The effect of Nrf2 on bone resorption in chronic apical periodontitis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The effect of Nrf2 on bone resorption in chronic apical periodontitis QiYi Song, Saixuan Wu, Ming Dong, Shuo Liu, Lina Wang, Weidong Niu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4116386/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Nuclear factor E2-related factor 2 (Nrf2) is responsible for regulating and maintaining the transcription of cytoprotective genes under conditions of stress and the destruction of redox homeostasis. This study aimed to elucidate the role of Nrf2 in the bone resorption of chronic apical periodontitis (CAP). We used immunohistochemical staining, western blotting and real‐time quantitative polymerase chain reaction (RT‐qPCR) to clarify the expression of Nrf2 in the normal human periodontal ligament and in CAP. A mouse model of apical periodontitis was established by root canal exposure to the oral cavity, and hematoxylin and eosin (HE) staining was used to observe the progress of apical periodontitis. Immunohistochemical staining was used to detect the expression of Nrf2 in different stages of apical periodontitis. An Escherichia coli lipopolysaccharide (LPS) mediated inflammatory environment was also established at the osteoclast and osteoblast levels, and the role of Nrf2 in proliferation and differentiation of osteoblasts and osteoclasts was examined by downregulating Nrf2 expression. The expression of Nrf2 in CAP was higher in the apical periodontitis group than that in healthy periodontal ligament tissue. The expression of Nrf2 increased with the progression of inflammation in mouse apical periodontitis model. In the inflammatory environment mediated by LPS, downregulation of Nrf2 promoted the proliferation and differentiation of osteoclasts and osteoblasts. Nrf2 is involved in the disease process of CAP and may participate in the occurrence and development of bone destruction in CAP by regulating the proliferation and differentiation of osteoclasts and osteoblasts. bone homeostasis chronic apical periodontitis mouse models Nrf2 osteoblast osteoclast Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Periapical periodontitis is a common dental pulp disease. It develops into chronic apical periodontitis (CAP) when periapical infection and pathogen irritants are present for a long time [ 1 – 5 ]. The pathological mechanism of CAP is still unclear. Microbial antigens from infected root canals can stimulate specific inflammatory and nonspecific immune responses in periapical tissues[ 6 – 10 ]. Gram negative bacteria is the main dominant bacterium in infected root canals and periapical tissue lesions. Lipopolysaccharide (LPS) is the main component of its cell wall adventitia that induces an inflammatory response leading to bone resorption [ 11 – 13 ]. Nuclear factor E2-related factor 2 ( Nrf2 ) is a transcription factor with a basic leucine zipper structure in the Cap'n'Collar subfamily [ 14 , 15 ], which is responsible for regulating and maintaining the transcription of cytoprotective genes under conditions of stress and the destruction of redox homeostasis [ 16 – 22 ]. Studies have shown that Nrf2 is closely related to the proliferation and differentiation of osteoclasts and osteoblasts. It reduces the level of reactive oxygen species in cells by activating the expression of antioxidant enzymes [ 23 , 24 ], downregulates the MAPK and PI3K/Akt pathways, and inhibits osteoclast differentiation and consequent bone resorption [ 25 ]. The Nrf2/ARE signaling pathway is involved in bone-related pathological diseases such as periodontitis and arthritis [ 26 ], and it regulates bone mass and bone mineral density [ 27 , 28 ]. Yoshida et al. [ 29 ] found that bone formation in Nrf2 gene knockout mice increased, and the serum levels of bone formation markers also increased significantly. These results indicated that the increase of bone mass in Nrf2 gene knockout mice may be caused by an increase of osteoblast production, indicating that the Nrf2 gene inhibits the proliferation and differentiation of osteoblasts. In contrast, a study by Sun et al. [ 30 ] found that compared with the control group, the bone mass, bone strength, and bone formation of Nrf2 gene knockout mice decreased. The above research shows that although Nrf2 plays a role in bone homeostasis, its specific effect is still controversial, especially in the inflammatory bone resorption of CAP. Here, we explored the potential regulatory effect of Nrf2 on periapical periodontitis by studying the expression of Nrf2 in human CAP and in an animal model of apical periodontitis and by establishing an LPS-mediated inflammation model of osteoblasts and osteoclasts in vitro. Materials and methods Study population and clinical examinations The study population consisted of 29 patients with CAP and 19 patients who had undergone orthodontic removal of healthy tooth tissue at the periodontal ligament (controls) at the Dental Hospital of Dalian Medical University from January 2019 to December 2020. All tissue samples were collected with the approval of the Ethics Committee of Dalian Medical University (approval number: 202106) and the patient's informed consent. The clinical subjects were divided into three groups. The first group was used for immunohistochemistry; the second group was used to detect periapical periodontitis-associated gene expression using real-time qPCR; and the samples from the third group were used to detect periapical periodontitis-associated protein expression using western blotting. The clinical cases were all diagnosed as asymptomatic apical periodontitis caused by caries-derived infection. The teeth didn't have spontaneous pain and the percussion was negative. The dental x-rays showed a periapical index (PAI) score≥3[31-33]. The CAP patients were in good health with no systemic or immune system diseases. Exclusion criteria were, as follows: the tooth was affected by periodontal disease or combined periodontal and pulpal disease; antibiotics or non-steroidal anti-inflammatory drugs had been taken in the 3 months before tooth extraction; allergies; refusal to participate in this study. Establishment of an an imal apical periodontitis model The animal apical periodontitis model was constructed following our previous protocol[34]. A total of 20 wild-type C57BL/6J mice were supplied by Dalian Medical University and were housed in an animal control facility in a 12-h light/dark cycle with a mean illumination of 80 lx. The animals were maintained at 22±2 °C. Tap water and food pellets were available ad libitum. The animal experiments were approved by the Ethics Committee of Dalian Medical University (approval number: AEE23006). The mice were anesthetized with pentobarbital sodium (30 mg/kg), a 1/4 round bur (Wave Dental, Hong Kong, China) was used to open the pulp cavity of the bilateral mandibular first molars, and mice without pulp exposure were used as the control group. The mice were randomly divided into 5 groups with 4 mice in each group. At each time point (0, 1, 2, 3 and 4 weeks), the mandibular bones of 4 mice were stained by immunohistochemistry and hematoxylin and eosin (HE) to evaluate the morphological changes caused by the development of periapical lesions in the model. Immunohistochemistry (IHC) The protein expression levels in tissue were represented by integrated optical densities (IOD). Immunohistochemistry was carried out according to the instructions of a rabbit streptavidin-biotin detection system kit (zsbio, Beijing, China). In short, the frozen tissue slides were dried at 37 °C for 30 minutes, endogenous peroxidase blocker was added, and normal goat serum working solution was used for sealing. According to the size of the tissue, a proper amount of primary Nrf2 polyclonal antibody (1:400 dilution, ABclonal, Wuhan, China) was added and incubated at 4 °C overnight. The tissue slides were then incubated with biotin-labeled goat anti-rabbit IgG polymer followed by horseradish enzyme-labeled streptavidin working solution and then DAB chromogenic solution and hematoxylin staining solution. Real-time qPCR Tissue RNA was extracted according to the instructions of the column Total RNA extraction Kit (Sangon Biotech, Shanghai, China). Genomic DNA was removed from 1000 ng of total RNA by an Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate Biology, Hunan, China), reverse transcription was performed to construct cDNA, and SYBR® Green I chimeric fluorescence was used for qPCR. The primers are listed in Table 1 and Table 2. The relative expression levels of the target genes were calculated by the 2 ﹣ △△ Ct method. Table 1. List of human related gene primers used in this study for real-time PCR. Gene Forward (5’-3’) Reverse (5’-3’) GAPDH GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA Nrf2 TTCCTCTGCTGCCATTAGTCAGTC GCTCTTCCATTTCCGAGTCACTG TRAP CCTACCCACTGCCTGGTCAA ACGTAGCCCACGCCATTCTC Table 2. List of mouse related gene primers used in this study for real-time PCR. Gene Forward (5’-3’) Reverse (5’-3’) GAPDH AAATGGTGAAGGTCGGTGTG TGAAGGGGTCGTTGATGG Nrf2 TTCCTCTGCTGCCATTAGTCAGTC GCTCTTCCATTTCCGAGTCACTG TRAP GGGTCACTGCCTACCTGTGT TCATTTCTTTGGGGCTTATCTC CTSK CACCCAGTGGGAGCTATGGAA GCCTCCAGGTTATGGGCAGA ALP TGAATCGGAACAACCTGACTGA GAGCCTGCTTGGCCTTACC Runx2 CCTCTGGCCTTCCTCTCTCA TAGGTAAAGGTGGCTGGGTAGTG Western blot Total protein was extracted with protease inhibitor (Solarbio, Beijing, China) containing cleavage buffer. Protein concentration was determined using a BCA Protein Assay Kit (Beyotime Biotechnology, Shanghai, China). The protein (20 μg) was separated by 10% sodium dodecyl sulfate and sodium salt-polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to a nitrocellulose membrane. The membrane was sealed with 5% skimmed milk at room temperature for 2.5 hours and then diluted with specific anti-Nrf2 antibody (1:800 dilution; ABclonal, Wuhan, China), TRAP (1:1500 dilution; ABclonal, Wuhan, China), CTSK (1:1000 dilution; ABclonal, Wuhan, China), ALP (1:1000 dilution; Abcam, Cambridge, UK), Runx2 (1:500 dilution; Abcam, Cambridge, UK), and GAPDH (1:5000 dilution; ABclonal, Wuhan, China). The membrane was washed three times with buffered saline and Tween 20 for 10 minutes each time, and the anti-rabbit immunoglobulin G antibody coupled with horseradish peroxidase was incubated for 2 hours. Protein bands were visualized using a gel imaging system (Bio–Rad, Hercules, CA). Image Lab (Bio–Rad) was used to analyze and output the collected images. Cell culture RAW264.7 (Procell Life Science & Technology Co., Ltd, CL-0190, Wuhan, China) and MC3T3-E1 (Sunncell Biotech, SNL-021, Wuhan, China) cells were cultured in high-sugar DMEM/α-MEM supplemented with 10% fetal bovine serum and antibiotics (1% penicillin/streptomycin) in a cell incubator at 37 °C with 5% carbon dioxide. When the fusion rate of adherent cells was more than 80%, the cells were passaged and were then digested with 0.25% trypsin (HyClone, Logan, Utah, USA). Third- or fourth-generation cells were used for in vitro experiments. Cell induction and identification RAW264.7 cells were induced with 0.05 μg/mL RANKL (Abcam, Cambridge, UK) induction solution for 5 days, and a tartrate-resistant acid phosphatase (TRAP) staining kit was used to test osteoclasts. Seven days later, MC3T3-E1 cells were induced with osteoblast induction solution (2 mmol/L Dex, 10 mmol/L β-sodium glycerophosphate, 2 mmol/L VC). Alkaline phosphatase (ALP) activity was detected using an alkaline phosphatase staining kit (Sigma–Aldrich, St. Louis, MO, USA). After 21 days of induction, the formation of calcified nodules in osteoblasts was observed by alizarin red (Sigma–Aldrich, St Louis, MO, USA) staining. Cell transfection RAW264.7 and MC3T3-E1 cells were treated with LPS and seeded in 6-well plates. For knockout experiments, siRNA targeting the Nrf2 gene (Nrf2-siRNA; 100 pmol/well) and negative control siRNA were purchased from GenePharma (Suzhou, China). Cells were transfected with Nrf2-siRNA using Xfect RNA transfection reagent (TaKaRa, Kyoto, Japan) when the cells were 70%-80% confluent. The transfection efficiency was determined by real-time PCR and Western blot. Cell Counting Kit-8 (CCK-8) RAW264.7 cells and MC3T3-E1 cells were seeded in 96-well plates at 100 μL per well (n = 50 3 cells) and cultured for 24 hours before 10 μL of CCK-8 solution was added to each well. The plates were then incubated for 1 hour, after which the absorbance (OD) at 450 nm was measured. Statistical analysis All the above data were analyzed as the mean ± standard deviation (SD). Differences between groups were calculated by one-way analysis of variance (ANOVA). Statistical analysis was conducted using SPSS 17.0 software. The differences were significant when P values < 0.05. Results 1. Human chronic apical periodontitis Expression of Nrf2 in CAP To evaluate the expression of Nrf2 in CAP (Fig. 1 A), we used immunohistochemical staining. There was positive expression of Nrf2 in the healthy periodontal ligament and CAP, only a few in normal periodontal ligament fibroblasts and a large amount in periapical granulomatous inflammatory cells (Fig. 1 B, C). The mRNA transcription levels of Nrf2 and TRAP were detected by real-time qPCR (Fig. 1 D) and were significantly higher than those in the control (p < 0.05). The protein levels of Nrf2 and TRAP detected by Western blot (Fig. 1 E) were significantly higher in the CAP group than in the control group (p < 0.05). 2. Animal apical periodontitis model Expression of Nrf2 in an animal model of periapical periodontitis Hematoxylin-eosin staining showed that the model of periapical periodontitis was successfully established (Fig. 1 A). In the 0-week group, the periodontal ligament structure was intact, no inflammatory cell infiltration was found in the periapical tissue, and no alveolar bone injury was found. In the 1-week group, there was a small amount of inflammatory cell infiltration in the periapical tissue and slight alveolar bone resorption. In the 2-week group, the infiltration of inflammatory cells in the periapical tissue and alveolar bone resorption increased. In the 3-week group, a large number of inflammatory cells continued to infiltrate, and alveolar bone resorption increased. Inflammation and bone resorption were obvious in the 4-week group but entered the stage of chronic inflammation (Fig. 2 B). The results of Nrf2 immunohistochemical staining showed that there were only a few positive cells in the healthy control group, and the expression of Nrf2 in the experimental group began to increase at 1 week (p < 0.05), reached a peak at 3 weeks (p < 0.05), and decreased at 4 weeks (Fig. 2 C) (p < 0.05). The number of Nrf2-positive cells in each experimental group was higher than that in the healthy control group (Fig. 2 D). 3. In vitro cell experiments Induction and identification of cells The morphological characteristics of osteoclasts were confirmed by light microscopy and TRAP staining. After 5 days of induction, the cells became larger, irregular or quasi-round, with 3 or more nuclei, and the number of TRAP-positive multinucleated osteoclasts (≥ 3 nuclei) increased significantly. Real-time qPCR detection showed that the gene expression levels of TRAP were increased, indicating that RANKL successfully induced osteoclast precursor RAW264.7 cells to differentiate into osteoclasts (Fig. 3A). ALP staining and alizarin red staining were used to observe the induction of osteoblasts. After 7 days of induction, the activity and gene expression of ALP increased. After 21 days of induction, alizarin red staining showed the formation of mineralized nodules (Fig. 3B). The results indicated that osteoblast precursor MC3T3-E1 cells successfully differentiated into osteoblast. Expression of Nrf2 in the inflammatory microenvironment Cell culture medium containing 100 ng/mL LPS was added to osteoclasts, and real-time qPCR and western blot results showed that the expression levels of Nrf2, CTSK and TRAP in LPS-treated cells were higher than those in control cells (Fig. 4 A, B). Cell culture medium containing 1,000 ng/mL LPS was added to osteoblasts, and real-time qPCR and western blot results showed that the expression of Nrf2 in LPS-treated cells was higher than that in control cells, while the expression levels of ALP and Runx2 were lower than those in control cells (Fig. 4 C, D). Effects of downregulation of Nrf2 on the proliferation and differentiation of osteoclasts and osteoblasts The results showed that downregulation of Nrf2 can promote the differentiation of osteoclasts and osteoblasts (Fig. 5 A). Osteoclasts and osteoblasts were transfected with Nrf2-siRNA, and real-time qPCR and Western blot results confirmed the successful transfection of Nrf2-siRNA (Fig. 5 B, C). CCK-8 assay was used to detect the effect of Nrf2 on cell proliferation and to construct cell growth curves, and the results showed that the proliferation of osteoclasts was promoted after downregulation of Nrf2 for 24 and 48 hours (p < 0.05), and downregulation of Nrf2 for 48 hours also could promote osteoblast proliferation (p < 0.05) (Fig. 5 D). Real-time qPCR and Western blot results showed that downregulation of Nrf2 could promote the expression of TRAP and CTSK genes and proteins in osteoclasts (p < 0.05) (Fig. 5 E) and promote the expression of ALP and Runx2 genes and proteins in osteoblasts (p < 0.05) (Fig. 5 F). Discussion CAP is the most common inflammatory bone disease associated with jaws and teeth. There is emerging evidence that apical periodontitis may negatively impact systemic health, since apical periodontitis can increase the level of inflammatory mediators and affect cardiovascular disease and diabetes. This is similar to periodontal disease, which can affect cardiovascular disease through inflammatory mediators, miRNAs, N-terminal pro-B-type natriuretic peptide and other factors [ 35 , 36 ]. In contrast to other inflammatory bone diseases, dental pulp infection can directly cause jaw lesions through the apical foramen. In the periapical tissue inflammatory microenvironment, the interaction between cells and cytokines and other inflammatory factors can protect the periapical tissue; however it may also lead to serious damage to the periapical tissue [ 37 ]. Therefore, it is necessary to investigate the molecular mechanism of CAP. In this study, high expression of Nrf2 was found in both human apical periodontitis samples and periapical tissues of mouse apical periodontitis. In recent years, it has been found that Nrf2 plays a certain role in the occurrence and development of diseases characterized by bone destruction, such as periodontitis, osteoporosis and osteoarthritis [ 23 , 28 , 38 – 41 ]. Our results showed that Nrf2 was highly expressed in human CAP tissues. This suggests that Nrf2 may participate in periapical inflammation. In addition, the experiments using an animal model of periapical periodontitis in this study showed that the expression of Nrf2 was the highest when periapical periodontitis progressed to the third week, which was the peak period of periapical bone resorption. Studies have shown that periodontal tissue damage in Nrf2 knockout mice is more serious than that in wild-type mice [ 42 ], indicating that Nrf2 may have a protective effect on bone against damage caused by periodontitis. It has been suggested that the Nrf2 antioxidant defense pathway may be activated under oxidative stress induced by experimental periodontitis [ 43 , 44 ]. Our results showed that Nrf2 was highly expressed in mouse periapical bone resorption tissues, which may be because Nrf2 initiates the antioxidant stress response. Hyeon et al.[ 45 ] showed that the bone marrow-derived macrophages of Nrf2 gene knockout mice, formation of tartrate-resistant acid phosphatase-positive multinuclear cells containing more than three nuclei, and ability to form actin rings were all significantly enhanced, indicating that Nrf2 may inhibit osteoclast differentiation and inhibit the formation of actin rings and bone resorption. The mRNA expression of the bone formation-related factors ALP, Runx2, and osteocalcin, as well as Runx2 protein, increased significantly in Nrf2 knockout MC3T3-E1 cells and skull-derived osteoblasts [ 46 ], which showed that Nrf2 may also inhibit the formation of osteoblasts. Therefore, the high expression of Nrf2 may play a protective role in periapical inflammation. To further clarify the role of Nrf2 in periapical periodontitis, this study established an inflammation model of osteoclasts and osteoblasts. The results showed that downregulation of Nrf2 in the inflammatory microenvironment promoted the proliferation and differentiation of osteoclasts. This result is consistent with previous research results, which showed that, compared with the control group, downregulation of Nrf2 promoted osteoclast differentiation [ 47 , 48 ]. After exposure of osteoblasts to LPS, it was found that downregulation of Nrf2 in the inflammatory microenvironment promoted the proliferation and differentiation of osteoblasts. It has been found that radiation reduces bone mineralization and the expression of osteonectin and osteocalcin in MC3T3-E1 cells in a dose-dependent manner. The downregulation of Nrf2 mediated by siRNA significantly reversed the negative effect of radiation on osteoblast differentiation, resulting in a decrease in HO-1 and an increase in Runx2 levels [ 49 ]. Overexpression of Nrf2 in MC3T3-E1 osteoblasts inhibited the expression of Runx2, a key transcription factor in osteoblast differentiation, thus preventing osteoblast differentiation [ 50 ]. These results suggest that Nrf2 negatively regulates the differentiation and mineralization of osteoblasts. In this study, by downregulating Nrf2 in the inflammatory microenvironment, it was found that Nrf2 negatively regulated the proliferation and differentiation of osteoclasts and osteoblasts, which was consistent with most previous studies. Some studies have identified possible mechanisms via which Nrf2 may inhibit osteoblast differentiation: under oxidative stress, the overexpression of Nrf2 and its downstream factors (HO-1) can interact with Runx2, and can also directly bind to the ARE-like sequence near OSE2 in the osteocalcin promoter to cooperatively reduce the transcriptional activity of osteocalcin (Bglap), and ultimately inhibit the expression of many key genes, regulating osteogenic differentiation and mineralization [ 51 ]. In addition, some studies have shown that osteoblasts activated by Nrf2 indirectly inhibit osteoclast formation through reduction of IL-6 [ 52 ]. Nrf2 also directly inhibits the formation of osteoclasts, indicating that there is a dual inhibitory effect on osteoclasts. This study showed that low expression of Nrf2 promotes the differentiation and maturation of osteoclasts and osteoblasts; however, in the acute phase of periapical periodontitis, the expression of Nrf2 is significantly increased, and this phase is also the active phase of bone resorption, indicating that in an inflammatory environment, the role of Nrf2 is more to activate its anti-oxidative stress response, but it is still unable to reverse the progression of inflammation. At the same time, compared with osteoclasts, the high expression of Nrf2 had a greater effect in inhibiting the generation and differentiation of osteoblasts, resulting in the destruction of bone tissue. The present study has only investigated Nrf2 is involved in the disease process of CAP and may participate in the occurrence and development of bone destruction in CAP by regulating the proliferation and differentiation of osteoclasts and osteoblasts. Further studies are needed to be performed to explain the exact role of Nrf2 in CAP. Declarations Funding This work was supported by the National Natural Science Foundation of China (grant number 82270971; 82100998); the Liaoning Province Doctor Startup Foundation (grant number 2022BS237); and the Dalian Science and Technology Innovation Fund (grant number 2022JJ13SN062). Conflicts of Interest The authors declare no conflict of interest. Author Contributions Qiyi Song and Weidong Niu designed the study. Saixuan Wu and Suo Liu conducted experimental research. Saixuan Wu and Ming Dong analyzed the data. Lina Wang developed the graphs, and wrote the manuscript. All authors revised and modified the paper, and all authors approved the final manuscript. Ethics approval This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Dalian Medical University (approval number: AEE23006). Consent to participate Informed consent was obtained from all individual participants included in the study. Data availability statement All data generated or analyzed during this study are included in this published article. References Braz-Silva PH, Bergamini ML, Mardegan AP, De Rosa CS, Hasseus B, Jonasson P. Inflammatory profile of chronic apical periodontitis: a literature review. Acta Odontol Scand 2019; 77:173-180.https://doi.org/10.1080/00016357.2018.1521005 Niazi SA, Bakhsh A. Association between Endodontic Infection, Its Treatment and Systemic Health: A Narrative Review. Medicina (Kaunas) 2022; 58:931.https://doi.org/10.3390/medicina58070931 Gomes B, Herrera DR. Etiologic role of root canal infection in apical periodontitis and its relationship with clinical symptomatology. Brazilian oral research 2018; 32:e69.https://doi.org/10.1590/1807-3107bor-2018.vol32.0069 Karamifar K, Tondari A, Saghiri MA. Endodontic Periapical Lesion: An Overview on the Etiology, Diagnosis and Current Treatment Modalities. Eur Endod J 2020; 5:54-67.https://doi.org/10.14744/eej.2020.42714 Luo X, Wan Q, Cheng L, Xu R. Mechanisms of bone remodeling and therapeutic strategies in chronic apical periodontitis. Front Cell Infect Microbiol 2022; 12:908859.https://doi.org/10.3389/fcimb.2022.908859 Colic M, Gazivoda D, Vucevic D, Vasilijic S, Rudolf R, Lukic A. Proinflammatory and immunoregulatory mechanisms in periapical lesions. Mol Immunol 2009; 47:101-13.https://doi.org/10.1016/j.molimm.2009.01.011 Petean IBF, Silva-Sousa AC, Cronenbold TJ, Mazzi-Chaves JF, Silva L, Segato RAB, et al. Genetic, Cellular and Molecular Aspects involved in Apical Periodontitis. Braz Dent J 2022; 33:1-11.https://doi.org/10.1590/0103-6440202205113 Lin X, Chi D, Meng Q, Gong Q, Tong Z. Single-Cell Sequencing Unveils the Heterogeneity of Nonimmune Cells in Chronic Apical Periodontitis. Front Cell Dev Biol 2021; 9:820274.https://doi.org/10.3389/fcell.2021.820274 Galler KM, Weber M, Korkmaz Y, Widbiller M, Feuerer M. Inflammatory Response Mechanisms of the Dentine-Pulp Complex and the Periapical Tissues. Int J Mol Sci 2021; 22:1480.https://doi.org/10.3390/ijms22031480 Cavalla F, Letra A, Silva RM, Garlet GP. Determinants of Periodontal/Periapical Lesion Stability and Progression. J Dent Res 2021; 100:29-36.https://doi.org/10.1177/0022034520952341 Maldonado RF, Sá-Correia I, Valvano MA. Lipopolysaccharide modification in Gram-negative bacteria during chronic infection. FEMS Microbiol Rev 2016; 40:480-93.https://doi.org/10.1093/femsre/fuw007 Henderson B, Kaiser F. Bacterial modulators of bone remodeling in the periodontal pocket. Periodontol 2000 2018; 76:97-108.https://doi.org/10.1111/prd.12160 Gugliandolo E, Fusco R, D'Amico R, Militi A, Oteri G, Wallace JL, et al. Anti-inflammatory effect of ATB-352, a H2S -releasing ketoprofen derivative, on lipopolysaccharide-induced periodontitis in rats. Pharmacol Res 2018; 132:220-231.https://doi.org/10.1016/j.phrs.2017.12.022 Nam LB, Keum YS. Binding partners of NRF2: Functions and regulatory mechanisms. Arch Biochem Biophys 2019; 678:108184.https://doi.org/10.1016/j.abb.2019.108184 Liu S, Pi J, Zhang Q. Mathematical modeling reveals quantitative properties of KEAP1-NRF2 signaling. Redox biology 2021; 47:102139.https://doi.org/10.1016/j.redox.2021.102139 Lau A, Tian W, Whitman SA, Zhang DD. The predicted molecular weight of Nrf2: it is what it is not. Antioxid Redox Signal 2013; 18:91-3.https://doi.org/10.1089/ars.2012.4754 Sunil C, Zheng X, Yang Z, Cui K, Su Y, Xu B. Antifatigue effects of Hechong (Tylorrhynchus heterochaetus) through modulation of Nrf2/ARE- mediated antioxidant signaling pathway. Food Chem Toxicol 2021; 157:112589.https://doi.org/10.1016/j.fct.2021.112589 Chang SH, Lee JS, Yun UJ, Park KW. A Role of Stress Sensor Nrf2 in Stimulating Thermogenesis and Energy Expenditure. Biomedicines 2021; 9.https://doi.org/10.3390/biomedicines9091196 Sánchez-de-Diego C, Pedrazza L, Pimenta-Lopes C, Martinez-Martinez A, Dahdah N, Valer JA, et al. NRF2 function in osteocytes is required for bone homeostasis and drives osteocytic gene expression. Redox Biology 2021; 40.https://doi.org/10.1016/j.redox.2020.101845 Santoso A, Kikuchi T, Tode N, Hirano T, Komatsu R, Damayanti T, et al. Syndecan 4 Mediates Nrf2-dependent Expansion of Bronchiolar Progenitors That Protect Against Lung Inflammation. Mol Ther 2016; 24:41-52.https://doi.org/10.1038/mt.2015.153 Strom J, Xu B, Tian X, Chen QM. Nrf2 protects mitochondrial decay by oxidative stress. FASEB J 2016; 30:66-80.https://doi.org/10.1096/fj.14-268904 Shaw P, Chattopadhyay A. Nrf2-ARE signaling in cellular protection: Mechanism of action and the regulatory mechanisms. J Cell Physiol 2020; 235:3119-3130.https://doi.org/10.1002/jcp.29219 Chen X, Zhu X, Wei A, Chen F, Gao Q, Lu K, et al. Nrf2 epigenetic derepression induced by running exercise protects against osteoporosis. Bone Res 2021; 9:15.https://doi.org/10.1038/s41413-020-00128-8 Wang R, Zheng L, Xu Q, Xu L, Wang D, Li J, et al. Unveiling the structural properties of water-soluble lignin from gramineous biomass by autohydrolysis and its functionality as a bioactivator (anti-inflammatory and antioxidative). Int J Biol Macromol 2021; 191:1087-1095.https://doi.org/10.1016/j.ijbiomac.2021.09.124 Wei L, Chen W, Huang L, Wang H, Su Y, Liang J, et al. Alpinetin ameliorates bone loss in LPS-induced inflammation osteolysis via ROS mediated P38/PI3K signaling pathway. Pharmacol Res 2022; 184:106400.https://doi.org/10.1016/j.phrs.2022.106400 Kim EN, Kim TY, Park EK, Kim JY, Jeong GS. Panax ginseng Fruit Has Anti-Inflammatory Effect and Induces Osteogenic Differentiation by Regulating Nrf2/HO-1 Signaling Pathway in In Vitro and In Vivo Models of Periodontitis. Antioxidants (Basel) 2020; 9.https://doi.org/10.3390/antiox9121221 Zhu C, Zhao Y, Wu X, Qiang C, Liu J, Shi J, et al. The therapeutic role of baicalein in combating experimental periodontitis with diabetes via Nrf2 antioxidant signaling pathway. J Periodontal Res 2020; 55:381-391.https://doi.org/10.1111/jre.12722 Chiu AV, Saigh MA, McCulloch CA, Glogauer M. The Role of NrF2 in the Regulation of Periodontal Health and Disease. J Dent Res 2017; 96:975-983.https://doi.org/10.1177/0022034517715007 Yoshida E, Suzuki T, Morita M, Taguchi K, Tsuchida K, Motohashi H, et al. Hyperactivation of Nrf2 leads to hypoplasia of bone in vivo. Genes Cells 2018; 23:386-392.https://doi.org/10.1111/gtc.12579 Sun YX, Li L, Corry KA, Zhang P, Yang Y, Himes E, et al. Deletion of Nrf2 reduces skeletal mechanical properties and decreases load-driven bone formation. Bone 2015; 74:1-9.https://doi.org/10.1016/j.bone.2014.12.066 Estrela C, Bueno MR, Azevedo BC, Azevedo JR, Pecora JD. A new periapical index based on cone beam computed tomography. J Endod 2008; 34:1325-1331.https://doi.org/10.1016/j.joen.2008.08.013 Abbott PV. Present status and future directions: Managing endodontic emergencies. Int Endod J 2022; 55:778-803.https://doi.org/10.1111/iej.13678 Brooke Blicher W, Mahmoud Torabinejad. Endodontics: Principles and practice: Elsevier, 2020. Wang L, Dong M, Shi D, Yang C, Liu S, Gao L, et al. Role of PI3K in the bone resorption of apical periodontitis. BMC Oral Health 2022; 22:345.https://doi.org/10.1186/s12903-022-02364-2 Isola G, Santonocito S, Distefano A, Polizzi A, Vaccaro M, Raciti G, et al. Impact of periodontitis on gingival crevicular fluid miRNAs profiles associated with cardiovascular disease risk. J Periodontal Res 2023; 58:165-174.https://doi.org/10.1111/jre.13078 Isola G, Tartaglia GM, Santonocito S, Polizzi A, Williams RC, Iorio-Siciliano V. Impact of N-terminal pro-B-type natriuretic peptide and related inflammatory biomarkers on periodontal treatment outcomes in patients with periodontitis: An explorative human randomized-controlled clinical trial. J Periodontol 2023.https://doi.org/10.1002/jper.23-0063 Nair PN. On the causes of persistent apical periodontitis: a review. Int Endod J 2006; 39:249-81.https://doi.org/10.1111/j.1365-2591.2006.01099.x Wei Y, Fu J, Wu W, Ma P, Ren L, Yi Z, et al. Quercetin Prevents Oxidative Stress-Induced Injury of Periodontal Ligament Cells and Alveolar Bone Loss in Periodontitis. Drug Des Devel Ther 2021; 15:3509-3522.https://doi.org/10.2147/dddt.S315249 Yen CH, Hsu CM, Hsiao SY, Hsiao HH. Pathogenic Mechanisms of Myeloma Bone Disease and Possible Roles for NRF2. Int J Mol Sci 2020; 21.https://doi.org/10.3390/ijms21186723 Huang Z, Jiang Z, Zheng Z, Zhang X, Wei X, Chen J, et al. Methyl 3,4-dihydroxybenzoate inhibits RANKL-induced osteoclastogenesis via Nrf2 signaling in vitro and suppresses LPS-induced osteolysis and ovariectomy-induced osteoporosis in vivo. Acta Biochim Biophys Sin 2022; 54:1068-1079.https://doi.org/10.3724/abbs.2022087 Tian X, Cong F, Guo H, Fan J, Chao G, Song T. Downregulation of Bach1 protects osteoblasts against hydrogen peroxide-induced oxidative damage in vitro by enhancing the activation of Nrf2/ARE signaling. Chem Biol Interact 2019; 309:108706.https://doi.org/10.1016/j.cbi.2019.06.019 Sima C, Aboodi GM, Lakschevitz FS, Sun C, Goldberg MB, Glogauer M. Nuclear Factor Erythroid 2-Related Factor 2 Down-Regulation in Oral Neutrophils Is Associated with Periodontal Oxidative Damage and Severe Chronic Periodontitis. Am J Pathol 2016; 186:1417-26.https://doi.org/10.1016/j.ajpath.2016.01.013 Kataoka K, Ekuni D, Tomofuji T, Irie K, Kunitomo M, Uchida Y, et al. Visualization of Oxidative Stress Induced by Experimental Periodontitis in Keap1-Dependent Oxidative Stress Detector-Luciferase Mice. Int J Mol Sci 2016; 17.https://doi.org/10.3390/ijms17111907 Jiang Y, Yang P, Li C, Lu Y, Kou Y, Liu H, et al. Periostin regulates LPS-induced apoptosis via Nrf2/HO-1 pathway in periodontal ligament fibroblasts. Oral Dis 2022.https://doi.org/10.1111/odi.14189 Hyeon S, Lee H, Yang Y, Jeong W. Nrf2 deficiency induces oxidative stress and promotes RANKL-induced osteoclast differentiation. Free Radic Biol Med 2013; 65:789-799.https://doi.org/10.1016/j.freeradbiomed.2013.08.005 Park CK, Lee Y, Kim KH, Lee ZH, Joo M, Kim HH. Nrf2 is a novel regulator of bone acquisition. Bone 2014; 63:36-46.https://doi.org/10.1016/j.bone.2014.01.025 Ha YJ, Choi YS, Oh YR, Kang EH, Khang G, Park YB, et al. Fucoxanthin Suppresses Osteoclastogenesis via Modulation of MAP Kinase and Nrf2 Signaling. Mar Drugs 2021; 19.https://doi.org/10.3390/md19030132 Li W, Sun Y. Nrf2 is required for suppressing osteoclast RANKL-induced differentiation in RAW 264.7 cells via inactivating cannabinoid receptor type 2 with AM630. Regen Ther 2020; 14:191-195.https://doi.org/10.1016/j.reth.2020.02.001 Kook SH, Kim KA, Ji H, Lee D, Lee JC. Irradiation inhibits the maturation and mineralization of osteoblasts via the activation of Nrf2/HO-1 pathway. Mol Cell Biochem 2015; 410:255-66.https://doi.org/10.1007/s11010-015-2559-z Hinoi E, Fujimori S, Wang L, Hojo H, Uno K, Yoneda Y. Nrf2 negatively regulates osteoblast differentiation via interfering with Runx2-dependent transcriptional activation. J Biol Chem 2006; 281:18015-24.https://doi.org/10.1074/jbc.M600603200 Han J, Yang K, An J, Jiang N, Fu S, Tang X. The Role of NRF2 in Bone Metabolism - Friend or Foe? Front Endocrinol 2022; 13:813057.https://doi.org/10.3389/fendo.2022.813057 Narimiya T, Kanzaki H, Yamaguchi Y, Wada S, Katsumata Y, Tanaka K, et al. Nrf2 activation in osteoblasts suppresses osteoclastogenesis via inhibiting IL-6 expression. Bone Rep 2019; 11:100228.https://doi.org/10.1016/j.bonr.2019.100228 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4116386","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":281755822,"identity":"d8c2d5ae-7609-4181-abac-8e48c3e99b3a","order_by":0,"name":"QiYi Song","email":"","orcid":"","institution":"Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"QiYi","middleName":"","lastName":"Song","suffix":""},{"id":281755823,"identity":"24ffc618-c0c7-475f-8dbc-28c1b7474eb3","order_by":1,"name":"Saixuan Wu","email":"","orcid":"","institution":"Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Saixuan","middleName":"","lastName":"Wu","suffix":""},{"id":281755824,"identity":"ad2e0eab-76b9-48aa-8001-92317caa1738","order_by":2,"name":"Ming Dong","email":"","orcid":"","institution":"Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Dong","suffix":""},{"id":281755825,"identity":"0c924a80-1433-4356-b7ab-16cab5172a58","order_by":3,"name":"Shuo Liu","email":"","orcid":"","institution":"Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shuo","middleName":"","lastName":"Liu","suffix":""},{"id":281755826,"identity":"25b59a64-8ee7-4615-99e7-fa4441622c35","order_by":4,"name":"Lina Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAqElEQVRIiWNgGAWjYBACPmYQWSAhx8befIA4LWxgLQYSxnw8xxKI1AImDRgS50nkKBCphZ334AcGA4v0NoYcBoYfFduIcRhfsgTQYbltDGcPMPacuU2MFh4DiBbGvgRmxjbitBj/AGpJB+klWosZyJYENjZStFgAtRi28bAlHCTKL/z8Z4xvMFTUycvPf3zwwY8KIrSAAPMfKOMAcepHwSgYBaNgFBAEAMXOKmBLLXp+AAAAAElFTkSuQmCC","orcid":"","institution":"Dalian Medical University","correspondingAuthor":true,"prefix":"","firstName":"Lina","middleName":"","lastName":"Wang","suffix":""},{"id":281755827,"identity":"961e0f29-354a-430f-9fa9-4197e9dfd097","order_by":5,"name":"Weidong Niu","email":"","orcid":"","institution":"Dalian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Weidong","middleName":"","lastName":"Niu","suffix":""}],"badges":[],"createdAt":"2024-03-17 09:50:01","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4116386/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4116386/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53251602,"identity":"d1def551-619e-4674-8ca5-0eae5323acbb","added_by":"auto","created_at":"2024-03-22 12:55:27","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":340815,"visible":true,"origin":"","legend":"\u003cp\u003eHuman chronic apical periodontitis results (A) Selection of clinical tissue. Healthy human periodontal ligaments were used as the Control group; Periapical granuloma tissues were used as the CAP group. (B) Immunohistochemistry results showed the distribution of Nrf2 in the control and CAP groups. (C) Quantitative analysis showed that the number of Nrf2-positive cells was increased in CAP in comparison to the control samples. (D) Real-time qPCR results showed that the mRNA expression of Nrf2 and TRAP was increased in CAP in comparison to the control samples. (E) Western blot results showed that the protein expression of Nrf2 and TRAP was increased in CAP in comparison to the control samples. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, ****P \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"floatimage1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4116386/v1/ac5c4dbf380cacd5cabd9105.jpg"},{"id":53251603,"identity":"64ca5eb8-cb4d-47f6-90e6-473168af4ae9","added_by":"auto","created_at":"2024-03-22 12:55:27","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":567134,"visible":true,"origin":"","legend":"\u003cp\u003eAnimal apical periodontitis model results. (A) Schematic diagram of establishing a mouse model of periapical inflammation. (B) Hematoxylin-eosin staining showed the periapical inflammation at different time points in the mouse. (C) Immunohistochemical staining showed the expression of Nrf2. (D) Statistical analysis of the IOD values of Nrf2 in each experimental group, *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4116386/v1/93a47e058f1cf7dc6fafb479.jpg"},{"id":53251601,"identity":"a4a12334-a975-4bf0-9b6b-a6cb0a0f6428","added_by":"auto","created_at":"2024-03-22 12:55:26","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":224089,"visible":true,"origin":"","legend":"\u003cp\u003eRaw264.7 cells (A) and MC3T3-E1 cells (B) induction and identification. (A) \u003cstrong\u003ea\u003c/strong\u003e and \u003cstrong\u003eb\u003c/strong\u003e: The morphology of osteoclasts was observed under a light microscope. \u003cstrong\u003ec\u003c/strong\u003e and \u003cstrong\u003ed\u003c/strong\u003e: The morphological characteristics of osteoclasts were determined by TRAP staining. \u003cstrong\u003ee\u003c/strong\u003e: Real-time qPCR detection showed that the gene expression of TRAP was increased. (B) \u003cstrong\u003ea\u003c/strong\u003eand \u003cstrong\u003eb\u003c/strong\u003e: ALP staining results. \u003cstrong\u003ec\u003c/strong\u003e and \u003cstrong\u003ed\u003c/strong\u003e: Alizarin red staining results. \u003cstrong\u003ee\u003c/strong\u003e: Real-time qPCR results showed that the expression of the ALP gene at 7 days after induction was higher than that at 0 days. **P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"floatimage3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4116386/v1/0ea153af87f2d7408b26e455.jpg"},{"id":53251604,"identity":"f293f506-3d60-4651-b8a1-16027d75a77c","added_by":"auto","created_at":"2024-03-22 12:55:27","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":3371664,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of Nrf2 in the inflammatory microenvironment (A) Real-time qPCR showed higher gene expression of \u003cem\u003eNrf2\u003c/em\u003e, \u003cem\u003eTRAP\u003c/em\u003e, and \u003cem\u003eCTSK\u003c/em\u003e after osteoclasts were stimulated with LPS. \u0026nbsp;(B) Western blot results showed higher protein expression of Nrf2, TRAP, and CTSK after osteoclasts were stimulated with LPS, in comparison with the control group. (C) Real-time qPCR showed a higher mRNA expression of \u003cem\u003eNrf2\u003c/em\u003e and a lower mRNA expression of \u003cem\u003eALP\u003c/em\u003e and \u003cem\u003eRunx2\u003c/em\u003eafter osteoblasts were stimulated with LPS, in comparison with the control group. (D) Western blot results showed a higher protein expression of Nrf2 and a lower protein expression of ALP and Runx2 after osteoblasts were stimulated with LPS, in comparison with the control group. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4116386/v1/5a04ae4bb6c5de7fdd8eaf5d.jpg"},{"id":53252317,"identity":"5c99bc43-f7db-4c33-82b0-d6bb7674afe7","added_by":"auto","created_at":"2024-03-22 13:03:27","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":464719,"visible":true,"origin":"","legend":"\u003cp\u003eProliferation and differentiation of osteoclasts and osteoblasts after \u003cem\u003eNrf2\u003c/em\u003e downregulation. (A) Schematic diagram of Nrf2 showing the differentiation mechanism of osteoblasts and osteoclasts. (B) si-Nrf2 was transfected into osteoclasts, and osteoclasts downregulation efficiency was analyzed by real-time qPCR (a) and western blotting (b and c) after transfection. (C) si-Nrf2 was transfected into osteoclasts, and osteoblasts downregulation efficiency was analyzed by real-time qPCR (a) and western blotting (b and c) after transfection. (D) Effects of downregulation of \u003cem\u003eNrf2\u003c/em\u003e on the activity of osteoclasts (a) and osteoblasts (b) were analyzed by CCK-8 assay. (E) The expression of TRAP and CTSK was analyzed by real-time qPCR (a) and western blotting (b and c) after \u003cem\u003eNrf2\u003c/em\u003edownregulation. (F) The expression of ALP and RUNX2 was analyzed by real-time qPCR (a) and western blotting (b and c) after \u003cem\u003eNrf2\u003c/em\u003edownregulation. *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"floatimage5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4116386/v1/04fff9f47307259167343ee7.jpg"},{"id":53393450,"identity":"3ee9f882-28b3-4a9d-8ede-63ca9a6ce85a","added_by":"auto","created_at":"2024-03-25 12:57:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1020117,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4116386/v1/43ef13e7-7cf6-4afa-84f4-68bdf953fdcb.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The effect of Nrf2 on bone resorption in chronic apical periodontitis","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePeriapical periodontitis is a common dental pulp disease. It develops into chronic apical periodontitis (CAP) when periapical infection and pathogen irritants are present for a long time [\u003cspan additionalcitationids=\"CR2 CR3 CR4\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The pathological mechanism of CAP is still unclear. Microbial antigens from infected root canals can stimulate specific inflammatory and nonspecific immune responses in periapical tissues[\u003cspan additionalcitationids=\"CR7 CR8 CR9\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Gram negative bacteria is the main dominant bacterium in infected root canals and periapical tissue lesions. Lipopolysaccharide (LPS) is the main component of its cell wall adventitia that induces an inflammatory response leading to bone resorption [\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNuclear factor E2-related factor 2 (\u003cem\u003eNrf2\u003c/em\u003e) is a transcription factor with a basic leucine zipper structure in the Cap'n'Collar subfamily [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], which is responsible for regulating and maintaining the transcription of cytoprotective genes under conditions of stress and the destruction of redox homeostasis [\u003cspan additionalcitationids=\"CR17 CR18 CR19 CR20 CR21\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Studies have shown that Nrf2 is closely related to the proliferation and differentiation of osteoclasts and osteoblasts. It reduces the level of reactive oxygen species in cells by activating the expression of antioxidant enzymes [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], downregulates the MAPK and PI3K/Akt pathways, and inhibits osteoclast differentiation and consequent bone resorption [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The Nrf2/ARE signaling pathway is involved in bone-related pathological diseases such as periodontitis and arthritis [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and it regulates bone mass and bone mineral density [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Yoshida et al. [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] found that bone formation in \u003cem\u003eNrf2\u003c/em\u003e gene knockout mice increased, and the serum levels of bone formation markers also increased significantly. These results indicated that the increase of bone mass in \u003cem\u003eNrf2\u003c/em\u003e gene knockout mice may be caused by an increase of osteoblast production, indicating that the \u003cem\u003eNrf2\u003c/em\u003e gene inhibits the proliferation and differentiation of osteoblasts. In contrast, a study by Sun et al. [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] found that compared with the control group, the bone mass, bone strength, and bone formation of \u003cem\u003eNrf2\u003c/em\u003e gene knockout mice decreased.\u003c/p\u003e \u003cp\u003eThe above research shows that although Nrf2 plays a role in bone homeostasis, its specific effect is still controversial, especially in the inflammatory bone resorption of CAP. Here, we explored the potential regulatory effect of Nrf2 on periapical periodontitis by studying the expression of Nrf2 in human CAP and in an animal model of apical periodontitis and by establishing an LPS-mediated inflammation model of osteoblasts and osteoclasts in vitro.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eStudy population and clinical examinations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study population consisted of 29 patients with CAP and 19 patients who had undergone orthodontic removal of healthy tooth tissue at the periodontal ligament (controls) at the Dental Hospital of Dalian Medical University from January 2019 to December 2020.\u0026nbsp;All tissue samples were collected with the approval of the Ethics Committee of Dalian Medical University (approval number: 202106) and the patient\u0026apos;s informed consent. The clinical subjects were divided into three groups. The first group was used for immunohistochemistry; the second group was used to detect periapical periodontitis-associated gene expression using real-time qPCR; and the samples from the third group were used to detect periapical periodontitis-associated\u0026nbsp;protein expression using western blotting.\u003c/p\u003e\n\u003cp\u003eThe clinical cases were all diagnosed as asymptomatic apical periodontitis caused by caries-derived infection.\u0026nbsp;The teeth didn\u0026apos;t have spontaneous pain and the percussion was negative. The dental x-rays showed\u0026nbsp;a periapical index (PAI) score\u0026ge;3[31-33]. The CAP patients were in good health with no systemic or immune system diseases. Exclusion criteria were, as follows: the tooth was affected by periodontal disease or combined periodontal and pulpal disease; antibiotics or non-steroidal anti-inflammatory drugs had been taken in the 3 months before tooth extraction; allergies; refusal to participate in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstablishment of an\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ean\u003c/strong\u003e\u003cstrong\u003eimal apical periodontitis model\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal apical periodontitis model was constructed following our previous protocol[34].\u0026nbsp;A total of 20 wild-type C57BL/6J mice were supplied by Dalian Medical University and were housed in an animal control facility in a 12-h light/dark cycle with a mean illumination of 80 lx. The animals were maintained at 22\u0026plusmn;2 \u0026deg;C. Tap water and food pellets were available ad libitum. The\u0026nbsp;animal experiments were approved by the Ethics Committee of Dalian Medical University (approval number:\u0026nbsp;AEE23006).\u0026nbsp;The mice were anesthetized with pentobarbital sodium (30\u0026thinsp;mg/kg), a 1/4 round bur\u0026nbsp;(Wave Dental, Hong Kong, China)\u0026nbsp;was used to open the pulp cavity of the bilateral mandibular first molars, and mice without pulp exposure were used as the control group.\u0026nbsp;The mice were randomly divided into 5 groups with 4 mice in each group. At each time point (0, 1, 2, 3 and 4 weeks),\u0026nbsp;the mandibular bones\u0026nbsp;of 4 mice were stained\u0026nbsp;by\u0026nbsp;immunohistochemistry and hematoxylin and eosin (HE) to evaluate the morphological changes caused by the development of periapical lesions in the model.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry (IHC)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe protein expression levels in tissue were represented by integrated optical densities (IOD).\u0026nbsp;Immunohistochemistry was carried out according to the instructions of a rabbit streptavidin-biotin detection system kit (zsbio, Beijing, China). In short, the frozen tissue slides were dried at 37 \u0026deg;C for 30 minutes, endogenous peroxidase blocker was added, and normal goat serum working solution was used for sealing. According to the size of the tissue, a proper amount of primary Nrf2 polyclonal antibody (1:400 dilution, ABclonal, Wuhan, China) was added and incubated at 4 \u0026deg;C overnight. The tissue slides were then incubated with biotin-labeled goat anti-rabbit IgG polymer followed by horseradish enzyme-labeled streptavidin working solution and then DAB chromogenic solution and hematoxylin staining solution.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReal-time qPCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTissue RNA was extracted according to the instructions of the column Total RNA extraction Kit (Sangon Biotech, Shanghai, China).\u0026nbsp;Genomic DNA was removed from 1000 ng of total RNA by an Evo M-MLV RT Kit with gDNA Clean for qPCR (Accurate Biology, Hunan, China), reverse transcription was performed to construct cDNA, and SYBR\u0026reg; Green I chimeric fluorescence was used for qPCR. The primers are listed in Table 1 and Table 2. The relative expression levels of the target genes were calculated by the 2\u003csup\u003e﹣\u003c/sup\u003e\u003csup\u003e△△\u003c/sup\u003e\u003csup\u003eCt\u003c/sup\u003e method.\u003c/p\u003e\n\u003cp\u003eTable 1. List of human related gene primers used in this study for real-time PCR.\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"101%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003eGene\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.44444444444444%\" valign=\"top\"\u003e\n \u003cp\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.42424242424242%\" valign=\"top\"\u003e\n \u003cp\u003eReverse (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eGAPDH\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.44444444444444%\" valign=\"top\"\u003e\n \u003cp\u003eGCACCGTCAAGGCTGAGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.42424242424242%\" valign=\"top\"\u003e\n \u003cp\u003eTGGTGAAGACGCCAGTGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eNrf2\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.44444444444444%\" valign=\"top\"\u003e\n \u003cp\u003eTTCCTCTGCTGCCATTAGTCAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.42424242424242%\" valign=\"top\"\u003e\n \u003cp\u003eGCTCTTCCATTTCCGAGTCACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTRAP \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"44.44444444444444%\" valign=\"top\"\u003e\n \u003cp\u003eCCTACCCACTGCCTGGTCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"42.42424242424242%\" valign=\"top\"\u003e\n \u003cp\u003eACGTAGCCCACGCCATTCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 2. List of mouse related gene primers used in this study for real-time PCR.\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"101%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003eGene\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eForward (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eReverse (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eGAPDH\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eAAATGGTGAAGGTCGGTGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eTGAAGGGGTCGTTGATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eNrf2\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eTTCCTCTGCTGCCATTAGTCAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eGCTCTTCCATTTCCGAGTCACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eTRAP \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eGGGTCACTGCCTACCTGTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eTCATTTCTTTGGGGCTTATCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eCTSK\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eCACCCAGTGGGAGCTATGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eGCCTCCAGGTTATGGGCAGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eALP\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eTGAATCGGAACAACCTGACTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eGAGCCTGCTTGGCCTTACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"13.131313131313131%\" valign=\"top\"\u003e\n \u003cp\u003e\u003cem\u003eRunx2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eCCTCTGGCCTTCCTCTCTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.43434343434343%\" valign=\"top\"\u003e\n \u003cp\u003eTAGGTAAAGGTGGCTGGGTAGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal protein was extracted with protease inhibitor (Solarbio, Beijing, China) containing cleavage buffer. Protein concentration was determined using a BCA Protein Assay Kit (Beyotime Biotechnology, Shanghai, China). The protein (20 \u0026mu;g) was separated by 10% sodium dodecyl sulfate and sodium salt-polyacrylamide gel electrophoresis (SDS\u0026ndash;PAGE) and transferred to a nitrocellulose membrane.\u003c/p\u003e\n\u003cp\u003eThe membrane was sealed with 5% skimmed milk at room temperature for 2.5 hours and then diluted with specific anti-Nrf2 antibody (1:800 dilution; ABclonal, Wuhan, China), TRAP (1:1500 dilution; ABclonal, Wuhan, China), CTSK (1:1000 dilution; ABclonal, Wuhan, China),\u0026nbsp;ALP (1:1000 dilution; Abcam, Cambridge, UK), Runx2 (1:500 dilution; Abcam, Cambridge, UK), and GAPDH (1:5000 dilution; ABclonal, Wuhan, China). The membrane was washed three times with buffered saline and Tween 20 for 10 minutes each time, and the anti-rabbit immunoglobulin G antibody coupled with horseradish peroxidase was incubated for 2 hours. Protein bands were visualized using a gel imaging system (Bio\u0026ndash;Rad, Hercules, CA). Image Lab (Bio\u0026ndash;Rad) was used to analyze and output the collected images.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 (Procell\u0026nbsp;Life Science \u0026amp; Technology Co.,\u0026nbsp;Ltd, CL-0190, Wuhan, China) and MC3T3-E1 (Sunncell Biotech,\u0026nbsp;SNL-021, Wuhan, China) cells were cultured in high-sugar DMEM/\u0026alpha;-MEM supplemented with 10% fetal bovine serum and antibiotics (1% penicillin/streptomycin) in a cell incubator\u0026nbsp;at 37 \u0026deg;C\u0026nbsp;with 5% carbon dioxide. When the fusion rate of adherent cells was more than 80%, the cells were passaged and were then digested with 0.25% trypsin (HyClone, Logan, Utah, USA). Third- or fourth-generation cells were used for in vitro experiments.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell induction and identification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 cells were induced with 0.05 \u0026mu;g/mL RANKL (Abcam, Cambridge, UK) induction solution for 5 days, and a tartrate-resistant acid phosphatase (TRAP) staining kit was used to test osteoclasts. Seven days later, MC3T3-E1 cells were induced with osteoblast induction solution (2 mmol/L Dex, 10 mmol/L \u0026beta;-sodium glycerophosphate, 2 mmol/L VC).\u0026nbsp;Alkaline phosphatase (ALP) activity was detected using an alkaline phosphatase staining kit (Sigma\u0026ndash;Aldrich, St.\u0026nbsp;Louis, MO, USA). After 21 days of induction, the formation of calcified nodules in osteoblasts was observed by alizarin red (Sigma\u0026ndash;Aldrich, St Louis, MO, USA) staining.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell transfection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 and MC3T3-E1 cells were treated with LPS and seeded in 6-well plates. For knockout experiments, siRNA targeting the Nrf2 gene (Nrf2-siRNA; 100 pmol/well) and negative control siRNA were purchased from GenePharma (Suzhou, China). Cells were transfected with Nrf2-siRNA using Xfect RNA transfection reagent (TaKaRa, Kyoto, Japan) when the cells were 70%-80% confluent.\u0026nbsp;The transfection efficiency was determined by real-time PCR and Western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell Counting Kit-8 (CCK-8)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRAW264.7 cells and MC3T3-E1 cells were seeded in 96-well plates at 100 \u0026mu;L per well (n\u0026nbsp;=\u0026nbsp;50\u003csup\u003e3\u003c/sup\u003e cells) and cultured for 24 hours before 10 \u0026mu;L of CCK-8 solution was added to each well. The plates were then incubated for 1 hour, after which the absorbance (OD) at 450 nm was measured.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the above data were analyzed as the mean \u0026plusmn; standard deviation (SD). Differences between groups were calculated by one-way analysis of variance (ANOVA). Statistical analysis was conducted using SPSS 17.0 software. The differences were significant when P values \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003e1. Human chronic apical periodontitis\u003c/h2\u003e\n \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e\n \u003ch2\u003eExpression of Nrf2 in CAP\u003c/h2\u003e\n \u003cp\u003eTo evaluate the expression of Nrf2 in CAP (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA), we used immunohistochemical staining. There was positive expression of Nrf2 in the healthy periodontal ligament and CAP, only a few in normal periodontal ligament fibroblasts and a large amount in periapical granulomatous inflammatory cells (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB, C). The mRNA transcription levels of Nrf2 and TRAP were detected by real-time qPCR (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD) and were significantly higher than those in the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The protein levels of Nrf2 and TRAP detected by Western blot (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eE) were significantly higher in the CAP group than in the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003e2. Animal apical periodontitis model\u003c/h2\u003e\n \u003cdiv id=\"Sec17\" class=\"Section3\"\u003e\n \u003ch2\u003eExpression of Nrf2 in an animal model of periapical periodontitis\u003c/h2\u003e\n \u003cp\u003eHematoxylin-eosin staining showed that the model of periapical periodontitis was successfully established (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA). In the 0-week group, the periodontal ligament structure was intact, no inflammatory cell infiltration was found in the periapical tissue, and no alveolar bone injury was found. In the 1-week group, there was a small amount of inflammatory cell infiltration in the periapical tissue and slight alveolar bone resorption. In the 2-week group, the infiltration of inflammatory cells in the periapical tissue and alveolar bone resorption increased. In the 3-week group, a large number of inflammatory cells continued to infiltrate, and alveolar bone resorption increased. Inflammation and bone resorption were obvious in the 4-week group but entered the stage of chronic inflammation (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). The results of Nrf2 immunohistochemical staining showed that there were only a few positive cells in the healthy control group, and the expression of Nrf2 in the experimental group began to increase at 1 week (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), reached a peak at 3 weeks (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and decreased at 4 weeks (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The number of Nrf2-positive cells in each experimental group was higher than that in the healthy control group (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003e3. In vitro cell experiments\u003c/h2\u003e\n \u003cdiv id=\"Sec19\" class=\"Section3\"\u003e\n \u003ch2\u003eInduction and identification of cells\u003c/h2\u003e\n \u003cp\u003eThe morphological characteristics of osteoclasts were confirmed by light microscopy and TRAP staining. After 5 days of induction, the cells became larger, irregular or quasi-round, with 3 or more nuclei, and the number of TRAP-positive multinucleated osteoclasts (\u0026ge;\u0026thinsp;3 nuclei) increased significantly. Real-time qPCR detection showed that the gene expression levels of TRAP were increased, indicating that RANKL successfully induced osteoclast precursor RAW264.7 cells to differentiate into osteoclasts (Fig. 3A). ALP staining and alizarin red staining were used to observe the induction of osteoblasts. After 7 days of induction, the activity and gene expression of ALP increased. After 21 days of induction, alizarin red staining showed the formation of mineralized nodules (Fig. 3B). The results indicated that osteoblast precursor MC3T3-E1 cells successfully differentiated into osteoblast.\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003eExpression of Nrf2 in the inflammatory microenvironment\u003c/h2\u003e\n \u003cp\u003eCell culture medium containing 100 ng/mL LPS was added to osteoclasts, and real-time qPCR and western blot results showed that the expression levels of Nrf2, CTSK and TRAP in LPS-treated cells were higher than those in control cells (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). Cell culture medium containing 1,000 ng/mL LPS was added to osteoblasts, and real-time qPCR and western blot results showed that the expression of Nrf2 in LPS-treated cells was higher than that in control cells, while the expression levels of ALP and Runx2 were lower than those in control cells (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eC, D).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003eEffects of downregulation of Nrf2 on the proliferation and differentiation of osteoclasts and osteoblasts\u003c/h2\u003e\n \u003cp\u003eThe results showed that downregulation of \u003cem\u003eNrf2\u003c/em\u003e can promote the differentiation of osteoclasts and osteoblasts (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA). Osteoclasts and osteoblasts were transfected with Nrf2-siRNA, and real-time qPCR and Western blot results confirmed the successful transfection of Nrf2-siRNA (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB, C). CCK-8 assay was used to detect the effect of \u003cem\u003eNrf2\u003c/em\u003e on cell proliferation and to construct cell growth curves, and the results showed that the proliferation of osteoclasts was promoted after downregulation of Nrf2 for 24 and 48 hours (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and downregulation of \u003cem\u003eNrf2\u003c/em\u003e for 48 hours also could promote osteoblast proliferation (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eD). Real-time qPCR and Western blot results showed that downregulation of \u003cem\u003eNrf2\u003c/em\u003e could promote the expression of TRAP and CTSK genes and proteins in osteoclasts (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eE) and promote the expression of ALP and Runx2 genes and proteins in osteoblasts (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eF).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eCAP is the most common inflammatory bone disease associated with jaws and teeth. There is emerging evidence that apical periodontitis may negatively impact systemic health, since apical periodontitis can increase the level of inflammatory mediators and affect cardiovascular disease and diabetes. This is similar to periodontal disease, which can affect cardiovascular disease through inflammatory mediators, miRNAs, N-terminal pro-B-type natriuretic peptide and other factors [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In contrast to other inflammatory bone diseases, dental pulp infection can directly cause jaw lesions through the apical foramen. In the periapical tissue inflammatory microenvironment, the interaction between cells and cytokines and other inflammatory factors can protect the periapical tissue; however it may also lead to serious damage to the periapical tissue [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Therefore, it is necessary to investigate the molecular mechanism of CAP.\u003c/p\u003e \u003cp\u003eIn this study, high expression of Nrf2 was found in both human apical periodontitis samples and periapical tissues of mouse apical periodontitis. In recent years, it has been found that Nrf2 plays a certain role in the occurrence and development of diseases characterized by bone destruction, such as periodontitis, osteoporosis and osteoarthritis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan additionalcitationids=\"CR39 CR40\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Our results showed that Nrf2 was highly expressed in human CAP tissues. This suggests that Nrf2 may participate in periapical inflammation. In addition, the experiments using an animal model of periapical periodontitis in this study showed that the expression of Nrf2 was the highest when periapical periodontitis progressed to the third week, which was the peak period of periapical bone resorption. Studies have shown that periodontal tissue damage in Nrf2 knockout mice is more serious than that in wild-type mice [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], indicating that Nrf2 may have a protective effect on bone against damage caused by periodontitis. It has been suggested that the Nrf2 antioxidant defense pathway may be activated under oxidative stress induced by experimental periodontitis [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Our results showed that Nrf2 was highly expressed in mouse periapical bone resorption tissues, which may be because Nrf2 initiates the antioxidant stress response.\u003c/p\u003e \u003cp\u003eHyeon et al.[\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] showed that the bone marrow-derived macrophages of Nrf2 gene knockout mice, formation of tartrate-resistant acid phosphatase-positive multinuclear cells containing more than three nuclei, and ability to form actin rings were all significantly enhanced, indicating that Nrf2 may inhibit osteoclast differentiation and inhibit the formation of actin rings and bone resorption. The mRNA expression of the bone formation-related factors ALP, Runx2, and osteocalcin, as well as Runx2 protein, increased significantly in Nrf2 knockout MC3T3-E1 cells and skull-derived osteoblasts [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], which showed that Nrf2 may also inhibit the formation of osteoblasts. Therefore, the high expression of Nrf2 may play a protective role in periapical inflammation.\u003c/p\u003e \u003cp\u003eTo further clarify the role of Nrf2 in periapical periodontitis, this study established an inflammation model of osteoclasts and osteoblasts. The results showed that downregulation of Nrf2 in the inflammatory microenvironment promoted the proliferation and differentiation of osteoclasts. This result is consistent with previous research results, which showed that, compared with the control group, downregulation of Nrf2 promoted osteoclast differentiation [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAfter exposure of osteoblasts to LPS, it was found that downregulation of Nrf2 in the inflammatory microenvironment promoted the proliferation and differentiation of osteoblasts. It has been found that radiation reduces bone mineralization and the expression of osteonectin and osteocalcin in MC3T3-E1 cells in a dose-dependent manner. The downregulation of Nrf2 mediated by siRNA significantly reversed the negative effect of radiation on osteoblast differentiation, resulting in a decrease in HO-1 and an increase in Runx2 levels [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Overexpression of Nrf2 in MC3T3-E1 osteoblasts inhibited the expression of Runx2, a key transcription factor in osteoblast differentiation, thus preventing osteoblast differentiation [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. These results suggest that Nrf2 negatively regulates the differentiation and mineralization of osteoblasts.\u003c/p\u003e \u003cp\u003eIn this study, by downregulating Nrf2 in the inflammatory microenvironment, it was found that Nrf2 negatively regulated the proliferation and differentiation of osteoclasts and osteoblasts, which was consistent with most previous studies. Some studies have identified possible mechanisms via which Nrf2 may inhibit osteoblast differentiation: under oxidative stress, the overexpression of Nrf2 and its downstream factors (HO-1) can interact with Runx2, and can also directly bind to the ARE-like sequence near OSE2 in the osteocalcin promoter to cooperatively reduce the transcriptional activity of osteocalcin (Bglap), and ultimately inhibit the expression of many key genes, regulating osteogenic differentiation and mineralization [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. In addition, some studies have shown that osteoblasts activated by Nrf2 indirectly inhibit osteoclast formation through reduction of IL-6 [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Nrf2 also directly inhibits the formation of osteoclasts, indicating that there is a dual inhibitory effect on osteoclasts.\u003c/p\u003e \u003cp\u003eThis study showed that low expression of Nrf2 promotes the differentiation and maturation of osteoclasts and osteoblasts; however, in the acute phase of periapical periodontitis, the expression of Nrf2 is significantly increased, and this phase is also the active phase of bone resorption, indicating that in an inflammatory environment, the role of Nrf2 is more to activate its anti-oxidative stress response, but it is still unable to reverse the progression of inflammation. At the same time, compared with osteoclasts, the high expression of Nrf2 had a greater effect in inhibiting the generation and differentiation of osteoblasts, resulting in the destruction of bone tissue. The present study has only investigated Nrf2 is involved in the disease process of CAP and may participate in the occurrence and development of bone destruction in CAP by regulating the proliferation and differentiation of osteoclasts and osteoblasts. Further studies are needed to be performed to explain the exact role of Nrf2 in CAP.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (grant number 82270971; 82100998); the Liaoning Province Doctor Startup Foundation (grant number 2022BS237); and the Dalian Science and Technology Innovation Fund (grant number 2022JJ13SN062).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQiyi Song and Weidong Niu designed the study. Saixuan Wu and Suo Liu conducted experimental research. Saixuan Wu and Ming Dong analyzed the data. Lina Wang developed the graphs, and wrote the manuscript. All authors revised and modified the paper, and all authors approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of Dalian Medical University (approval number:\u0026nbsp;AEE23006).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eInformed consent was obtained from all individual participants included in the study.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBraz-Silva PH, Bergamini ML, Mardegan AP, De Rosa CS, Hasseus B, Jonasson P. Inflammatory profile of chronic apical periodontitis: a literature review. \u003cem\u003eActa Odontol Scand\u003c/em\u003e 2019; 77:173-180.https://doi.org/10.1080/00016357.2018.1521005 \u003c/li\u003e\n\u003cli\u003eNiazi SA, Bakhsh A. Association between Endodontic Infection, Its Treatment and Systemic Health: A Narrative Review. \u003cem\u003eMedicina (Kaunas)\u003c/em\u003e 2022; 58:931.https://doi.org/10.3390/medicina58070931 \u003c/li\u003e\n\u003cli\u003eGomes B, Herrera DR. Etiologic role of root canal infection in apical periodontitis and its relationship with clinical symptomatology. \u003cem\u003eBrazilian oral research\u003c/em\u003e 2018; 32:e69.https://doi.org/10.1590/1807-3107bor-2018.vol32.0069 \u003c/li\u003e\n\u003cli\u003eKaramifar K, Tondari A, Saghiri MA. Endodontic Periapical Lesion: An Overview on the Etiology, Diagnosis and Current Treatment Modalities. \u003cem\u003eEur Endod J\u003c/em\u003e 2020; 5:54-67.https://doi.org/10.14744/eej.2020.42714 \u003c/li\u003e\n\u003cli\u003eLuo X, Wan Q, Cheng L, Xu R. Mechanisms of bone remodeling and therapeutic strategies in chronic apical periodontitis. \u003cem\u003eFront Cell Infect Microbiol\u003c/em\u003e 2022; 12:908859.https://doi.org/10.3389/fcimb.2022.908859 \u003c/li\u003e\n\u003cli\u003eColic M, Gazivoda D, Vucevic D, Vasilijic S, Rudolf R, Lukic A. Proinflammatory and immunoregulatory mechanisms in periapical lesions. \u003cem\u003eMol Immunol\u003c/em\u003e 2009; 47:101-13.https://doi.org/10.1016/j.molimm.2009.01.011 \u003c/li\u003e\n\u003cli\u003ePetean IBF, Silva-Sousa AC, Cronenbold TJ, Mazzi-Chaves JF, Silva L, Segato RAB, et al. Genetic, Cellular and Molecular Aspects involved in Apical Periodontitis. \u003cem\u003eBraz Dent J\u003c/em\u003e 2022; 33:1-11.https://doi.org/10.1590/0103-6440202205113 \u003c/li\u003e\n\u003cli\u003eLin X, Chi D, Meng Q, Gong Q, Tong Z. Single-Cell Sequencing Unveils the Heterogeneity of Nonimmune Cells in Chronic Apical Periodontitis. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e 2021; 9:820274.https://doi.org/10.3389/fcell.2021.820274 \u003c/li\u003e\n\u003cli\u003eGaller KM, Weber M, Korkmaz Y, Widbiller M, Feuerer M. Inflammatory Response Mechanisms of the Dentine-Pulp Complex and the Periapical Tissues. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2021; 22:1480.https://doi.org/10.3390/ijms22031480 \u003c/li\u003e\n\u003cli\u003eCavalla F, Letra A, Silva RM, Garlet GP. Determinants of Periodontal/Periapical Lesion Stability and Progression. \u003cem\u003eJ Dent Res\u003c/em\u003e 2021; 100:29-36.https://doi.org/10.1177/0022034520952341 \u003c/li\u003e\n\u003cli\u003eMaldonado RF, S\u0026aacute;-Correia I, Valvano MA. Lipopolysaccharide modification in Gram-negative bacteria during chronic infection. \u003cem\u003eFEMS Microbiol Rev\u003c/em\u003e 2016; 40:480-93.https://doi.org/10.1093/femsre/fuw007 \u003c/li\u003e\n\u003cli\u003eHenderson B, Kaiser F. Bacterial modulators of bone remodeling in the periodontal pocket. \u003cem\u003ePeriodontol 2000\u003c/em\u003e 2018; 76:97-108.https://doi.org/10.1111/prd.12160 \u003c/li\u003e\n\u003cli\u003eGugliandolo E, Fusco R, D\u0026apos;Amico R, Militi A, Oteri G, Wallace JL, et al. Anti-inflammatory effect of ATB-352, a H2S -releasing ketoprofen derivative, on lipopolysaccharide-induced periodontitis in rats. \u003cem\u003ePharmacol Res\u003c/em\u003e 2018; 132:220-231.https://doi.org/10.1016/j.phrs.2017.12.022 \u003c/li\u003e\n\u003cli\u003eNam LB, Keum YS. Binding partners of NRF2: Functions and regulatory mechanisms. \u003cem\u003eArch Biochem Biophys\u003c/em\u003e 2019; 678:108184.https://doi.org/10.1016/j.abb.2019.108184 \u003c/li\u003e\n\u003cli\u003eLiu S, Pi J, Zhang Q. Mathematical modeling reveals quantitative properties of KEAP1-NRF2 signaling. \u003cem\u003eRedox biology\u003c/em\u003e 2021; 47:102139.https://doi.org/10.1016/j.redox.2021.102139 \u003c/li\u003e\n\u003cli\u003eLau A, Tian W, Whitman SA, Zhang DD. The predicted molecular weight of Nrf2: it is what it is not. \u003cem\u003eAntioxid Redox Signal\u003c/em\u003e 2013; 18:91-3.https://doi.org/10.1089/ars.2012.4754 \u003c/li\u003e\n\u003cli\u003eSunil C, Zheng X, Yang Z, Cui K, Su Y, Xu B. Antifatigue effects of Hechong (Tylorrhynchus heterochaetus) through modulation of Nrf2/ARE- mediated antioxidant signaling pathway. \u003cem\u003eFood Chem Toxicol\u003c/em\u003e 2021; 157:112589.https://doi.org/10.1016/j.fct.2021.112589 \u003c/li\u003e\n\u003cli\u003eChang SH, Lee JS, Yun UJ, Park KW. A Role of Stress Sensor Nrf2 in Stimulating Thermogenesis and Energy Expenditure. \u003cem\u003eBiomedicines\u003c/em\u003e 2021; 9.https://doi.org/10.3390/biomedicines9091196 \u003c/li\u003e\n\u003cli\u003eS\u0026aacute;nchez-de-Diego C, Pedrazza L, Pimenta-Lopes C, Martinez-Martinez A, Dahdah N, Valer JA, et al. NRF2 function in osteocytes is required for bone homeostasis and drives osteocytic gene expression. \u003cem\u003eRedox Biology\u003c/em\u003e 2021; 40.https://doi.org/10.1016/j.redox.2020.101845 \u003c/li\u003e\n\u003cli\u003eSantoso A, Kikuchi T, Tode N, Hirano T, Komatsu R, Damayanti T, et al. Syndecan 4 Mediates Nrf2-dependent Expansion of Bronchiolar Progenitors That Protect Against Lung Inflammation. \u003cem\u003eMol Ther\u003c/em\u003e 2016; 24:41-52.https://doi.org/10.1038/mt.2015.153 \u003c/li\u003e\n\u003cli\u003eStrom J, Xu B, Tian X, Chen QM. Nrf2 protects mitochondrial decay by oxidative stress. \u003cem\u003eFASEB J\u003c/em\u003e 2016; 30:66-80.https://doi.org/10.1096/fj.14-268904 \u003c/li\u003e\n\u003cli\u003eShaw P, Chattopadhyay A. Nrf2-ARE signaling in cellular protection: Mechanism of action and the regulatory mechanisms. \u003cem\u003eJ Cell Physiol\u003c/em\u003e 2020; 235:3119-3130.https://doi.org/10.1002/jcp.29219 \u003c/li\u003e\n\u003cli\u003eChen X, Zhu X, Wei A, Chen F, Gao Q, Lu K, et al. Nrf2 epigenetic derepression induced by running exercise protects against osteoporosis. \u003cem\u003eBone Res\u003c/em\u003e 2021; 9:15.https://doi.org/10.1038/s41413-020-00128-8 \u003c/li\u003e\n\u003cli\u003eWang R, Zheng L, Xu Q, Xu L, Wang D, Li J, et al. Unveiling the structural properties of water-soluble lignin from gramineous biomass by autohydrolysis and its functionality as a bioactivator (anti-inflammatory and antioxidative). \u003cem\u003eInt J Biol Macromol\u003c/em\u003e 2021; 191:1087-1095.https://doi.org/10.1016/j.ijbiomac.2021.09.124 \u003c/li\u003e\n\u003cli\u003eWei L, Chen W, Huang L, Wang H, Su Y, Liang J, et al. Alpinetin ameliorates bone loss in LPS-induced inflammation osteolysis via ROS mediated P38/PI3K signaling pathway. \u003cem\u003ePharmacol Res\u003c/em\u003e 2022; 184:106400.https://doi.org/10.1016/j.phrs.2022.106400 \u003c/li\u003e\n\u003cli\u003eKim EN, Kim TY, Park EK, Kim JY, Jeong GS. Panax ginseng Fruit Has Anti-Inflammatory Effect and Induces Osteogenic Differentiation by Regulating Nrf2/HO-1 Signaling Pathway in In Vitro and In Vivo Models of Periodontitis. \u003cem\u003eAntioxidants (Basel)\u003c/em\u003e 2020; 9.https://doi.org/10.3390/antiox9121221 \u003c/li\u003e\n\u003cli\u003eZhu C, Zhao Y, Wu X, Qiang C, Liu J, Shi J, et al. The therapeutic role of baicalein in combating experimental periodontitis with diabetes via Nrf2 antioxidant signaling pathway. \u003cem\u003eJ Periodontal Res\u003c/em\u003e 2020; 55:381-391.https://doi.org/10.1111/jre.12722 \u003c/li\u003e\n\u003cli\u003eChiu AV, Saigh MA, McCulloch CA, Glogauer M. The Role of NrF2 in the Regulation of Periodontal Health and Disease. \u003cem\u003eJ Dent Res\u003c/em\u003e 2017; 96:975-983.https://doi.org/10.1177/0022034517715007 \u003c/li\u003e\n\u003cli\u003eYoshida E, Suzuki T, Morita M, Taguchi K, Tsuchida K, Motohashi H, et al. Hyperactivation of Nrf2 leads to hypoplasia of bone in vivo. \u003cem\u003eGenes Cells\u003c/em\u003e 2018; 23:386-392.https://doi.org/10.1111/gtc.12579 \u003c/li\u003e\n\u003cli\u003eSun YX, Li L, Corry KA, Zhang P, Yang Y, Himes E, et al. Deletion of Nrf2 reduces skeletal mechanical properties and decreases load-driven bone formation. \u003cem\u003eBone\u003c/em\u003e 2015; 74:1-9.https://doi.org/10.1016/j.bone.2014.12.066 \u003c/li\u003e\n\u003cli\u003eEstrela C, Bueno MR, Azevedo BC, Azevedo JR, Pecora JD. A new periapical index based on cone beam computed tomography. \u003cem\u003eJ Endod\u003c/em\u003e 2008; 34:1325-1331.https://doi.org/10.1016/j.joen.2008.08.013 \u003c/li\u003e\n\u003cli\u003eAbbott PV. Present status and future directions: Managing endodontic emergencies. \u003cem\u003eInt Endod J\u003c/em\u003e 2022; 55:778-803.https://doi.org/10.1111/iej.13678 \u003c/li\u003e\n\u003cli\u003eBrooke Blicher W, Mahmoud Torabinejad. Endodontics: Principles and practice: Elsevier, 2020.\u003c/li\u003e\n\u003cli\u003eWang L, Dong M, Shi D, Yang C, Liu S, Gao L, et al. Role of PI3K in the bone resorption of apical periodontitis. \u003cem\u003eBMC Oral Health\u003c/em\u003e 2022; 22:345.https://doi.org/10.1186/s12903-022-02364-2 \u003c/li\u003e\n\u003cli\u003eIsola G, Santonocito S, Distefano A, Polizzi A, Vaccaro M, Raciti G, et al. Impact of periodontitis on gingival crevicular fluid miRNAs profiles associated with cardiovascular disease risk. \u003cem\u003eJ Periodontal Res\u003c/em\u003e 2023; 58:165-174.https://doi.org/10.1111/jre.13078 \u003c/li\u003e\n\u003cli\u003eIsola G, Tartaglia GM, Santonocito S, Polizzi A, Williams RC, Iorio-Siciliano V. Impact of N-terminal pro-B-type natriuretic peptide and related inflammatory biomarkers on periodontal treatment outcomes in patients with periodontitis: An explorative human randomized-controlled clinical trial. \u003cem\u003eJ Periodontol\u003c/em\u003e 2023.https://doi.org/10.1002/jper.23-0063 \u003c/li\u003e\n\u003cli\u003eNair PN. On the causes of persistent apical periodontitis: a review. \u003cem\u003eInt Endod J\u003c/em\u003e 2006; 39:249-81.https://doi.org/10.1111/j.1365-2591.2006.01099.x \u003c/li\u003e\n\u003cli\u003eWei Y, Fu J, Wu W, Ma P, Ren L, Yi Z, et al. Quercetin Prevents Oxidative Stress-Induced Injury of Periodontal Ligament Cells and Alveolar Bone Loss in Periodontitis. \u003cem\u003eDrug Des Devel Ther\u003c/em\u003e 2021; 15:3509-3522.https://doi.org/10.2147/dddt.S315249 \u003c/li\u003e\n\u003cli\u003eYen CH, Hsu CM, Hsiao SY, Hsiao HH. Pathogenic Mechanisms of Myeloma Bone Disease and Possible Roles for NRF2. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2020; 21.https://doi.org/10.3390/ijms21186723 \u003c/li\u003e\n\u003cli\u003eHuang Z, Jiang Z, Zheng Z, Zhang X, Wei X, Chen J, et al. Methyl 3,4-dihydroxybenzoate inhibits RANKL-induced osteoclastogenesis via Nrf2 signaling in vitro and suppresses LPS-induced osteolysis and ovariectomy-induced osteoporosis in vivo. \u003cem\u003eActa Biochim Biophys Sin\u003c/em\u003e 2022; 54:1068-1079.https://doi.org/10.3724/abbs.2022087 \u003c/li\u003e\n\u003cli\u003eTian X, Cong F, Guo H, Fan J, Chao G, Song T. Downregulation of Bach1 protects osteoblasts against hydrogen peroxide-induced oxidative damage in vitro by enhancing the activation of Nrf2/ARE signaling. \u003cem\u003eChem Biol Interact\u003c/em\u003e 2019; 309:108706.https://doi.org/10.1016/j.cbi.2019.06.019 \u003c/li\u003e\n\u003cli\u003eSima C, Aboodi GM, Lakschevitz FS, Sun C, Goldberg MB, Glogauer M. Nuclear Factor Erythroid 2-Related Factor 2 Down-Regulation in Oral Neutrophils Is Associated with Periodontal Oxidative Damage and Severe Chronic Periodontitis. \u003cem\u003eAm J Pathol\u003c/em\u003e 2016; 186:1417-26.https://doi.org/10.1016/j.ajpath.2016.01.013 \u003c/li\u003e\n\u003cli\u003eKataoka K, Ekuni D, Tomofuji T, Irie K, Kunitomo M, Uchida Y, et al. Visualization of Oxidative Stress Induced by Experimental Periodontitis in Keap1-Dependent Oxidative Stress Detector-Luciferase Mice. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2016; 17.https://doi.org/10.3390/ijms17111907 \u003c/li\u003e\n\u003cli\u003eJiang Y, Yang P, Li C, Lu Y, Kou Y, Liu H, et al. Periostin regulates LPS-induced apoptosis via Nrf2/HO-1 pathway in periodontal ligament fibroblasts. \u003cem\u003eOral Dis\u003c/em\u003e 2022.https://doi.org/10.1111/odi.14189 \u003c/li\u003e\n\u003cli\u003eHyeon S, Lee H, Yang Y, Jeong W. Nrf2 deficiency induces oxidative stress and promotes RANKL-induced osteoclast differentiation. \u003cem\u003eFree Radic Biol Med\u003c/em\u003e 2013; 65:789-799.https://doi.org/10.1016/j.freeradbiomed.2013.08.005 \u003c/li\u003e\n\u003cli\u003ePark CK, Lee Y, Kim KH, Lee ZH, Joo M, Kim HH. Nrf2 is a novel regulator of bone acquisition. \u003cem\u003eBone\u003c/em\u003e 2014; 63:36-46.https://doi.org/10.1016/j.bone.2014.01.025 \u003c/li\u003e\n\u003cli\u003eHa YJ, Choi YS, Oh YR, Kang EH, Khang G, Park YB, et al. Fucoxanthin Suppresses Osteoclastogenesis via Modulation of MAP Kinase and Nrf2 Signaling. \u003cem\u003eMar Drugs\u003c/em\u003e 2021; 19.https://doi.org/10.3390/md19030132 \u003c/li\u003e\n\u003cli\u003eLi W, Sun Y. Nrf2 is required for suppressing osteoclast RANKL-induced differentiation in RAW 264.7 cells via inactivating cannabinoid receptor type 2 with AM630. \u003cem\u003eRegen Ther\u003c/em\u003e 2020; 14:191-195.https://doi.org/10.1016/j.reth.2020.02.001 \u003c/li\u003e\n\u003cli\u003eKook SH, Kim KA, Ji H, Lee D, Lee JC. Irradiation inhibits the maturation and mineralization of osteoblasts via the activation of Nrf2/HO-1 pathway. \u003cem\u003eMol Cell Biochem\u003c/em\u003e 2015; 410:255-66.https://doi.org/10.1007/s11010-015-2559-z \u003c/li\u003e\n\u003cli\u003eHinoi E, Fujimori S, Wang L, Hojo H, Uno K, Yoneda Y. Nrf2 negatively regulates osteoblast differentiation via interfering with Runx2-dependent transcriptional activation. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2006; 281:18015-24.https://doi.org/10.1074/jbc.M600603200 \u003c/li\u003e\n\u003cli\u003eHan J, Yang K, An J, Jiang N, Fu S, Tang X. The Role of NRF2 in Bone Metabolism - Friend or Foe? \u003cem\u003eFront Endocrinol\u003c/em\u003e 2022; 13:813057.https://doi.org/10.3389/fendo.2022.813057 \u003c/li\u003e\n\u003cli\u003eNarimiya T, Kanzaki H, Yamaguchi Y, Wada S, Katsumata Y, Tanaka K, et al. Nrf2 activation in osteoblasts suppresses osteoclastogenesis via inhibiting IL-6 expression. \u003cem\u003eBone Rep\u003c/em\u003e 2019; 11:100228.https://doi.org/10.1016/j.bonr.2019.100228 \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"bone homeostasis, chronic apical periodontitis, mouse models, Nrf2, osteoblast, osteoclast","lastPublishedDoi":"10.21203/rs.3.rs-4116386/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4116386/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNuclear factor E2-related factor 2 (Nrf2) is responsible for regulating and maintaining the transcription of cytoprotective genes under conditions of stress and the destruction of redox homeostasis. This study aimed to elucidate the role of Nrf2 in the bone resorption of chronic apical periodontitis (CAP). We used immunohistochemical staining, western blotting and real‐time quantitative polymerase chain reaction (RT‐qPCR) to clarify the expression of Nrf2 in the normal human periodontal ligament and in CAP. A mouse model of apical periodontitis was established by root canal exposure to the oral cavity, and hematoxylin and eosin (HE) staining was used to observe the progress of apical periodontitis. Immunohistochemical staining was used to detect the expression of Nrf2 in different stages of apical periodontitis. An Escherichia coli lipopolysaccharide (LPS) mediated inflammatory environment was also established at the osteoclast and osteoblast levels, and the role of Nrf2 in proliferation and differentiation of osteoblasts and osteoclasts was examined by downregulating Nrf2 expression. The expression of Nrf2 in CAP was higher in the apical periodontitis group than that in healthy periodontal ligament tissue. The expression of Nrf2 increased with the progression of inflammation in mouse apical periodontitis model. In the inflammatory environment mediated by LPS, downregulation of Nrf2 promoted the proliferation and differentiation of osteoclasts and osteoblasts. Nrf2 is involved in the disease process of CAP and may participate in the occurrence and development of bone destruction in CAP by regulating the proliferation and differentiation of osteoclasts and osteoblasts.\u003c/p\u003e","manuscriptTitle":"The effect of Nrf2 on bone resorption in chronic apical periodontitis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-22 12:55:21","doi":"10.21203/rs.3.rs-4116386/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b85aa7f8-2d5e-470e-8c09-e789866f607a","owner":[],"postedDate":"March 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-25T12:57:08+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-22 12:55:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4116386","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4116386","identity":"rs-4116386","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.