DNAJC1 Facilitates Glioblastoma Progression by Promoting Extracellular Matrix Reorganization and Macrophage Infiltration

preprint OA: closed
Full text JSON View at publisher
Full text 125,097 characters · extracted from preprint-html · click to expand
DNAJC1 Facilitates Glioblastoma Progression by Promoting Extracellular Matrix Reorganization and Macrophage Infiltration | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article DNAJC1 Facilitates Glioblastoma Progression by Promoting Extracellular Matrix Reorganization and Macrophage Infiltration Han Zhang, Wenjing Zheng, Xu Chen, Longqi Sa, Yi Huo, Lingling Zhang, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4002088/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Jun, 2024 Read the published version in Journal of Cancer Research and Clinical Oncology → Version 1 posted 7 You are reading this latest preprint version Abstract Background: Glioblastoma (GBM) is a high-grade and heterogeneous subtype of glioma that presents a substantial challenge to human health, characterized by a poor prognosis and low survival rates. Despite its known involvement in regulating leukemia and melanoma, the function and mechanism of DNAJC1 in GBM remain poorly understood. Methods: Utilizing data from the TCGA, CGGA, and GEO databases, we investigated the expression pattern of DNAJC1 and its correlation with clinical characteristics in GBM specimens. Loss-of-function experiments were conducted to explore the impact of DNAJC1 on GBM cell lines, with co-culture experiments assessing macrophage infiltration and functional marker expression. Results: Our analysis demonstrated frequent overexpression of DNAJC1 in GBM, significantly associated with various clinical characteristics including WHO grade, IDH status, chromosome 1p/19q codeletion, and histological type. Moreover, Kaplan‒Meier and ROC analyses revealed DNAJC1 as a negative prognostic predictor and a promising diagnostic biomarker for GBM patients. Functional studies indicated that silencing DNAJC1 impeded cell proliferation and migration, induced cell cycle arrest, and enhanced apoptosis. Mechanistically, DNAJC1 was implicated in stimulating extracellular matrix reorganization, triggering the epithelial-mesenchymal transition (EMT) process, and initiating immunosuppressive macrophage infiltration. Conclusions: Our findings underscore the pivotal role of DNAJC1 in GBM pathogenesis, suggesting its potential as a diagnostic and therapeutic target for this challenging disease. DNAJC1 glioblastoma prognostic biomarker extracellular matrix reorganization macrophage infiltration Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Gliomas constitute over 70% of malignant brain tumors in the central nervous system (CNS) and represent the most prevalent primary brain tumors 1 . The prognosis for glioma patients is bleak, with a five-year survival rate of a mere 59%. Glioblastoma (GBM), the most aggressive and heterogeneous glioma subtype, exhibits a particularly dismal two-year survival rate of 26% 2 . GBM is characterized by its rapid proliferation, invasiveness, and capacity to modulate the tumor microenvironment—factors that significantly contribute to its malignancy by impairing immune responses through the release of anti-inflammatory cytokines 3 . Additionally, the blood-brain barrier (BBB) poses a substantial obstacle to the delivery of therapeutics to GBM lesions 4 . Despite advances in various treatment modalities, the median survival for GBM patients hovers between 14 and 17 months 5 , 6 . Recent research has implicated several genetic and epigenetic regulators in GBM pathogenesis; however, the central mechanisms remain elusive 7 , necessitating the identification of effective targets to elucidate GBM's underlying biology and to develop new treatment strategies. Heat shock proteins (HSPs), a ubiquitous and evolutionarily conserved superfamily of proteins, are crucial molecular chaperones that safeguard the cell from various stresses and contribute to maintaining homeostasis 8 – 10 . Beyond their protective roles, HSPs also modulate an array of pathological states, including cancer 11 . Their dysregulated expression in various tumor types implicates a significant role in cellular processes such as apoptosis, proliferation, differentiation, and immune modulation 12 8 . Nonetheless, the precise function and regulation of HSPs in GBM are not fully understood, although some have been identified as playing roles in tumor promotion or suppression 13 . The DnaJ Heat Shock Protein Family (HSP40) Member C1, also known as DNAJC1, is a highly conserved protein that assists in protein maturation and various cellular processes 14 . Abnormal expression levels of DNAJC1 homologs have been observed in gliomas, affecting tumor development and progression 15 . Overexpression of DNAJC1 has been associated with tumor growth and invasiveness in leukemia and melanoma, suggesting a potential role in tumorigenesis 16 , 17 . However, the exact functions and mechanisms of DNAJC1 in GBM remain to be elucidated. This study employed bioinformatics techniques to analyze clinical characteristics, molecular markers, and immune cell infiltration in GBM, highlighting the prognostic and diagnostic potential of DNAJC1 as a clinical biomarker. In vitro analyses revealed DNAJC1's role in promoting GBM cell proliferation, cell cycle progression, and migration. Moreover, the study uncovered that DNAJC1 facilitates epithelial-mesenchymal transition (EMT) and attracts immunosuppressive macrophage infiltration into the GBM microenvironment, thus exacerbating GBM oncogenesis. This research offers a comprehensive examination of DNAJC1's influence on immune cell infiltration, particularly its interaction with immunosuppressive cell types, and delves into the molecular mechanisms underpinning these processes in GBM, proposing novel diagnostic and therapeutic strategies. Materials and Methods Datasets We sourced a comprehensive dataset comprising 10,534 tumor samples across various subtypes, including matched normal controls, from The Cancer Genome Atlas (TCGA) to analyze DNAJC1 expression patterns in pan-cancer contexts. This dataset encompassed RNA-seq data from 689 GBM patients and 1,157 normal controls. Additional data for primary GBM specimens were obtained from the China Glioma Genome Atlas (CGGA), consisting of 156 cases and 5 controls, and the Gene Expression Omnibus (GEO), which included 52 GBM specimens and 20 controls from the GSE29796 series. These datasets facilitated a detailed investigation into the differential expression of DNAJC1 in GBM and its potential association with clinical parameters, including WHO grade, IDH status, 1p/19q co-deletion, and histological subtypes. Bioinformatics Analysis The TCGA GBM dataset was bifurcated into high and low DNAJC1 expression groups. We sequenced the transcriptomes of these cohorts to pinpoint differentially expressed genes (DEGs) and their enriched functions or pathways. The R software package (Version 4.2.1) was used for group classification and DEG calculation. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses identified enriched cellular components (CC), biological processes (BP), molecular functions (MF), and signaling pathways. Gene Set Enrichment Analysis (GSEA) corroborated these findings by assessing biological functions and pathway enrichments, adhering to the cutoff criteria of P 1, and FDR < 0.25. We extracted gene markers for 24 immune cell types from previous research to analyze immune infiltration, employing single-sample GSEA (ssGSEA) with the GSVA R package using TCGA-COADREAD datasets 18 . Spearman correlation tests quantified the association between DNAJC1 expression and immune cell infiltration. Visualization was achieved using the ggplot2 R package. Immunohistochemistry on Human Glioma Specimens Glioma tissues, including a variety of histological grades and normal brain tissues, were procured from the Pathology Department of Xijing Hospital, Air Force Medical University, Xi'an, China. The collection encompassed tissue chips from 63 patients, treated from 2010 to 2015. Ethical approval was granted by the institution’s ethics committee, and informed consent was obtained from all participants. Tissue preparation entailed meticulous microdissection. For immunohistochemistry (IHC), sections underwent deparaffinization, rehydration through graded ethanol, and antigen retrieval by boiling. Blocking of endogenous peroxidase was with 3% H2O2 in methanol. Primary antibodies were incubated overnight at 4°C in a humidified chamber. Subsequent incubation with secondary antibodies and streptavidin-conjugated horseradish peroxidase was conducted. Visualization utilized 3,3'-diaminobenzidine (DAB), and hematoxylin counterstaining followed. Sections were dehydrated and mounted in Eukitt medium. Cell Culture GBM cell lines U251 and U87, and the mononuclear cell line THP-1, were sourced from the Cell Bank of the Chinese Academy of Sciences. Cultivation occurred in RPMI-1640 medium, enriched with 10% fetal bovine serum and 1% penicillin-streptomycin, in a humidified 37°C incubator with 5% CO2. Plasmid Construction and Lentivirus Production Plasmids containing specific shRNA sequences targeting DNAJC1 were constructed as described: shDNAJC1_1: 5’ GCAGCTCAACTTCTACCAGTT 3’; shDNAJC1_2: 5’ GGGTCATTATGCTGTGGTTTG 3’; shDNAJC1_3: 5’ AGGTACAAGTTGCTGGTTGAA 3’. A random control sequence for targeting was also generated: 5’ ACTACCGTTGTTATAGGTG 3’. The DNAJC1 shRNAs and control shRNA were synthesized and inserted downstream of a U6 promoter in the pLVX-U6-EF1α-GFP-Puro lentiviral vector. Validation of all cloning steps was conducted through sequencing. The transfer plasmid containing the shRNA, the viral envelope plasmid, and the packaging plasmid were co-transfected into HEK293T cells using PEI transfection reagent (AC04L091, Shanghai Life-iLab Biotech). After 48 and 72 hours post-transfection, lentivirus-containing supernatants were harvested, filtered through a 0.45 µm filter (Millipore), and subsequently combined with PEG6000 overnight at 4°C. The mixture was concentrated via centrifugation at 4500 × g for 30 minutes at 4°C. U251 and U87 cells were transduced with the lentivirus at a multiplicity of infection (MOI) of 50 accompanied by 10 µg/ml polybrene. Following 72 hours of viral infection, the culture medium was supplemented with 2 µg/ml puromycin, and the cells were maintained for an additional week to establish stable cell lines expressing both GFP and shRNA. Protein Isolation and Western Blot Analysis Total protein was isolated from cell lysates using RIPA buffer (Sangon, Shanghai, China) with a protease inhibitor cocktail (Genstar, Shenzhen, China). Protein concentration was determined via bicinchoninic acid assay (BCA kit, Biosharp, Anhui, China). Then, 25 µg of protein per sample was resolved on a 10% SDS-PAGE gel at 110 V and transferred to a PVDF membrane (Millipore, USA) at 300 mA. Blocking was performed using 5% BSA in TBST for 1 hour at room temperature. Primary antibodies were incubated overnight at 4°C. Following washes with TBST, membranes were incubated with secondary antibodies for 1 hour at room temperature. Protein bands were visualized using a FluorChem FC2 system (Alpha Innotech, USA) as per the manufacturer's protocol. Growth Curve Assay Cell proliferation was assessed using a CCK-8 kit (Beyotime, Shanghai, China). Cells (2 × 10^3 per well) were seeded in 96-well plates with 200 µL of 10% FBS medium. Post attachment, 10 µL of CCK-8 solution was added and incubated at 37°C for 90 minutes. Absorbance at 450 nm was measured with a microplate reader (Bio-Rad, USA). Assays were conducted at 0, 24, 48, and 72 hours post-seeding and replicated thrice. Colony Formation Assay Logarithmically growing cells (2 × 10^3) were plated in a 6-cm dish with 5 mL of 10% FBS medium, ensuring even dispersion. After 2–3 weeks of incubation at 37°C and 5% CO2, cells were fixed with methanol, stained with Giemsa, and colonies were counted upon dish inversion. Cell Apoptosis and Cycle Analyses Flow cytometry was employed for apoptosis and cell cycle analyses. For apoptosis, cells (5 × 10^5) were cultured for 24, 48, or 72 hours, then exposed to 2% FBS medium for 24 hours. Post-harvesting, cells were stained with 7AAD and Annexin V-FITC for 30 minutes at 4°C in darkness. Analysis was performed using an EPICS XL flow cytometer (Beckman Coulter, USA) with CellQuest software. For cell cycle analysis, cells were fixed in 70% ethanol overnight at 4°C, rinsed, and stained with PI and RNase. A FACScan flow cytometer (BD Bioscience) was used for detection. Each assay was conducted in triplicate. Wound Healing and Transwell Assay Cell migration was evaluated through wound healing and transwell assays. For wound healing, cells (5 × 10^5) in a 6-well plate were grown to 90% confluence, scratched with a pipette tip, and imaged at 0 and 24 hours. In transwell assays, cells (1 × 10^4) were placed in the upper chamber of a transwell setup with complete medium as chemoattractant below. After 48 hours, cells were fixed, stained with crystal violet, and counted under a microscope. Each assay was performed thrice. Cell Coculture A cell coculture system was established by differentiating THP-1 cells into macrophages using 100 ng/mL phorbol 12-myristate 13-acetate (PMA). After 24 hours, the macrophages were polarized into M2 phenotype by incubating with 20 ng/mL IL-4 for an additional 48 hours. For the coculture, 1 × 10^5 macrophages were suspended in 500 µL of serum-free medium and seeded onto the upper transwell chamber membrane without Matrigel coating (24-well, 8 µm; Millipore). The lower compartment was filled with 500 µL of GBM cell supernatants. Following a 24-hour incubation period, the transwell chamber was washed thrice with PBS, stained with 0.1% crystal violet for 20 minutes, air-dried, photographed, and cell counts were conducted in at least five randomly chosen fields. Statistical Analysis Data were analyzed with SPSS 25.0, presented as mean ± SD, and derived from a minimum of three assays. R software (Version 4.2.1) was utilized for bioinformatics. Differences between two groups were evaluated using a two-tailed Student's t-test, while one-way ANOVA with Bonferroni's test compared multiple groups. Kaplan-Meier and log-rank tests assessed survival, Spearman's test examined correlations, and Cox regression analyzed group characteristics. ROC curve and AUC analyses gauged diagnostic accuracy. Significance levels were denoted as *, P < 0.05; **, P < 0.01; ***, P < 0.001. Results DNAJC1 Expression is Elevated and May Play a Role in Human GBM Tumorigenesis To examine the expression of DNAJC1 in tumors, we analyzed data from TCGA database. Our analysis revealed a significant upregulation of DNAJC1 in 20 different tumor types, including GBM and brain lower-grade glioma (LGG), compared to adjacent normal tissues (Fig. 1 A). To validate these findings, we also analyzed RNA-seq data from TCGA (Fig. 1 B), GSE29796 (Fig. 1 C), and CGGA databases (Fig. 1 D). Consistently, the expression of DNAJC1 was significantly higher in GBM specimens compared to normal specimens, indicating a positive association between DNAJC1 and GBM. Furthermore, we investigated the correlation between DNAJC1 and various clinical factors using the TCGA database (Table 1). Our results demonstrated that the expression of DNAJC1 gradually increased with the progression of GBM from WHO grade I to IV (Fig. 1 E). Additionally, GBM specimens with IDH mutations exhibited lower levels of DNAJC1 compared to those with wild-type IDH (Fig. 1 F). Moreover, DNAJC1 expression was significantly lower in GBM specimens with chromosome 1p/19q co-deletion compared to those without co-deletion (Fig. 1 G). Notably, GBM showed higher levels of DNAJC1 expression compared to less malignant subtypes such as astrocytoma, oligoastrocytoma, and oligodendroglioma (Fig. 1 H). To further evaluate the expression pattern of DNAJC1 in different glioma grades, we performed immunohistochemical staining on tissue samples obtained from patients with various tumor grades as well as normal brain tissue samples. Our results demonstrated a gradual increase in DNAJC1 expression from normal cerebral cortex to astrocytoma (WHO grade II) or oligoastrocytoma (WHO grade II), and further to anaplastic astrocytoma (WHO grade III) and anaplastic oligodendroglioma (WHO grade III). Notably, the highest expression level of DNAJC1 was observed in GBM (WHO grade IV) (Fig. 1 I). These findings suggest that DNAJC1 is positively associated with clinical progression and may potentially act as a tumor activator in human GBM. DNAJC1 Serves as an Unfavorable Prognostic Indicator and a Potential Diagnostic Biomarker for Human GBM. To evaluate the relationship between DNAJC1 expression and patient survival, we analyzed survival data obtained from the TCGA database. GBM patients were divided into two cohorts based on their DNAJC1 expression: high and low. The data, illustrated in Figs. 2 A-C, show that patients with elevated DNAJC1 expression have significantly reduced overall survival (OS), disease-specific survival (DSS), and progression-free interval (PFI) in contrast to those with diminished expression. In scenarios involving IDH mutation, 1p/19q codeletion, or primary therapy outcome, the high-expression cohort consistently presented with poorer OS outcomes (Figs. 2 D-F). Both univariate and multivariate analyses corroborated the status of DNAJC1 expression as an independent prognostic factor for GBM (Table 2). The CGGA database analysis corroborated these findings, revealing an inverse relationship between DNAJC1 expression and OS in patients with either initial or recurrent GBM (Figs. 2 G-H), further supporting DNAJC1's role as a negative prognostic indicator. In addition, receiver operating characteristic (ROC) curve analysis highlighted DNAJC1's capacity to differentiate between primary GBM tumors and normal tissue controls, with an impressive area under the curve (AUC) of 0.931 (Fig. 2 I). The discriminative power of DNAJC1 was also consistent across variables such as IDH mutation status, 1p/19q codeletion status, and primary therapy outcomes, yielding AUC values of 0.709, 0.654, and 0.621, respectively (Figs. 2 J-L). These findings suggest that DNAJC1 is a promising diagnostic biomarker for GBM in a clinical context. DNAJC1 Enhances Proliferation and Suppresses Apoptosis in GBM Cells In Vitro To elucidate DNAJC1's oncogenic function in GBM, we performed in vitro experiments using GBM cell lines. U251 cells were infected with lentiviruses carrying GFP alongside various DNAJC1-targeting shRNAs. GFP-positive cells underwent selection via puromycin (Fig. 3 A). Western blot analysis revealed marked downregulation of DNAJC1 in cells treated with shDNAJC1_2 and shDNAJC1_3, and a modest reduction with shDNAJC1_1, relative to controls (Fig. 3 B). For validation, we generated U87 GBM cell lines transfected with either a control vector or shDNAJC1_2. Consistent expression patterns were confirmed in both U87 and U251 cells through flow cytometry and western blotting (Figs. 3 C-D). Proliferation assays indicated that both U251 and U87 cells with DNAJC1 knockdown (shDNAJC1_2 and shDNAJC1_3) exhibited reduced growth compared to control vector-transfected cells (Figs. 3 E-F). Colony formation assays showed a substantial reduction in colony numbers in DNAJC1-silenced U251 cells (Figs. 3 G-H). Cell cycle analysis indicated a decrease in S-phase fraction and an increase in G0/G1 and G2 phases upon DNAJC1 silencing in both cell lines (Figs. 3 I-L). Furthermore, apoptotic rates increased in a time-dependent manner following DNAJC1 downregulation in serum-deprived U251 (Figs. 3 M-N) and U87 (Figs. 3 O-P) cells, as determined by flow cytometry with Annexin V-FITC and 7AAD staining. Collectively, these data imply that DNAJC1 facilitates GBM cell proliferation, expedites cell cycle progression, and inhibits apoptosis in vitro. DNAJC1 Influences ECM Organization and Immune Response in the GBM Microenvironment To decipher DNAJC1's role in the evolution and advancement of GBM, we conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses on GBM samples exhibiting elevated DNAJC1 expression. The analysis presented in Fig. 4 A identified significant enrichment in biological functions related to the extracellular matrix structural constituent (GO-MF), the immunoglobulin complex (GO-CC), and complement activation (GO-BP). The KEGG pathway analysis revealed a notable correlation of the DNAJC1-associated gene cluster with pivotal processes and pathways, including the PI3K/AKT signaling pathway, cytokine-cytokine receptor interaction, focal adhesion, ECM-receptor interaction, and the IL-17 signaling pathway (Fig. 4 B). These data point to DNAJC1's possible involvement in modulating the ECM and immune response within the GBM microenvironment. Gene set enrichment analysis (GSEA) further corroborated these observations in the high DNAJC1 expression sample subset. We focused on gene clusters meeting the threshold of a nominal p-value (NOM) < 0.05 and a false discovery rate (FDR) q < 0.25, calculating the normalized enrichment score (NES) to ascertain specific pathway enrichments. The analysis underscored significant enrichment in genes related to MET PROMOTES CELL MOTILITY (Fig. 4 C), COLLAGENS (Fig. 4 D), and ECM REGULATORS (Fig. 4 E), reinforcing DNAJC1's critical role in ECM modulation. Additionally, the enriched gene cluster was associated with pathways pertinent to INITIAL TRIGGERING OF COMPLEMENT (Fig. 4 F), PD-1 SIGNALING (Fig. 4 G), and INTERLEUKIN 10 SIGNALING (Fig. 4 H), illustrating DNAJC1's intimate connection with immune response mechanisms within the GBM microenvironment. Notably, DNAJC1 was found to negatively regulate neuronal system development and was enriched in associated pathways such as NEURONAL SYSTEM (Fig. 4 I), DOPAMINE NEUROTRANSMITTER RELEASE (Fig. 4 J), and NEUROACTIVE LIGAND-RECEPTOR INTERACTION (Fig. 4 K). Collectively, the evidence emphasizes DNAJC1's central role in orchestrating ECM organization and immune dynamics, thereby promoting an environment conducive to GBM progression, invasion, and immune escape. DNAJC1 Knockdown Inhibits GBM Cell Migration and EMT Reflecting on the GO and GSEA results that linked DNAJC1 expression to ECM organization, we explored the gene's effects on GBM cell motility. Wound healing assays demonstrated a marked reduction in migratory capabilities of U251 and U87 cells with silenced DNAJC1 (Figs. 5 A-D). Similarly, transwell assays indicated fewer migrating cells on the membranes of the lower chambers when DNAJC1 expression was inhibited in U251 and U87 cells (Figs. 5 E-H). These results robustly suggest that DNAJC1 is instrumental in promoting GBM cell migration in vitro. Epithelial-mesenchymal transition (EMT) plays a pivotal role in the metastasis of various solid tumors. We assessed the role of DNAJC1 in EMT using quantitative real-time PCR (qRT-PCR) to measure the impact of DNAJC1 knockdown on EMT marker expression in U251 cells. A significant reduction in the mRNA expression of EMT markers, including Vimentin, FN1, ETS1, SNAI1, and ZEB1, was noted following DNAJC1 suppression (Fig. 5 I). Western blot analysis corroborated these findings, showing an upregulation of the epithelial marker E-cadherin and downregulation of the mesenchymal marker Vimentin in U251 cells with reduced DNAJC1 levels (Fig. 5 J). These results affirm DNAJC1's role in EMT activation, thereby contributing to the migratory and invasive behavior of GBM cells. DNAJC1 Augments Immunosuppressive Cell Infiltration in the GBM Microenvironment Our investigation delved into the role of DNAJC1 in modulating immune cell infiltration within GBM. A distinct link was established between DNAJC1 expression and the presence of immunosuppressive cell types, such as macrophages, neutrophils, and T helper type 2 (Th2) cells, known to facilitate GBM tumorigenesis within the tumor microenvironment (TME) [references 19–21]. Positive correlations were observed between DNAJC1 expression and macrophage (r = 0.485, P < 0.001), neutrophil (r = 0.394, P < 0.001), and Th2 cell (r = 0.485, P < 0.001) infiltration (Figs. 6 B-D). Notably, groups with high DNAJC1 expression had significantly greater enrichment of macrophages (Fig. 6 G), neutrophils (Fig. 6 H), and Th2 cells (Fig. 6 I) when compared to low-expression groups. These results point to DNAJC1's involvement in the recruitment of pro-tumorigenic immune cells within the GBM microenvironment. In contrast, there was no discernible association between DNAJC1 expression and the infiltration of anti-tumorigenic immune cells, such as CD8 + T cells and Th1 cells, which were similarly distributed across both high-expression and low-expression DNAJC1 groups (Figs. 6 A, E, F, J, K). Thus, our data underscore DNAJC1's role in fostering the infiltration of immune cells that support GBM tumorigenesis. DNAJC1 Knockdown Reduces Macrophage Infiltration and M2 Macrophage Marker CD163 Expression In Vitro Further investigating the interplay between DNAJC1 expression and macrophage infiltration, we employed a coculture system consisting of GBM cells and macrophages. When macrophages were cocultured with U251 and U87 cells with DNAJC1 knockdown (shDNAJC1_2 and shDNAJC1_3 for U251, shDNAJC1_2 for U87), we noted fewer labeled macrophages on the lower chamber membranes relative to control cells (Figs. 7 A-D), aligning with our bioinformatic predictions (Figs. 6 A and 6 B). This suggests DNAJC1's potential role in enhancing macrophage infiltration within the GBM microenvironment. Additionally, DNAJC1 suppression led to a decrease in the M2 macrophage marker CD163 (Figs. 7 E and 7 F), implying that GBM cell-derived DNAJC1 expression may be linked to the immunosuppressive M2 phenotype in macrophages. Discussion The diagnostic paradigm for GBM has evolved to integrate molecular profiling alongside traditional histopathological examination. Clinically, molecular markers such as IDH mutations and 1p/19q codeletion are now routinely utilized for GBM diagnosis, prognosis assessment, and therapeutic decision-making 19 . IDH, a critical enzyme in the Krebs cycle, catalyzes the conversion of isocitric acid into α-ketoglutarate (α-KG) and CO2, essential for energy production and biosynthetic precursor synthesis 20 . Typically occurring in the early phases of glioma development, IDH mutations are prevalent in oligodendroglioma, astrocytoma, and secondary GBM, but rare in primary GBM 21 . Patients with IDH-mutant GBM generally have a protracted disease course and improved outcomes compared to those with wild-type IDH 22 . The codeletion of the short arm of chromosome 1 and the long arm of chromosome 19 is often found in younger glioma patients 23 . The WHO's classification system identifies the 1p/19q codeletion as a distinctive marker for oligodendroglioma 24 . As these chromosomal regions harbor essential genes for cellular growth and differentiation, this codeletion can inhibit GBM cell proliferation and vasculature formation, enhancing response to chemotherapy and ultimately leading to better patient prognoses 25 . Nonetheless, despite the employment of molecular markers such as IDH mutations and 1p/19q codeletion in the clinical management of GBM, patient outcomes remain dismal, with median survival rates of 14–17 months 5 . Bioinformatic analysis of public databases has uncovered numerous novel differentially expressed genes that hold significant potential for improving GBM diagnostics and treatment strategies 26 – 28 . This study commenced with an analysis of the TCGA database to ascertain the expression pattern of DNAJC1. The gene was significantly upregulated in at least 20 tumor subtypes, with notably high levels in GBM or LGG, suggesting a potential oncogenic role for DNAJC1. Further examination of TCGA, CGGA, and GEO databases corroborated the elevated expression of DNAJC1 in GBM tissues, which increased concomitantly with higher WHO tumor grades. Additionally, DNAJC1 expression was inversely correlated with both IDH mutation and 1p/19q codeletion. Kaplan–Meier survival analysis revealed that higher DNAJC1 expression was associated with poorer OS, DSS, and PFI in GBM patients. Conversely, patients with lower DNAJC1 expression displayed enhanced responses to chemotherapy, with higher complete response (CR), partial response (PR), and stable disease (SD) rates. These findings underscore DNAJC1's potential as a prognostic biomarker and its diagnostic relevance in GBM. The TME is instrumental in GBM growth and progression and consists of immune and non-immune elements that interact with tumor cells 19 , 29 . Components such as collagen, laminin, and fibronectin are integral to the TME structure, alongside extracellular matrix elements, cancer-associated fibroblasts (CAFs), and immunosuppressive cytokines like IL-10 and IL-17 30–32 . Our analyses via GO, KEGG, and GSEA identified DNAJC1's involvement in extracellular matrix organization and collagen binding within the GBM TME. DNAJC1 also regulates complement and cytokine signaling, including IL-10, IL-17, and PD-1 pathways, and is associated with EMT. The suppression of DNAJC1 results in decreased EMT marker expression, suggesting its role in promoting EMT and thereby enhancing GBM cell invasion and migration. Moreover, the infiltration of immune cells into the TME is critical in gliomagenesis 33 . Macrophages, particularly those with the M2 phenotype, dominate the inflammatory cell population within tumors and facilitate tumor progression by promoting growth, angiogenesis, migration, and resistance to various therapies 34 – 36 . Th2 cells and immature neutrophils in the TME contribute to an immunosuppressive milieu that aids tumor immune evasion 37 , 38 . In our research, we found that elevated DNAJC1 expression is positively associated with the infiltration of macrophages, neutrophils, and Th2 cells into the glioma TME. Inhibition of DNAJC1 led to reduced expression of the M2 macrophage marker CD163. Collectively, these findings support DNAJC1's role in gliomagenesis through the recruitment of immunosuppressive cells into the TME. In conclusion, bioinformatic analysis reveals that DNAJC1 exhibits high expression levels in human GBM specimens with a strong correlation to clinical prognostic outcomes. DNAJC1 is implicated in enhancing proliferation, migration, and the recruitment of immunosuppressive macrophages in glioblastoma, and its association with the expression of immunosuppressive molecules, such as CTLA-4, PD-1, and PD-L1, suggests a role in immune cell inhibition and tumor immune evasion. It appears that DNAJC1 may facilitate GBM growth and progression within the TME by supporting immune escape mechanisms and drug resistance, potentially through promoting the epithelial-mesenchymal transition (EMT) process and upregulating immune inhibitory signaling. Clinically, DNAJC1 holds promise as a prognostic marker and diagnostic biomarker for GBM. However, the complexity and heterogeneity of GBM necessitate further clinical validation and translational research. Personalized therapy, tailored to individual patient subtypes and clinical features, represents an important avenue for future GBM treatment strategies. The combined use of DNAJC1 with other molecular markers and clinical indicators may lead to more customized treatment approaches. Our study, through a blend of bioinformatic inquiry and clinical data, contributes to a nuanced understanding of DNAJC1's function in gliomas. Notwithstanding, reliance on public databases could introduce bias, and in vitro loss-of-function experiments may not fully capture the complexity of human gliomas. Consequently, additional research employing animal models is imperative. Overall, our research underscores DNAJC1's pivotal role in glioma pathogenesis and underscores its potential as a significant prognostic biomarker and a candidate for targeted therapy, opening new pathways for advancing glioma diagnostics and treatment. Declarations Ethics approval and consent to participate: The research was approved by the Institutional Animal Care and Use Committee of the School of Medicine, Fourth Military Medical University. Consent for publication : All subjects provided written informed consent. Data Availability Statement: The original contributions presented in the study are included in the article file, and further inquiries can be directed to the corresponding author. Competing interests: The authors declare no conflict of interest Funding: This research was funded by grants from the National Natural Science Foundation of China, grant number 82073361 and 82203274; the State Key Laboratory of Cancer Biology Project, grant number CBSKL2022ZZ21; the Key R&D Plan of Shaanxi Province, grant number 2023-YBSF-667; the Xi'an Municipal Health Commission grant, grant number 2022ms06. Author Contributions: Conceptualization, T.W., L.S. and X.C.; methodology, H.Z., W.Z. and L.S.; validation, H.Z., Y.H. and H.L.; formal analysis, W.Z.; investigation, T.W and L.S.; data curation, H.Z. and Y.H.; writing—original draft preparation, H.Z. and X.C.; writing—review and editing, T.W.; supervision, T.W and L.S.; project administration, T.W and L.S.; funding acquisition, T.W., L.S. and X.C. All authors have read and agreed to the published version of the manuscript. Acknowledgments: We would like to thank American Journal Experts (www.aje.cn) for its linguistic assistance during the preparation of this manuscript. We also would like to thank Dr. Jing Ye from Department of Pathology, Fourth Military Medical University for his help in immunohistochemical staining. References Rong, L.; Li, N.; Zhang, Z., Emerging therapies for glioblastoma: current state and future directions. J Exp Clin Cancer Res 2022, 41 (1), 142. Yaghi, N. K.; Gilbert, M. R., Immunotherapeutic Approaches for Glioblastoma Treatment. Biomedicines 2022, 10 (2). Bellail, A. C.; Hunter, S. B.; Brat, D. J.; Tan, C.; Van Meir, E. G., Microregional extracellular matrix heterogeneity in brain modulates glioma cell invasion. Int J Biochem Cell Biol 2004, 36 (6), 1046-69. Yang, K.; Wu, Z.; Zhang, H.; Zhang, N.; Wu, W.; Wang, Z.; Dai, Z.; Zhang, X.; Zhang, L.; Peng, Y.; Ye, W.; Zeng, W.; Liu, Z.; Cheng, Q., Glioma targeted therapy: insight into future of molecular approaches. Mol Cancer 2022, 21 (1), 39. Xie, Z.; Janczyk, P. L.; Zhang, Y.; Liu, A.; Shi, X.; Singh, S.; Facemire, L.; Kubow, K.; Li, Z.; Jia, Y.; Schafer, D.; Mandell, J. W.; Abounader, R.; Li, H., A cytoskeleton regulator AVIL drives tumorigenesis in glioblastoma. Nat Commun 2020, 11 (1), 3457. Zhang, L.; He, A.; Chen, B.; Bi, J.; Chen, J.; Guo, D.; Qian, Y.; Wang, W.; Shi, T.; Zhao, Z.; Shi, J.; An, W.; Attenello, F.; Lu, W., A HOTAIR regulatory element modulates glioma cell sensitivity to temozolomide through long-range regulation of multiple target genes. Genome Res 2020, 30 (2), 155-163. Jia, P.; Cai, H.; Liu, X.; Chen, J.; Ma, J.; Wang, P.; Liu, Y.; Zheng, J.; Xue, Y., Long non-coding RNA H19 regulates glioma angiogenesis and the biological behavior of glioma-associated endothelial cells by inhibiting microRNA-29a. Cancer Lett 2016, 381 (2), 359-69. Nicchitta, C. V., Re-evaluating the role of heat-shock protein-peptide interactions in tumour immunity. Nat Rev Immunol 2003, 3 (5), 427-32. Kampinga, H. H.; Bergink, S., Heat shock proteins as potential targets for protective strategies in neurodegeneration. The Lancet Neurology 2016, 15 (7), 748-759. Aghdassi, A.; Phillips, P.; Dudeja, V.; Dhaulakhandi, D.; Sharif, R.; Dawra, R.; Lerch, M. M.; Saluja, A., Heat shock protein 70 increases tumorigenicity and inhibits apoptosis in pancreatic adenocarcinoma. Cancer Res 2007, 67 (2), 616-25. Dudeja, V.; Vickers, S. M.; Saluja, A. K., The role of heat shock proteins in gastrointestinal diseases. Gut 2009, 58 (7), 1000-9. Iglesia, R. P.; Fernandes, C. F. L.; Coelho, B. P.; Prado, M. B.; Melo Escobar, M. I.; Almeida, G.; Lopes, M. H., Heat Shock Proteins in Glioblastoma Biology: Where Do We Stand? Int J Mol Sci 2019, 20 (22). Rajesh, Y.; Biswas, A.; Banik, P.; Pal, I.; Das, S.; Borkar, S. A.; Sardana, H.; Saha, A.; Das, S. K.; Emdad, L.; Fisher, P. B.; Mandal, M., Transcriptional regulation of HSPB1 by Friend leukemia integration-1 factor modulates radiation and temozolomide resistance in glioblastoma. Oncotarget 2020, 11 (13), 1097-1108. Qiu, X. B.; Shao, Y. M.; Miao, S.; Wang, L., The diversity of the DnaJ/Hsp40 family, the crucial partners for Hsp70 chaperones. Cell Mol Life Sci 2006, 63 (22), 2560-70. Sun, H.; Zou, H. Y.; Cai, X. Y.; Zhou, H. F.; Li, X. Q.; Xie, W. J.; Xie, W. M.; Du, Z. P.; Xu, L. Y.; Li, E. M.; Wu, B. L., Network Analyses of the Differential Expression of Heat Shock Proteins in Glioma. DNA Cell Biol 2020, 39 (7), 1228-1242. Papalas, J. A.; Vollmer, R. T.; Gonzalez-Gronow, M.; Pizzo, S. V.; Burchette, J.; Youens, K. E.; Johnson, K. B.; Selim, M. A., Patterns of GRP78 and MTJ1 expression in primary cutaneous malignant melanoma. Mod Pathol 2010, 23 (1), 134-43. Shiba, N.; Yoshida, K.; Hara, Y.; Yamato, G.; Shiraishi, Y.; Matsuo, H.; Okuno, Y.; Chiba, K.; Tanaka, H.; Kaburagi, T.; Takeuchi, M.; Ohki, K.; Sanada, M.; Okubo, J.; Tomizawa, D.; Taki, T.; Shimada, A.; Sotomatsu, M.; Horibe, K.; Taga, T.; Adachi, S.; Tawa, A.; Miyano, S.; Ogawa, S.; Hayashi, Y., Transcriptome analysis offers a comprehensive illustration of the genetic background of pediatric acute myeloid leukemia. Blood Adv 2019, 3 (20), 3157-3169. Bindea, G.; Mlecnik, B.; Tosolini, M.; Kirilovsky, A.; Waldner, M.; Obenauf, A. C.; Angell, H.; Fredriksen, T.; Lafontaine, L.; Berger, A.; Bruneval, P.; Fridman, W. H.; Becker, C.; Pages, F.; Speicher, M. R.; Trajanoski, Z.; Galon, J., Spatiotemporal dynamics of intratumoral immune cells reveal the immune landscape in human cancer. Immunity 2013, 39 (4), 782-95. White, K.; Connor, K.; Meylan, M.; Bougoüin, A.; Salvucci, M.; Bielle, F.; O'Farrell, A. C.; Sweeney, K.; Weng, L.; Bergers, G.; Dicker, P.; Ashley, D. M.; Lipp, E. S.; Low, J. T.; Zhao, J.; Wen, P.; Prins, R.; Verreault, M.; Idbaih, A.; Biswas, A.; Prehn, J. H. M.; Lambrechts, D.; Arijs, I.; Lodi, F.; Dilcan, G.; Lamfers, M.; Leenstra, S.; Fabro, F.; Ntafoulis, I.; Kros, J. M.; Cryan, J.; Brett, F.; Quissac, E.; Beausang, A.; MacNally, S.; O'Halloran, P.; Clerkin, J.; Bacon, O.; Kremer, A.; Tching Chi Yen, R.; Varn, F. S.; Verhaak, R. G. W.; Sautès-Fridman, C.; Fridman, W. H.; Byrne, A. T., Identification, validation and biological characterization of novel Glioblastoma Tumour Microenvironment subtypes: Implications for precision immunotherapy. Ann Oncol 2022 . Fan, F.; Zhang, H.; Dai, Z.; Zhang, Y.; Xia, Z.; Cao, H.; Yang, K.; Hu, S.; Guo, Y.; Ding, F.; Cheng, Q.; Zhang, N., A comprehensive prognostic signature for glioblastoma patients based on transcriptomics and single cell sequencing. Cell Oncol (Dordr) 2021, 44 (4), 917-935. Han, S.; Liu, Y.; Cai, S. J.; Qian, M.; Ding, J.; Larion, M.; Gilbert, M. R.; Yang, C., IDH mutation in glioma: molecular mechanisms and potential therapeutic targets. Br J Cancer 2020, 122 (11), 1580-1589. Shi, D. D.; Anand, S.; Abdullah, K. G.; McBrayer, S. K., DNA damage in IDH-mutant gliomas: mechanisms and clinical implications. J Neurooncol 2022 . Hu, X.; Martinez-Ledesma, E.; Zheng, S.; Kim, H.; Barthel, F.; Jiang, T.; Hess, K. R.; Verhaak, R. G. W., Multigene signature for predicting prognosis of patients with 1p19q co-deletion diffuse glioma. Neuro Oncol 2017, 19 (6), 786-795. Numan, T.; Breedt, L. C.; Maciel, B.; Kulik, S. D.; Derks, J.; Schoonheim, M. M.; Klein, M.; de Witt Hamer, P. C.; Miller, J. J.; Gerstner, E. R.; Stufflebeam, S. M.; Hillebrand, A.; Stam, C. J.; Geurts, J. J. G.; Reijneveld, J. C.; Douw, L., Regional healthy brain activity, glioma occurrence and symptomatology. Brain 2022, 145 (10), 3654-3665. Wong, D.; Lee, T. H.; Lum, A.; Tao, V. L.; Yip, S., Integrated proteomic analysis of low-grade gliomas reveals contributions of 1p-19q co-deletion to oligodendroglioma. Acta Neuropathol Commun 2022, 10 (1), 70. Li, Y.; Ammari, S.; Lawrance, L.; Quillent, A.; Assi, T.; Lassau, N.; Chouzenoux, E., Radiomics-Based Method for Predicting the Glioma Subtype as Defined by Tumor Grade, IDH Mutation, and 1p/19q Codeletion. Cancers (Basel) 2022, 14 (7). Wan, S.; Moure, U. A. E.; Liu, R.; Liu, C.; Wang, K.; Deng, L.; Liang, P.; Cui, H., Combined bulk RNA-seq and single-cell RNA-seq identifies a necroptosis-related prognostic signature associated with inhibitory immune microenvironment in glioma. Front Immunol 2022, 13 , 1013094. Manini, I.; Dalla, E.; Vendramin, V.; Cesselli, D.; Di Loreto, C.; Skrap, M.; Ius, T., Identification of a Prognostic Microenvironment-Related Gene Signature in Glioblastoma Patients Treated with Carmustine Wafers. Cancers (Basel) 2022, 14 (14). Bikfalvi, A.; da Costa, C. A.; Avril, T.; Barnier, J. V.; Bauchet, L.; Brisson, L.; Cartron, P. F.; Castel, H.; Chevet, E.; Chneiweiss, H.; Clavreul, A.; Constantin, B.; Coronas, V.; Daubon, T.; Dontenwill, M.; Ducray, F.; Enz-Werle, N.; Figarella-Branger, D.; Fournier, I.; Frenel, J. S.; Gabut, M.; Galli, T.; Gavard, J.; Huberfeld, G.; Hugnot, J. P.; Idbaih, A.; Junier, M. P.; Mathivet, T.; Menei, P.; Meyronet, D.; Mirjolet, C.; Morin, F.; Mosser, J.; Moyal, E. C.; Rousseau, V.; Salzet, M.; Sanson, M.; Seano, G.; Tabouret, E.; Tchoghandjian, A.; Turchi, L.; Vallette, F. M.; Vats, S.; Verreault, M.; Virolle, T., Challenges in glioblastoma research: focus on the tumor microenvironment. Trends in cancer 2023, 9 (1), 9-27. Buoncervello, M.; Gabriele, L.; Toschi, E., The Janus Face of Tumor Microenvironment Targeted by Immunotherapy. Int J Mol Sci 2019, 20 (17). Li, X.; Bechara, R.; Zhao, J.; McGeachy, M. J.; Gaffen, S. L., IL-17 receptor-based signaling and implications for disease. Nat Immunol 2019, 20 (12), 1594-1602. Rivas, J. R.; Liu, Y.; Alhakeem, S. S.; Eckenrode, J. M.; Marti, F.; Collard, J. P.; Zhang, Y.; Shaaban, K. A.; Muthusamy, N.; Hildebrandt, G. C.; Fleischman, R. A.; Chen, L.; Thorson, J. S.; Leggas, M.; Bondada, S., Interleukin-10 suppression enhances T-cell antitumor immunity and responses to checkpoint blockade in chronic lymphocytic leukemia. Leukemia 2021, 35 (11), 3188-3200. Crivii, C. B.; Bosca, A. B.; Melincovici, C. S.; Constantin, A. M.; Marginean, M.; Dronca, E.; Sufletel, R.; Gonciar, D.; Bungardean, M.; Sovrea, A., Glioblastoma Microenvironment and Cellular Interactions. Cancers (Basel) 2022, 14 (4). Ross, J. L.; Velazquez Vega, J.; Plant, A.; MacDonald, T. J.; Becher, O. J.; Hambardzumyan, D., Tumour immune landscape of paediatric high-grade gliomas. Brain 2021, 144 (9), 2594-2609. Mantovani, A.; Marchesi, F.; Malesci, A.; Laghi, L.; Allavena, P., Tumour-associated macrophages as treatment targets in oncology. Nat Rev Clin Oncol 2017, 14 (7), 399-416. Gutmann, D. H.; Kettenmann, H., Microglia/Brain Macrophages as Central Drivers of Brain Tumor Pathobiology. Neuron 2019, 104 (3), 442-449. Basu, A.; Ramamoorthi, G.; Albert, G.; Gallen, C.; Beyer, A.; Snyder, C.; Koski, G.; Disis, M. L.; Czerniecki, B. J.; Kodumudi, K., Differentiation and Regulation of T(H) Cells: A Balancing Act for Cancer Immunotherapy. Front Immunol 2021, 12 , 669474. Lin, Y. J.; Wu, C. Y.; Wu, J. Y.; Lim, M., The Role of Myeloid Cells in GBM Immunosuppression. Frontiers in immunology 2022, 13 , 887781. Tables Tables 1 to 3 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Table1.pdf Table2.pdf Table3.pdf supplementfiles.tif Cite Share Download PDF Status: Published Journal Publication published 21 Jun, 2024 Read the published version in Journal of Cancer Research and Clinical Oncology → Version 1 posted Editorial decision: Revision requested 07 Apr, 2024 Reviews received at journal 05 Apr, 2024 Reviewers agreed at journal 15 Mar, 2024 Reviewers invited by journal 05 Mar, 2024 Editor assigned by journal 01 Mar, 2024 Submission checks completed at journal 01 Mar, 2024 First submitted to journal 29 Feb, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4002088","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":275926895,"identity":"2fb3730c-c8ae-4d7d-97ca-706c6bd9b385","order_by":0,"name":"Han Zhang","email":"","orcid":"","institution":"Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Zhang","suffix":""},{"id":275926896,"identity":"45d977b9-e123-40c2-b3f1-d37b6f5ce52e","order_by":1,"name":"Wenjing Zheng","email":"","orcid":"","institution":"Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenjing","middleName":"","lastName":"Zheng","suffix":""},{"id":275926897,"identity":"305c72c9-e8b9-4c90-90fc-f49b1812a534","order_by":2,"name":"Xu Chen","email":"","orcid":"","institution":"Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xu","middleName":"","lastName":"Chen","suffix":""},{"id":275926898,"identity":"4972fc4b-cdd2-4d28-8d4f-238d86baa5d5","order_by":3,"name":"Longqi Sa","email":"","orcid":"","institution":"Honghui Hospital, Xi'an Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Longqi","middleName":"","lastName":"Sa","suffix":""},{"id":275926901,"identity":"cfa7966b-0cf2-4f4d-9591-8d89bc1fa4b9","order_by":4,"name":"Yi Huo","email":"","orcid":"","institution":"Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Huo","suffix":""},{"id":275926903,"identity":"566220bf-c7c5-434a-8a4f-4acecffa66a6","order_by":5,"name":"Lingling Zhang","email":"","orcid":"","institution":"Fourth Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Lingling","middleName":"","lastName":"Zhang","suffix":""},{"id":275926905,"identity":"431e2b0d-b65f-4bc9-9ee5-070336314a75","order_by":6,"name":"Lequn Shan","email":"","orcid":"","institution":"Honghui Hospital, Xi'an Jiaotong University","correspondingAuthor":false,"prefix":"","firstName":"Lequn","middleName":"","lastName":"Shan","suffix":""},{"id":275926907,"identity":"700d4f70-a8ae-42f0-a214-dc427b1116a0","order_by":7,"name":"Tao Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAv0lEQVRIiWNgGAWjYNCCCjkIzUO0jgNnjEnVcrCNFC0Gx88efv1xnkG07owExgdv2xjkzQlqOZOXZnFwm0HuthsJzIZz2xgMdzYQ0GJ2IMfM4OC2PyAtbNK8bQwJBgcIaTn/BqhlDtgW9t/EabmRY/zgYANYCxszUVrsb7wxYzhzDKjlzMNmyTnnJAw3ENIi2Z9j/KGiBqjlePLBD2/KbOQJ2gIEbBIQmrEBSEgQVg8EzB+IUjYKRsEoGAUjFwAAzE5GV9Q2/20AAAAASUVORK5CYII=","orcid":"","institution":"Fourth Military Medical University","correspondingAuthor":true,"prefix":"","firstName":"Tao","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-03-01 04:59:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4002088/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4002088/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00432-024-05823-1","type":"published","date":"2024-06-22T00:19:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":52037698,"identity":"b270216d-57e5-4ba1-9764-8853182dd642","added_by":"auto","created_at":"2024-03-05 17:23:40","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":7228518,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelation between DNAJC1 expression and clinicopathological characteristics of GBM\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) DNAJC1 expression in different cancers from the TCGA database. ACC, adrenocortical carcinoma; BLCA, bladder urothelial carcinoma; BRCA, breast invasive carcinoma; CESC, cervical squamous cell carcinoma and endocervical adenocarcinoma; CHOL, cholangiocarcinoma; COAD, colon adenocarcinoma; DLBC, lymphoid neoplasm diffuse large B-cell lymphoma; ESCA, esophageal carcinoma; GBM, glioblastoma multiforme; HNSC, head and neck squamous cell carcinoma; KICH, kidney chromophobe; KIRC, kidney renal clear cell carcinoma; KIRP, kidney renal papillary cell carcinoma; LAML, acute myeloid leukemia; LGG, low grade glioma; LIHC, liver hepatocellular carcinoma; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; MESO, mesothelioma; OV, ovarian serous cystadenocarcinoma; PAAD, pancreatic adenocarcinoma; PCPG, pheochromocytoma and paraganglioma; PRAD, prostate adenocarcinoma; READ, rectum adenocarcinoma; SARC, sarcoma; SKCM, skin cutaneous melanoma; STAD, stomach adenocarcinoma; TGCT, testicular germ cell tumors; THCA, thyroid carcinoma; THYM, thymoma; UCEC, uterine corpus endometrial carcinoma; UCS, uterine carcinosarcoma; UVM, uveal melanoma. (B-D) The expression of DNAJC1 in GBM samples and normal tissues from (B) TCGA, (C) GSE29796 or (D) CGGA. (E-H) The expression of DNAJC1 in different (E) glioma grades, (F) IDH mutant status, (G) chromosome 1p/19q codeletion or (H) histological types. (I) Representative immunohistochemical staining of DNAJC1 in different histological gliomas using a tissue chip. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/fb3e4d1ea79177bce9d5e13b.jpg"},{"id":52038155,"identity":"f207025b-b2b7-42be-81e1-635c6150555b","added_by":"auto","created_at":"2024-03-05 17:31:40","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2989177,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelation between DNAJC1 expression and GBM survival prognosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-C) Correlation between DNAJC1 expression and (A) overall survival, (B) disease-specific survival or (C) progression-free interval in GBM patients. (D-F) Correlation between DNAJC1 expression and the overall survival of (D) IDH mutation status, (E) chromosome 1p/19q noncodeletion or (F) primary therapy outcome in GBM patients. (G-H) Correlation between DNAJC1 expression and the overall survival of GBM patients with (G) primary tumors or (H) recurrent tumors. (I-L) Receiver operating characteristic (ROC) curve analyses were used to distinguish DNAJC1 expression in (I) primary GBM tumors, (J) IDH mutation, (K) 1p/19q codeletion or (L) primary therapy outcome in GBM patients.\u003c/p\u003e","description":"","filename":"figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/8169b0d1032a836abc23d36a.jpg"},{"id":52037702,"identity":"db771655-e7ef-48fe-90be-fa17499e9fda","added_by":"auto","created_at":"2024-03-05 17:23:41","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":7966181,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDNAJC1 silencing inhibits proliferation and promotes apoptosis in GBM cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-D) Establishment of GMB cell lines stably expressing control shRNA or DNAJC1-targeting shRNA. U251 and U87 cells were transduced with lentivirus encoding GFP and shRNA. Puromycin (2 μg/mL) was added to the culture medium 72 h post-virus infection, and the cells were cultured for another week to obtain stable GFP- and shRNA-expressing cell lines. Flow cytometry analysis of GFP-positive (A) U251 cells and (C) U87 cells was performed. Western blot analysis was used to detect DNAJC1 expression in DNAJC1- silencing (B) U251 cells and (D) U87 cells. (E-H) DNAJC1 silencing inhibits GBM cell growth. A growth curve assay was performed with DNAJC1- silencing (E) U251 cells and (F) U87 cells. (G) Colony formation assay and (H) statistical analysis were performed with DNAJC1- silencing U251 cells. (I-L) Cell cycle experiments and statistical analyses were performed in DNAJC1- silencing (I, J) U251 cells and (K, L) U87 cells. (M-P) U251 or U87 cells were cultured in medium containing 2% FBS for 24 h, 48 h, or 72 h before harvesting. Flow cytometry analysis was performed with Annexin V-FITC and 7AAD staining to detect apoptosis at 72 h (M, O) or over a period of time (N, P) after serum deprivation.\u003c/p\u003e","description":"","filename":"figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/a77d2a9e2487cace0b2c4a85.jpg"},{"id":52037703,"identity":"a5aed488-5591-4636-a30d-3c159c3c5b66","added_by":"auto","created_at":"2024-03-05 17:23:41","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3020722,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFunctional enrichment analysis of DNAJC1 in GBM from the TCGA database\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Enriched Gene Ontology terms of DNAJC1 coexpression genes in GBM based on biological processes, cellular components, and molecular function. (B) KEGG analysis of GBM patients with high DNAJC1 expression. (C-K) Enrichment plots from GSEA, including (C) MET promotes the cell motility pathway, (D) collagens pathway, (E) ECM regulators pathway, (F) initial triggering of the complement pathway, (G) PD-1 signaling pathway, (H) interleukin 10 signaling pathway, (I) neuronal system pathway, (J) dopamine neurotransmitter release pathway, and (K) neuroactive ligand receptor interaction pathway.\u003c/p\u003e","description":"","filename":"figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/d138d1ef9179c549cd30dcd9.jpg"},{"id":52037696,"identity":"9702c39c-64b1-446b-aeaf-cfd4ec400f37","added_by":"auto","created_at":"2024-03-05 17:23:40","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3849511,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDNAJC1 promotes the migration of GBM cells and induces the EMT process\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-D) Wound healing experiments were conducted along with statistical analysis to assess the migratory capacity of DNAJC1- silencing (A, B) U251 cells and (C, D) U87 cells. (E-H) The migration ability of (E, F) U251 cells and (G, H) U87 cells was examined using the transwell assay. (I) qPCR analysis was performed to assess the expression of EMT markers in U251 cells with DNAJC1 knocked down and control cells. (J) Western blot analysis was conducted to examine the expression of the epithelial marker E-cadherin and the mesenchymal marker Vimentin in U251 cells with DNAJC1 knocked down and control cells.\u003c/p\u003e","description":"","filename":"figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/58d00f93dfce350703919228.jpg"},{"id":52037706,"identity":"4381decb-4fd6-46b8-a7be-7418304655f9","added_by":"auto","created_at":"2024-03-05 17:23:41","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":798415,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCorrelation analysis between DNAJC1 expression and immune cell infiltration in GBM\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Correlation between DNAJC1 expression and 24 immune cells. (B-F) Correlation of DNAJC1 expression with the tumor immune infiltration level of (B) macrophages, (C) neutrophils, (D) Th2 cells, (E) CD8\u003csup\u003e+\u003c/sup\u003e T cells, and (F) Th1 cells. (G-K) Relationship between DNAJC1 expression level and GBM infiltrating (G) macrophages, (H) neutrophils, (I) Th2 cells, (J) CD8\u003csup\u003e+\u003c/sup\u003e T cells, and (K) Th1 cells.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/153d112c2a556eb5252a58e3.jpg"},{"id":52037704,"identity":"ef9673ac-38d6-4e69-98f5-6da5854b9d8d","added_by":"auto","created_at":"2024-03-05 17:23:41","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":3408793,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSilencing of DNAJC1 hampers macrophage migration and reduces CD163 expression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-D) Coculture and recruitment experiments were performed using GBM cells and macrophages. Macrophages, differentiated from THP-1 cells by PMA, were seeded in the upper transwell chambers, while DNAJC1- silencing (I, J) U251 cells or (K, L) U87 cells were placed in the lower transwell chambers. Following 24 hours of incubation, macrophages that migrated through the chamber membrane were stained with 0.1% crystal violet and counted for statistical analysis. (E, F) Flow cytometry was employed to analyze the expression of the M2 marker CD163 on macrophages after coculture with DNAJC1-silenced U251 cells or control cells.\u003c/p\u003e","description":"","filename":"figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/a19ff1922b14e20f9c926b13.jpg"},{"id":58874302,"identity":"92ff9340-3caa-418d-ad1d-f422c3bb220d","added_by":"auto","created_at":"2024-06-23 00:19:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":30133873,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/51457037-7bad-42f3-a946-a025ec4a3f76.pdf"},{"id":52038156,"identity":"823ae725-ea69-4b4c-a8b8-8849c88181f4","added_by":"auto","created_at":"2024-03-05 17:31:41","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":120660,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/a5c77551225270cb90050c10.pdf"},{"id":52037699,"identity":"c7148acb-83a6-41e4-a342-6a3eaf0f21c5","added_by":"auto","created_at":"2024-03-05 17:23:40","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":71889,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/f160fa9bfcfd4fbfe53c83fe.pdf"},{"id":52037700,"identity":"fd7eee89-4d5b-48dc-b52d-369c2aa0bdf4","added_by":"auto","created_at":"2024-03-05 17:23:41","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":88727,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/8e2aef258d888695c5ae41bc.pdf"},{"id":52037707,"identity":"c7f93820-be44-4e55-b501-33cfe053446e","added_by":"auto","created_at":"2024-03-05 17:23:45","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":63274012,"visible":true,"origin":"","legend":"","description":"","filename":"supplementfiles.tif","url":"https://assets-eu.researchsquare.com/files/rs-4002088/v1/3680d1610f02a247dd4baa67.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"DNAJC1 Facilitates Glioblastoma Progression by Promoting Extracellular Matrix Reorganization and Macrophage Infiltration","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGliomas constitute over 70% of malignant brain tumors in the central nervous system (CNS) and represent the most prevalent primary brain tumors\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. The prognosis for glioma patients is bleak, with a five-year survival rate of a mere 59%. Glioblastoma (GBM), the most aggressive and heterogeneous glioma subtype, exhibits a particularly dismal two-year survival rate of 26%\u003csup\u003e2\u003c/sup\u003e. GBM is characterized by its rapid proliferation, invasiveness, and capacity to modulate the tumor microenvironment\u0026mdash;factors that significantly contribute to its malignancy by impairing immune responses through the release of anti-inflammatory cytokines\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Additionally, the blood-brain barrier (BBB) poses a substantial obstacle to the delivery of therapeutics to GBM lesions\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Despite advances in various treatment modalities, the median survival for GBM patients hovers between 14 and 17 months\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Recent research has implicated several genetic and epigenetic regulators in GBM pathogenesis; however, the central mechanisms remain elusive\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e, necessitating the identification of effective targets to elucidate GBM's underlying biology and to develop new treatment strategies.\u003c/p\u003e \u003cp\u003eHeat shock proteins (HSPs), a ubiquitous and evolutionarily conserved superfamily of proteins, are crucial molecular chaperones that safeguard the cell from various stresses and contribute to maintaining homeostasis\u003csup\u003e\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Beyond their protective roles, HSPs also modulate an array of pathological states, including cancer\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Their dysregulated expression in various tumor types implicates a significant role in cellular processes such as apoptosis, proliferation, differentiation, and immune modulation\u003csup\u003e12 8\u003c/sup\u003e. Nonetheless, the precise function and regulation of HSPs in GBM are not fully understood, although some have been identified as playing roles in tumor promotion or suppression\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe DnaJ Heat Shock Protein Family (HSP40) Member C1, also known as DNAJC1, is a highly conserved protein that assists in protein maturation and various cellular processes\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Abnormal expression levels of DNAJC1 homologs have been observed in gliomas, affecting tumor development and progression\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Overexpression of DNAJC1 has been associated with tumor growth and invasiveness in leukemia and melanoma, suggesting a potential role in tumorigenesis\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. However, the exact functions and mechanisms of DNAJC1 in GBM remain to be elucidated.\u003c/p\u003e \u003cp\u003eThis study employed bioinformatics techniques to analyze clinical characteristics, molecular markers, and immune cell infiltration in GBM, highlighting the prognostic and diagnostic potential of DNAJC1 as a clinical biomarker. In vitro analyses revealed DNAJC1's role in promoting GBM cell proliferation, cell cycle progression, and migration. Moreover, the study uncovered that DNAJC1 facilitates epithelial-mesenchymal transition (EMT) and attracts immunosuppressive macrophage infiltration into the GBM microenvironment, thus exacerbating GBM oncogenesis. This research offers a comprehensive examination of DNAJC1's influence on immune cell infiltration, particularly its interaction with immunosuppressive cell types, and delves into the molecular mechanisms underpinning these processes in GBM, proposing novel diagnostic and therapeutic strategies.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eDatasets\u003c/h2\u003e \u003cp\u003eWe sourced a comprehensive dataset comprising 10,534 tumor samples across various subtypes, including matched normal controls, from The Cancer Genome Atlas (TCGA) to analyze DNAJC1 expression patterns in pan-cancer contexts. This dataset encompassed RNA-seq data from 689 GBM patients and 1,157 normal controls. Additional data for primary GBM specimens were obtained from the China Glioma Genome Atlas (CGGA), consisting of 156 cases and 5 controls, and the Gene Expression Omnibus (GEO), which included 52 GBM specimens and 20 controls from the GSE29796 series. These datasets facilitated a detailed investigation into the differential expression of DNAJC1 in GBM and its potential association with clinical parameters, including WHO grade, IDH status, 1p/19q co-deletion, and histological subtypes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics Analysis\u003c/h2\u003e \u003cp\u003eThe TCGA GBM dataset was bifurcated into high and low DNAJC1 expression groups. We sequenced the transcriptomes of these cohorts to pinpoint differentially expressed genes (DEGs) and their enriched functions or pathways. The R software package (Version 4.2.1) was used for group classification and DEG calculation. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses identified enriched cellular components (CC), biological processes (BP), molecular functions (MF), and signaling pathways. Gene Set Enrichment Analysis (GSEA) corroborated these findings by assessing biological functions and pathway enrichments, adhering to the cutoff criteria of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, |NES| \u0026gt; 1, and FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.25. We extracted gene markers for 24 immune cell types from previous research to analyze immune infiltration, employing single-sample GSEA (ssGSEA) with the GSVA R package using TCGA-COADREAD datasets\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Spearman correlation tests quantified the association between DNAJC1 expression and immune cell infiltration. Visualization was achieved using the ggplot2 R package.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry on Human Glioma Specimens\u003c/h2\u003e \u003cp\u003eGlioma tissues, including a variety of histological grades and normal brain tissues, were procured from the Pathology Department of Xijing Hospital, Air Force Medical University, Xi'an, China. The collection encompassed tissue chips from 63 patients, treated from 2010 to 2015. Ethical approval was granted by the institution\u0026rsquo;s ethics committee, and informed consent was obtained from all participants. Tissue preparation entailed meticulous microdissection.\u003c/p\u003e \u003cp\u003eFor immunohistochemistry (IHC), sections underwent deparaffinization, rehydration through graded ethanol, and antigen retrieval by boiling. Blocking of endogenous peroxidase was with 3% H2O2 in methanol. Primary antibodies were incubated overnight at 4\u0026deg;C in a humidified chamber. Subsequent incubation with secondary antibodies and streptavidin-conjugated horseradish peroxidase was conducted. Visualization utilized 3,3'-diaminobenzidine (DAB), and hematoxylin counterstaining followed. Sections were dehydrated and mounted in Eukitt medium.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell Culture\u003c/h2\u003e \u003cp\u003eGBM cell lines U251 and U87, and the mononuclear cell line THP-1, were sourced from the Cell Bank of the Chinese Academy of Sciences. Cultivation occurred in RPMI-1640 medium, enriched with 10% fetal bovine serum and 1% penicillin-streptomycin, in a humidified 37\u0026deg;C incubator with 5% CO2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003ePlasmid Construction and Lentivirus Production\u003c/h2\u003e \u003cp\u003ePlasmids containing specific shRNA sequences targeting DNAJC1 were constructed as described: shDNAJC1_1: 5\u0026rsquo; GCAGCTCAACTTCTACCAGTT 3\u0026rsquo;; shDNAJC1_2: 5\u0026rsquo; GGGTCATTATGCTGTGGTTTG 3\u0026rsquo;; shDNAJC1_3: 5\u0026rsquo; AGGTACAAGTTGCTGGTTGAA 3\u0026rsquo;. A random control sequence for targeting was also generated: 5\u0026rsquo; ACTACCGTTGTTATAGGTG 3\u0026rsquo;. The DNAJC1 shRNAs and control shRNA were synthesized and inserted downstream of a U6 promoter in the pLVX-U6-EF1α-GFP-Puro lentiviral vector. Validation of all cloning steps was conducted through sequencing. The transfer plasmid containing the shRNA, the viral envelope plasmid, and the packaging plasmid were co-transfected into HEK293T cells using PEI transfection reagent (AC04L091, Shanghai Life-iLab Biotech). After 48 and 72 hours post-transfection, lentivirus-containing supernatants were harvested, filtered through a 0.45 \u0026micro;m filter (Millipore), and subsequently combined with PEG6000 overnight at 4\u0026deg;C. The mixture was concentrated via centrifugation at 4500 \u0026times; g for 30 minutes at 4\u0026deg;C. U251 and U87 cells were transduced with the lentivirus at a multiplicity of infection (MOI) of 50 accompanied by 10 \u0026micro;g/ml polybrene. Following 72 hours of viral infection, the culture medium was supplemented with 2 \u0026micro;g/ml puromycin, and the cells were maintained for an additional week to establish stable cell lines expressing both GFP and shRNA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eProtein Isolation and Western Blot Analysis\u003c/h2\u003e \u003cp\u003eTotal protein was isolated from cell lysates using RIPA buffer (Sangon, Shanghai, China) with a protease inhibitor cocktail (Genstar, Shenzhen, China). Protein concentration was determined via bicinchoninic acid assay (BCA kit, Biosharp, Anhui, China). Then, 25 \u0026micro;g of protein per sample was resolved on a 10% SDS-PAGE gel at 110 V and transferred to a PVDF membrane (Millipore, USA) at 300 mA. Blocking was performed using 5% BSA in TBST for 1 hour at room temperature. Primary antibodies were incubated overnight at 4\u0026deg;C. Following washes with TBST, membranes were incubated with secondary antibodies for 1 hour at room temperature. Protein bands were visualized using a FluorChem FC2 system (Alpha Innotech, USA) as per the manufacturer's protocol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eGrowth Curve Assay\u003c/h2\u003e \u003cp\u003eCell proliferation was assessed using a CCK-8 kit (Beyotime, Shanghai, China). Cells (2 \u0026times; 10^3 per well) were seeded in 96-well plates with 200 \u0026micro;L of 10% FBS medium. Post attachment, 10 \u0026micro;L of CCK-8 solution was added and incubated at 37\u0026deg;C for 90 minutes. Absorbance at 450 nm was measured with a microplate reader (Bio-Rad, USA). Assays were conducted at 0, 24, 48, and 72 hours post-seeding and replicated thrice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eColony Formation Assay\u003c/h2\u003e \u003cp\u003eLogarithmically growing cells (2 \u0026times; 10^3) were plated in a 6-cm dish with 5 mL of 10% FBS medium, ensuring even dispersion. After 2\u0026ndash;3 weeks of incubation at 37\u0026deg;C and 5% CO2, cells were fixed with methanol, stained with Giemsa, and colonies were counted upon dish inversion.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCell Apoptosis and Cycle Analyses\u003c/h2\u003e \u003cp\u003eFlow cytometry was employed for apoptosis and cell cycle analyses. For apoptosis, cells (5 \u0026times; 10^5) were cultured for 24, 48, or 72 hours, then exposed to 2% FBS medium for 24 hours. Post-harvesting, cells were stained with 7AAD and Annexin V-FITC for 30 minutes at 4\u0026deg;C in darkness. Analysis was performed using an EPICS XL flow cytometer (Beckman Coulter, USA) with CellQuest software. For cell cycle analysis, cells were fixed in 70% ethanol overnight at 4\u0026deg;C, rinsed, and stained with PI and RNase. A FACScan flow cytometer (BD Bioscience) was used for detection. Each assay was conducted in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWound Healing and Transwell Assay\u003c/h2\u003e \u003cp\u003eCell migration was evaluated through wound healing and transwell assays. For wound healing, cells (5 \u0026times; 10^5) in a 6-well plate were grown to 90% confluence, scratched with a pipette tip, and imaged at 0 and 24 hours. In transwell assays, cells (1 \u0026times; 10^4) were placed in the upper chamber of a transwell setup with complete medium as chemoattractant below. After 48 hours, cells were fixed, stained with crystal violet, and counted under a microscope. Each assay was performed thrice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCell Coculture\u003c/h2\u003e \u003cp\u003eA cell coculture system was established by differentiating THP-1 cells into macrophages using 100 ng/mL phorbol 12-myristate 13-acetate (PMA). After 24 hours, the macrophages were polarized into M2 phenotype by incubating with 20 ng/mL IL-4 for an additional 48 hours. For the coculture, 1 \u0026times; 10^5 macrophages were suspended in 500 \u0026micro;L of serum-free medium and seeded onto the upper transwell chamber membrane without Matrigel coating (24-well, 8 \u0026micro;m; Millipore). The lower compartment was filled with 500 \u0026micro;L of GBM cell supernatants. Following a 24-hour incubation period, the transwell chamber was washed thrice with PBS, stained with 0.1% crystal violet for 20 minutes, air-dried, photographed, and cell counts were conducted in at least five randomly chosen fields.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eData were analyzed with SPSS 25.0, presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, and derived from a minimum of three assays. R software (Version 4.2.1) was utilized for bioinformatics. Differences between two groups were evaluated using a two-tailed Student's t-test, while one-way ANOVA with Bonferroni's test compared multiple groups. Kaplan-Meier and log-rank tests assessed survival, Spearman's test examined correlations, and Cox regression analyzed group characteristics. ROC curve and AUC analyses gauged diagnostic accuracy. Significance levels were denoted as *, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; ***, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eDNAJC1 Expression is Elevated and May Play a Role in Human GBM Tumorigenesis\u003c/h2\u003e \u003cp\u003eTo examine the expression of DNAJC1 in tumors, we analyzed data from TCGA database. Our analysis revealed a significant upregulation of DNAJC1 in 20 different tumor types, including GBM and brain lower-grade glioma (LGG), compared to adjacent normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To validate these findings, we also analyzed RNA-seq data from TCGA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), GSE29796 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), and CGGA databases (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Consistently, the expression of DNAJC1 was significantly higher in GBM specimens compared to normal specimens, indicating a positive association between DNAJC1 and GBM.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFurthermore, we investigated the correlation between DNAJC1 and various clinical factors using the TCGA database (Table\u0026nbsp;1). Our results demonstrated that the expression of DNAJC1 gradually increased with the progression of GBM from WHO grade I to IV (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Additionally, GBM specimens with IDH mutations exhibited lower levels of DNAJC1 compared to those with wild-type IDH (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Moreover, DNAJC1 expression was significantly lower in GBM specimens with chromosome 1p/19q co-deletion compared to those without co-deletion (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Notably, GBM showed higher levels of DNAJC1 expression compared to less malignant subtypes such as astrocytoma, oligoastrocytoma, and oligodendroglioma (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eTo further evaluate the expression pattern of DNAJC1 in different glioma grades, we performed immunohistochemical staining on tissue samples obtained from patients with various tumor grades as well as normal brain tissue samples. Our results demonstrated a gradual increase in DNAJC1 expression from normal cerebral cortex to astrocytoma (WHO grade II) or oligoastrocytoma (WHO grade II), and further to anaplastic astrocytoma (WHO grade III) and anaplastic oligodendroglioma (WHO grade III). Notably, the highest expression level of DNAJC1 was observed in GBM (WHO grade IV) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI). These findings suggest that DNAJC1 is positively associated with clinical progression and may potentially act as a tumor activator in human GBM.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDNAJC1 Serves as an Unfavorable Prognostic Indicator and a Potential Diagnostic Biomarker for Human GBM.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the relationship between DNAJC1 expression and patient survival, we analyzed survival data obtained from the TCGA database. GBM patients were divided into two cohorts based on their DNAJC1 expression: high and low. The data, illustrated in Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C, show that patients with elevated DNAJC1 expression have significantly reduced overall survival (OS), disease-specific survival (DSS), and progression-free interval (PFI) in contrast to those with diminished expression. In scenarios involving IDH mutation, 1p/19q codeletion, or primary therapy outcome, the high-expression cohort consistently presented with poorer OS outcomes (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-F). Both univariate and multivariate analyses corroborated the status of DNAJC1 expression as an independent prognostic factor for GBM (Table\u0026nbsp;2). The CGGA database analysis corroborated these findings, revealing an inverse relationship between DNAJC1 expression and OS in patients with either initial or recurrent GBM (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG-H), further supporting DNAJC1's role as a negative prognostic indicator.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn addition, receiver operating characteristic (ROC) curve analysis highlighted DNAJC1's capacity to differentiate between primary GBM tumors and normal tissue controls, with an impressive area under the curve (AUC) of 0.931 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). The discriminative power of DNAJC1 was also consistent across variables such as IDH mutation status, 1p/19q codeletion status, and primary therapy outcomes, yielding AUC values of 0.709, 0.654, and 0.621, respectively (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ-L). These findings suggest that DNAJC1 is a promising diagnostic biomarker for GBM in a clinical context.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eDNAJC1 Enhances Proliferation and Suppresses Apoptosis in GBM Cells In Vitro\u003c/h2\u003e \u003cp\u003eTo elucidate DNAJC1's oncogenic function in GBM, we performed in vitro experiments using GBM cell lines. U251 cells were infected with lentiviruses carrying GFP alongside various DNAJC1-targeting shRNAs. GFP-positive cells underwent selection via puromycin (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Western blot analysis revealed marked downregulation of DNAJC1 in cells treated with shDNAJC1_2 and shDNAJC1_3, and a modest reduction with shDNAJC1_1, relative to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). For validation, we generated U87 GBM cell lines transfected with either a control vector or shDNAJC1_2. Consistent expression patterns were confirmed in both U87 and U251 cells through flow cytometry and western blotting (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eProliferation assays indicated that both U251 and U87 cells with DNAJC1 knockdown (shDNAJC1_2 and shDNAJC1_3) exhibited reduced growth compared to control vector-transfected cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE-F). Colony formation assays showed a substantial reduction in colony numbers in DNAJC1-silenced U251 cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-H). Cell cycle analysis indicated a decrease in S-phase fraction and an increase in G0/G1 and G2 phases upon DNAJC1 silencing in both cell lines (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI-L). Furthermore, apoptotic rates increased in a time-dependent manner following DNAJC1 downregulation in serum-deprived U251 (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eM-N) and U87 (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eO-P) cells, as determined by flow cytometry with Annexin V-FITC and 7AAD staining. Collectively, these data imply that DNAJC1 facilitates GBM cell proliferation, expedites cell cycle progression, and inhibits apoptosis in vitro.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eDNAJC1 Influences ECM Organization and Immune Response in the GBM Microenvironment\u003c/h2\u003e \u003cp\u003eTo decipher DNAJC1's role in the evolution and advancement of GBM, we conducted Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses on GBM samples exhibiting elevated DNAJC1 expression. The analysis presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA identified significant enrichment in biological functions related to the extracellular matrix structural constituent (GO-MF), the immunoglobulin complex (GO-CC), and complement activation (GO-BP). The KEGG pathway analysis revealed a notable correlation of the DNAJC1-associated gene cluster with pivotal processes and pathways, including the PI3K/AKT signaling pathway, cytokine-cytokine receptor interaction, focal adhesion, ECM-receptor interaction, and the IL-17 signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). These data point to DNAJC1's possible involvement in modulating the ECM and immune response within the GBM microenvironment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGene set enrichment analysis (GSEA) further corroborated these observations in the high DNAJC1 expression sample subset. We focused on gene clusters meeting the threshold of a nominal p-value (NOM)\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and a false discovery rate (FDR) q\u0026thinsp;\u0026lt;\u0026thinsp;0.25, calculating the normalized enrichment score (NES) to ascertain specific pathway enrichments. The analysis underscored significant enrichment in genes related to MET PROMOTES CELL MOTILITY (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), COLLAGENS (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), and ECM REGULATORS (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE), reinforcing DNAJC1's critical role in ECM modulation. Additionally, the enriched gene cluster was associated with pathways pertinent to INITIAL TRIGGERING OF COMPLEMENT (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), PD-1 SIGNALING (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG), and INTERLEUKIN 10 SIGNALING (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH), illustrating DNAJC1's intimate connection with immune response mechanisms within the GBM microenvironment. Notably, DNAJC1 was found to negatively regulate neuronal system development and was enriched in associated pathways such as NEURONAL SYSTEM (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI), DOPAMINE NEUROTRANSMITTER RELEASE (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ), and NEUROACTIVE LIGAND-RECEPTOR INTERACTION (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK). Collectively, the evidence emphasizes DNAJC1's central role in orchestrating ECM organization and immune dynamics, thereby promoting an environment conducive to GBM progression, invasion, and immune escape.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eDNAJC1 Knockdown Inhibits GBM Cell Migration and EMT\u003c/h2\u003e \u003cp\u003eReflecting on the GO and GSEA results that linked DNAJC1 expression to ECM organization, we explored the gene's effects on GBM cell motility. Wound healing assays demonstrated a marked reduction in migratory capabilities of U251 and U87 cells with silenced DNAJC1 (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-D). Similarly, transwell assays indicated fewer migrating cells on the membranes of the lower chambers when DNAJC1 expression was inhibited in U251 and U87 cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-H). These results robustly suggest that DNAJC1 is instrumental in promoting GBM cell migration in vitro.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eEpithelial-mesenchymal transition (EMT) plays a pivotal role in the metastasis of various solid tumors. We assessed the role of DNAJC1 in EMT using quantitative real-time PCR (qRT-PCR) to measure the impact of DNAJC1 knockdown on EMT marker expression in U251 cells. A significant reduction in the mRNA expression of EMT markers, including Vimentin, FN1, ETS1, SNAI1, and ZEB1, was noted following DNAJC1 suppression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI). Western blot analysis corroborated these findings, showing an upregulation of the epithelial marker E-cadherin and downregulation of the mesenchymal marker Vimentin in U251 cells with reduced DNAJC1 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ). These results affirm DNAJC1's role in EMT activation, thereby contributing to the migratory and invasive behavior of GBM cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eDNAJC1 Augments Immunosuppressive Cell Infiltration in the GBM Microenvironment\u003c/h2\u003e \u003cp\u003eOur investigation delved into the role of DNAJC1 in modulating immune cell infiltration within GBM. A distinct link was established between DNAJC1 expression and the presence of immunosuppressive cell types, such as macrophages, neutrophils, and T helper type 2 (Th2) cells, known to facilitate GBM tumorigenesis within the tumor microenvironment (TME) [references 19\u0026ndash;21]. Positive correlations were observed between DNAJC1 expression and macrophage (r\u0026thinsp;=\u0026thinsp;0.485, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), neutrophil (r\u0026thinsp;=\u0026thinsp;0.394, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001), and Th2 cell (r\u0026thinsp;=\u0026thinsp;0.485, P\u0026thinsp;\u0026lt;\u0026thinsp;0.001) infiltration (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB-D). Notably, groups with high DNAJC1 expression had significantly greater enrichment of macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG), neutrophils (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH), and Th2 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI) when compared to low-expression groups. These results point to DNAJC1's involvement in the recruitment of pro-tumorigenic immune cells within the GBM microenvironment. In contrast, there was no discernible association between DNAJC1 expression and the infiltration of anti-tumorigenic immune cells, such as CD8\u0026thinsp;+\u0026thinsp;T cells and Th1 cells, which were similarly distributed across both high-expression and low-expression DNAJC1 groups (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, E, F, J, K). Thus, our data underscore DNAJC1's role in fostering the infiltration of immune cells that support GBM tumorigenesis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eDNAJC1 Knockdown Reduces Macrophage Infiltration and M2 Macrophage Marker CD163 Expression In Vitro\u003c/h2\u003e \u003cp\u003eFurther investigating the interplay between DNAJC1 expression and macrophage infiltration, we employed a coculture system consisting of GBM cells and macrophages. When macrophages were cocultured with U251 and U87 cells with DNAJC1 knockdown (shDNAJC1_2 and shDNAJC1_3 for U251, shDNAJC1_2 for U87), we noted fewer labeled macrophages on the lower chamber membranes relative to control cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-D), aligning with our bioinformatic predictions (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). This suggests DNAJC1's potential role in enhancing macrophage infiltration within the GBM microenvironment. Additionally, DNAJC1 suppression led to a decrease in the M2 macrophage marker CD163 (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF), implying that GBM cell-derived DNAJC1 expression may be linked to the immunosuppressive M2 phenotype in macrophages.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe diagnostic paradigm for GBM has evolved to integrate molecular profiling alongside traditional histopathological examination. Clinically, molecular markers such as IDH mutations and 1p/19q codeletion are now routinely utilized for GBM diagnosis, prognosis assessment, and therapeutic decision-making\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. IDH, a critical enzyme in the Krebs cycle, catalyzes the conversion of isocitric acid into α-ketoglutarate (α-KG) and CO2, essential for energy production and biosynthetic precursor synthesis\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Typically occurring in the early phases of glioma development, IDH mutations are prevalent in oligodendroglioma, astrocytoma, and secondary GBM, but rare in primary GBM\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Patients with IDH-mutant GBM generally have a protracted disease course and improved outcomes compared to those with wild-type IDH\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. The codeletion of the short arm of chromosome 1 and the long arm of chromosome 19 is often found in younger glioma patients\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. The WHO's classification system identifies the 1p/19q codeletion as a distinctive marker for oligodendroglioma\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. As these chromosomal regions harbor essential genes for cellular growth and differentiation, this codeletion can inhibit GBM cell proliferation and vasculature formation, enhancing response to chemotherapy and ultimately leading to better patient prognoses\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eNonetheless, despite the employment of molecular markers such as IDH mutations and 1p/19q codeletion in the clinical management of GBM, patient outcomes remain dismal, with median survival rates of 14\u0026ndash;17 months\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Bioinformatic analysis of public databases has uncovered numerous novel differentially expressed genes that hold significant potential for improving GBM diagnostics and treatment strategies\u003csup\u003e\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThis study commenced with an analysis of the TCGA database to ascertain the expression pattern of DNAJC1. The gene was significantly upregulated in at least 20 tumor subtypes, with notably high levels in GBM or LGG, suggesting a potential oncogenic role for DNAJC1. Further examination of TCGA, CGGA, and GEO databases corroborated the elevated expression of DNAJC1 in GBM tissues, which increased concomitantly with higher WHO tumor grades. Additionally, DNAJC1 expression was inversely correlated with both IDH mutation and 1p/19q codeletion. Kaplan\u0026ndash;Meier survival analysis revealed that higher DNAJC1 expression was associated with poorer OS, DSS, and PFI in GBM patients. Conversely, patients with lower DNAJC1 expression displayed enhanced responses to chemotherapy, with higher complete response (CR), partial response (PR), and stable disease (SD) rates. These findings underscore DNAJC1's potential as a prognostic biomarker and its diagnostic relevance in GBM.\u003c/p\u003e \u003cp\u003eThe TME is instrumental in GBM growth and progression and consists of immune and non-immune elements that interact with tumor cells\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Components such as collagen, laminin, and fibronectin are integral to the TME structure, alongside extracellular matrix elements, cancer-associated fibroblasts (CAFs), and immunosuppressive cytokines like IL-10 and IL-17\u003csup\u003e30\u0026ndash;32\u003c/sup\u003e. Our analyses via GO, KEGG, and GSEA identified DNAJC1's involvement in extracellular matrix organization and collagen binding within the GBM TME. DNAJC1 also regulates complement and cytokine signaling, including IL-10, IL-17, and PD-1 pathways, and is associated with EMT. The suppression of DNAJC1 results in decreased EMT marker expression, suggesting its role in promoting EMT and thereby enhancing GBM cell invasion and migration.\u003c/p\u003e \u003cp\u003eMoreover, the infiltration of immune cells into the TME is critical in gliomagenesis\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Macrophages, particularly those with the M2 phenotype, dominate the inflammatory cell population within tumors and facilitate tumor progression by promoting growth, angiogenesis, migration, and resistance to various therapies\u003csup\u003e\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Th2 cells and immature neutrophils in the TME contribute to an immunosuppressive milieu that aids tumor immune evasion\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. In our research, we found that elevated DNAJC1 expression is positively associated with the infiltration of macrophages, neutrophils, and Th2 cells into the glioma TME. Inhibition of DNAJC1 led to reduced expression of the M2 macrophage marker CD163. Collectively, these findings support DNAJC1's role in gliomagenesis through the recruitment of immunosuppressive cells into the TME.\u003c/p\u003e \u003cp\u003eIn conclusion, bioinformatic analysis reveals that DNAJC1 exhibits high expression levels in human GBM specimens with a strong correlation to clinical prognostic outcomes. DNAJC1 is implicated in enhancing proliferation, migration, and the recruitment of immunosuppressive macrophages in glioblastoma, and its association with the expression of immunosuppressive molecules, such as CTLA-4, PD-1, and PD-L1, suggests a role in immune cell inhibition and tumor immune evasion. It appears that DNAJC1 may facilitate GBM growth and progression within the TME by supporting immune escape mechanisms and drug resistance, potentially through promoting the epithelial-mesenchymal transition (EMT) process and upregulating immune inhibitory signaling.\u003c/p\u003e \u003cp\u003eClinically, DNAJC1 holds promise as a prognostic marker and diagnostic biomarker for GBM. However, the complexity and heterogeneity of GBM necessitate further clinical validation and translational research. Personalized therapy, tailored to individual patient subtypes and clinical features, represents an important avenue for future GBM treatment strategies. The combined use of DNAJC1 with other molecular markers and clinical indicators may lead to more customized treatment approaches.\u003c/p\u003e \u003cp\u003eOur study, through a blend of bioinformatic inquiry and clinical data, contributes to a nuanced understanding of DNAJC1's function in gliomas. Notwithstanding, reliance on public databases could introduce bias, and in vitro loss-of-function experiments may not fully capture the complexity of human gliomas. Consequently, additional research employing animal models is imperative. Overall, our research underscores DNAJC1's pivotal role in glioma pathogenesis and underscores its potential as a significant prognostic biomarker and a candidate for targeted therapy, opening new pathways for advancing glioma diagnostics and treatment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate:\u003c/strong\u003e The research was approved by the Institutional Animal Care and Use Committee of the School of Medicine, Fourth Military Medical University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003eAll subjects provided written informed consent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u003c/strong\u003e The original contributions presented in the study are included in the article file, and further inquiries can be directed to the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e The authors declare no conflict of interest\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This research was funded by grants from the National Natural Science Foundation of China, grant number 82073361 and 82203274; the State Key Laboratory of Cancer Biology Project, grant number CBSKL2022ZZ21; the Key R\u0026amp;D Plan of Shaanxi Province, grant number 2023-YBSF-667; the Xi'an Municipal Health Commission grant, grant number 2022ms06.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u0026nbsp;\u003c/strong\u003eConceptualization, T.W., L.S. and X.C.; methodology, H.Z., W.Z. and L.S.; validation, H.Z., Y.H. and H.L.; formal analysis, W.Z.; investigation, T.W and L.S.; data curation, H.Z. and Y.H.; writing—original draft preparation, H.Z. and X.C.; writing—review and editing, T.W.; supervision, T.W and L.S.; project administration, T.W and L.S.; funding acquisition, T.W., L.S. and X.C. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e We would like to thank American Journal Experts (www.aje.cn) for its linguistic assistance during the preparation of this manuscript. We also would like to thank Dr. Jing Ye from Department of Pathology, Fourth Military Medical University for his help in immunohistochemical staining.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eRong, L.; Li, N.; Zhang, Z., Emerging therapies for glioblastoma: current state and future directions. \u003cem\u003eJ Exp Clin Cancer Res \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e41\u003c/em\u003e (1), 142.\u003c/li\u003e\n\u003cli\u003eYaghi, N. K.; Gilbert, M. R., Immunotherapeutic Approaches for Glioblastoma Treatment. \u003cem\u003eBiomedicines \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e10\u003c/em\u003e (2).\u003c/li\u003e\n\u003cli\u003eBellail, A. C.; Hunter, S. B.; Brat, D. J.; Tan, C.; Van Meir, E. G., Microregional extracellular matrix heterogeneity in brain modulates glioma cell invasion. \u003cem\u003eInt J Biochem Cell Biol \u003c/em\u003e\u003cstrong\u003e2004,\u003c/strong\u003e \u003cem\u003e36\u003c/em\u003e (6), 1046-69.\u003c/li\u003e\n\u003cli\u003eYang, K.; Wu, Z.; Zhang, H.; Zhang, N.; Wu, W.; Wang, Z.; Dai, Z.; Zhang, X.; Zhang, L.; Peng, Y.; Ye, W.; Zeng, W.; Liu, Z.; Cheng, Q., Glioma targeted therapy: insight into future of molecular approaches. \u003cem\u003eMol Cancer \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e21\u003c/em\u003e (1), 39.\u003c/li\u003e\n\u003cli\u003eXie, Z.; Janczyk, P. L.; Zhang, Y.; Liu, A.; Shi, X.; Singh, S.; Facemire, L.; Kubow, K.; Li, Z.; Jia, Y.; Schafer, D.; Mandell, J. W.; Abounader, R.; Li, H., A cytoskeleton regulator AVIL drives tumorigenesis in glioblastoma. \u003cem\u003eNat Commun \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e11\u003c/em\u003e (1), 3457.\u003c/li\u003e\n\u003cli\u003eZhang, L.; He, A.; Chen, B.; Bi, J.; Chen, J.; Guo, D.; Qian, Y.; Wang, W.; Shi, T.; Zhao, Z.; Shi, J.; An, W.; Attenello, F.; Lu, W., A HOTAIR regulatory element modulates glioma cell sensitivity to temozolomide through long-range regulation of multiple target genes. \u003cem\u003eGenome Res \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e30\u003c/em\u003e (2), 155-163.\u003c/li\u003e\n\u003cli\u003eJia, P.; Cai, H.; Liu, X.; Chen, J.; Ma, J.; Wang, P.; Liu, Y.; Zheng, J.; Xue, Y., Long non-coding RNA H19 regulates glioma angiogenesis and the biological behavior of glioma-associated endothelial cells by inhibiting microRNA-29a. \u003cem\u003eCancer Lett \u003c/em\u003e\u003cstrong\u003e2016,\u003c/strong\u003e \u003cem\u003e381\u003c/em\u003e (2), 359-69.\u003c/li\u003e\n\u003cli\u003eNicchitta, C. V., Re-evaluating the role of heat-shock protein-peptide interactions in tumour immunity. \u003cem\u003eNat Rev Immunol \u003c/em\u003e\u003cstrong\u003e2003,\u003c/strong\u003e \u003cem\u003e3\u003c/em\u003e (5), 427-32.\u003c/li\u003e\n\u003cli\u003eKampinga, H. H.; Bergink, S., Heat shock proteins as potential targets for protective strategies in neurodegeneration. \u003cem\u003eThe Lancet Neurology \u003c/em\u003e\u003cstrong\u003e2016,\u003c/strong\u003e \u003cem\u003e15\u003c/em\u003e (7), 748-759.\u003c/li\u003e\n\u003cli\u003eAghdassi, A.; Phillips, P.; Dudeja, V.; Dhaulakhandi, D.; Sharif, R.; Dawra, R.; Lerch, M. M.; Saluja, A., Heat shock protein 70 increases tumorigenicity and inhibits apoptosis in pancreatic adenocarcinoma. \u003cem\u003eCancer Res \u003c/em\u003e\u003cstrong\u003e2007,\u003c/strong\u003e \u003cem\u003e67\u003c/em\u003e (2), 616-25.\u003c/li\u003e\n\u003cli\u003eDudeja, V.; Vickers, S. M.; Saluja, A. K., The role of heat shock proteins in gastrointestinal diseases. \u003cem\u003eGut \u003c/em\u003e\u003cstrong\u003e2009,\u003c/strong\u003e \u003cem\u003e58\u003c/em\u003e (7), 1000-9.\u003c/li\u003e\n\u003cli\u003eIglesia, R. P.; Fernandes, C. F. L.; Coelho, B. P.; Prado, M. B.; Melo Escobar, M. I.; Almeida, G.; Lopes, M. H., Heat Shock Proteins in Glioblastoma Biology: Where Do We Stand? \u003cem\u003eInt J Mol Sci \u003c/em\u003e\u003cstrong\u003e2019,\u003c/strong\u003e \u003cem\u003e20\u003c/em\u003e (22).\u003c/li\u003e\n\u003cli\u003eRajesh, Y.; Biswas, A.; Banik, P.; Pal, I.; Das, S.; Borkar, S. A.; Sardana, H.; Saha, A.; Das, S. K.; Emdad, L.; Fisher, P. B.; Mandal, M., Transcriptional regulation of HSPB1 by Friend leukemia integration-1 factor modulates radiation and temozolomide resistance in glioblastoma. \u003cem\u003eOncotarget \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e11\u003c/em\u003e (13), 1097-1108.\u003c/li\u003e\n\u003cli\u003eQiu, X. B.; Shao, Y. M.; Miao, S.; Wang, L., The diversity of the DnaJ/Hsp40 family, the crucial partners for Hsp70 chaperones. \u003cem\u003eCell Mol Life Sci \u003c/em\u003e\u003cstrong\u003e2006,\u003c/strong\u003e \u003cem\u003e63\u003c/em\u003e (22), 2560-70.\u003c/li\u003e\n\u003cli\u003eSun, H.; Zou, H. Y.; Cai, X. Y.; Zhou, H. F.; Li, X. Q.; Xie, W. J.; Xie, W. M.; Du, Z. P.; Xu, L. Y.; Li, E. M.; Wu, B. L., Network Analyses of the Differential Expression of Heat Shock Proteins in Glioma. \u003cem\u003eDNA Cell Biol \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e39\u003c/em\u003e (7), 1228-1242.\u003c/li\u003e\n\u003cli\u003ePapalas, J. A.; Vollmer, R. T.; Gonzalez-Gronow, M.; Pizzo, S. V.; Burchette, J.; Youens, K. E.; Johnson, K. B.; Selim, M. A., Patterns of GRP78 and MTJ1 expression in primary cutaneous malignant melanoma. \u003cem\u003eMod Pathol \u003c/em\u003e\u003cstrong\u003e2010,\u003c/strong\u003e \u003cem\u003e23\u003c/em\u003e (1), 134-43.\u003c/li\u003e\n\u003cli\u003eShiba, N.; Yoshida, K.; Hara, Y.; Yamato, G.; Shiraishi, Y.; Matsuo, H.; Okuno, Y.; Chiba, K.; Tanaka, H.; Kaburagi, T.; Takeuchi, M.; Ohki, K.; Sanada, M.; Okubo, J.; Tomizawa, D.; Taki, T.; Shimada, A.; Sotomatsu, M.; Horibe, K.; Taga, T.; Adachi, S.; Tawa, A.; Miyano, S.; Ogawa, S.; Hayashi, Y., Transcriptome analysis offers a comprehensive illustration of the genetic background of pediatric acute myeloid leukemia. \u003cem\u003eBlood Adv \u003c/em\u003e\u003cstrong\u003e2019,\u003c/strong\u003e \u003cem\u003e3\u003c/em\u003e (20), 3157-3169.\u003c/li\u003e\n\u003cli\u003eBindea, G.; Mlecnik, B.; Tosolini, M.; Kirilovsky, A.; Waldner, M.; Obenauf, A. C.; Angell, H.; Fredriksen, T.; Lafontaine, L.; Berger, A.; Bruneval, P.; Fridman, W. H.; Becker, C.; Pages, F.; Speicher, M. R.; Trajanoski, Z.; Galon, J., Spatiotemporal dynamics of intratumoral immune cells reveal the immune landscape in human cancer. \u003cem\u003eImmunity \u003c/em\u003e\u003cstrong\u003e2013,\u003c/strong\u003e \u003cem\u003e39\u003c/em\u003e (4), 782-95.\u003c/li\u003e\n\u003cli\u003eWhite, K.; Connor, K.; Meylan, M.; Bougo\u0026uuml;in, A.; Salvucci, M.; Bielle, F.; O\u0026apos;Farrell, A. C.; Sweeney, K.; Weng, L.; Bergers, G.; Dicker, P.; Ashley, D. M.; Lipp, E. S.; Low, J. T.; Zhao, J.; Wen, P.; Prins, R.; Verreault, M.; Idbaih, A.; Biswas, A.; Prehn, J. H. M.; Lambrechts, D.; Arijs, I.; Lodi, F.; Dilcan, G.; Lamfers, M.; Leenstra, S.; Fabro, F.; Ntafoulis, I.; Kros, J. M.; Cryan, J.; Brett, F.; Quissac, E.; Beausang, A.; MacNally, S.; O\u0026apos;Halloran, P.; Clerkin, J.; Bacon, O.; Kremer, A.; Tching Chi Yen, R.; Varn, F. S.; Verhaak, R. G. W.; Saut\u0026egrave;s-Fridman, C.; Fridman, W. H.; Byrne, A. T., Identification, validation and biological characterization of novel Glioblastoma Tumour Microenvironment subtypes: Implications for precision immunotherapy. \u003cem\u003eAnn Oncol \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eFan, F.; Zhang, H.; Dai, Z.; Zhang, Y.; Xia, Z.; Cao, H.; Yang, K.; Hu, S.; Guo, Y.; Ding, F.; Cheng, Q.; Zhang, N., A comprehensive prognostic signature for glioblastoma patients based on transcriptomics and single cell sequencing. \u003cem\u003eCell Oncol (Dordr) \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e44\u003c/em\u003e (4), 917-935.\u003c/li\u003e\n\u003cli\u003eHan, S.; Liu, Y.; Cai, S. J.; Qian, M.; Ding, J.; Larion, M.; Gilbert, M. R.; Yang, C., IDH mutation in glioma: molecular mechanisms and potential therapeutic targets. \u003cem\u003eBr J Cancer \u003c/em\u003e\u003cstrong\u003e2020,\u003c/strong\u003e \u003cem\u003e122\u003c/em\u003e (11), 1580-1589.\u003c/li\u003e\n\u003cli\u003eShi, D. D.; Anand, S.; Abdullah, K. G.; McBrayer, S. K., DNA damage in IDH-mutant gliomas: mechanisms and clinical implications. \u003cem\u003eJ Neurooncol \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eHu, X.; Martinez-Ledesma, E.; Zheng, S.; Kim, H.; Barthel, F.; Jiang, T.; Hess, K. R.; Verhaak, R. G. W., Multigene signature for predicting prognosis of patients with 1p19q co-deletion diffuse glioma. \u003cem\u003eNeuro Oncol \u003c/em\u003e\u003cstrong\u003e2017,\u003c/strong\u003e \u003cem\u003e19\u003c/em\u003e (6), 786-795.\u003c/li\u003e\n\u003cli\u003eNuman, T.; Breedt, L. C.; Maciel, B.; Kulik, S. D.; Derks, J.; Schoonheim, M. M.; Klein, M.; de Witt Hamer, P. C.; Miller, J. J.; Gerstner, E. R.; Stufflebeam, S. M.; Hillebrand, A.; Stam, C. J.; Geurts, J. J. G.; Reijneveld, J. C.; Douw, L., Regional healthy brain activity, glioma occurrence and symptomatology. \u003cem\u003eBrain \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e145\u003c/em\u003e (10), 3654-3665.\u003c/li\u003e\n\u003cli\u003eWong, D.; Lee, T. H.; Lum, A.; Tao, V. L.; Yip, S., Integrated proteomic analysis of low-grade gliomas reveals contributions of 1p-19q co-deletion to oligodendroglioma. \u003cem\u003eActa Neuropathol Commun \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e10\u003c/em\u003e (1), 70.\u003c/li\u003e\n\u003cli\u003eLi, Y.; Ammari, S.; Lawrance, L.; Quillent, A.; Assi, T.; Lassau, N.; Chouzenoux, E., Radiomics-Based Method for Predicting the Glioma Subtype as Defined by Tumor Grade, IDH Mutation, and 1p/19q Codeletion. \u003cem\u003eCancers (Basel) \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e14\u003c/em\u003e (7).\u003c/li\u003e\n\u003cli\u003eWan, S.; Moure, U. A. E.; Liu, R.; Liu, C.; Wang, K.; Deng, L.; Liang, P.; Cui, H., Combined bulk RNA-seq and single-cell RNA-seq identifies a necroptosis-related prognostic signature associated with inhibitory immune microenvironment in glioma. \u003cem\u003eFront Immunol \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e13\u003c/em\u003e, 1013094.\u003c/li\u003e\n\u003cli\u003eManini, I.; Dalla, E.; Vendramin, V.; Cesselli, D.; Di Loreto, C.; Skrap, M.; Ius, T., Identification of a Prognostic Microenvironment-Related Gene Signature in Glioblastoma Patients Treated with Carmustine Wafers. \u003cem\u003eCancers (Basel) \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e14\u003c/em\u003e (14).\u003c/li\u003e\n\u003cli\u003eBikfalvi, A.; da Costa, C. A.; Avril, T.; Barnier, J. V.; Bauchet, L.; Brisson, L.; Cartron, P. F.; Castel, H.; Chevet, E.; Chneiweiss, H.; Clavreul, A.; Constantin, B.; Coronas, V.; Daubon, T.; Dontenwill, M.; Ducray, F.; Enz-Werle, N.; Figarella-Branger, D.; Fournier, I.; Frenel, J. S.; Gabut, M.; Galli, T.; Gavard, J.; Huberfeld, G.; Hugnot, J. P.; Idbaih, A.; Junier, M. P.; Mathivet, T.; Menei, P.; Meyronet, D.; Mirjolet, C.; Morin, F.; Mosser, J.; Moyal, E. C.; Rousseau, V.; Salzet, M.; Sanson, M.; Seano, G.; Tabouret, E.; Tchoghandjian, A.; Turchi, L.; Vallette, F. M.; Vats, S.; Verreault, M.; Virolle, T., Challenges in glioblastoma research: focus on the tumor microenvironment. \u003cem\u003eTrends in cancer \u003c/em\u003e\u003cstrong\u003e2023,\u003c/strong\u003e \u003cem\u003e9\u003c/em\u003e (1), 9-27.\u003c/li\u003e\n\u003cli\u003eBuoncervello, M.; Gabriele, L.; Toschi, E., The Janus Face of Tumor Microenvironment Targeted by Immunotherapy. \u003cem\u003eInt J Mol Sci \u003c/em\u003e\u003cstrong\u003e2019,\u003c/strong\u003e \u003cem\u003e20\u003c/em\u003e (17).\u003c/li\u003e\n\u003cli\u003eLi, X.; Bechara, R.; Zhao, J.; McGeachy, M. J.; Gaffen, S. L., IL-17 receptor-based signaling and implications for disease. \u003cem\u003eNat Immunol \u003c/em\u003e\u003cstrong\u003e2019,\u003c/strong\u003e \u003cem\u003e20\u003c/em\u003e (12), 1594-1602.\u003c/li\u003e\n\u003cli\u003eRivas, J. R.; Liu, Y.; Alhakeem, S. S.; Eckenrode, J. M.; Marti, F.; Collard, J. P.; Zhang, Y.; Shaaban, K. A.; Muthusamy, N.; Hildebrandt, G. C.; Fleischman, R. A.; Chen, L.; Thorson, J. S.; Leggas, M.; Bondada, S., Interleukin-10 suppression enhances T-cell antitumor immunity and responses to checkpoint blockade in chronic lymphocytic leukemia. \u003cem\u003eLeukemia \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e35\u003c/em\u003e (11), 3188-3200.\u003c/li\u003e\n\u003cli\u003eCrivii, C. B.; Bosca, A. B.; Melincovici, C. S.; Constantin, A. M.; Marginean, M.; Dronca, E.; Sufletel, R.; Gonciar, D.; Bungardean, M.; Sovrea, A., Glioblastoma Microenvironment and Cellular Interactions. \u003cem\u003eCancers (Basel) \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e14\u003c/em\u003e (4).\u003c/li\u003e\n\u003cli\u003eRoss, J. L.; Velazquez Vega, J.; Plant, A.; MacDonald, T. J.; Becher, O. J.; Hambardzumyan, D., Tumour immune landscape of paediatric high-grade gliomas. \u003cem\u003eBrain \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e144\u003c/em\u003e (9), 2594-2609.\u003c/li\u003e\n\u003cli\u003eMantovani, A.; Marchesi, F.; Malesci, A.; Laghi, L.; Allavena, P., Tumour-associated macrophages as treatment targets in oncology. \u003cem\u003eNat Rev Clin Oncol \u003c/em\u003e\u003cstrong\u003e2017,\u003c/strong\u003e \u003cem\u003e14\u003c/em\u003e (7), 399-416.\u003c/li\u003e\n\u003cli\u003eGutmann, D. H.; Kettenmann, H., Microglia/Brain Macrophages as Central Drivers of Brain Tumor Pathobiology. \u003cem\u003eNeuron \u003c/em\u003e\u003cstrong\u003e2019,\u003c/strong\u003e \u003cem\u003e104\u003c/em\u003e (3), 442-449.\u003c/li\u003e\n\u003cli\u003eBasu, A.; Ramamoorthi, G.; Albert, G.; Gallen, C.; Beyer, A.; Snyder, C.; Koski, G.; Disis, M. L.; Czerniecki, B. J.; Kodumudi, K., Differentiation and Regulation of T(H) Cells: A Balancing Act for Cancer Immunotherapy. \u003cem\u003eFront Immunol \u003c/em\u003e\u003cstrong\u003e2021,\u003c/strong\u003e \u003cem\u003e12\u003c/em\u003e, 669474.\u003c/li\u003e\n\u003cli\u003eLin, Y. J.; Wu, C. Y.; Wu, J. Y.; Lim, M., The Role of Myeloid Cells in GBM Immunosuppression. \u003cem\u003eFrontiers in immunology \u003c/em\u003e\u003cstrong\u003e2022,\u003c/strong\u003e \u003cem\u003e13\u003c/em\u003e, 887781.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 to 3 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-cancer-research-and-clinical-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jocr","sideBox":"Learn more about [Journal of Cancer Research and Clinical Oncology](https://www.springer.com/journal/432)","snPcode":"432","submissionUrl":"https://submission.nature.com/new-submission/432/3","title":"Journal of Cancer Research and Clinical Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"DNAJC1, glioblastoma, prognostic biomarker, extracellular matrix reorganization, macrophage infiltration","lastPublishedDoi":"10.21203/rs.3.rs-4002088/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4002088/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eGlioblastoma (GBM) is a high-grade and heterogeneous subtype of glioma that presents a substantial challenge to human health, characterized by a poor prognosis and low survival rates. Despite its known involvement in regulating leukemia and melanoma, the function and mechanism of DNAJC1 in GBM remain poorly understood.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eUtilizing data from the TCGA, CGGA, and GEO databases, we investigated the expression pattern of DNAJC1 and its correlation with clinical characteristics in GBM specimens. Loss-of-function experiments were conducted to explore the impact of DNAJC1 on GBM cell lines, with co-culture experiments assessing macrophage infiltration and functional marker expression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults: \u003c/strong\u003eOur analysis demonstrated frequent overexpression of DNAJC1 in GBM, significantly associated with various clinical characteristics including WHO grade, IDH status, chromosome 1p/19q codeletion, and histological type. Moreover, Kaplan‒Meier and ROC analyses revealed DNAJC1 as a negative prognostic predictor and a promising diagnostic biomarker for GBM patients. Functional studies indicated that silencing DNAJC1 impeded cell proliferation and migration, induced cell cycle arrest, and enhanced apoptosis. Mechanistically, DNAJC1 was implicated in stimulating extracellular matrix reorganization, triggering the epithelial-mesenchymal transition (EMT) process, and initiating immunosuppressive macrophage infiltration.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eOur findings underscore the pivotal role of DNAJC1 in GBM pathogenesis, suggesting its potential as a diagnostic and therapeutic target for this challenging disease.\u003c/p\u003e","manuscriptTitle":"DNAJC1 Facilitates Glioblastoma Progression by Promoting Extracellular Matrix Reorganization and Macrophage Infiltration","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-05 17:23:36","doi":"10.21203/rs.3.rs-4002088/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-07T15:39:08+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-05T20:14:56+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"f7654130-6ee3-49ad-8f1c-e0d3b29fe991","date":"2024-03-15T15:34:36+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-03-05T16:14:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-02T04:58:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-02T02:36:38+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Cancer Research and Clinical Oncology","date":"2024-03-01T04:46:54+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-cancer-research-and-clinical-oncology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jocr","sideBox":"Learn more about [Journal of Cancer Research and Clinical Oncology](https://www.springer.com/journal/432)","snPcode":"432","submissionUrl":"https://submission.nature.com/new-submission/432/3","title":"Journal of Cancer Research and Clinical Oncology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d2d98ef2-5781-42d8-ac80-c23b4ff8c126","owner":[],"postedDate":"March 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-06-23T00:19:04+00:00","versionOfRecord":{"articleIdentity":"rs-4002088","link":"https://doi.org/10.1007/s00432-024-05823-1","journal":{"identity":"journal-of-cancer-research-and-clinical-oncology","isVorOnly":false,"title":"Journal of Cancer Research and Clinical Oncology"},"publishedOn":"2024-06-22 00:19:04","publishedOnDateReadable":"June 22nd, 2024"},"versionCreatedAt":"2024-03-05 17:23:36","video":"","vorDoi":"10.1007/s00432-024-05823-1","vorDoiUrl":"https://doi.org/10.1007/s00432-024-05823-1","workflowStages":[]},"version":"v1","identity":"rs-4002088","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4002088","identity":"rs-4002088","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00