffee E et al (2016) Genomic change in hepatitis B virus associated with development of hepatocellular carcinoma. World J Gastroenterol 22(23): 5393-9. Biswas A, Banerjee A, Chandra PK, Datta S, Panigrahi R, Dutta D et al (2011) Variations in the functional domain of basal core promoter of hepatitis B virus among Eastern Indian patients with prevalence of genotypes A, C, and D among the same ethnic population. J Med Virol 83(2): 253-60. Xiao L, Zhou B, Gao H, Ma S, Yang G, Xu M et al (2011) Hepatitis B virus genotype B with G1896A and A1762T/G1764A mutations is associated with hepatitis B related acute-on-chronic liver failure. J Med Virol 83(9): 1544-50. Tables Table. [1]: Oligonucleotide primers used for semi-nested PCR and sequencing of X-region of hepatitis B [19, 20]. Primer name Sequence (5' to 3') Target sequence PCR program F1 ATCGTATCCATGGCTGCTAGGCT 1365-1387 Step 1: 94°C 5 min, 35 cycles (94°C 1 min, 55°C 1 min and 72°C 1 min), 72°C 7 min. Step 2: 94°C 5 min, 35 cycles (94°C 30 Sec, 57.5°C 30 Sec and 72°C 45 Sec), 72°C 5 min. R1 CAGAATAGCTTGCCTGAGTGC 2058-2078 R2 CACAGCTTGGAGGCTTGAACA 1881-1861 Table 2 . Main characteristics of chronic HBV patients in three groups. Basic characteristics Three generations Two generations Intrafamilial members Age (Mean±SD) 45.23± 22.8 35.83±17.7 35.5±15.2 Gender (N) Male Female 4 26 11 29 8 12 HBe-Ag (N) + - 0 30 7 33 33 7 Anti-HBe (N) + - 30 0 4 16 16 4 ALT (IU/L) (Mean±SD) 24.6 ± 14.37 24 ± 8.9 22 ± 7.9 AST (IU/L) (Mean±SD) 25.46 ± 13.67 26 ± 11.2 23.3 ± 10.2 ALP (IU/L) (Mean±SD) 419.567 ± 259.78 464.75 ± 274.1 337.6 ± 172.2 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3403899","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":277104083,"identity":"085e5361-b8ab-4174-a97d-8cfe48ffb3b3","order_by":0,"name":"Malihe naderi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYNACNiBib2CDcJiJ1sJzgFQtDBIJbMQ5Sbf9ANuDH2U2+XySz5895mGwk2dg532AV4vZmQR2w55zaZZt0jnmxjwMyYYNzOwG+LUcSGCT4G07bMAmncMmzcPAnMDATMCBZucfsEn+bftvwCZ5/BlQSz0RWm4ksEnzth0wYJNgMANqOUyMlgds0jLnkg3YeHLMDecYHDdsI+ywBDbJN2V2BvLtx589eFNRLc/Pfwy/FgYG/g9IHANIHI2CUTAKRsEooBAAAFm+MtoRprunAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-3723-4340","institution":"Shahid Beheshti University","correspondingAuthor":true,"prefix":"","firstName":"Malihe","middleName":"","lastName":"naderi","suffix":""},{"id":277104084,"identity":"1264fa88-5edd-458d-96d2-af17bee19120","order_by":1,"name":"Seyed Masoud Hosseini","email":"","orcid":"","institution":"Shahid Beheshti University","correspondingAuthor":false,"prefix":"","firstName":"Seyed","middleName":"Masoud","lastName":"Hosseini","suffix":""},{"id":277104085,"identity":"1b91e8fc-f435-4eeb-902a-78bd2c9b6510","order_by":2,"name":"Naser Behnampour","email":"","orcid":"","institution":"Golestan University of Medical Sciences and Health Services School of Health and Paramedicine","correspondingAuthor":false,"prefix":"","firstName":"Naser","middleName":"","lastName":"Behnampour","suffix":""},{"id":277104086,"identity":"b9cb57d1-1c7e-49a3-96ac-bef8b417f35f","order_by":3,"name":"Iraj Shahramian","email":"","orcid":"","institution":"Shiraz University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Iraj","middleName":"","lastName":"Shahramian","suffix":""},{"id":277104087,"identity":"bef45e01-76d1-48b0-bbdc-b220d7392e03","order_by":4,"name":"Abdolvahab Moradi","email":"","orcid":"https://orcid.org/0000-0003-2877-4190","institution":"Golestan University of Medical Sciences and Health Services School of Health and Paramedicine","correspondingAuthor":false,"prefix":"","firstName":"Abdolvahab","middleName":"","lastName":"Moradi","suffix":""}],"badges":[],"createdAt":"2023-10-02 06:02:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3403899/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3403899/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52525308,"identity":"05f06f94-8bcc-4d68-8bb9-7a0e5c43f76e","added_by":"auto","created_at":"2024-03-12 15:45:33","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":164783,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe frequency of nucleotide points mutations in the X gene in CHB patients.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3403899/v1/462d9861aeb317a5a845ee5d.jpg"},{"id":54487970,"identity":"453d4b82-9446-4378-868f-d23ccf3fda70","added_by":"auto","created_at":"2024-04-11 09:36:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":375705,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3403899/v1/7f01c59a-8ce0-455c-a642-48509888eb4e.pdf"}],"financialInterests":"","formattedTitle":"X gene mutations of Hepatitis B virus and impact on chronic hepatitis B infection in CHB three-generations in the family","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHBV is a primary etiological agent for hepatitis on a global scale [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], with chronic cases leading to end-stage liver diseases like HCC and cirrhosis [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The prevalence of HBV infection among the Iranian population is approximately 3%, and the progression of related liver disease is influenced by host, viral, and environmental factors [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMutations in the virus genome, play an important role in the exacerbation of infection [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Some genomic regions, such as the pre-core/BCP, direct repetition sequences, and enhancer II, can interact with the HBV \u003cem\u003eX-gene\u003c/em\u003e [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The \u003cem\u003eHBX\u003c/em\u003e protein, acts as a versatile non-structural protein with transcriptional transactivator capabilities, influencing both cellular and viral promoters [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. It serves as a multifaceted oncoprotein linked to HCC in chronic HBV patients [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Genetic variations in the \u003cem\u003eX-gene\u003c/em\u003e, including mutations and genotypic-specific changes during chronic infection [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], can impact not only the amino acid sequence but also influence other genes and alter HBV expression [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The mutations in the \u003cem\u003eX-gene\u003c/em\u003e have broader implications, affecting the physiological functions of the protein and its involvement in biological mechanisms like transcription, signal transduction, apoptosis, and cell proliferation, ultimately influencing disease progression [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The \u003cem\u003eHBX\u003c/em\u003e protein also has the potential to increase a cellular environment conducive to HBV replication by activating host genes associated with inflammation and cell proliferation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSpecific mutations such as C1653T, AG1762/1764TA, T1753C, C1485T, G1613A, and A1383C have been linked to HCC survival, though their functional consequences are unclear [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The presence of the no synonymous mutation C1653T in the EnH II region may modify binding affinity, leading to amino acid substitution in the \u003cem\u003eHBx\u003c/em\u003e protein. These alterations are associated with poorer outcomes in HCC [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe double mutation K130M\u0026thinsp;+\u0026thinsp;V131I in the HBx gene increases with liver disease progression [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], potentially contributing to HCC by stimulating NF-κB activity [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Building upon prior research on mutations in the S gene of HBV in three-generations of CHB patients [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], the current study focuses on identifying and analyzing X-gene mutational patterns across in CHB patients.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eAccording to previous study and in accordance with the inclusion and exclusion criteria [\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e], Serum samples were collected from the patients, and after measuring the LFT to study mutations in the X gene, were utilized.\u003c/p\u003e\n\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eExtraction of HBV DNA and Semi-Nested PCR\u003c/h2\u003e\n\u003cp\u003eHBV-DNA was extracted from 200\u0026micro;L of serum according to the instructions provided by the manufacturer. The amplification of HBV sequences covering nucleotides 1365\u0026ndash;2078 (F1/R1 primers). In the second round, a 713 bp template was used to amplify nucleotides 1365\u0026ndash;1881 (F1/R2 primers) [Table\u0026nbsp;1] [\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003eDNA Sequencing and mutation analysis\u003c/h2\u003e\n\u003cp\u003eAccording to previous study, the process of identifying mutations and performing analysis included the alignment of nucleotide sequences with the standard sequence of HBV, was done [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eThe current research examined the HBx gene by sequencing 90 samples from CHB patients [Accession numbers: ON346437-ON346526]. Compared to other groups, the findings of LFT of the three-generation group showed a significant proportion of people with high levels. The study revealed that in the two-generation and intra-familial groups, LFT were generally elevated in HBeAg-positive patients. Within the three-generation group, no statistically significant correlation was observed in terms of the levels of liver enzymes, gender (\u003cem\u003eP-Value\u0026thinsp;=\u0026thinsp;0.5\u003c/em\u003e), and age (\u003cem\u003eP-Value\u0026thinsp;=\u0026thinsp;0.06\u003c/em\u003e) [Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eWhen the sequences of the HBV genome isolated from CHB patients were compared with the reference sequence, it was found that 9.47% of CHB patients didn\u0026rsquo;t have a mutation in the \u003cem\u003eX-gene (\u003c/em\u003e3.4%, 15% and 10% in three groups, respectively). The findings of the sequence analysis performed on patients showed that the \u003cem\u003eX-gene\u003c/em\u003e has the highest degree of similarity (79.3%) and the lowest mutation rate (20.7%) in mothers and children. The present study identified the co-occurrence of A1762T/G1764A mutations (15.6% in whole of CHB patients) was 6.7% in the three-generation, 20% in the two-generation, and 20% in the intra-familial groups. The statistical analysis exhibited a significant difference (\u003cem\u003eP-Value\u0026thinsp;=\u0026thinsp;0.03\u003c/em\u003e) in the co-occurrence of G1764A/A1762T mutations across three distinct groups. Simultaneous observation of C1766G/G1764T mutations was noted in 13.4%, 15%, and 10% of CHB patients in three groups \u003cem\u003e(P-Value\u0026thinsp;=\u0026thinsp;0.4).\u003c/em\u003e The presence of T1464C was detected in 30% of CHB patients, with a higher prevalence in intra-familial group (35%) compared with two-generation (25%) and three-generation (33.4%) groups \u003cem\u003e(P-Value\u0026thinsp;=\u0026thinsp;0.02).\u003c/em\u003e In addition, G1479A/C1481T double mutation was detected in 6.7%, 10%, and 15% of CHB patients in three-generation, two-generation, and intra-familial groups, respectively \u003cem\u003e(P-Value\u0026thinsp;=\u0026thinsp;0.04).\u003c/em\u003e In addition, the C1500T point mutation was found in 40% of CHB patients, with the highest frequency in the three-generation group (43.4%) compared to the other two groups \u003cem\u003e(P-Value\u0026thinsp;=\u0026thinsp;0.03)\u003c/em\u003e. The three-generation CHB group had significantly higher A1635T (46.7%) and A1635G (20%) point mutations than the other two groups (\u003cem\u003eP-Value\u0026thinsp;=\u0026thinsp;0.01, P-Value\u0026thinsp;=\u0026thinsp;0.04\u003c/em\u003e, respectively). It should be noted that there was no statistically significant relationship between the HBx mutation and increased LFT or age (\u003cem\u003eP-Value\u0026thinsp;=\u0026thinsp;0.1\u003c/em\u003e) [Figure 1].\u003c/p\u003e\n\u003cp\u003eThere were silent mutation A1727G (10% and 20%, respectively) and missense mutation A1727T (30% and 27.5%, respectively) in the HBV DNA sequence of the three-generation and two-generation groups (\u003cem\u003eP-Value\u0026thinsp;=\u0026thinsp;0.04, P-Value\u0026thinsp;=\u0026thinsp;0.03\u003c/em\u003e, respectively). The presence of a triplet mutation, A1762T/G1764A/C1773T, was observed in 12.5% of patients. The study identified additional triplet mutations, specifically C1812T/C1813T /A1814T, which exhibited a lower prevalence of 5% and 1% in the two generations and intra-familial groups, respectively. Mutations were observed with high frequency in groups; however, no statistically significant difference was detected (\u003cem\u003eP-Value\u0026thinsp;=\u0026thinsp;0.3\u003c/em\u003e). The B-cell epitope of \u003cem\u003eHBx\u003c/em\u003e protein (aa 26\u0026ndash;48) exhibited two mutations, namely C1491G and C1500T. In the two- and three-generation groups, the frequency of these mutations was observed at 25% and 43.4% respectively. The three-generation group also exhibited the highest frequency of mutations (33.4%) in comparison to other groups. The G1613T mutation was observed in 23.9% of population studied [Figure 1], which resulted in the substitution of Glu80 with Asp. Mutations were observed with comparable frequency in both groups; however, the statistical analysis did not reveal any significant difference (\u003cem\u003eP-Value\u0026thinsp;=\u0026thinsp;0.2\u003c/em\u003e). Based on the findings shown in Fig.\u0026nbsp;1, A1633G (43.4%), C1500T (43.4%), and A1635T (46.7%), mutations had the highest frequency in the three-generation group compared to the other two groups. The rate of mutation occurrence was relatively higher in patients with HBeAg negative (\u003cem\u003eP-Value\u0026thinsp;=\u0026thinsp;0.03\u003c/em\u003e).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eDetection of \u003cem\u003eHBx\u003c/em\u003e in patients with HCC is a well-known phenomenon that is often associated with the presence of mutations that could contribute to the development of HBV infection [\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHBx\u003c/em\u003e proteins lack the C domain, which is essential for the suppressive effects of \u003cem\u003eHBx\u003c/em\u003e on cell proliferation, cell growth, transactivation activity, and transformation. However, these proteins inhibit p53-mediated apoptosis and thus contribute to the development of HCC [\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. 2.9% of CHB cases were discovered to have deletions or insertions totaling 8bp in the C-terminus of \u003cem\u003eHBx\u003c/em\u003e from the cirrhotic group. In addition, 15 distinct deletions, 1762\u0026ndash;1768, 1763\u0026ndash;1770, 1769\u0026ndash;1773, and T1771/A1775, were identified in cirrhotic patients [\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e]. In contrast to the above research, it was observed that CHB patients didn\u0026rsquo;t show any deletion-related mutations, except for C1773T that this particular mutation had 20% frequency in the two-generation group. Our findings are consistent with recent studies [\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e], showing that HBeAg-negative patients are more likely to have deletion and insertion mutations in the C-terminus of \u003cem\u003eHBx\u003c/em\u003e. In a separate study, it has been observed that the occurrence of A1762T/G1764A mutation in the C-terminal overlap region of the \u003cem\u003eX-gene\u003c/em\u003e with BCP results in the disease progression from the chronic stage to cirrhosis. This is attributed to a change in the amino acid sequence of protein \u003cem\u003eX\u003c/em\u003e. \u003cem\u003eSalarnia et al.\u003c/em\u003e, demonstrated that the incidence A1762T/G1764A mutation, was higher in individuals with cirrhosis in comparison to those with CHB. The presence of this genetic mutation plays a significant role in the advancement of liver disease toward more critical phases [\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e]. Our results are in line with those of many previous studies, \u003cem\u003eChen et al.\u003c/em\u003e [\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e], \u003cem\u003eVazjalali et al.\u003c/em\u003e, and \u003cem\u003eMaleki et al.\u003c/em\u003e [\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e], who have shown that increased frequency of A1762T/G1764A mutations accelerates disease progression. According to the results of our research, this mutation is more frequent in HBeAg-negative in the two-generation patient.\u003c/p\u003e\n\u003cp\u003eA study carried out by \u003cem\u003eSalarnia et al\u003c/em\u003e. identified new mutations within the HBx gene. The N-terminal region, Box \u0026alpha;, Enhancer II, and Core promoter of the \u003cem\u003eX-gene\u003c/em\u003e have been reported to exhibit various mutations, including C1500T, C1491G, G1658T, and G1613T [\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e]. Consistent with the aforementioned investigation, novel mutations were detected in patients. The three-generation group exhibited the highest frequency percentage, with A1635T, A1633G, C1500T, and C1491G mutations being the most commonly reported.\u003c/p\u003e\n\u003cp\u003eThe A1635T mutation results (Isoleucine \u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAACkAAAAUCAYAAAAQhBSFAAAAlklEQVRIDWP4PwQAwxBw4/9RR1Irlugeki/ef/s/a/tNktw/II70qtv9H4SJdeyAOpJYxw4KRxJyLIojYYoHmkZPBoPOkaFt+/8v2Xfn/5fvv+GZC8WRcFEaMkC5G1tMYXMczBkD7kh8jhtwRxLjuAFzJCitoac5mGNw0XSPblwOwSc+6kh8oUOK3GhIkhJa+NQOiZAEADqnMrX+epFyAAAAAElFTkSuQmCC\" height=\"20\" width=\"41\"\u003e Phenylalanine) in the \u003cem\u003eHBx\u003c/em\u003e protein sequence (aa 88-100), which leads to an interaction with the DNA damage binding complex-1, that due to the overlap between NRE and \u003cem\u003eHBx\u003c/em\u003e coding sequences. A study by\u0026nbsp;\u003cem\u003eGhosh et al\u003c/em\u003e. showed a higher incidence of A1635T among subjects with cirrhosis (53.85%) compared to subjects with chronic, inactive HBV carriers [27]. Contrary to our findings, this mutation was observed in patients, in the three-generation group.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIt has been newly documented in several studies that A1727T mutation is a novel predictive marker of the cirrhosis stage among HBV-infected patients [\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]. Patients with cirrhosis have been found to have a higher incidence of the A1727G mutation, which has been linked to a higher chance of HCC [\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]. The majority of TA1 mutations occur in 1750-1755nt, and this area of the gene has been identified as a potential predictor of HCC [\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]. It was also shown that the T1753C mutation is a potential marker for cirrhosis severity and also it is associated with severe liver disease [\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e]. In agreement with the aforementioned mutation studies, we found that the A1727G mutation was present in CHB cases and a statistically significant difference was found between these three groups. The T1753C mutation, an important predictor of the cirrhotic stage, was found with high prevalence in two-generation group.\u003c/p\u003e\n\u003cp\u003eIt has been found that specific patterns of \u003cem\u003eHBx\u003c/em\u003e mutations can be used as early markers of increased risk of HCC and to predict the clinical outcome of HBV-infected patients. Prior research, exemplified by \u003cem\u003eXiao et al\u003c/em\u003e., has demonstrated that mutations in the \u003cem\u003eX-region\u003c/em\u003e tend to arise during the advanced phases of chronic HBV infection, resulting in serious liver disorders, such as HCC and cirrhosis [\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e]. The findings of the current investigation indicate that CHB patients exhibit significant occurrences of double mutations C1481T/G1479A, as well as point mutations A1635T, T1464C, and C1500T. The presence of triple mutations, specifically A1762T/G1764A/C1773T and C1812/C1813T/A1814T, was observed in three groups. C1481T/G1479A mutations were detected in three groups, and a higher prevalence was observed in the two generations and intrafamilial groups. In addition, mothers showed a higher frequency of these mutations compared to their children and grandmothers.\u003c/p\u003e\n\u003cp\u003eIn conclusion, the identification and correlation analysis of genomic mutations with clinical complications are crucial for disease management, prognosis, and treatment. These mutations can be utilized for screening high-risk individuals for liver disease, improving diagnostic methods, and refining therapeutic approaches. Additionally, investigating the impact of A1762T/G1764A mutations on different phases of HBV infection, such as HCC, is recommended.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003eThe present study was derived from a research project for completion of Ph.D. course Shahid Beheshti University and Golestan University of Medical Sciences.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; Contribution\u0026nbsp;\u003c/strong\u003eA.M, S.M.H, I.SH, S.B contributed to study conception. A.M, N.B, M.N contributed to data analysis. M.N performing the experiments. A.M, S.M.H, M.N; Revision: A.M, M.N Reading and confirming the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eThis research received no specific grant during the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003eThe nucleotide sequences of \u003cem\u003eHBx\u003c/em\u003e \u003cem\u003egene\u003c/em\u003e to identify mutations in 90 CHB patient samples in this study were deposited in the GenBank database under accession numbers ON346437 - ON346526.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interest statement\u0026nbsp;\u003c/strong\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e The ethical committee of Golestan University of Medical Sciences granted approval for the study [IR. GOUMS.REC.1399.105].\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGong DY, Chen EQ, Huang FJ, Leng XH, Cheng X, Tang H (2013) Role and functional domain of hepatitis B virus X protein in regulating HBV transcription and replication in vitro and in vivo. Viruses 5(5): 1261-71.\u003c/li\u003e\n\u003cli\u003eAl-Qahtani AA, Al-Anazi MR, Nazir N, Ghai R, Abdo AA, Sanai FM et al (2017) Hepatitis B virus (HBV) X gene mutations and their association with liver disease progression in HBV-infected patients. Oncotarget 8(62): 105115-105125. \u003c/li\u003e\n\u003cli\u003eNaderi M, Hosseini SM, Besharat S, Behnampour N, Shahramian I, Moradi A (2023) Clinical and virological aspects of core and pre-core mutations in three generations of chronic hepatitis B virus patients. Future Virol. 18(6).\u003c/li\u003e\n\u003cli\u003eAzad AR, Zargar M, Zolfaghari MR, Mohammadbeigi A (2020) The Prevalence of Hepatitis B and D Viruses and Evaluating YMDD Mutation in HBV-Suspected Patients in Qom Province, Iran. Jundishapur J Microbiol 13(2): e100038. \u003c/li\u003e\n\u003cli\u003eSalarnia F, Zhand S, Khodabakhshi B, Tabarraei A, Vakili MA, Javid N, Bazori M, Moradi A (2016) Mutations at Nucleotide 1762, 1764 and 1766 of Hepatitis B Virus X Gene in Patients with Chronic Hepatitis B and Hepatitis B-Related Cirrhosis. Mljgoums 10(1): 31-35.\u003c/li\u003e\n\u003cli\u003eDatta S, Chatterjee S, Veer V, Chakravarty R (2012) Molecular biology of the hepatitis B virus for clinicians. J Clin Exp Hepatol 2(4): 353-65. \u003c/li\u003e\n\u003cli\u003eSalarnia F, Behboudi E, Shahramian I, Moradi A (2022) Novel X gene point mutations in chronic hepatitis B and HBV related cirrhotic patients. Infect Genet Evol 97: 105186. \u003c/li\u003e\n\u003cli\u003eSchollmeier A, Glitscher M, Hildt E (2023) Relevance of HBx for Hepatitis B Virus-Associated Pathogenesis. Int J Mol Sci 24: 4964. \u003c/li\u003e\n\u003cli\u003eSong BC, Cui XJ, Kim HU, Cho YK (2006) Sequential accumulation of the basal core promoter and the precore mutations in the progression of hepatitis B virus-related chronic liver disease. Intervirology 49(5): 266-73. \u003c/li\u003e\n\u003cli\u003eKreutz C (2002) Molecular, immunological and clinical properties of mutated hepatitis B viruses. J Cell Mol Med 6(1): 113-43. \u003c/li\u003e\n\u003cli\u003eDatta S, Banerjee A, Chandra PK, Biswas A, Panigrahi R, Mahapatra PK et al (2008) Analysis of hepatitis B virus X gene phylogeny, genetic variability and its impact on pathogenesis: implications in Eastern Indian HBV carriers. Virology 382: 190\u0026ndash;198. \u003c/li\u003e\n\u003cli\u003eZhang X, Ding HG (2015) Key role of hepatitis B virus mutation in chronic hepatitis B development to hepatocellular carcinoma. World J Hepatol 7(9): 1282-6. \u003c/li\u003e\n\u003cli\u003eLee S, Mun HS, Kim H, Lee HK, Kim BJ, Hwang ES et al (2011) Naturally occurring hepatitis B virus X deletions and insertions among Korean chronic patients. J Med Virol 83(1): 65-70. \u003c/li\u003e\n\u003cli\u003eZhang C, Xie Y, Lai R, Wu J, Guo Z (2022) Nonsynonymous C1653T Mutation of Hepatitis B Virus X Gene Enhances Malignancy of Hepatocellular Carcinoma Cells. J Hepatocell Carcinoma 9: 367-377. \u003c/li\u003e\n\u003cli\u003eLi SK, Ho SF, Tsui KW, Fung KP, Waye MY (2008) Identification of functionally important amino acid residues in the mitochondria targeting sequence of hepatitis B virus X protein. Virology 381(1): 81-8. \u003c/li\u003e\n\u003cli\u003eChen CH, Lee CM, Lu SN, Changchien CS, Eng HL, Huang CM et al (2005) Clinical significance of hepatitis B virus (HBV) genotypes and precore and core promoter mutations affecting HBV e antigen expression in Taiwan. J Clin Microbiol 43(12): 6000-6. \u003c/li\u003e\n\u003cli\u003eLee JH, Han KH, Lee JM, Park JH, Kim HS (2011) Impact of hepatitis B virus (HBV) x gene mutations on hepatocellular carcinoma development in chronic HBV infection. Clin Vaccine Immunol 18(6): 914-21. \u003c/li\u003e\n\u003cli\u003eNaderi M, Hosseini SM, Behnampour N, Shahramian I, Moradi A (2023) Mutations in the S gene of hepatitis B virus in three generations of patients with chronic hepatitis B. Virus Genes 59(5): 662-669. \u003c/li\u003e\n\u003cli\u003eLazarevic I (2014) Clinical implications of hepatitis B virus mutations: recent advances. World J Gastroenterol 20(24): 7653-64. \u003c/li\u003e\n\u003cli\u003eBouchard MJ, Schneider RJ (2004) The enigmatic X gene of hepatitis B virus. J Virol 78: 12725\u0026ndash;34. \u003c/li\u003e\n\u003cli\u003eMukherji A, Janbandhu VC, Kumar V (2007) HBx-dependent cell cycle deregulation involves interaction with cyclin E/A-cdk2 complex and destabilization of p27Kip1. Biochem J 401(1): 247-56. \u003c/li\u003e\n\u003cli\u003eMa NF, Lau SH, Hu L, Xie D, Wu J, Yang J et al (2008) COOH-terminal truncated HBV X protein plays key role in hepatocarcinogenesis. Clin Cancer Res 14(16): 5061-8. \u003c/li\u003e\n\u003cli\u003eSalarnia F, Besharat S, Zhand S, Javid N, Khodabakhshi B, Moradi A (2017) Mutations in Hepatitis-B X-Gene Region: Chronic Hepatitis-B versus Cirrhosis. J Clin Diagn Res 11(3): OC31-OC34. \u003c/li\u003e\n\u003cli\u003eFujiwara K, Tanaka Y, Paulon E, Orito E, Sugiyama M, Ito K et al (2005) Novel type of hepatitis B virus mutation: replacement mutation involving a hepatocyte nuclear factor 1 binding site tandem repeat in chronic hepatitis B virus genotype E. J Virol 79(22): 14404-10. \u003c/li\u003e\n\u003cli\u003eVaezjalali M, Rezaee H, Goudarzi H (2013) HBV S Gene Premature Stop Codon in Strains from Middle Eastern Patients. Arch Clin Infect Dis 8(1): 3-7. \u003c/li\u003e\n\u003cli\u003eMalik A, Singhal DK, Albanyan A, Husain SA, Kar P (2012) Hepatitis B virus gene mutations in liver diseases: a report from New Delhi. PLoS One 7(6): e39028. \u003c/li\u003e\n\u003cli\u003eGhosh S, Mondal RK, Banerjee P, Nandi M, Sarkar S, Das K et al (2012) Tracking the naturally occurring mutations across the full-length genome of hepatitis B virus of genotype D in different phases of chronic e-antigen-negative infection. Clin Microbiol Infect 18(10): E412-8. \u003c/li\u003e\n\u003cli\u003eYin J, Xie J, Liu S, Zhang H, Han L, Lu W et al (2011) Association between the various mutations in viral core promoter region to different stages of hepatitis B, ranging of asymptomatic carrier state to hepatocellular carcinoma. Am J Gastroenterol 106(1): 81-92. \u003c/li\u003e\n\u003cli\u003eKhan A, Al Balwi MA, Tanaka Y, Hajeer A, Sanai FM, Al Abdulkarim I et al (2013) Novel point mutations and mutational complexes in the enhancer II, core promoter and precore regions of hepatitis B virus genotype D1 associated with hepatocellular carcinoma in Saudi Arabia. Int J Cancer 133(12): 2864-71. \u003c/li\u003e\n\u003cli\u003eLee D, Lyu H, Chung YH, Kim JA, Mathews P, Jaffee E et al (2016) Genomic change in hepatitis B virus associated with development of hepatocellular carcinoma. World J Gastroenterol 22(23): 5393-9. \u003c/li\u003e\n\u003cli\u003eBiswas A, Banerjee A, Chandra PK, Datta S, Panigrahi R, Dutta D et al (2011) Variations in the functional domain of basal core promoter of hepatitis B virus among Eastern Indian patients with prevalence of genotypes A, C, and D among the same ethnic population. J Med Virol 83(2): 253-60. \u003c/li\u003e\n\u003cli\u003eXiao L, Zhou B, Gao H, Ma S, Yang G, Xu M et al (2011) Hepatitis B virus genotype B with G1896A and A1762T/G1764A mutations is associated with hepatitis B related acute-on-chronic liver failure. J Med Virol 83(9): 1544-50. \u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable. [1]: Oligonucleotide primers used for semi-nested PCR and sequencing of X-region of hepatitis B [19, 20].\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"670\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.149253731343284%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.61194029850746%\" valign=\"top\"\u003e\n \u003cp\u003eSequence (5\u0026apos; to 3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.91044776119403%\" valign=\"top\" style=\"width: 10.0204%;\"\u003e\n \u003cp\u003eTarget sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.32835820895522%\" valign=\"top\" style=\"width: 22.2184%;\"\u003e\n \u003cp\u003ePCR program\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"10.149253731343284%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eF1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"37.61194029850746%\" valign=\"top\"\u003e\n \u003cp\u003eATCGTATCCATGGCTGCTAGGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.91044776119403%\" valign=\"top\" style=\"width: 10.0204%;\"\u003e\n \u003cp\u003e1365-1387\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"34.32835820895522%\" rowspan=\"3\" valign=\"top\" style=\"width: 22.2184%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eStep 1:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e94\u0026deg;C 5 min, 35 cycles (94\u0026deg;C 1 min, 55\u0026deg;C 1 min and 72\u0026deg;C 1 min), 72\u0026deg;C 7 min.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eStep 2:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e94\u0026deg;C 5 min, 35 cycles (94\u0026deg;C 30 Sec, 57.5\u0026deg;C 30 Sec and 72\u0026deg;C 45 Sec), 72\u0026deg;C 5 min.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.454545454545455%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eR1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"57.27272727272727%\" valign=\"top\"\u003e\n \u003cp\u003eCAGAATAGCTTGCCTGAGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\" style=\"width: 10.0204%;\"\u003e\n \u003cp\u003e2058-2078\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"15.454545454545455%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eR2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"57.27272727272727%\" valign=\"top\"\u003e\n \u003cp\u003eCACAGCTTGGAGGCTTGAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"27.272727272727273%\" valign=\"top\" style=\"width: 10.0204%;\"\u003e\n \u003cp\u003e1881-1861\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2\u003cspan dir=\"RTL\"\u003e.\u003c/span\u003e Main characteristics of chronic HBV patients in three groups.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.423728813559322%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eBasic characteristics\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eThree generations\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eTwo generations\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.625235404896422%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eIntrafamilial members\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.423728813559322%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAge (Mean\u0026plusmn;SD)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e45.23\u0026plusmn; 22.8\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e35.83\u0026plusmn;17.7\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.625235404896422%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e35.5\u0026plusmn;15.2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.423728813559322%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eGender\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;(N)\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eMale\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eFemale\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e4\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e26\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e11\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e29\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.625235404896422%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e8\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e12\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.423728813559322%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eHBe-Ag\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;(N)\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e+\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e-\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e0\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e30\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e7\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e33\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.625235404896422%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e33\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e7\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.423728813559322%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAnti-HBe\u003c/em\u003e\u003c/strong\u003e\u003cem\u003e\u0026nbsp;(N)\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e+\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e-\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e30\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e0\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e4\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e16\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.625235404896422%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e16\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e4\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.423728813559322%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eALT (IU/L)\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e(Mean\u0026plusmn;SD)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e24.6 \u0026plusmn; 14.37\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e24 \u0026plusmn; 8.9\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.625235404896422%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e22 \u0026plusmn; 7.9\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.423728813559322%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eAST (IU/L)\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e(Mean\u0026plusmn;SD)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e25.46 \u0026plusmn; 13.67\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e26 \u0026plusmn; 11.2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.625235404896422%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e23.3 \u0026plusmn; 10.2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"25.423728813559322%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003eALP (IU/L)\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003e(Mean\u0026plusmn;SD)\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e419.567 \u0026plusmn; 259.78\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"22.975517890772128%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e464.75 \u0026plusmn; 274.1\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.625235404896422%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u003cem\u003e337.6 \u0026plusmn; 172.2\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3403899/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3403899/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study focused on detecting mutational patterns in the \u003cem\u003eX-gene\u003c/em\u003e of the HBV genome in three-generations of CHB patients. Ninety CHB patients were analyzed, revealing the highest similarity in \u003cem\u003eX-gene\u003c/em\u003e sequences between mothers and children in two-generations (79.3%). The N-terminal of the \u003cem\u003eX-gene\u003c/em\u003e showed frequent mutations, with notable occurrences at positions C1491G (25%), C1500T (43.4%), G1613T (23.9%), and G1658T (33.4%). Mutations were more prevalent in HBeAg-negative patients, indicating a significant difference (\u003cem\u003eP-value\u0026thinsp;=\u0026thinsp;0.03\u003c/em\u003e). A1762T/G1764A mutations were present in 15.6% of patients, demonstrating significant relevance. These mutational patterns may aid in predicting clinical outcomes and identifying susceptibility to hepatocellular HCC in patients.\u003c/p\u003e","manuscriptTitle":"X gene mutations of Hepatitis B virus and impact on chronic hepatitis B infection in CHB three-generations in the family","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-12 15:45:28","doi":"10.21203/rs.3.rs-3403899/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4bafc1e2-fe56-4f75-968f-80eb3465717b","owner":[],"postedDate":"March 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-11T09:28:39+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-12 15:45:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3403899","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3403899","identity":"rs-3403899","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}