TAX1BP1 limits macrophage-myofibroblastlast transition in lupus kidney fibrosis

TAX1BP1 limits macrophage-myofibroblastlast transition in lupus kidney fibrosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article TAX1BP1 limits macrophage-myofibroblastlast transition in lupus kidney fibrosis xiaorong deng, xue jiang, fenglin chen, tian qian, haoyun luo, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7699737/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Lupus nephritis causes kidney failure in systemic lupus erythematosus. We asked whether raising levels of the TAX1BP1 could slow this damage. Using mice with lupus-like disease, we delivered a gene therapy that increased TAX1BP1 in kidney tubule cells. After four weeks, treated animals showed smaller lymph nodes and spleens, lower anti-DNA antibodies and serum creatinine, and less protein in the urine. Kidney fibrosis, judged by collagen staining, was markedly reduced. Single-cell sequencing revealed that TAX1BP1 was highest in proximal tubule cells and linked to decreased Galectin-3, a known driver of fibrosis. Immunofluorescence confirmed lower Galectin-3 and fewer α-SMA + macrophages, indicating fewer cells transitioning into myofibroblasts. We conclude that boosting TAX1BP1 in proximal tubule cells limits kidney fibrosis by reducing Galectin-3 and blocking macrophage-to-myofibroblast transition, offering a potential new strategy against lupus nephritis. systemic lupus erythematosus lupus nephritis TAX1BP1 Galectin-3 macrophage-to-myofibroblast transition Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1.Introduction Lupus nephritis (LN) is a form of glomerulonephritis and constitutes one of the most severe organ manifestations of systemic lupus erythematosus (SLE). About half of adults and 70% of children with lupus will develop LN.[ 1 , 2 ] Despite advancements in understanding the genetic and pathogenetic basis of LN and improvements in treatment options, LN remains a significant cause of morbidity and mortality in SLE patients. The main clinical manifestations of LN are proteinuria, haematuria and swelling, which may also cause acute nephritic syndrome, acute progressive nephritic syndrome and nephrotic syndrome. [ 3 , 4 ] Renal fibrosis is a common pathological feature in almost all forms of chronic kidney disease[ 5 ] ,6 . During fibrosis, myofibroblasts, which are defined by the expression of α-SMA, play a crucial role in collagen matrix production.[ 6 ] In both human and experimental mouse models of chronic kidney disease, the transition of macrophages to myofibroblasts (MMT) also serves as a significant source of myofibroblasts in the fibrosing kidney.[ 6 , 7 ] TAX1BP1 is a conserved ubiquitin-binding protein that contributes to autophagy, thereby regulating cell death, inflammatory signalling pathways and innate immunity.[ 8 – 10 ] In addition, TAX1BP1 can regulate A20 function in anti-inflammatory and antiviral signalling pathways.[ 11 ] Our previous study showed that TAX1BP1 participates in SLE by regulating monocyte/macrophage function, and it is negatively corelated with the SLEDAI score and dsDNA level.[ 12 ] Thus, TAX1BP1 may be a key process in SLE, and targeting TAX1BP1 may be a novel and specific therapy for SLE. However, the role of TAX1BP1 in inhibiting renal fibrosis remains unclear. In this study, adeno-associated viruses carrying overexpressed TAX1BP1 were injected by tail vein in MRL/lpr mice, and the changes in lupus erythematosus–related indicators were observed after 4 weeks. We have made the first find that TAX1BP1 overexpression in MRL/lpr inhibits renal fibrosis by blocking MMT in lupus nephritis via downregulating Galectin-3(Gal-3) in proximal tubular cells (PTC). 2. Subjects and Methods 2.1. AAV preparation The experimental construct rAAV-Ef1α-tax1bp1-2A-EGFP-WPREs was generated and packaged into AAV capsids by BrainVTA Corporation (Wuhan, China). rAAV-EF1α-EGFP-WPRE-hGH polyA was used as the control virus. Both constructs were prepared at a viral titre of 5 × 10¹² vg/mL. 2.2 Animal and experimental treatment The animal experiments in this study were conducted in accordance with the experimental protocol approved by the Medical Ethics Committee of the Third Affiliated Hospital of Chongqing Medical University (ethic approval no. IACUC-CQMU-2024-0642). MRL/lpr mice (8 weeks) were purchased from Saiye (Suzhou) Biological Technology Co. Ltd., with an initial body weight of 25.93 ± 1.18 g. The animals were housed in Chongqing Medical University Animal Research Center in a specific pathogen-free environment with a 12 h light–dark cycle, and the temperature was maintained at 24 °C–26 °C. The mice were randomly divided into two groups. The AAV-TAX1BP1 group received an intravenous administration of adeno-associated viral serotype 9 (AAV9) vector harbouring the TAX1BP1 gene via tail vein injection at 12 weeks of age. The AAV-EGFP group received AAV-EGFP as a control. Mouse urine was collected weekly for urine protein testing. At the end of the experiment, the spleen of each group was weighed. The kidneys were collected for subsequent experiments. Peripheral lymph nodes with a diameter greater than 4 mm were evaluated. 2.3 Measurement of blood ds-DNA, ANA, serum creatinine (Scr) and urine protein Fresh serum was collected at the end of the experiment. The amount of anti-dsDNA antibody and anti-ANA body was measured by using ELISA, which was purchased from Shanghai Jianglai Industrial Limited by Share Ltd. (Lot, JL12477, JL17316). An ELISA kit from Wuhan Fine Biotech Co. Ltd. (Lot, EM1982) was used to analyse urine albumin levels in accordance with the protocol. 2.4 Quantitative real-time PCR assay Total RNA was extracted from kidney tissues using the TRIzol reagent (Invitrogen). The extracted RNA was reverse transcribed into cDNA using the HiScript III qRT SuperMix (Cowin, CW0957). Quantitative real-time PCR (qPCR) was performed using the 2× ChamQ SYBR qPCR Master Mix (Vazyme) on a 7300 Real-Time PCR System (Applied Biosystems). Relative expression levels were normalised to those of the normal group using the 2 −∆∆Ct method. The primer sequences used for RT-qPCR are listed in Table 1 . Table.1 The primers information of genes in this study primer Forward (5′–3′) Reverse (5′–3′) （b） lgals3 CTGCTGCTGGCCCTTATG TGTTTGCGTTGGGTTTCAC 126 ctss TCCTATCCCTACAAAGC TTCACAAGCCAGTAATCT 284 lghm GTTCCTGAGTCTGCCTTTA TGGAGAATCTTAGCGAGTA 176 TAX1bp1 GCCAGCCTGCTCGAAAC TCCCATGCCCACGTAAAT 120 GAPDH AAATTCAACGGCACAGTCAA TAGACTCCACGACATACTCAGCA 133 2.5 Western blotting assay Kidney tissue was weighed and washed two times with phosphate-buffered saline. RIPA lysate (1:100) and phosphorylase inhibitors (1:100) were added to the chopped renal tissue. After homogenisation at 4 °C, the tissue sample was transferred to a sterile EP tube. Then, it was centrifuged at 10,000× g for 15 min, and the supernatant protein concentration was quantified via bicinchoninic acid assay. Protein was denatured at 95 °C for 5 min. SDS-PAGE gel of different concentrations was prepared to separate the target proteins. Electrophoresis was performed at 80 V when the samples were run on a concentration gel. Then, the protein was transferred to a PVDF membrane at 300 mA and incubated with a target antibody overnight at 4 °C post blocking. The membrane was washed three times and incubated in the secondary antibody for 1 h at room temperature (RT). After washing three times, the protein bands were detected using a Bio-Rad developer. The primary and secondary antibodies are listed in the supplementary material. 2.6 Haematoxylin–eosin and Masson staining The kidney tissues were fixed with 4% paraformaldehyde, then trimmed, dehydrated and dipped in wax, embedded, sectioned, dewaxed, stained and sealed. Haematoxylin–eosin and Masson staining were performed in accordance with the manufacturer’s instructions. Different pathological phenomena in the sections were recorded using an upright optical microscope (Nikon ECLIPSE E100, Japan) and imaging system (Nikon DS-U3, Japan). Finally, the slides were evaluated by an experienced pathologist blinded to the treatment. Renal histopathological changes were scored semi-quantitatively: 0–4 points (0, none; 1, mild; 2, mild-moderate; 3, moderate; 4, severe). 2.7 Immunofluorescence assays The paraffin sections were deparaffinised, rehydrated, antigen retrieved and endogenous peroxidase activity blocked. Then, 3% BSA was used as a confining liquid-covered tissue for 30 min. The target antibody was added to the section and incubated overnight at 4 °C. Alternatively, the sections were equilibrated with recombinant dT enzyme, Biotin-DuTP labelling mix and Bration buffer (1:5:50 μL). After the sections were slightly shaken and dried, the samples were incubated with Streptavidin-HRP (HRP-labelled) at RT for 50 min. Next, newly DAB colour developing solution was added, and DAPI was used for nuclear counterstaining. The sections were dehydrated and mounted using a SweSuper Clean BioMount medium. Tissue staining was visualised under a microscope (Leica, Germany). In addition, image acquisition and analysis were performed. The positive glomerular arand secondary antibodies used for immunohistochemistry are listed in supplemen materials. Wheas were analysed as a percentage of the total area. The fluorescence intensity of 10 randomly collected glomeruli was analysed for each group using ImageJ software. 2.8 scRNA-seq data analysis In accordance with the standardised protocols, renal tissue was cryopreserved, dissociated and processed using the Singleron Matrix single-cell sequencing platform. Subsequently, sequencing libraries were constructed using the GEXSCOPE kit and subjected to high-throughput sequencing on the Illumina NovaSeq platform, generating approximately 150–200 million sequencing reads per sample. The raw data derived from the Singleron pipeline were processed using a customised bioinformatics workflow based on the Matrix platform analytical tools. For comprehensive cell population analysis, clustering algorithms were implemented using the CelloScope computational toolkit, facilitating global clustering across the entire cellular cohort and refined and secondary clustering within distinct cell types. To ensure data integration and batch effect correction, single-cell RNA sequencing datasets were consolidated into a unified object and aligned via Harmony integration. Quality control measures were applied to exclude cells with fewer than 300 detected genes, more than 8000 detected genes or mitochondrial content exceeding 10%, thereby maintaining data quality and integrity. 3. Quantification and statistical analysis Statistical analyses were performed using GraphPad Prism 10.0 (GraphPad, USA). At least three biological replicates were performed for each experiment. Student’s t-test or one-way analysis of variance was adopted for statistical analyses. P < 0.05 indicated that a difference was statistically significant. 4. Results 4.1 TAX1BP1 overexpression reduced enlarged lymph nodes and spleen weight Before starting the experiment, we confirmed through a pilot study that the expression of TAX1BP1 in the kidneys of MRL/lpr mice is lower than that in MRL/MPJ mice by Western blot (Fig. 1A). Then, we treated the mice in accordance with Fig. 1B. We counted the number of peripheral lymph nodes with a diameter greater than 4 mm in both groups and performed statistical analysis at the end of the experiment (Fig. 1C, F). In addition, the weight of the spleen in the AAV-TAX1BP1 group was significantly reduced (Fig. 1D, E). 4.2 TAX1BP1 overexpression reduced the level of dsDNA and Scr Following the AAV-mediated overexpression of TAX1BP1, a significant decrease in the rate of urinary albumin excretion was observed (Fig. 2A) The expression level of blood anti-dsDNA (Fig. 2B) and Scr (Fig. 2C) significantly decreased. However, no significant difference was observed in the levels of ANA (Fig. 2D). 4.3 TAX1BP1 overexpression improved renal function and alleviated renal injury The urinary protein concentration in MRL/lpr mice increased at week 12. HE staining indicates a significant reduction in glomerular and periglomerular inflammatory cell infiltration in the AAV-TAX1BP1 group at week 16 (Fig. 2E and F). In addition, Masson staining indicates a decrease in glomerular collagen in the AAV-TAX1BP1 group compared with the AAV-EGFP group at week 16 (Fig. 2G). 4.4 Single-cell sequencing revealed that PTC were the primary site of TAX1BP1 overexpression in the kidneys Renal biopsy single-cell sequencing was performed to identify the primary cells expressing TAX1BP1 of the kidney at the end of the experiment. Low-resolution clustering of renal cells revealed 10 distinct clusters (Fig. 3A), which were annotated on the basis of lineage-specific marker genes and up-regulated transcripts (Fig. 3B-K): PTC marked by Pck1, T cells (CD3g), B cells (Lglv3), distal convoluted tubular cells (Aqp2), thick ascending limb cells (Slc12a1), endothelial cells (Sprr1a), macrophages (CD68), smooth muscle cells (Cald1), monocytes (Ly6c1) and podocytes (Nphs2). Comparative analysis of TAX1BP1 expression revealed significant heterogeneity amongst clusters. Notably, PTC in the AAV-TAX1BP1 group exhibited a significant increase in TAX1BP1 transcript levels compared with the AAV-EGFP group (Fig. 4A). Gene expression differences in PTC between the AAV-TAX1BP1 and AAV-EGFP groups were analysed by GO analysis. A total of 24 differentially expressed genes were identified in PTC subpopulations (Table 2). Comparative gene expression analysis showed a significant down-regulation of Lgals3 in the AAV-TAX1BP1 group by Q-PCR (Fig. 4C, G). Correspondingly, protein blotting confirmed a decrease in Gal3-3 protein levels, which was encoded by Lgals3 (Fig. 4F). Lgals3 is enriched in pathways related to biological processes (BPs) such as extracellular matrix (ECM) organisation, macrophage chemotaxis and migration (Fig. 4B). Lgals3 influences molecular function (MF) such as ECM binding, immunoglobulin binding and immunoglobulin receptor binding (Fig. 4B). We further analysed the genes enriched in association with macrophage-associated fibrosis. BP influences cell chemotaxis, leukocyte aggregation, macrophage chemotaxis and migration (Fig. 4H). MF enriches chemokine and cytokine activity (Fig. 4J). Table2 differentially expressed genes were identified in PTC subpopulations p_val avg_log2FC pct.1 pct.2 p_valadj Ighm 0.000000e+00 0.5717835 0.229 0.151 0.000000e+00 lghg3 2.339184e-238 0.2810816 0.371 0.537 4.678368e-235 Igha 3.816523e-154 0.3970739 0.204 0.108 7.633046e-151 Hmgcs2 7.613338e-127 -0.2984575 0.827 0.439 1.522668e-123 Ren1 2.529718e-89 -0.4134640 0.583 0.192 5.059436e-86 Dnase1 1.976468e-87 -0.2878083 0.829 0.478 3.952937e-84 lghg2b 5.638261e-78 0.4999737 0.255 0.074 1.127652e-74 Spp2 4.276533e-46 0.2821983 0.854 0.586 8.553065e-43 Cyp2a5 1.424902e-43 -0.2571938 0.839 0.609 2.849805e-40 Ccl5 1.070688e-41 0.5197757 0.504 0.472 2.141375e-38 Gm26917 4.907816e-35 -0.2502686 0.725 0.465 9.815633e-32 Nat8 1.182006e-28 -0.2929536 0.799 0.550 2.364012e-25 Ctss 5.710750e-25 0.2687283 0.540 0.503 1.142150e-21 Hba-a1 6.063205e-18 1.7691902 0.411 0.207 1.212641e-14 Hpd 1.939391e-12 -0.2564851 0.832 0.676 3.878783e-09 Lgals3 2.236164e-12 0.2737040 0.543 0.484 4.472328e-09 Lyz2 2.128999e-10 0.3924240 0.677 0.497 4.257998e-07 Jchain 1.008182e-08 0.4286706 0.377 0.158 2.016365e-05 Acaa1b 2.510583e-07 -0.2624558 0.865 0.812 5.021165e-04 Hbb-bs 1.914069e-06 1.5120385 0.503 0.253 3.828138e-03 Ctsb 2.340640e-05 0.2641519 0.793 0.685 4.681280e-02 Tmem176a 5.263824e-05 0.3152015 0.877 0.754 1.052765e-01 H2-Eb1 3.950594e-04 0.2933672 0.896 0.747 7.901188e-01 Klk1 8.462938e-01 -0.3113672 0.783 0.646 1.000000e+00 4.5 TAX1BP1 overexpression in PTC reduced Gal-3 in PTC and α-SMA on macrophages We also detected Gal-3 expression on PTC and changes in macrophages. Immunofluorescence assays demonstrated a reduction in Gal-3 expression on ABCG2 + cells (Fig. 5A and B). The expression level of CD68+ cell and α-SMA on CD68+ macrophages in the AAV-TAX1BP1 group decreased (Fig. 5C, D and E). Furthermore, we detection of key fibrotic proteins revealed that compared with the AAV-EFGP group, AAV-TAX1BP1 decreased the protein expression of TGF-β1, and Smad3 protein levels. 5. Discussion LN is a severe manifestation of SLE, characterized by significant renal inflammation and fibrosis, which often leads to end-stage renal disease. Despite advancements in understanding the genetic and pathogenetic basis of LN, current treatments, including immunosuppressive therapies with mycophenolate mofetil or cyclophosphamide and glucocorticoids, remain suboptimal. [13,14] Therefore, identifying novel therapeutic targets is crucial for improving outcomes in LN patients. The major findings from our previous study revealed that TAX1BP1 was negatively corelated with the SLEDAI score and the level of dsDNA in patients with SLE.[12] In this study, the overexpression of TAX1BP1 via tail vein injection significantly attenuated peripheral lymph node enlargement(Fig. 1C and F) and reduced blood anti-dsDNA (Fig. 2B) and Scr levels (Fig. 2C), which is closely correlated to the severity of SLE.[13–15] We also detected the changes in urine protein levels weekly after viral injection. The results indicated that the trend of urine protein increase in the AAV-TAX1BP1 group was significantly slowed down compared with the AAV-EGFP group. A decrease was also observed (Fig. 2A). The slowing of the urinary protein excretion curve is a clinically relevant outcome, as proteinuria is a marker of kidney damage in SLE.[16]Our results indicate that TAX1BP1 overexpression may slow the progression of nephritis, potentially improving renal prognosis. Previous studies have demonstrated that TAX1BP1 can modulate renal PTC apoptosis and inflammation through the NF-kB pathway, thereby alleviating acute kidney injury.[17–19] However, our experimental results indicated no significant differences between the two groups(Supplementary Materials). In addition, the decrease in renal inflammatory cell infiltration indicates that TAX1BP1 overexpression may have a direct anti-inflammatory effect within the kidney of LN. This phenomenon is a significant advancement, as renal inflammation is a key pathological feature of LN.[20] In addition, Masson staining indicates a decrease in glomerular collagen in the AAV-TAX1BP1 group (Fig.2E,G), which indicates that TAX1BP1 overexpression may exert a renoprotective effect. This effect could delay or even reverse the progression of renal fibrosis, which is a hallmark of chronic kidney disease in LN. Given the progressive nature of renal fibrosis in LN, the ability of TAX1BP1 to mitigate this process shows great application potential in improving the long-term prognosis of patients with SLE. Nextly, scRNA-seq was applied to renal tissue in both groups. TAX1BP1 overexpression was most pronounced in PTC (Fig4.A). This localisation is crucial, as the PTC are key sites for immune complex deposition and inflammation in LN. Immune deposits are often observed along the tubular basement membrane in patients with LN. Previous studies have confirmed that anti‐dsDNA antibodies contribute to renal tubulo-interstitial inflammation through binding to PTC and induction of pro‐inflammatory mediators in LN.[19] The high IFN response signature and fibrotic signature in tubular cells were associated with failure to respond to treatment[21]. PTC have a capacity for antigen cross-presentation, thereby inducing cytotoxic CD8+ T cells in vitro, which may contribute to the pathology of immune-mediated glomerulonephritis [22]. We further analysed the differentially expressed genes in PTC. A total of 24 genes were found, among which Lgals3, CTSS and Lghm exhibited the most significant differences in expression (Fig. 4C, D, E). In addition, RT-qPCR shows that Lgals3 significantly decreases in AAV-TAX1BP1 group (Fig. 4G). Gal-3 decreased in AAV-TAX1BP1 group. (Fig. 4F) Immunofluorescence assays demonstrated a reduction in Gal-3 expression on PTC (Fig. 5A). Our analysis revealed that it exhibited significant differences in the pathways of renal filtration, ECM organisation, macrophage chemotaxis and migration, which is closely associated with the excessive proliferation of mesangial cells and may lead to glomerular fibrosis, a key pathological feature of LN.[23] Previous studies have confirmed that metformin can reduce the infiltration of F4/80-positive macrophages in the kidneys of diabetic mouse models, thereby alleviating renal inflammatory injury.[24] Our results indicate that the down-regulation of Lgals-3 expression in PTC may be closely related to the chemotaxis and migratory functions of macrophages (Fig.2C). Lgals-3 affects macrophage movement by altering ECM composition or binding to macrophage receptors.[25] Endogenous Galectin-8 suppresses Th17 cell infiltration and renal fibrosis via the TAX1BP1–autophagy axis[26,27]. Abnormal collagen expression may promote macrophage infiltration, worsening renal damage. [28] Lgals3 can exacerbate LN through immune complex deposition and immune cell activation, making it a potential therapeutic target. Studies in Gal3-/- mice show attenuated peritoneal inflammation, positively correlated with LN.[29,30]. MMT is a significant source of myofibroblasts in the fibrosing kidney in both human and experimental mouse models of chronic kidney disease. Our result showed the expression level of CD68+ cell and α-SMA on CD68+ macrophages in the AAV-TAX1BP1 group decreased (Fig. 5C, D and E). This suggested that TAX1BP1 overexpression in PTC can downregulate Gal-3 expression, thereby reducing MMT which renal inflammation and fibrosis. This is consistent with previous research indicating that TAX1BP1 participates in SLE activity by regulating antigen presentation in monocytes and inflammatory responses in M1 macrophages.[12] Additionally, TGF-β/Smad3 signaling is the master regulator of renal fibrosis.[31]The involvement of TGF-β signaling in the MMT process has been well documented, and our results suggest that TAX1BP1 may interact with this pathway to exert its protective effects(Fig5.F). In conclusion, we have made the first find that TAX1BP1 overexpression in PTC inhibits renal fibrosis by blocking MMT in lupus nephritis via downregulating Gal-3 in PTC. This finding provides novel insights into the therapeutic potential of TAX1BP1 overexpression in PTC for mitigating renal fibrosis in LN. Future studies should further explore the mechanisms underlying TAX1BP1's effects on MMT and its potential as a therapeutic target in LN. Limitations and Future Directions Our study provides preliminary evidence for the role of TAX1BP1 in SLE. The small sample size and lack of human data limit the generalisability of our findings. Future studies should aim to replicate these findings in larger cohorts and explore the potential clinical applications of TAX1BP1 in patients with SLE. Declarations Ethics approval and consent to participate This study has been approved by the Medical Ethics Committee of the Third Affiliated Hospital of Chongqing Medical University (ethic approval no. IACUC-CQMU-2024-0642). Availability of data and material All data are included in the supplementary files. Competing interests The authors declare no competing interests. Funding This work was supported by the National Natural Science Foundation of China (82173408, 82405590). Authors ’ contributions Writing‐Original Draft: Xiaorong Deng. Conceptualization:Xiaorong Deng. Visualization: Deming Liu, Fei hao. Methodology: Xue Jian, Fenglin Chen. Formal analysis:Tian Qian, Haoyun Luo Funding acquisition: Fei hao,Fenglin Chen. Writing‐review and editing: Xiaorong Deng. All authors read and approved the final manuscript. Acknowledgements We thank Prof. Bing Ni for instructive suggestions on the work.We also thank Fujin Yang and Xi Chen for technical assistance. References Antar, S. A., Ashour, N. A., Marawan, M. E. et al . (2023). Fibrosis: Types, effects, markers, mechanisms for disease progression, and its relation with oxidative stress, immunity, and inflammation. International Journal of Molecular Sciences , 24(4), 4004. https://doi.org/10.3390/ijms24044004 Bauer, C.-J., Karakostas, P., Weber, N. et al . (2023). Comparative analysis of contemporary anti-double stranded DNA antibody assays for systemic lupus erythematosus. Frontiers in Immunology , 14, 1305865. https://doi.org/10.3389/fimmu.2023.1305865 Bethunaickan, R., Berthier, C. C., Ramanujam, M. et al . (2011). A unique hybrid renal mononuclear phagocyte activation phenotype in murine systemic lupus erythematosus nephritis. Journal of Immunology , 186(8), 4994–5003. https://doi.org/10.4049/jimmunol.1003010 Broder, A., Mowrey, W. B., Khan, H. N. et al . (2018). Tubulointerstitial damage predicts end stage renal disease in lupus nephritis with preserved to moderately impaired renal function: A retrospective cohort study. Seminars in Arthritis and Rheumatism , 47(4), 545–551. https://doi.org/10.1016/j.semarthrit.2017.07.007 Chang A, Clark MR, Ko K. (2021). Cellular aspects of the pathogenesis of lupus nephritis. C urrent Opinion in Rheumatology, 33(2), 197–204. https://doi.org/10.1097/BOR.0000000000000777 Chen, S.-Y., Wang, C.-T., Chen, C.-Y. et al . (2023). Galectin-3 mediates NETosis and acts as an autoantigen in systemic lupus erythematosus-associated diffuse alveolar haemorrhage. International Journal of Molecular Sciences , 24(11), 9493. https://doi.org/10.3390/ijms24119493 De Vriese, A. S., Sethi, S., & Fervenza, F. C. (2025). Lupus nephritis: Redefining the treatment goals. Kidney International , 107(2), 198–211. https://doi.org/10.1016/j.kint.2024.10.018 Der, E., Suryawanshi, H., Morozov, P. et al . (2019).Tubular cell and keratinocyte single-cell transcriptomics applied to lupus nephritis reveal type I IFN and fibrosis relevant pathways. Nat Immunol 20, 915–927 https://doi.org/10.1038/s41590-019-0386-1 Faustini, F., Idborg, H., Fuzzi. et al . (2023). Urine galectin-3 binding protein reflects nephritis activity in systemic lupus erythematosus. Lupus , 32(2), 252–262. https://doi.org/10.1177/09612033221145534 Fava, A., & Petri, M. (2019). Systemic lupus erythematosus: Diagnosis and clinical management. Journal of Autoimmunity , 96, 1–13. https://doi.org/10.1016/j.jaut.2018.11.001 He YS, Hu YQ, Xiang K. et al . （2022） Therapeutic Potential of Galectin-1 and Galectin-3 in Autoimmune Diseases. Current Pharmaceutical Design , 28(1), 36–45. https://doi.org/10.2174/1381612827666210927164935 Hsieh, C., Chang, A., Brandt, D. et al . (2011). Tubulointerstitial inflammation and scarring predict outcome in lupus nephritis. Arthritis Care and Research , 63 (6), 865–874. https://doi.org/10.1002/acr.20441 Huen, S. C., & Cantley, L. G. (2017). Macrophages in renal injury and repair. Annual Review of Physiology , 79(1), 449–469. https://doi.org/10.1146/annurev-physiol-022516-034219 Iwata, Y., Boström, E. A., Menke, J. et al . (2012). Aberrant macrophages mediate defective kidney repair that triggers nephritis in lupus-susceptible mice. Journal of Immunology , 188(9), 4568–4580. https://doi.org/10.4049/jimmunol.1102154 Jiang, Q., Zhao, Q., Chen, Y. et al . (2023). Galectin-3 impairs calcium transients and β-cell function. Nat Commun, 2024; 1;15(1):3682. https://doi.org/10.3389/fimmu.2023.1305865 Li, G., Yang, H., Zhang, D. et al . (2024). The role of macrophages in fibrosis of chronic kidney disease. Biomedicine & Pharmacotherapy , 177, 117079. https://doi.org/10.1016/j.biopha.2024.117079 Linke, A., Cicek, H., Müller, A. et al . (2022). Antigen cross-presentation by murine proximal tubular epithelial cells induces cytotoxic and inflammatory CD8+ T cells. Cells , 11(9), 1510. https://doi.org/10.3390/cells11091510 Mahajan, A., Amelio, J., Gairy, K. et al . (2020). Systemic lupus erythematosus, lupus nephritis and end-stage renal disease: A pragmatic review mapping disease severity and progression. Lupus , 29(9), 1011–1020. https://doi.org/10.1177/0961203320932219 Matsushita, N., Suzuki, M., Ikebe, E. et al . (2016). Regulation of B cell differentiation by the ubiquitin-binding protein TAX1BP1. Scientific Reports , 6(1), 31266. https://doi.org/10.1038/srep31266 Qian, T., Huo, B., Deng, X. et al . (2023). Decreased TAX1BP1 participates in systemic lupus erythematosus by regulating monocyte/macrophage function. International Immunology , dxad027. https://doi.org/10.1093/intimm/dxad027 Reyes-Thomas, J., Blanco, I., & Putterman, C. (2011). Urinary biomarkers in lupus nephritis. Clinical Reviews in Allergy and Immunology , 40(3), 138–150. https://doi.org/10.1007/s12016-010-8197-z Roger, E., Chadjichristos, C. E., Kavvadas, P. et al . (2023). Connexin-43 hemichannels orchestrate NOD-like receptor protein-3 (NLRP3) inflammasome activation and sterile inflammation in tubular injury. Cell Communication and Signaling , 21(1), 263. https://doi.org/10.1186/s12964-023-01245-7 Sethi, S., De Vriese, A. S., & Fervenza, F. C. (2022). Acute glomerulonephritis. Lancet , 399(10335), 1646–1663. https://doi.org/10.1016/S0140-6736(22)00461-5 Shi, Z., Zhang, Y., Hong, D. et al . (2022). Anti-galectin-3 antibodies induce skin vascular inflammation via promoting local production of IL-1β in systemic lupus erythematosus. International Immunopharmacology , 112, 109197. https://doi.org/10.1016/j.intimp.2022.109197 Siegel, CH., & Sammaritano, LR. (2024). Systemic lupus erythematosus: A review. JAMA , 331(17), 1480. https://doi.org/10.1001/jama.2024.2315 Suzuki, H., Hasegawa, S., Fushimi, S. et al . (2025). Metformin prevents diabetes development in type 1 diabetes models via suppression of mTOR and STAT3 signaling in immune cells. Scientific Reports , 15(1), 10641. https://doi.org/10.1038/s41598-025-93647-5 Whang, M. I., Tavares, R. M., Benjamin, D. I. et al . (2017). The ubiquitin binding protein TAX1BP1 mediates autophagosome induction and the metabolic transition of activated T cells. Immunity , 46(3), 405–420. https://doi.org/10.1016/j.immuni.2017.02.018 White, J., Suklabaidya, S., Vo, M. T. et al . (2023). Multifaceted roles of TAX1BP1 in autophagy. Autophagy , 19(1), 44–53. https://doi.org/10.1080/15548627.2022.2070331 Wu, Z., Tan, W., Wang, C. et al . (2025). TAX1BP1 regulates the apoptosis of renal tubular epithelial cells in ischemia/reperfusion injury via the NF-kB/PMAIP1 signaling pathway. Inflammation Research , 74(1), 9. https://doi.org/10.1007/s00011-024-01976-4 Yang, Q., Liu, T.-T., Lin, H. et al . (2017). TRIM32-TAX1BP1-dependent selective autophagic degradation of TRIF negatively regulates TLR3/4-mediated innate immune responses. PLOS Pathogens , 13(9), e1006600. https://doi.org/10.1371/journal.ppat.1006600 Yap, D. Y. H., & Chan, T. M. (2019). B cell abnormalities in systemic lupus erythematosus and lupus nephritis—Role in pathogenesis and effect of immunosuppressive treatments. International Journal of Molecular Sciences , 20(24), 6231. https://doi.org/10.3390/ijms20246231 Yu, F., Haas, M., Glassock, R., & Zhao, M.-H. (2017). Redefining lupus nephritis: Clinical implications of pathophysiologic subtypes. Nature Reviews Nephrology , 13(8), 483–495. https://doi.org/10.1038/nrneph.2017.85 Yung S, Ng CY, Au KY. et al . (2017). Binding of anti-dsDNA antibodies to proximal tubular epithelial cells contributes to renal tubulo-interstitial inflammation. Clin Sci (Lond), 1;131(1):49-67. https://doi.org/10.1042/CS20160421 Yung, S., Yap, D. Y., & Chan, T. M. (2017). Recent advances in the understanding of renal inflammation and fibrosis in lupus nephritis. F1000Research , 6, 874. https://doi.org/10.12688/f1000research.10445.1 Zuberi RI, Hsu DK, Kalayci O. et al . (2004). Critical role for galectin-3 in airway inflammation and bronchial hyperresponsiveness in a murine model of asthma. American Journal of Pathology , 165 (6), 2045–2053. https://doi.org/10.1016/S0002-9440(10)63255-5 Additional Declarations No competing interests reported. Supplementary Files keymessage.docx boltoffig1a.tif blotoffig5F1.tif blotoffig4f.tif Antibody.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7699737","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":528430265,"identity":"29c061c5-4b48-4975-8e3d-7b411e7e691d","order_by":0,"name":"xiaorong deng","email":"","orcid":"","institution":"The Third Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"prefix":"","firstName":"xiaorong","middleName":"","lastName":"deng","suffix":""},{"id":528430268,"identity":"4732e6fc-108f-44d3-a4c2-b02d820b2b9a","order_by":1,"name":"xue jiang","email":"","orcid":"","institution":"Chongqing Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"xue","middleName":"","lastName":"jiang","suffix":""},{"id":528430271,"identity":"3aa860b6-e6a2-4cb7-8517-31be90e21566","order_by":2,"name":"fenglin chen","email":"","orcid":"","institution":"Chongqing Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"fenglin","middleName":"","lastName":"chen","suffix":""},{"id":528430273,"identity":"be8a4476-d1e2-44e7-b8d7-f8d0844ff437","order_by":3,"name":"tian qian","email":"","orcid":"","institution":"The Third Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"prefix":"","firstName":"tian","middleName":"","lastName":"qian","suffix":""},{"id":528430275,"identity":"ca718ac8-54df-46f4-9156-f9e762eb9124","order_by":4,"name":"haoyun luo","email":"","orcid":"","institution":"The Third Affiliated Hospital of Chongqing Medical University","correspondingAuthor":false,"prefix":"","firstName":"haoyun","middleName":"","lastName":"luo","suffix":""},{"id":528430277,"identity":"048c5160-d0e5-4c43-9bcf-c9c3b0d9e8dc","order_by":5,"name":"deming liu","email":"","orcid":"","institution":"Chongqing Hospital of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"deming","middleName":"","lastName":"liu","suffix":""},{"id":528430279,"identity":"763a104b-d1f9-4939-9ef7-67fa1fee2dfd","order_by":6,"name":"fei hao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIElEQVRIie3Pv0oDMRzA8V856C0pWX9H/fMKEQcrLT7LBaEdbLu43NAhIuQWsWt8ixOhc46DTjm7HnSxDyBkcixeW04drtbRIV9CICQfyA/A5fqH0dM0tjbqhZuDBuhUF95eEihPNpTp74gGPEyY8qXXktmWwN9I+06ulFmMKc3TzE4QaHzTR4i6XPi5riMXR2nMbLS8DdQ41HqOgOZ9hmAGXJBxWEcuBReBMkueFIRp3URgOJphQ2ZcIGG1H9NctFvylScLU5J1Rda/kILLkmie6CHTqayI2E+Ch/T+TJlr/rSZJX9EUs7y0gnng3NJhrWE+vHqzUZXfErzzEYfvRMaj54LO+keT31TS35Eqj3cLmgeeP9FYPfe5XK5XN99AtrmbR4Ag0VgAAAAAElFTkSuQmCC","orcid":"","institution":"The Third Affiliated Hospital of Chongqing Medical University","correspondingAuthor":true,"prefix":"","firstName":"fei","middleName":"","lastName":"hao","suffix":""}],"badges":[],"createdAt":"2025-09-24 05:53:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7699737/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7699737/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93663967,"identity":"ebd97f54-5fac-477f-8cbf-74497b7b9426","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3521319,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/d82a581f39e937deee7f45e1.docx"},{"id":93663965,"identity":"2593846c-0027-4859-8d25-4e8c0c908409","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7557,"visible":true,"origin":"","legend":"","description":"","filename":"695f49729db945debb7ece22035eb20e.json","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/ab1b6ceb01018845c7257779.json"},{"id":93664300,"identity":"63d8f118-8b32-4c10-8380-58f2409015ac","added_by":"auto","created_at":"2025-10-16 08:47:23","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12193,"visible":true,"origin":"","legend":"","description":"","filename":"Antibody.docx","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/edeb9633074115dada86c699.docx"},{"id":93664303,"identity":"73837fd2-fb3f-481e-84d3-2c7bafe967ee","added_by":"auto","created_at":"2025-10-16 08:47:23","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1473456,"visible":true,"origin":"","legend":"","description":"","filename":"blotoffig4f.tif","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/65fe3614121e2fa387b58158.tif"},{"id":93664304,"identity":"0ad3200c-6520-4ab1-9274-c6a9f9827b38","added_by":"auto","created_at":"2025-10-16 08:47:23","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1473456,"visible":true,"origin":"","legend":"","description":"","filename":"blotoffig5F1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/bd359305241df3b713c62539.tif"},{"id":93663975,"identity":"9b4822bd-47fc-47c9-a9f4-24403229e02b","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1473456,"visible":true,"origin":"","legend":"","description":"","filename":"boltoffig1a.tif","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/2dc7b6c1e3a0ff08ecf2efa4.tif"},{"id":93663971,"identity":"91f58b8e-738e-497d-a8d2-d0cff8d304a3","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11501,"visible":true,"origin":"","legend":"","description":"","filename":"keymessage.docx","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/171fe9904bc0188d26fd4e2d.docx"},{"id":93663979,"identity":"9932220b-ab60-4b85-8dbf-2f732c7a078c","added_by":"auto","created_at":"2025-10-16 08:39:24","extension":"xml","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":107407,"visible":true,"origin":"","legend":"","description":"","filename":"695f49729db945debb7ece22035eb20e1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/0488aafe2717c979f1434920.xml"},{"id":93664310,"identity":"d77563d2-6a05-437c-878e-29f1cd4e5a94","added_by":"auto","created_at":"2025-10-16 08:47:24","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10189106,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/acaf738f95990eb7d5707247.jpeg"},{"id":93664306,"identity":"c783420c-6b0a-421d-adc3-9ff13191ee54","added_by":"auto","created_at":"2025-10-16 08:47:24","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":381146,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/4bfc699191f15bb888ffdcb6.jpeg"},{"id":93663980,"identity":"38d3ab2f-feb6-456a-a969-045ee8599676","added_by":"auto","created_at":"2025-10-16 08:39:24","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10189106,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/04fb01e44adafd3ad9fe7f9e.jpeg"},{"id":93663981,"identity":"72d3cabd-b412-44db-8588-dcd73cf10f79","added_by":"auto","created_at":"2025-10-16 08:39:24","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9884978,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/430767bac6502897c9ccaed0.jpeg"},{"id":93663982,"identity":"d8e0a18c-c1e6-4e0c-9930-5d68e817d6a8","added_by":"auto","created_at":"2025-10-16 08:39:24","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10189106,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/33b62cd958bb766d65bbf731.jpeg"},{"id":93664309,"identity":"0e95bba5-4852-44f9-96dd-96468a4818cb","added_by":"auto","created_at":"2025-10-16 08:47:24","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":52038,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/bd9a7d2ed2bb8680859f4741.png"},{"id":93663969,"identity":"9e32cd98-b932-4dc7-91ce-255c533705da","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110815,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/728cde22ab124e7dddc5534c.png"},{"id":93663978,"identity":"5a5fb648-36ee-4828-9ffe-f0eda5a07d1a","added_by":"auto","created_at":"2025-10-16 08:39:24","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":80419,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/5a7748843810c11fb093e95b.png"},{"id":93663988,"identity":"ef52d41b-3a31-426e-b079-7da893042067","added_by":"auto","created_at":"2025-10-16 08:39:24","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":69135,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/0f3cb6d0ec05965cdf78aca5.png"},{"id":93665488,"identity":"132dc192-7954-4dc2-883d-8b3992a259a8","added_by":"auto","created_at":"2025-10-16 08:55:24","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122922,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/9fc5c2f5cdc642122aab00cd.png"},{"id":93663989,"identity":"07dae6a4-c437-44c2-b91d-97064dff51f2","added_by":"auto","created_at":"2025-10-16 08:39:24","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":106325,"visible":true,"origin":"","legend":"","description":"","filename":"695f49729db945debb7ece22035eb20e1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/1ac93c249e3660598298ae96.xml"},{"id":93663985,"identity":"11f5ca2c-60a4-4234-824b-51daef2505fd","added_by":"auto","created_at":"2025-10-16 08:39:24","extension":"html","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":117112,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/7bc7a1dad268311353010041.html"},{"id":93665486,"identity":"b30793ad-155d-48f7-bc6b-e5c883a9d777","added_by":"auto","created_at":"2025-10-16 08:55:23","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":457687,"visible":true,"origin":"","legend":"\u003cp\u003eA) TAX1BP1 was decreased in the MRL/lpr. B) Flow charts of targeting TAX1BP1 by AAV tail intravenous injection in MRL/lpr. C) representative pictures of peripheral lymph nodes from MRL/lpr sacrificed at 16 weeks. D) representative pictures of spleens from MRL/lpr sacrificed at 16 weeks. E) spleen weight of MRL/lpr was assessed (P=0.015). F）numbers of peripheral lymph nodes was assessed（P\u0026lt;0.0001).Results are shown as mean±SD.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/e14bda1888567839fd10a5ed.png"},{"id":93663960,"identity":"e2d8bfbe-9eae-4ec4-b054-116ad2db8f6e","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":416788,"visible":true,"origin":"","legend":"\u003cp\u003eA) The weekly changes in urinary protein of MRL/lpr after viral injection. B) level of serum dsDNA（P\u0026lt;0.0056）C) level of serum scr （P\u0026lt;0.0001). D) level of serumANA(P=0.3030) .E）HE, Masson staining of LN in AAV-TAX1BP1 and AAV-EGFP group. F）score of HE(P=0.0005). G) score of Masson(P=0.0011). Results are shown as mean±SD.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/f59f73c8a4992b74637f5531.png"},{"id":93663964,"identity":"9eb58079-5d6a-4a43-87be-a14518fd74de","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":304506,"visible":true,"origin":"","legend":"\u003cp\u003eA) sc-RNA seq annalysis of UMAP plot colored two groups of kidney tissues from different sample origins,AAV-EGFP: 41, 44, 82 as control ; AAV-TAX1BP1:71,78,80 as overexpression group .UMAP of cells reclustered into 10 subpopulationsin :PTC;TC;BC;DCT;DLH;EC;MC;SMC;MON;POD;.(right).B) Density plot showing UMAP of PTC (Pck1). c) Density plot showing TC (CD3g). D) Density plot showing BC (Lglv3).E) Density plot showing of DCT (Aqp2).F) Density plot showing DLH (Slc12a1). G) Density plot showing EC (Sprr1a). H) Density plot showing MC (CD68). I) Density plot showing SMC (Cald1). J)Density plot showing Mon (Ly6c1). K) Density plot showing POD (Nphs2).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/62fdb000b29bcf76c7d6ea8c.png"},{"id":93663976,"identity":"75a38808-62aa-43a7-b2fd-11f409eed971","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":397986,"visible":true,"origin":"","legend":"\u003cp\u003eA) sc-RNA seq annalysis the level of TAX1BP1(y axis) in different cell subpopulationsin (x axis) . P adjusted was showed above the chart.B) GO enrichment analysis and visualization of PTCs. C) Lgals3 expression of kindney in different groups by RT-qPCR. D) Lghm expression of kindney in different groups by RT-qPCR. E) Ctss expression of kindney in different groups by RT-qPCR. F) Western blot of kidney tissues from different sample origins.Total cell lysates were subjected to Western blotting with the indicated antibodies.G) the relative mRNA level of Lghm(P=0.0199) . H) the relative mRNA level of Lgals3(P\u0026lt;0.0001). I) the relative mRNA level of CTSS(P=0.2253). J) GO enrichment analysis and visualization of macrophages.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/0f2465bb61ad4433084bc8c7.png"},{"id":93663973,"identity":"a71d5f2f-14b6-4943-998d-9de764fe70b8","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":522677,"visible":true,"origin":"","legend":"\u003cp\u003eA) Details of the distribution patterns of ABCG2/Gal-3 stained cells were examined using the same sections. Nuclei were stained with DAPI. ABCG2(a marker for PTCs), Gal-3 and merged images. (Scale bars = 75μm) B) mean gray value of Gal-3(P=0.009). C)mean gray value of CD68(P=0.0112). D)mean gray value of α-SMA (P=0.0191). E) Details of the distribution patterns of CD68/α-SMA stained cells were examined using the same sections. Nuclei were stained with DAPI. CD68 (a marker for Macrophage), Gal-3 and merged images. (Scale bars = 25μm)\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/d0e79943256d2d78447293d4.png"},{"id":94826240,"identity":"c8d39da1-2bba-48f7-98e6-51cb83625ee3","added_by":"auto","created_at":"2025-10-31 06:51:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2824327,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/d6515c2f-6b03-434d-a712-d0c87a5d36ff.pdf"},{"id":93665840,"identity":"49017e38-b339-4c89-befb-c472edff2a39","added_by":"auto","created_at":"2025-10-16 09:03:23","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":11501,"visible":true,"origin":"","legend":"","description":"","filename":"keymessage.docx","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/41038a1b0687bd28e45321e7.docx"},{"id":93664301,"identity":"6dc67a95-ed4d-43fc-a856-499fb913b778","added_by":"auto","created_at":"2025-10-16 08:47:23","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1473456,"visible":true,"origin":"","legend":"","description":"","filename":"boltoffig1a.tif","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/32555fef86eaa05ac9cbf204.tif"},{"id":93664297,"identity":"e17f22f9-d876-454a-80de-90ba5d1c8bff","added_by":"auto","created_at":"2025-10-16 08:47:23","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1473456,"visible":true,"origin":"","legend":"","description":"","filename":"blotoffig5F1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/6bddd002252bc053245a6a3b.tif"},{"id":93664302,"identity":"5d3e20c5-5466-4d3e-9ab6-ae2b9b82b0eb","added_by":"auto","created_at":"2025-10-16 08:47:23","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1473456,"visible":true,"origin":"","legend":"","description":"","filename":"blotoffig4f.tif","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/1809752f4b1e56237e6bd090.tif"},{"id":93663968,"identity":"bbb291c9-8ec6-46bb-8b8b-19a4dfc72cad","added_by":"auto","created_at":"2025-10-16 08:39:23","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":12193,"visible":true,"origin":"","legend":"","description":"","filename":"Antibody.docx","url":"https://assets-eu.researchsquare.com/files/rs-7699737/v1/47c47d6bb237819448252b9a.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"TAX1BP1 limits macrophage-myofibroblastlast transition in lupus kidney fibrosis","fulltext":[{"header":"1.Introduction","content":"\u003cp\u003eLupus nephritis (LN) is a form of glomerulonephritis and constitutes one of the most severe organ manifestations of systemic lupus erythematosus (SLE). About half of adults and 70% of children with lupus will develop LN.[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] Despite advancements in understanding the genetic and pathogenetic basis of LN and improvements in treatment options, LN remains a significant cause of morbidity and mortality in SLE patients. The main clinical manifestations of LN are proteinuria, haematuria and swelling, which may also cause acute nephritic syndrome, acute progressive nephritic syndrome and nephrotic syndrome. [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] Renal fibrosis is a common pathological feature in almost all forms of chronic kidney disease[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]\u003csup\u003e,6\u003c/sup\u003e. During fibrosis, myofibroblasts, which are defined by the expression of α-SMA, play a crucial role in collagen matrix production.[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] In both human and experimental mouse models of chronic kidney disease, the transition of macrophages to myofibroblasts (MMT) also serves as a significant source of myofibroblasts in the fibrosing kidney.[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/p\u003e\u003cp\u003eTAX1BP1 is a conserved ubiquitin-binding protein that contributes to autophagy, thereby regulating cell death, inflammatory signalling pathways and innate immunity.[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] In addition, TAX1BP1 can regulate A20 function in anti-inflammatory and antiviral signalling pathways.[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] Our previous study showed that TAX1BP1 participates in SLE by regulating monocyte/macrophage function, and it is negatively corelated with the SLEDAI score and dsDNA level.[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] Thus, TAX1BP1 may be a key process in SLE, and targeting TAX1BP1 may be a novel and specific therapy for SLE. However, the role of TAX1BP1 in inhibiting renal fibrosis remains unclear. In this study, adeno-associated viruses carrying overexpressed TAX1BP1 were injected by tail vein in MRL/lpr mice, and the changes in lupus erythematosus\u0026ndash;related indicators were observed after 4 weeks. We have made the first find that TAX1BP1 overexpression in MRL/lpr inhibits renal fibrosis by blocking MMT in lupus nephritis via downregulating Galectin-3(Gal-3) in proximal tubular cells (PTC).\u003c/p\u003e"},{"header":"2. Subjects and Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1. AAV preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe experimental construct rAAV-Ef1\u0026alpha;-tax1bp1-2A-EGFP-WPREs was generated and packaged into AAV capsids by BrainVTA Corporation (Wuhan, China). rAAV-EF1\u0026alpha;-EGFP-WPRE-hGH polyA was used as the control virus. Both constructs were prepared at a viral titre of 5 \u0026times; 10\u0026sup1;\u0026sup2; vg/mL.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Animal and experimental treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal experiments in this study were conducted in accordance with the experimental protocol approved by the Medical Ethics Committee of the Third Affiliated Hospital of Chongqing Medical University (ethic approval no. IACUC-CQMU-2024-0642). MRL/lpr mice (8 weeks) were purchased from Saiye (Suzhou) Biological Technology Co. Ltd., with an initial body weight of 25.93 \u0026plusmn; 1.18 g. The animals were housed in Chongqing Medical University Animal Research Center in a specific pathogen-free environment with a 12 h light\u0026ndash;dark cycle, and the temperature was maintained at 24 \u0026deg;C\u0026ndash;26 \u0026deg;C. The mice were randomly divided into two groups. The AAV-TAX1BP1\u0026nbsp;group received an intravenous administration of adeno-associated viral serotype 9 (AAV9) vector harbouring the TAX1BP1 gene via tail vein injection at 12 weeks of age. The AAV-EGFP\u0026nbsp;group received AAV-EGFP as a control. Mouse urine was collected weekly for urine protein testing. At the end of the experiment, the spleen of each group was weighed. The kidneys were collected for subsequent experiments. Peripheral lymph nodes with a diameter greater than 4 mm were evaluated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 Measurement of blood ds-DNA, ANA, serum creatinine (Scr) and urine protein\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFresh serum was collected at the end of the experiment. The amount of anti-dsDNA antibody and anti-ANA body was measured by using ELISA, which was purchased from Shanghai Jianglai Industrial Limited by Share Ltd. (Lot, JL12477, JL17316). An ELISA kit from Wuhan Fine Biotech Co. Ltd. (Lot, EM1982) was used to analyse urine albumin levels in accordance with the protocol.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4 Quantitative real-time PCR assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from kidney tissues using the TRIzol reagent (Invitrogen). The extracted RNA was reverse transcribed into cDNA using the HiScript III qRT SuperMix (Cowin, CW0957). Quantitative real-time PCR (qPCR) was performed using the 2\u0026times; ChamQ SYBR qPCR Master Mix (Vazyme) on a 7300 Real-Time PCR System (Applied Biosystems). Relative expression levels were normalised to those of the normal group using the 2\u003csup\u003e\u0026minus;∆∆Ct\u003c/sup\u003e method. The primer sequences used for RT-qPCR are listed in\u0026nbsp;\u003cstrong\u003eTable 1\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable.1\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eThe primers information of genes in this study\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"920\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 94px;\"\u003e\n \u003cp\u003eprimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 268px;\"\u003e\n \u003cp\u003eForward (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 262px;\"\u003e\n \u003cp\u003eReverse (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e（b）\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 94px;\"\u003e\n \u003cp\u003elgals3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 268px;\"\u003e\n \u003cp\u003eCTGCTGCTGGCCCTTATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 262px;\"\u003e\n \u003cp\u003eTGTTTGCGTTGGGTTTCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e126\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 94px;\"\u003e\n \u003cp\u003ectss\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 268px;\"\u003e\n \u003cp\u003eTCCTATCCCTACAAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 262px;\"\u003e\n \u003cp\u003eTTCACAAGCCAGTAATCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e284\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 94px;\"\u003e\n \u003cp\u003elghm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 268px;\"\u003e\n \u003cp\u003eGTTCCTGAGTCTGCCTTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 262px;\"\u003e\n \u003cp\u003eTGGAGAATCTTAGCGAGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e176\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 94px;\"\u003e\n \u003cp\u003eTAX1bp1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 268px;\"\u003e\n \u003cp\u003eGCCAGCCTGCTCGAAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 262px;\"\u003e\n \u003cp\u003eTCCCATGCCCACGTAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e120\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 94px;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 268px;\"\u003e\n \u003cp\u003eAAATTCAACGGCACAGTCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 262px;\"\u003e\n \u003cp\u003eTAGACTCCACGACATACTCAGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 66px;\"\u003e\n \u003cp\u003e133\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003ch3\u003e\u0026nbsp;\u003c/h3\u003e\n\u003ch3\u003e2.5 Western blotting assay\u003c/h3\u003e\n\u003cp\u003eKidney tissue was weighed and washed two times with phosphate-buffered saline. RIPA lysate (1:100) and phosphorylase inhibitors (1:100) were added to the chopped renal tissue. After homogenisation at 4 \u0026deg;C, the tissue sample was transferred to a sterile EP tube. Then, it was centrifuged at 10,000\u0026times; \u003cem\u003eg\u0026nbsp;\u003c/em\u003efor 15 min, and the supernatant protein concentration was quantified via bicinchoninic acid assay. Protein was denatured at 95 \u0026deg;C for 5 min. SDS-PAGE gel of different concentrations was prepared to separate the target proteins. Electrophoresis was performed at 80 V when the samples were run on a concentration gel. Then, the protein was transferred to a PVDF membrane at 300 mA and incubated with a target antibody overnight at 4 \u0026deg;C post blocking. The membrane was washed three times and incubated in the secondary antibody for 1 h at room temperature (RT). After washing three times, the protein bands were detected using a Bio-Rad developer. The primary and secondary antibodies are listed in the supplementary material.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6 Haematoxylin\u0026ndash;eosin and Masson staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe kidney tissues were fixed with 4% paraformaldehyde, then trimmed, dehydrated and dipped in wax, embedded, sectioned, dewaxed, stained and sealed. Haematoxylin\u0026ndash;eosin and Masson staining were performed in accordance with the manufacturer\u0026rsquo;s instructions. Different pathological phenomena in the sections were recorded using an upright optical microscope (Nikon ECLIPSE E100, Japan) and imaging system (Nikon DS-U3, Japan). Finally, the slides were evaluated by an experienced pathologist blinded to the treatment. Renal histopathological changes were scored semi-quantitatively: 0\u0026ndash;4 points (0, none; 1, mild; 2, mild-moderate; 3, moderate; 4, severe).\u003c/p\u003e\n\u003ch3\u003e2.7 Immunofluorescence assays\u003c/h3\u003e\n\u003cp\u003eThe paraffin sections were deparaffinised, rehydrated, antigen retrieved and endogenous peroxidase activity blocked. Then, 3% BSA was used as a confining liquid-covered tissue for 30 min. The target antibody was added to the section and incubated overnight at 4 \u0026deg;C. Alternatively, the sections were equilibrated with recombinant dT enzyme, Biotin-DuTP labelling mix and Bration buffer (1:5:50 \u0026mu;L). After the sections were slightly shaken and dried, the samples were incubated with Streptavidin-HRP (HRP-labelled) at RT for 50 min. Next, newly DAB colour developing solution was added, and DAPI was used for nuclear counterstaining. The sections were dehydrated and mounted using a SweSuper Clean BioMount medium. Tissue staining was visualised under a microscope (Leica, Germany). In addition, image acquisition and analysis were performed. The positive glomerular arand secondary antibodies used for immunohistochemistry are listed in supplemen materials. Wheas were analysed as a percentage of the total area. The fluorescence intensity of 10 randomly collected glomeruli was analysed for each group using ImageJ software.\u0026nbsp;\u003c/p\u003e\n\u003ch3\u003e2.8 scRNA-seq data analysis\u003c/h3\u003e\n\u003cp\u003eIn accordance with the standardised protocols, renal tissue was cryopreserved, dissociated and processed using the Singleron Matrix single-cell sequencing platform. Subsequently, sequencing libraries were constructed using the GEXSCOPE kit and subjected to high-throughput sequencing on the Illumina NovaSeq platform, generating approximately 150\u0026ndash;200 million sequencing reads per sample. The raw data derived from the Singleron pipeline were processed using a customised bioinformatics workflow based on the Matrix platform analytical tools. For comprehensive cell population analysis, clustering algorithms were implemented using the CelloScope computational toolkit, facilitating global clustering across the entire cellular cohort and refined and secondary clustering within distinct cell types. To ensure data integration and batch effect correction, single-cell RNA sequencing datasets were consolidated into a unified object and aligned via Harmony integration. Quality control measures were applied to exclude cells with fewer than 300 detected genes, more than 8000 detected genes or mitochondrial content exceeding 10%, thereby maintaining data quality and integrity.\u003c/p\u003e"},{"header":"3. Quantification and statistical analysis","content":"\u003cp\u003eStatistical analyses were performed using GraphPad Prism 10.0 (GraphPad, USA). At least three biological replicates were performed for each experiment. Student\u0026rsquo;s t-test or one-way analysis of variance was adopted for statistical analyses. \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 indicated that a difference was statistically significant.\u003c/p\u003e"},{"header":"4. Results","content":"\u003cp\u003e\u003cstrong\u003e4.1 TAX1BP1 overexpression reduced enlarged lymph nodes and spleen weight\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBefore starting the experiment, we confirmed through a pilot study that the expression of TAX1BP1 in the kidneys of MRL/lpr mice is lower than that in MRL/MPJ mice by Western blot (Fig. 1A). Then, we treated the mice in accordance with Fig. 1B.\u0026nbsp;We counted the number of peripheral lymph nodes with a diameter greater than 4 mm in both groups and performed statistical analysis at the end of the experiment (Fig. 1C, F). In addition, the weight of the spleen in the AAV-TAX1BP1 group was significantly reduced (Fig. 1D, E).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.2 TAX1BP1 overexpression reduced the level of dsDNA and Scr\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFollowing the AAV-mediated overexpression of TAX1BP1, a significant decrease in the rate of urinary albumin excretion was observed (Fig. 2A) The expression level of blood anti-dsDNA (Fig. 2B) and Scr (Fig. 2C) significantly decreased. However, no significant difference was observed in the levels of ANA (Fig. 2D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.3 TAX1BP1 overexpression improved renal function and alleviated renal injury\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe urinary protein concentration in MRL/lpr mice increased at week 12. HE staining indicates a significant reduction in glomerular and periglomerular inflammatory cell infiltration in the AAV-TAX1BP1 group at week 16 (Fig. 2E and F). In addition, Masson staining indicates a decrease in glomerular collagen in the AAV-TAX1BP1 group compared with the AAV-EGFP group at week 16 (Fig. 2G).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.4 Single-cell sequencing revealed that PTC were the primary site of TAX1BP1 overexpression in the kidneys\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRenal biopsy single-cell sequencing was performed to identify the primary cells expressing TAX1BP1 of the kidney at the end of the experiment. Low-resolution clustering of renal cells revealed 10 distinct clusters (Fig. 3A), which were annotated on the basis of lineage-specific marker genes and up-regulated transcripts (Fig. 3B-K): PTC marked by Pck1, T cells (CD3g), B cells (Lglv3), distal convoluted tubular cells (Aqp2), thick ascending limb cells (Slc12a1), endothelial cells (Sprr1a), macrophages (CD68), smooth muscle cells (Cald1), monocytes (Ly6c1) and podocytes (Nphs2). Comparative analysis of TAX1BP1 expression revealed significant heterogeneity amongst clusters.\u003c/p\u003e\n\u003cp\u003eNotably, PTC in the AAV-TAX1BP1 group exhibited a significant increase in TAX1BP1 transcript levels compared with the AAV-EGFP group (Fig. 4A). Gene expression differences in PTC between the AAV-TAX1BP1 and AAV-EGFP groups were analysed by GO analysis. A total of 24 differentially expressed genes were identified in PTC subpopulations (Table 2). Comparative gene expression analysis showed a significant down-regulation of Lgals3 in the AAV-TAX1BP1 group by Q-PCR (Fig. 4C, G). Correspondingly, protein blotting confirmed a decrease in Gal3-3 protein levels, which was encoded by Lgals3 (Fig. 4F). Lgals3 is enriched in pathways related to biological processes (BPs) such as extracellular matrix (ECM) organisation, macrophage chemotaxis and migration (Fig. 4B). Lgals3 influences molecular function (MF) such as ECM binding, immunoglobulin binding and immunoglobulin receptor binding (Fig. 4B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe further analysed the genes enriched in association with macrophage-associated fibrosis. BP influences cell chemotaxis, leukocyte aggregation, macrophage chemotaxis and migration (Fig. 4H). MF enriches chemokine and cytokine activity (Fig. 4J).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable2\u0026nbsp;\u003c/strong\u003edifferentially expressed genes were identified in PTC subpopulations\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\" width=\"95%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003ep_val\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003eavg_log2FC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003epct.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003epct.2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003ep_valadj\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eIghm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e0.000000e+00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.5717835\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.229\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.151\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e0.000000e+00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003elghg3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.339184e-238\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.2810816\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.371\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.537\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e4.678368e-235\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eIgha\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e3.816523e-154\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.3970739\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.204\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.108\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e7.633046e-151\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eHmgcs2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e7.613338e-127\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e-0.2984575\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.827\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.439\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.522668e-123\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eRen1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.529718e-89\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e-0.4134640\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.583\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.192\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e5.059436e-86\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eDnase1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.976468e-87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e-0.2878083\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.829\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.478\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e3.952937e-84\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003elghg2b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e5.638261e-78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.4999737\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.255\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.074\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.127652e-74\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eSpp2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e4.276533e-46\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.2821983\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.854\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.586\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e8.553065e-43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eCyp2a5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.424902e-43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e-0.2571938\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.839\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.609\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.849805e-40\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eCcl5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.070688e-41\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.5197757\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.504\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.472\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.141375e-38\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eGm26917\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e4.907816e-35\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e-0.2502686\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.725\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.465\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e9.815633e-32\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eNat8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.182006e-28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e-0.2929536\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.799\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.550\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.364012e-25\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eCtss\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e5.710750e-25\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.2687283\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.540\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.503\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.142150e-21\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eHba-a1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e6.063205e-18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e1.7691902\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.411\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.207\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.212641e-14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eHpd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.939391e-12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e-0.2564851\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.832\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.676\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e3.878783e-09\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eLgals3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.236164e-12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.2737040\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.543\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.484\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e4.472328e-09\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eLyz2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.128999e-10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.3924240\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.677\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.497\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e4.257998e-07\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eJchain\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.008182e-08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.4286706\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.377\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.158\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.016365e-05\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eAcaa1b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.510583e-07\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e-0.2624558\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.865\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.812\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e5.021165e-04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eHbb-bs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.914069e-06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e1.5120385\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.503\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.253\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e3.828138e-03\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eCtsb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e2.340640e-05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.2641519\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.793\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.685\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e4.681280e-02\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eTmem176a\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e5.263824e-05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.3152015\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.877\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.754\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.052765e-01\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eH2-Eb1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e3.950594e-04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e0.2933672\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.896\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.747\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e7.901188e-01\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 17px;\"\u003e\n \u003cp\u003eKlk1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e8.462938e-01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 18px;\"\u003e\n \u003cp\u003e-0.3113672\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.783\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 10px;\"\u003e\n \u003cp\u003e0.646\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 21px;\"\u003e\n \u003cp\u003e1.000000e+00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e4.5 TAX1BP1 overexpression in PTC reduced Gal-3 in PTC and \u0026alpha;-SMA on\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emacrophages\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe also detected Gal-3 expression on PTC and changes in macrophages. Immunofluorescence assays demonstrated a reduction in Gal-3 expression on ABCG2\u003csup\u003e+\u003c/sup\u003ecells (Fig. 5A and B). The expression level of CD68+ cell and \u0026alpha;-SMA on CD68+ macrophages in the AAV-TAX1BP1 group decreased (Fig. 5C, D and E). Furthermore, we detection of key fibrotic proteins revealed that compared with the AAV-EFGP group, AAV-TAX1BP1 decreased the protein expression of TGF-\u0026beta;1, and Smad3 protein levels.\u003c/p\u003e"},{"header":"5. Discussion","content":"\u003cp\u003eLN is a severe manifestation of SLE, characterized by significant renal inflammation and fibrosis, which often leads to end-stage renal disease. Despite advancements in understanding the genetic and pathogenetic basis of LN, current treatments, including immunosuppressive therapies with mycophenolate mofetil or cyclophosphamide and glucocorticoids, remain suboptimal. [13,14] Therefore, identifying novel therapeutic targets is crucial for improving outcomes in LN patients.\u003c/p\u003e\n\u003cp\u003eThe major findings from our previous study revealed that TAX1BP1 was negatively corelated with the SLEDAI score and the level of dsDNA in patients with SLE.[12]\u0026nbsp;In this study, the overexpression of TAX1BP1 via tail vein injection significantly attenuated peripheral lymph node enlargement(Fig. 1C and F) and reduced blood anti-dsDNA (Fig. 2B) and Scr levels (Fig. 2C), which is closely correlated to the severity of SLE.[13\u0026ndash;15] We also detected the changes in urine protein levels weekly after viral injection. The results indicated that the trend of urine protein increase in the AAV-TAX1BP1 group was significantly slowed down compared with the AAV-EGFP group. A decrease was also observed (Fig. 2A). The slowing of the urinary protein excretion curve is a clinically relevant outcome, as proteinuria is a marker of kidney damage in SLE.[16]Our results indicate that TAX1BP1 overexpression may slow the progression of nephritis, potentially improving renal prognosis. Previous studies have demonstrated that TAX1BP1 can modulate renal PTC apoptosis and inflammation through the NF-kB pathway, thereby alleviating acute kidney injury.[17\u0026ndash;19] However, our experimental results indicated no significant differences between the two groups(Supplementary Materials). In addition, the decrease in renal inflammatory cell infiltration indicates that TAX1BP1 overexpression may have a direct anti-inflammatory effect within the kidney of LN. This phenomenon is a significant advancement, as renal inflammation is a key pathological feature of LN.[20] In addition, Masson staining indicates a decrease in glomerular collagen in the AAV-TAX1BP1 group (Fig.2E,G), which indicates that TAX1BP1 overexpression may exert a renoprotective effect. This effect could delay or even reverse the progression of renal fibrosis, which is a hallmark of chronic kidney disease in LN. Given the progressive nature of renal fibrosis in LN, the ability of TAX1BP1 to mitigate this process shows great application potential in improving the long-term prognosis of patients with SLE.\u003c/p\u003e\n\u003cp\u003eNextly, scRNA-seq was applied to renal tissue in both groups. TAX1BP1 overexpression was most pronounced in PTC (Fig4.A). This localisation is crucial, as the PTC are key sites for immune complex deposition and inflammation in LN.\u0026nbsp;Immune deposits are often observed along the tubular basement membrane in patients with LN. Previous studies have confirmed that anti‐dsDNA antibodies contribute to renal tubulo-interstitial inflammation through binding to PTC and induction of pro‐inflammatory mediators in LN.[19] The high IFN response signature and fibrotic signature in tubular cells were associated with failure to respond to treatment[21]. PTC have a capacity for antigen cross-presentation, thereby inducing cytotoxic CD8+ T cells in vitro, which may contribute to the pathology of immune-mediated glomerulonephritis [22].\u003c/p\u003e\n\u003cp\u003eWe further analysed the differentially expressed genes in PTC. A total of 24 genes were found, among which Lgals3, CTSS and Lghm exhibited the most significant differences in expression (Fig. 4C, D, E). In addition, RT-qPCR shows that Lgals3 significantly decreases in AAV-TAX1BP1 group (Fig. 4G). Gal-3 decreased in AAV-TAX1BP1 group. (Fig. 4F) Immunofluorescence assays demonstrated a reduction in Gal-3 expression on PTC (Fig. 5A). Our analysis revealed that it exhibited significant differences in the pathways of renal filtration, ECM organisation, macrophage chemotaxis and migration, which is closely associated with the excessive proliferation of mesangial cells and may lead to glomerular fibrosis, a key pathological feature of LN.[23] Previous studies have confirmed that metformin can reduce the infiltration of F4/80-positive macrophages in the kidneys of diabetic mouse models, thereby alleviating renal inflammatory injury.[24] Our results indicate that the down-regulation of Lgals-3 expression in PTC may be closely related to the chemotaxis and migratory functions of macrophages (Fig.2C). Lgals-3 affects macrophage movement by altering ECM composition or binding to macrophage receptors.[25] Endogenous Galectin-8 suppresses Th17 cell infiltration and renal fibrosis via the TAX1BP1\u0026ndash;autophagy axis[26,27]. Abnormal collagen expression may promote macrophage infiltration, worsening renal damage. [28] Lgals3 can exacerbate LN through immune complex deposition and immune cell activation, making it a potential therapeutic target. Studies in Gal3-/- mice show attenuated peritoneal inflammation, positively correlated with LN.[29,30].\u003c/p\u003e\n\u003cp\u003eMMT is a significant source of myofibroblasts in the fibrosing kidney in both human and experimental mouse models of chronic kidney disease. Our result showed the expression level of CD68+ cell and \u0026alpha;-SMA on CD68+ macrophages in the AAV-TAX1BP1 group decreased (Fig. 5C, D and E). This suggested that TAX1BP1 overexpression in PTC can downregulate Gal-3 expression, thereby reducing MMT which renal inflammation and fibrosis. This is consistent with previous research indicating that TAX1BP1 participates in SLE activity by regulating antigen presentation in monocytes and inflammatory responses in M1 macrophages.[12] Additionally, TGF-\u0026beta;/Smad3 signaling is the master regulator of renal fibrosis.[31]The involvement of TGF-\u0026beta; signaling in the MMT process has been well documented, and our results suggest that TAX1BP1 may interact with this pathway to exert its protective effects(Fig5.F).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn conclusion, we have made the first find that TAX1BP1 overexpression in PTC inhibits renal fibrosis by blocking MMT in lupus nephritis via downregulating Gal-3 in PTC. This finding provides novel insights into the therapeutic potential of TAX1BP1 overexpression in PTC for mitigating renal fibrosis in LN. Future studies should further explore the mechanisms underlying TAX1BP1\u0026apos;s effects on MMT and its potential as a therapeutic target in LN.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLimitations and Future Directions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur study provides preliminary evidence for the role of TAX1BP1 in SLE. The small sample size and lack of human data limit the generalisability of our findings. Future studies should aim to replicate these findings in larger cohorts and explore the potential clinical applications of TAX1BP1 in patients with SLE.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study has been approved by the Medical Ethics Committee of the Third Affiliated Hospital of Chongqing Medical University (ethic approval no. IACUC-CQMU-2024-0642).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are included in the supplementary files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (82173408, 82405590).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u003c/strong\u003e\u003cstrong\u003e\u0026rsquo;\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWriting‐Original Draft: Xiaorong Deng. Conceptualization:Xiaorong Deng. Visualization:\u0026nbsp;Deming Liu, Fei hao. Methodology:\u0026nbsp;Xue Jian, Fenglin Chen. Formal analysis:Tian Qian, Haoyun Luo\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFunding acquisition:\u0026nbsp;Fei hao,Fenglin Chen. Writing‐review and editing:\u0026nbsp;Xiaorong Deng.\u0026nbsp;All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Prof. Bing Ni for instructive suggestions on the work.We also thank Fujin Yang and Xi Chen for technical assistance.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAntar, S. A., Ashour, N. A., Marawan, M. E. \u003cem\u003eet al\u003c/em\u003e. (2023). Fibrosis: Types, effects, markers, mechanisms for disease progression, and its relation with oxidative stress, immunity, and inflammation. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, 24(4), 4004.\u003cu\u003ehttps://doi.org/10.3390/ijms24044004\u003c/u\u003e\u003c/li\u003e\n\u003cli\u003eBauer, C.-J., Karakostas, P., Weber, N.\u003cem\u003eet al\u003c/em\u003e. (2023). Comparative analysis of contemporary anti-double stranded DNA antibody assays for systemic lupus erythematosus. \u003cem\u003eFrontiers in Immunology\u003c/em\u003e, 14, 1305865. https://doi.org/10.3389/fimmu.2023.1305865\u003c/li\u003e\n\u003cli\u003eBethunaickan, R., Berthier, C. C., Ramanujam, M.\u003cem\u003e et al\u003c/em\u003e. (2011). A unique hybrid renal mononuclear phagocyte activation phenotype in murine systemic lupus erythematosus nephritis. \u003cem\u003eJournal of Immunology\u003c/em\u003e, 186(8), 4994\u0026ndash;5003. https://doi.org/10.4049/jimmunol.1003010\u003c/li\u003e\n\u003cli\u003eBroder, A., Mowrey, W. B., Khan, H. N.\u003cem\u003e et al\u003c/em\u003e. (2018). Tubulointerstitial damage predicts end stage renal disease in lupus nephritis with preserved to moderately impaired renal function: A retrospective cohort study. \u003cem\u003eSeminars in Arthritis and Rheumatism\u003c/em\u003e, 47(4), 545\u0026ndash;551. https://doi.org/10.1016/j.semarthrit.2017.07.007\u003c/li\u003e\n\u003cli\u003eChang A, Clark MR, Ko K. (2021). Cellular aspects of the pathogenesis of lupus nephritis. \u003cem\u003eC\u003c/em\u003e\u003cem\u003eurrent Opinion in Rheumatology,\u003c/em\u003e 33(2), 197\u0026ndash;204. https://doi.org/10.1097/BOR.0000000000000777\u003c/li\u003e\n\u003cli\u003eChen, S.-Y., Wang, C.-T., Chen, C.-Y.\u003cem\u003e et al\u003c/em\u003e. (2023). Galectin-3 mediates NETosis and acts as an autoantigen in systemic lupus erythematosus-associated diffuse alveolar haemorrhage. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, 24(11), 9493. https://doi.org/10.3390/ijms24119493\u003c/li\u003e\n\u003cli\u003eDe Vriese, A. S., Sethi, S., \u0026amp; Fervenza, F. C. (2025). Lupus nephritis: Redefining the treatment goals. \u003cem\u003eKidney International\u003c/em\u003e, 107(2), 198\u0026ndash;211. https://doi.org/10.1016/j.kint.2024.10.018\u003c/li\u003e\n\u003cli\u003eDer, E., Suryawanshi, H., Morozov, P.\u003cem\u003eet al\u003c/em\u003e. (2019).Tubular cell and keratinocyte single-cell transcriptomics applied to lupus nephritis reveal type I IFN and fibrosis relevant pathways. Nat Immunol 20, 915\u0026ndash;927 https://doi.org/10.1038/s41590-019-0386-1\u003c/li\u003e\n\u003cli\u003eFaustini, F., Idborg, H., Fuzzi. \u003cem\u003eet al\u003c/em\u003e. (2023). Urine galectin-3 binding protein reflects nephritis activity in systemic lupus erythematosus. \u003cem\u003eLupus\u003c/em\u003e, 32(2), 252\u0026ndash;262. https://doi.org/10.1177/09612033221145534\u003c/li\u003e\n\u003cli\u003eFava, A., \u0026amp; Petri, M. (2019). Systemic lupus erythematosus: Diagnosis and clinical management. \u003cem\u003eJournal of Autoimmunity\u003c/em\u003e, 96, 1\u0026ndash;13. https://doi.org/10.1016/j.jaut.2018.11.001\u003c/li\u003e\n\u003cli\u003eHe YS, Hu YQ, Xiang K. \u003cem\u003eet al\u003c/em\u003e. （2022） Therapeutic Potential of Galectin-1 and Galectin-3 in Autoimmune Diseases. \u003cem\u003eCurrent Pharmaceutical Design\u003c/em\u003e, 28(1), 36\u0026ndash;45. https://doi.org/10.2174/1381612827666210927164935\u003c/li\u003e\n\u003cli\u003eHsieh, C., Chang, A., Brandt, D. \u003cem\u003eet al\u003c/em\u003e. (2011). Tubulointerstitial inflammation and scarring predict outcome in lupus nephritis. \u003cem\u003eArthritis Care and Research\u003c/em\u003e, \u003cem\u003e63\u003c/em\u003e(6), 865\u0026ndash;874. https://doi.org/10.1002/acr.20441\u003c/li\u003e\n\u003cli\u003eHuen, S. C., \u0026amp; Cantley, L. G. (2017). Macrophages in renal injury and repair. \u003cem\u003eAnnual Review of Physiology\u003c/em\u003e, 79(1), 449\u0026ndash;469. https://doi.org/10.1146/annurev-physiol-022516-034219\u003c/li\u003e\n\u003cli\u003eIwata, Y., Bostr\u0026ouml;m, E. A., Menke, J. \u003cem\u003eet al\u003c/em\u003e. (2012). Aberrant macrophages mediate defective kidney repair that triggers nephritis in lupus-susceptible mice. \u003cem\u003eJournal of Immunology\u003c/em\u003e, 188(9), 4568\u0026ndash;4580. https://doi.org/10.4049/jimmunol.1102154\u003c/li\u003e\n\u003cli\u003eJiang, Q., Zhao, Q., Chen, Y. \u003cem\u003eet al\u003c/em\u003e. (2023). Galectin-3 impairs calcium transients and \u0026beta;-cell function. \u003cem\u003eNat Commun, \u003c/em\u003e2024; 1;15(1):3682. https://doi.org/10.3389/fimmu.2023.1305865\u003c/li\u003e\n\u003cli\u003eLi, G., Yang, H., Zhang, D. \u003cem\u003eet al\u003c/em\u003e. (2024). The role of macrophages in fibrosis of chronic kidney disease. \u003cem\u003eBiomedicine \u0026amp; Pharmacotherapy\u003c/em\u003e, 177, 117079. https://doi.org/10.1016/j.biopha.2024.117079\u003c/li\u003e\n\u003cli\u003eLinke, A., Cicek, H., M\u0026uuml;ller, A. \u003cem\u003eet al\u003c/em\u003e. (2022). Antigen cross-presentation by murine proximal tubular epithelial cells induces cytotoxic and inflammatory CD8+ T cells. \u003cem\u003eCells\u003c/em\u003e, 11(9), 1510. https://doi.org/10.3390/cells11091510\u003c/li\u003e\n\u003cli\u003eMahajan, A., Amelio, J., Gairy, K. \u003cem\u003eet al\u003c/em\u003e. (2020). Systemic lupus erythematosus, lupus nephritis and end-stage renal disease: A pragmatic review mapping disease severity and progression. \u003cem\u003eLupus\u003c/em\u003e, 29(9), 1011\u0026ndash;1020. https://doi.org/10.1177/0961203320932219\u003c/li\u003e\n\u003cli\u003eMatsushita, N., Suzuki, M., Ikebe, E. \u003cem\u003eet al\u003c/em\u003e. (2016). Regulation of B cell differentiation by the ubiquitin-binding protein TAX1BP1. \u003cem\u003eScientific Reports\u003c/em\u003e, 6(1), 31266. https://doi.org/10.1038/srep31266\u003c/li\u003e\n\u003cli\u003eQian, T., Huo, B., Deng, X. \u003cem\u003eet al\u003c/em\u003e. (2023). Decreased TAX1BP1 participates in systemic lupus erythematosus by regulating monocyte/macrophage function. \u003cem\u003eInternational Immunology\u003c/em\u003e, dxad027. https://doi.org/10.1093/intimm/dxad027\u003c/li\u003e\n\u003cli\u003eReyes-Thomas, J., Blanco, I., \u0026amp; Putterman, C. (2011). Urinary biomarkers in lupus nephritis. \u003cem\u003eClinical Reviews in Allergy and Immunology\u003c/em\u003e, 40(3), 138\u0026ndash;150. https://doi.org/10.1007/s12016-010-8197-z\u003c/li\u003e\n\u003cli\u003eRoger, E., Chadjichristos, C. E., Kavvadas, P. \u003cem\u003eet al\u003c/em\u003e. (2023). Connexin-43 hemichannels orchestrate NOD-like receptor protein-3 (NLRP3) inflammasome activation and sterile inflammation in tubular injury. \u003cem\u003eCell Communication and Signaling\u003c/em\u003e, 21(1), 263. https://doi.org/10.1186/s12964-023-01245-7\u003c/li\u003e\n\u003cli\u003eSethi, S., De Vriese, A. S., \u0026amp; Fervenza, F. C. (2022). Acute glomerulonephritis. \u003cem\u003eLancet\u003c/em\u003e, 399(10335), 1646\u0026ndash;1663. https://doi.org/10.1016/S0140-6736(22)00461-5\u003c/li\u003e\n\u003cli\u003eShi, Z., Zhang, Y., Hong, D. \u003cem\u003eet al\u003c/em\u003e. (2022). Anti-galectin-3 antibodies induce skin vascular inflammation via promoting local production of IL-1\u0026beta; in systemic lupus erythematosus. \u003cem\u003eInternational Immunopharmacology\u003c/em\u003e, 112, 109197. https://doi.org/10.1016/j.intimp.2022.109197\u003c/li\u003e\n\u003cli\u003eSiegel, CH., \u0026amp; Sammaritano, LR. (2024). Systemic lupus erythematosus: A review. \u003cem\u003eJAMA\u003c/em\u003e, 331(17), 1480. https://doi.org/10.1001/jama.2024.2315\u003c/li\u003e\n\u003cli\u003eSuzuki, H., Hasegawa, S., Fushimi, S. \u003cem\u003eet al\u003c/em\u003e. (2025). Metformin prevents diabetes development in type 1 diabetes models via suppression of mTOR and STAT3 signaling in immune cells. \u003cem\u003eScientific Reports\u003c/em\u003e, 15(1), 10641. https://doi.org/10.1038/s41598-025-93647-5\u003c/li\u003e\n\u003cli\u003eWhang, M. I., Tavares, R. M., Benjamin, D. I. \u003cem\u003eet al\u003c/em\u003e. (2017). The ubiquitin binding protein TAX1BP1 mediates autophagosome induction and the metabolic transition of activated T cells. \u003cem\u003eImmunity\u003c/em\u003e, 46(3), 405\u0026ndash;420. https://doi.org/10.1016/j.immuni.2017.02.018\u003c/li\u003e\n\u003cli\u003eWhite, J., Suklabaidya, S., Vo, M. T.\u003cem\u003eet al\u003c/em\u003e. (2023). Multifaceted roles of TAX1BP1 in autophagy. \u003cem\u003eAutophagy\u003c/em\u003e, 19(1), 44\u0026ndash;53. https://doi.org/10.1080/15548627.2022.2070331\u003c/li\u003e\n\u003cli\u003eWu, Z., Tan, W., Wang, C. \u003cem\u003eet al\u003c/em\u003e. (2025). TAX1BP1 regulates the apoptosis of renal tubular epithelial cells in ischemia/reperfusion injury via the NF-kB/PMAIP1 signaling pathway. \u003cem\u003eInflammation Research\u003c/em\u003e, 74(1), 9. https://doi.org/10.1007/s00011-024-01976-4\u003c/li\u003e\n\u003cli\u003eYang, Q., Liu, T.-T., Lin, H. \u003cem\u003eet al\u003c/em\u003e. (2017). TRIM32-TAX1BP1-dependent selective autophagic degradation of TRIF negatively regulates TLR3/4-mediated innate immune responses. \u003cem\u003ePLOS Pathogens\u003c/em\u003e, 13(9), e1006600. https://doi.org/10.1371/journal.ppat.1006600\u003c/li\u003e\n\u003cli\u003eYap, D. Y. H., \u0026amp; Chan, T. M. (2019). B cell abnormalities in systemic lupus erythematosus and lupus nephritis\u0026mdash;Role in pathogenesis and effect of immunosuppressive treatments. \u003cem\u003eInternational Journal of Molecular Sciences\u003c/em\u003e, 20(24), 6231. https://doi.org/10.3390/ijms20246231\u003c/li\u003e\n\u003cli\u003eYu, F., Haas, M., Glassock, R., \u0026amp; Zhao, M.-H. (2017). Redefining lupus nephritis: Clinical implications of pathophysiologic subtypes. \u003cem\u003eNature Reviews Nephrology\u003c/em\u003e, 13(8), 483\u0026ndash;495. https://doi.org/10.1038/nrneph.2017.85\u003c/li\u003e\n\u003cli\u003eYung S, Ng CY, Au KY. \u003cem\u003eet al\u003c/em\u003e. (2017). Binding of anti-dsDNA antibodies to proximal tubular epithelial cells contributes to renal tubulo-interstitial inflammation. \u003cem\u003eClin Sci (Lond), \u003c/em\u003e1;131(1):49-67. https://doi.org/10.1042/CS20160421\u003c/li\u003e\n\u003cli\u003eYung, S., Yap, D. Y., \u0026amp; Chan, T. M. (2017). Recent advances in the understanding of renal inflammation and fibrosis in lupus nephritis. \u003cem\u003eF1000Research\u003c/em\u003e, 6, 874. https://doi.org/10.12688/f1000research.10445.1\u003c/li\u003e\n\u003cli\u003eZuberi RI, Hsu DK, Kalayci O. \u003cem\u003eet al\u003c/em\u003e. (2004). Critical role for galectin-3 in airway inflammation and bronchial hyperresponsiveness in a murine model of asthma. \u003cem\u003eAmerican Journal of Pathology\u003c/em\u003e, \u003cem\u003e165\u003c/em\u003e(6), 2045\u0026ndash;2053. \u003cu\u003ehttps://doi.org/10.1016/S0002-9440(10)63255-5 \u003c/u\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"systemic lupus erythematosus, lupus nephritis, TAX1BP1, Galectin-3, macrophage-to-myofibroblast transition","lastPublishedDoi":"10.21203/rs.3.rs-7699737/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7699737/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eLupus nephritis causes kidney failure in systemic lupus erythematosus. We asked whether raising levels of the TAX1BP1 could slow this damage. Using mice with lupus-like disease, we delivered a gene therapy that increased TAX1BP1 in kidney tubule cells. After four weeks, treated animals showed smaller lymph nodes and spleens, lower anti-DNA antibodies and serum creatinine, and less protein in the urine. Kidney fibrosis, judged by collagen staining, was markedly reduced. Single-cell sequencing revealed that TAX1BP1 was highest in proximal tubule cells and linked to decreased Galectin-3, a known driver of fibrosis. Immunofluorescence confirmed lower Galectin-3 and fewer α-SMA\u0026thinsp;+\u0026thinsp;macrophages, indicating fewer cells transitioning into myofibroblasts. We conclude that boosting TAX1BP1 in proximal tubule cells limits kidney fibrosis by reducing Galectin-3 and blocking macrophage-to-myofibroblast transition, offering a potential new strategy against lupus nephritis.\u003c/p\u003e","manuscriptTitle":"TAX1BP1 limits macrophage-myofibroblastlast transition in lupus kidney fibrosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-16 08:39:18","doi":"10.21203/rs.3.rs-7699737/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5664d680-2c3d-481b-a62b-630f6ad5dc93","owner":[],"postedDate":"October 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-30T22:23:19+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-16 08:39:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7699737","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7699737","identity":"rs-7699737","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}