Investigation of Antimicrobial and Antivirulence Effects of Lactobionic Acid and Carvacrol, Individually and in Combination, Against Escherichia coli Isolates

Investigation of Antimicrobial and Antivirulence Effects of Lactobionic Acid and Carvacrol, Individually and in Combination, Against Escherichia coli Isolates | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Investigation of Antimicrobial and Antivirulence Effects of Lactobionic Acid and Carvacrol, Individually and in Combination, Against Escherichia coli Isolates Fatemeh Mottaghizadeh, Nefise Akçelik, Mehri HAEILI This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8668470/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Apr, 2026 Read the published version in Molecular Biology Reports → Version 1 posted 7 You are reading this latest preprint version Abstract Background: The proliferation of multidrug-resistant (MDR) Escherichia coli represents a critical global health challenge, driven primarily by the bacterium's robust biofilm-forming capacity, which facilitates antimicrobial tolerance and infection persistence. This study aimed to investigate the individual and synergistic antibiofilm and antivirulence activities of lactobionic acid (LBA) and carvacrol (CAR) against MDR E. coli clinical isolates. Methods and Results: Biofilm formation was characterized in 51 clinical isolates, including the reference strain E. coli ATCC 25922. The antimicrobial efficacy of LBA and CAR was determined via Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) assays. For 43 isolates identified as strong or moderate biofilm producers, the Minimum Biofilm Eradication Concentration (MBEC) was established. Synergistic effects were evaluated using the checkerboard method. Furthermore, RT-qPCR was employed to quantify the expression of luxS, csgA, pfs, and rpoS genes critical to quorum sensing, adhesion, and stress response. MIC values for CAR and LBA ranged from 256-4096 µg/mL and 2048-16,384 µg/mL, respectively, with MBC/MIC ratios ≤ 4, indicating potent bactericidal activity. Individually, CAR and LBA inhibited biofilm formation by 24.12% and 57.7%, respectively; however, their combination achieved up to 87.7% inhibition in strong biofilm-formers. Checkerboard assays demonstrated synergy (FICI ≤ 0.5) in 85% of the tested isolates, resulting in a 32-fold reduction in the MIC. LBA was found to be more effective than CAR for the eradication of biofilm structures. Molecular analysis revealed a significant downregulation of all target genes, with the combined treatment resulting in a 10-fold reduction in csgA expression. Conclusions: These results demonstrate that the combination of LBA and CAR effectively suppresses the growth, biofilm maturity, and virulence of MDR E. coli . This synergistic approach represents a promising alternative therapeutic strategy for managing persistent infections caused by multidrug-resistant pathogens. Escherichia coli Biofilms Multidrug-resistant Carvacrol Lactobionic acid Synergism Figures Figure 1 Figure 2 Figure 3 1. Introduction Escherichia coli is a prominent Gram-negative pathogen responsible for a diverse clinical spectrum, ranging from self-limiting gastrointestinal distress to life-threatening systemic infections. A critical factor in its pathogenicity is the ability to transition from a planktonic state to a biofilm community, a process that significantly enhances antimicrobial resistance (AMR) and infection persistence [ 1 ]. The architecture of E. coli biofilm development typically follows four distinct stages: (i) the reversible attachment of planktonic cells mediated by surface appendages such as pili and flagella; (ii) the formation of microcolonies characterized by the secretion of an extracellular polymeric substance (EPS) matrix; (iii) biofilm maturation, driven by synchronized gene expression and intercellular signaling; and (iv) the active dispersion of cells to colonize novel ecological niches [ 2 ]. These mature structures exhibit profound tolerance to both antimicrobial agents and host immune responses, facilitating the establishment of chronic infections. Notably, the U.S. National Institutes of Health (NIH) estimates that up to 80% of human microbial infections are associated with biofilm phenotypes [ 3 ]. A fundamental regulatory mechanism underlying biofilm development and virulence is quorum sensing (QS), a density-dependent chemical communication system mediated by signaling molecules termed autoinducers. QS enables bacterial populations to monitor their density and collectively orchestrate the expression of genes involved in matrix production, virulence factor secretion, and toxin synthesis [37, 38]. By facilitating both intra- and inter-species communication, QS regulates complex behaviors that underpin the pathogenicity and resilience of biofilm-associated infections. Consequently, the disruption of QS-regulated pathways emerges as a highly promising therapeutic strategy to combat multidrug-resistant E. coli [ 4 , 5 ]. Lactobionic acid (LBA), a naturally occurring polyhydroxy acid and chelating agent derived from lactose, possesses diverse biological properties, including antioxidant, prebiotic, and potent antimicrobial activities. A notable feature of LBA is its selective toxicity; while it supports the proliferation of beneficial gut microbiota, it significantly suppresses the growth of various pathogenic species [ 6 ]. The antimicrobial efficacy of LBA is primarily attributed to its ability to disrupt bacterial cell membrane integrity, interfere with protein synthesis, and inhibit the early stages of biofilm assembly, thereby compromising microbial viability [ 7 ]. Carvacrol (CAR), a predominant monoterpenoid phenol found in the essential oils of the Lamiaceae family, has demonstrated broad-spectrum antimicrobial activity, particularly against MDR and biofilm-producing bacteria. Its mode of action primarily involves the destabilization of the lipid bilayer and the alteration of membrane fluidity, which leads to the leakage of intracellular constituents and subsequent cell death [ 8 ]. Despite the established individual antimicrobial and antibiofilm properties of LBA and CAR, their potential synergistic interaction against MDR E. coli remains largely unexplored. Given their distinct and potentially complementary mechanisms of action-membrane disruption and metabolic interference-a combinatorial approach may enhance therapeutic efficacy while minimizing the effective concentrations required for each compound. Consequently, this study was designed to evaluate the individual and synergistic effects of LBA and CAR on the growth, biofilm formation, and virulence profiles of clinical MDR E. coli isolates, providing a comprehensive analysis of their potential as an alternative antimicrobial strategy. 2. Materials And Methods 2.1. Bacterial Strains and Culture Conditions A total of 50 E. coli isolates were investigated in this study. Forty isolates were recovered from various clinical specimens, primarily catheter-associated infections, prosthetic-related infections, and sepsis, at the Ankara University Faculty of Medicine, İbn-i Sina Hospital. To enhance the genetic and phenotypic diversity of the study population, 10 additional isolates were obtained from the culture collections of the General Hospital Medical Microbiology Department, Etlik City Hospital (Türkiye), and the Microbiology Laboratory of Tabriz University (Iran). E. coli ATCC 25922 was utilized as the reference control strain. All isolates were preserved in Tryptic Soy Broth (TSB) supplemented with 10% (v/v) glycerol at -80°C for long-term storage. Before each experiment, isolates were subcultured on appropriate agar media to ensure viability and purity. 2.2. Determination of Biofilm-Forming Capacity The biofilm-forming capacity of the isolates was assessed using a modified microtiter plate (MTP) assay, as previously described by Stepanović et al. [ 9 ]. Briefly, overnight cultures were standardized to a 0.5 McFarland turbidity (approx. 10 8 CFU/mL) in Luria-Bertani (LB) broth. Subsequently, 30 µL of the standardized inoculum was added to 96-well microplates containing 100 µL of LB broth (without NaCl) and incubated at 37°C for 48 h under static conditions. Following the incubation, the supernatant was discarded, and wells were gently washed three times with 200 µL of phosphate-buffered saline (PBS, pH 7.2) to remove non-adherent (planktonic) cells. The remaining adherent biofilm was fixed with 140 µL of 95% methanol for 15 min and subsequently stained with 140 µL of 0.1% (w/v) crystal violet (CV) solution for 30 min at room temperature. After washing the plates to remove excess dye, the bound CV was eluted using 140 µL of 33% (v/v) glacial acetic acid. The optical density (OD) of each well was measured at 595 nm using a microplate reader. To account for background interference, the cut-off OD (OD c) was established as three standard deviations above the mean OD of the negative controls (sterile medium). Isolates were categorized based on their adherence capabilities according to the following criteria [ 9 ]: OD test ≤ OD c (Non-biofilm former) OD c < OD test ≤ 2 × OD c (Weak biofilm former) 2 × OD c < OD test ≤ 4 × OD c (Moderate biofilm former) 4 × OD c < OD test (Strong biofilm former) All experiments were performed in three biological replicates, each with three technical replicates. 2.3. Determination of Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) Carvacrol (≥ 99%, FG W224511) and Lactobionic acid (≥ 97%, 153516) were procured from Sigma-Aldrich (USA) and maintained at − 20°C until analysis. The MIC and MBC of both compounds were determined using the broth microdilution method according to CLSI guidelines. To determine the MIC, two fold serial dilutions of the agents were prepared in LB broth within 96-well microplates. Each well was inoculated with a final bacterial concentration of approximately 5x10 5 CFU/mL and incubated at 37°C for 18–24 h. The MIC was defined as the lowest concentration of the antimicrobial agent that completely inhibited visible bacterial growth. Following MIC determination, the percentage of viable cell reduction was quantified. Aliquots from the MIC wells and untreated control wells were serially diluted and plated onto LB agar. After incubation at 37°C for 24 h, colonies were enumerated, and the percentage of inhibition was calculated using the formula: % inhibition= [(CFU/ml control - CFU/ml treatment) / CFU/ml control] ×100. To establish the MBC, 10 µL aliquots from all wells showing no visible growth were subcultured onto LB agar plates and incubated at 37°C for an additional 24 h. The MBC was recorded as the lowest concentration that resulted in a reduction (3-log reduction) in the initial bacterial inoculum. All assays were conducted in triplicate (three biological replicates), each performed with three technical replicates. 2.4. Determination of Minimum Biofilm Eradication Concentration (MBEC) The MBEC of CAR and LBA, both individually and in combination, was determined against pre-established biofilms of E. coli isolates. The individual efficacy of CAR and LBA was assessed across 43 isolates (comprising E. coli ATCC 25922, 17 moderate, and 25 strong biofilm producers). For combinatorial analysis, the reference strain E. coli ATCC 25922 and two representative strong biofilm-forming isolates were selected. To establish mature biofilms, isolates were cultured in 96-well microtiter plates under standard conditions. Following the 48-hour maturation period, the supernatant was removed, and pre-established biofilms were challenged with varying concentrations of the agents, ranging from 1× MIC to 4× MIC. After a 24-hour incubation period at 37°C, biofilms were quantified using the crystal violet staining method OD 595 nm [ 9 ]. MBEC was defined as the lowest concentration of the agent(s) required to eradicate the pre-formed biofilm, resulting in an OD value comparable to the negative control. 2.5. Checkerboard Analysis for Synergy Determination To evaluate potential synergistic interactions between LBA and CAR, a checkerboard microdilution assay was performed. In a 96-well plate, LBA was serially diluted two-fold along the x-axis, while CAR was diluted along the y-axis. Each well was inoculated with active bacterial culture to achieve a final concentration of approximately 10 5 CFU/mL. Following incubation at 37°C for 24 h, the interaction was quantified by determining the Fractional Inhibitory Concentration Index (FICI) using the formula: FIC index = FICA + FICB = (MIC of lactobionic acid in combination acid / MIC of lactobionic acid alone) + (MIC of carvacrol in combination / MIC of carvacrol alone). The interactions were interpreted as follows: Synergy: FIC index ≤ 0.5; Additive effect: 0.5 < FIC index ≤ 1, Indifferent: 1 4 (10). All experiments were performed in triplicate on separate days. 2.6. Gene Expression Analysis via RT-qPCR The impact of CAR and LBA on the expression profiles of quorum sensing (QS), biofilm-related, and virulence-associated genes was evaluated using Reverse Transcription-quantitative PCR (RT-qPCR). Total RNA was extracted from E. coli cultures treated with sub-inhibitory concentrations of the agents using the GeneMATRIX Universal RNA Purification Kit (EURx, Poland), according to the manufacturer’s protocol. RNA concentration and purity were determined using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, USA), and structural integrity was verified via agarose gel electrophoresis. Subsequently, 1 µg of total RNA was reverse-transcribed into cDNA using the smART First Strand cDNA Synthesis Kit (EURx, Poland). Quantitative PCR amplification was performed on a LightCycler 480 system (Roche, Germany) using 5× HOT FIREPol EvaGreen qPCR Supermix (Solis BioDyne, Estonia). Specific primers were utilized to target key genetic markers: luxS (QS), csgA (biofilm/adhesion), pfs (SAH nucleosidase), and rpoS (stress response) (Table 1 ). The 16S rRNA gene was employed as an internal reference for normalization. Relative fold changes in gene expression were calculated using the method, comparing treated samples against the untreated control group. Table 1 Nucleotide sequences of the primers used for RT-qPCR analysis Gene Sequence (5′−3′) Function Product size (bp) Reference 16S rRNA F: GGAGACTGCCAGTGATAAAC R: GGACTACGACGCACTTTATG Reference gene 151 This study luxS F: GCAATGGAAGACGTGCTGAA R: TGCAACTTCTCTTTCGGCAG QS regulator 182 This study csgA F: GCAGCAATCGTATTCTCCGG R: ATCAGAACCTTGGCCCACAT Virulence, motility 234 This study pfs F: CGGCAACAGCCAGGAACTCA R: GCGAAAATCCGCCACAACTT Virulence 169 (11) rpoS F: CTCAACATACGCAACCTG R: GTCATCAACTGGCTTATCC Stress, growth, and virulence 199 (12,13) 2.7. Statistical Analysis All experimental assays were performed in at least three independent biological replicates, each containing three technical replicates. Data are presented as the mean ± standard deviation (SD). Statistical significance was evaluated using GraphPad Prism version 10.0 (GraphPad Software, San Diego, CA, USA). Differences between treated groups and the untreated control were analyzed using one-way analysis of variance (ANOVA), followed by Tukey’s post-hoc test for multiple comparisons. A p-value of less than 0.05 [ 21 ] was considered statistically significant. 3. Results 3.1. Biofilm-Forming Phenotypes of Clinical Isolates The biofilm production capacity of 50 clinical E. coli isolates and the reference strain E. coli ATCC 25922 was quantitatively assessed. Based on the classification criteria, the isolates exhibited diverse biofilm-forming phenotypes. Specifically, 49.01% (n = 25) were identified as strong biofilm producers, while 33.33% (n = 17) were categorized as moderate producers. Weak biofilm formation was observed in 11.76% (n = 6) of the strains, and only 3.92% (n = 2) were classified as non-biofilm producers. The reference strain E. coli ATCC 25922 was confirmed as a strong biofilm producer, consistent with its role as a positive control. These results highlight a high prevalence (82.34%) of moderate-to-strong biofilm-forming capacity among the clinical isolates, underlining the clinical significance of these strains in persistent infections. 3.2. Antimicrobial Efficacy of LBA and CAR (MIC and MBC) The antimicrobial activities of LBA and CAR were evaluated against the panel of E. coli isolates. CAR exhibited potent antibacterial activity, with MIC values ranging from 256 to 4096 µg/mL. In comparison, LBA demonstrated higher MIC values, spanning from 2048 to 16,384 µg/mL. Despite differences in inhibitory concentrations, both agents exhibited a strong bactericidal profile. The MBC values for CAR and LBA were found to be either equal to or within two-fold of their respective MICs. Notably, MBC/MIC ratios of the tested compounds were ≤ 4 for 98.03% (n = 50 out of 51 isolates) and 100% (n = 51) of the isolates, indicating strong bactericidal activity against E. coli . Live cell count assays further confirmed these effects, with inhibition rates ranging from 84–100% for carvacrol and 99–100% for lactobiotic assay. For the reference strain E. coli ATCC 25922, the MIC values for CAR and LBA were recorded at 1024 µg/mL and 8192 µg/mL, respectively. These findings establish that while CAR is effective at lower concentrations, both compounds possess the capacity to eradicate planktonic cells of multidrug-resistant isolates. Table 2 The MIC and MBC values of carvacrol and lactobionic acid against 50 clinical E. coli isolates. Isolate code Carvacrol Lactobionic acid MIC (µg/ml) MBC (µg/ml) Inhibition percentage (%) Effect MIC (µg/ml) MBC (µg/ml) Inhibition percentage (%) Effect E. coli 25922 1024 2048 97.64 BC/BS 8192 16384 99.99 BC 345 2048 2048 100 BC 8192 16384 99.99 BC 336 2048 2048 100 BC 16384 32768 99.99 BC 246 2048 2048 100 BC 8192 32768 99.99 BC 171 2048 2048 100 BC 4096 8192 99.92 BC 348 2048 2048 100 BC 8192 16384 99.99 BC 166 2048 4096 99.98 BC 4096 16384 99.99 BC 170 2048 2048 100 BC 4096 16384 99.99 BC 173 1024 8192 84.83 BS 2048 8192 99.88 BC 292 1024 1024 100 BC 8192 16384 99.99 BC 302 2048 2048 100 BC 4096 16384 99.99 BC 650 2048 2048 100 BC 8192 16384 99.99 BC 203 512 512 100 BC 4096 16384 99.99 BC 658 512 512 100 BC 8192 16384 99.99 BC 652 512 512 100 BC 4096 16384 99.99 BC 161 256 256 100 BC 4096 16384 99.99 BC 657 256 256 100 BC 8192 16384 99.97 BC 607 512 512 100 BC 4096 8192 99.99 BC 282 512 512 100 BC 4096 16384 99.99 BC 653 1024 1024 100 BC 8192 32768 99.99 BC 181 512 512 100 BC 8192 32768 99.99 BC 208 256 256 100 BC 8192 16384 99.96 BC 266 256 256 100 BC 4096 8192 99.99 BC 661 256 256 100 BC 8192 16384 99.99 BC 654 256 256 100 BC 2048 2048 100 BC 666 512 512 100 BC 8192 16384 99.99 BC 621 512 512 100 BC 8192 16384 99.99 BC 663 512 512 100 BC 4096 16384 99.99 BC 163 2048 2048 100 BC 8192 16384 99.99 BC 162 2048 2048 100 BC 8192 16384 99.99 BC 169 2048 2048 100 BC 16384 32768 99.98 BC 172 2048 2048 100 BC 8192 8192 100 BC 174 1024 1024 100 BC 8192 16384 99.99 BC 640 1024 2048 99.99 BC 8192 16384 99.97 BC 194 2048 2048 100 BC 8192 16384 99.99 BC 291 2048 2048 100 BC 8192 32768 99.99 BC 317 2048 2048 100 BC 8192 16384 99.95 BC 651 2048 2048 100 BC 8192 32768 99.56 BC 624 2048 2048 100 BC 4096 16384 99.99 BC 274 2048 2048 100 BC 16384 32768 99.97 BC 668 2048 2048 100 BC 8192 32768 99.99 BC 662 2048 2048 100 BC 8192 32768 99.99 BC 670 1024 1024 100 BC 8192 32768 99.99 BC 667 2048 2048 100 BC 8192 32768 99.99 BC 656 2048 2048 100 BC 8192 32768 99.99 BC 659 2048 4096 99.99 BC 8192 16384 99.99 BC 664 4096 8192 99.99 BC 8192 32768 99.99 BC 669 2048 2048 100 BC 8192 32768 99.99 BC 655 2048 2048 100 BC 4096 16384 99.97 BC 310 2048 2048 100 BC 8192 32768 99.97 BC 665 1024 1024 100 BC 8192 32768 99.99 BC BC: Bactericidal BS: Bacteriostatic The susceptibility profiles showed a heterogeneous distribution. The MIC distribution for CAR demonstrated that the majority of isolates were inhibited at concentrations between 512 and 1024 µg/mL. Specifically, 18% of the isolates exhibited an MIC of 512 µg/mL, while 14% required 1024 µg/mL for complete growth inhibition. In contrast, the MIC distribution for LBA shifted toward higher concentration ranges. The most frequent MIC value was observed at 8192 µg/mL, accounting for 64% of the tested population. Despite the broader range of LBA concentrations required, a clear dose-dependent inhibitory effect was observed across all MDR isolates. 3.3. Minimum Biofilm Eradication Concentration (MBEC) The MBEC of CAR and LBA was determined for 43 E. coli isolates. Results demonstrated that significantly higher concentrations were required to eradicate established biofilms compared to those needed to inhibit planktonic growth. 3.3.1. Biofilm Eradication Profile of Carvacrol CAR effectively eradicated mature biofilms across a range of concentrations. The most frequent MBEC values were recorded at 2048 µg/mL and 4096 µg/mL, each accounting for 25.58% of the isolates. Lower MBEC values of 512 µg/mL and 1024 µg/mL were observed in 16.27% and 9.30% of the strains, respectively. In terms of overall efficacy, CAR exhibited its most substantial antibiofilm activity at 2× and 4× MIC levels, achieving an average biofilm inhibition rate of 24.12% across the entire panel. 3.3.2. Biofilm Eradication Profile of Lactobionic Acid LBA demonstrated a distinct MBEC distribution, with more than half of the isolates (51.16%) being eradicated at a concentration of 8192 µg/mL. This was followed by 4096 µg/mL, which was effective against 25.58% of the isolates. Notably, LBA showed superior antibiofilm potency compared to CAR when used individually, with an average biofilm reduction rate of 57.7% at its MIC (Table 3 ). Table 3 The MBEC values of carvacrol and lactobionic acid Carvacrol Lactobionic acid Isolate code MBEC (µg/ml) Inhibition rate (%) MBEC (µg/ml) Inhibition rate (%) E. coli ATCC25922 4096 (4 MIC) 20.49 8192 (MIC) 43.29 345 4096 (2 MIC) 32.66 24567 (3 MIC) 17.29 246 2048 (MIC) 13.37 8192 (MIC) 44.47 166 6144 (3 MIC) 42.73 32768 (4 MIC) 7.21 170 2048 (MIC) 60 4096 (MIC) 80.4 348 4096 (2 MIC) 48.20 4096 (MIC) 54.72 173 4096 (4 MIC) 15.81 2048 (MIC) 51.5 292 2048 (2 MIC) 33.84 8192 (MIC) 68.89 302 2048 (MIC) 14.57 4096 (MIC) 85.18 203 512 (MIC) 17.09 4096 (MIC) 88.24 658 512 (MIC) 17.24 16384(2 MIC) 54.03 652 2048 (4 MIC) 6.79 4096 (MIC) 56.55 161 1024 (4 MIC) 14.28 4096 (MIC) 78.68 657 512 (2 MIC) 14.70 8192 (MIC) 41.07 607 512 (MIC) 21,17 4096 (MIC) 90.28 282 1024 (2 MIC) 14.16 8192 (2 MIC) 85.68 653 3072 (3 MIC) 32.40 16384 (2 MIC) 46.06 181 512 (MIC) 22.54 8192 (MIC) 66.71 266 256 (MIC) 8.73 4096 (MIC) 84.89 666 2048 (4 MIC) 3.73 8192 (MIC) 75.77 621 1536 (3 MIC) 5.74 16384 (2 MIC) 53.51 661 512 (2 MIC) 11.30 8192(MIC) 75.77 654 512 (2 MIC) 34.71 2048 (MIC) 66.89 169 1536 (3 MIC) 16.66 4096 (MIC) 86.03 663 1536 (3 MIC) 4 4096 (MIC) 68.32 174 1024 (MIC) 17.10 8192 (MIC) 43.67 640 2048 (2 MIC) 12.28 8192 (MIC) 63.45 194 4096 (2 MIC) 48.32 8192 (MIC) 58.17 291 4096 (2 MIC) 23.73 8192 (MIC) 68.08 317 2048 (MIC) 30.47 8192 (MIC) 44.84 651 4096 (2 MIC) 34.40 8192 (MIC) 35,37 624 8192 (4 MIC) 33.12 8192 (MIC) 57.08 274 4096 (2 MIC) 41.52 49153 (3 MIC) 6.42 668 2048 (MIC) 38.23 24567 (3 MIC) 38.49 662 4096 (2 MIC) 47.45 8192 (MIC) 67.49 670 4096 (4 MIC) 10.63 24567 (3 MIC) 24.74 667 2048 (MIC) 34.48 8192 (MIC) 43.72 656 2048 (MIC) 6.57 8192 (MIC) 83.88 659 8192 (4 MIC) 42.22 8192 (MIC) 37.87 664 12288 (3 MIC) 15.38 8192(MIC) 41.45 669 8192 (4 MIC) 21.86 4096 (MIC) 92.41 655 4096 (2 MIC) 28.18 8192 (MIC) 51.92 665 1024 (MIC) 21.62 8192 (MIC) 30 3.4. Synergistic Interactions of LBA and CAR (Checkerboard Assay) To our knowledge, this is the first study to employ the checkerboard-based FIC method to characterize the interaction between LBA and CAR against E. coli. This evaluation was conducted on seven representative isolates, including E. coli ATCC 25922 and six clinical isolates (strains 640, 274, 345, 208, 162, and 171) with diverse biofilm phenotypes. The combinatorial analysis revealed a predominant synergistic relationship. Synergy (FICI 0.5) was observed in 85.7% (6 out of 7) of the tested isolates, while an additive effect (0.5 < FICI 1) was identified in only one isolate (Table 4 ). Notably, the combined application of CAR and LBA resulted in a dramatic reduction in their individual MIC values, ranging from 2-fold to 32-fold. These findings underscore the potentiation effect of LBA on CAR efficacy. Table 4 Checkerboard assay results showing the interaction of tested compounds against Escherichia coli isolates. Bacterial isolates Biofilm Formation Ability Carvacrol MIC (µg/ml) Lactobionic Acid MIC (µg/ml) FICI Effect E. coli ATCC25922 Strong 1024 8192 0.50 Synergistic effect 640 Strong 1024 8192 1 Additive effect 274 Strong 2048 16384 0.28 Synergistic effect 345 Strong 2048 8192 0.37 Synergistic effect 208 Weak 256 8192 0.50 Synergistic effect 162 Weak 2048 8192 0.31 Synergistic effect 171 None 2048 4096 0.15 Synergistic effect 3.5. Synergistic Inhibition of Biofilm Formation by CAR and LBA The combinatorial effect of CAR and LBA on biofilm assembly—an interaction not previously documented—was evaluated against E. coli ATCC 25922 and two strong biofilm-producing clinical isolates (345 and 274). In the reference strain E. coli ATCC 25922, individual treatments with CAR and LBA reduced biofilm formation by 20.49% and 43.29%, respectively. Notably, their simultaneous application resulted in a significantly enhanced inhibition rate of 79.86%. A consistent synergistic trend was observed across the clinical isolates. For isolate 345, CAR and LBA alone achieved inhibition rates of 32.66% and 17.29%; however, the combined treatment yielded a superior inhibition of 83.72%. The most pronounced synergistic effect was recorded in isolate 274; while LBA alone showed marginal efficacy (6.42%) and CAR moderate efficacy (41.52%), their combination led to a robust biofilm reduction of 87.74% (Fig. 2 ). These results demonstrate that the CAR-LBA combination exerts a potent synergistic potentiation, effectively suppressing biofilm formation in highly resilient clinical isolates. 6. Quantification of Gene Expression Levels (RT-qPCR) The regulatory effects of CAR and LBA on the transcriptional levels of key virulence and biofilm-associated genes were quantified via RT-qPCR. Both compounds exhibited a consistent suppressive effect on target genes, albeit to varying degrees. Individually, LBA induced a downregulation in the expression of luxS , csgA , pfs , and rpoS by 1.92, 4.34, 20.0, and 7.69-fold, respectively. CAR demonstrated a more pronounced inhibitory impact, reducing the expression of these genes by 3.36, 1.13, 33.78, and 33.33-fold. While CAR exhibited the most potent suppressive effect on luxS , pfs , and rpoS, the synergistic combination achieved the most significant inhibitory effect on csgA . Specifically, the combined treatment resulted in a 10-fold reduction in csgA expression (Fig. 3 ). This marked downregulation is particularly critical, as csgA e ncodes the major subunit of curli fimbriae, essential for initial surface adhesion and the structural integrity of E. coli biofilms. 4. Discussion The escalating threat of antibiotic resistance has intensified global efforts to identify alternative therapeutic options. Natural products, particularly plant-derived compounds, are increasingly recognized as promising alternatives for combating drug resistance. Indeed, various bioactive compounds—including alkaloids, flavonoids, and terpenoids—can act independently or synergistically with conventional antibiotics to restore or enhance antimicrobial efficacy [ 14 ]. Numerous studies now support the potential of these natural molecules to target bacterial virulence and pathogenesis pathways or to counteract drug-resistant infections by sensitizing bacteria to clinically relevant classes of antibiotics [ 15 , 16 ]. Lactobionic acid (LBA) is one such natural compound known to inhibit various pathogenic bacteria. Previous research on Pseudomonas fluorescens and methicillin-resistant Staphylococcus aureus (MRSA) suggests that LBA disrupts the integrity of bacterial cell walls and membranes, negatively impacting protein content and enzymatic activity. Similarly, carvacrol (CAR), a monoterpenoid phenol, targets bacterial cell membranes and modulates the expression of genes involved in biofilm formation. A study conducted in Türkiye reported that CAR exhibited significant antibacterial properties against Acinetobacter baumannii and effectively reduced colistin resistance when used in combination with colistin, demonstrating both synergistic and additive effects [ 17 ]. In the present study, we assessed for the first time the anti-virulence and antibiofilm effects of LBA and CAR—both individually and in combination—against extra-intestinal and catheter-associated E. coli isolates. Our results revealed that MIC values for CAR and LBA ranged from 256 to 4096 µg/mL and 2048 to 16,384 µg/mL, respectively. Furthermore, viable cell count assays showed that CAR achieved an inhibitory effect ranging from 84% to 100% across all isolates, while LBA demonstrated an inhibitory effect of 99% to 100%. Based on the obtained MBC/MIC ratios, both CAR and LBA exhibited potent bactericidal activity against E. coli , which is consistent with existing literature [ 18 , 19 ]. A study by Khan et al. [ 20 ] reported that CAR exhibited MIC values of 450 µg/mL against uropathogenic E. coli , including ESBL-producing strains, while Boyer et al. [ 21 ] observed an MIC of 600 µg/mL against Salmonella Typhimurium [ 20 , 21 ]. These findings closely align with the results of the present study. Regarding LBA, previous reports indicated MIC values of 12.5 mg/mL and 18.75 mg/mL against P. fluorescens and MRSA, respectively [ 7 ]. In our study, however, 65% of E. coli isolates were inhibited at significantly lower MICs of approximately 8 mg/mL, suggesting that LBA may be more effective against E. coli than against those species. Comparable findings were reported by Chen and Zhong [ 22 ], who demonstrated that LBA exhibited an MIC of 10 mg/mL against both Listeria monocytogenes and E. coli . In their study, the MBC for L. monocytogenes was twice the MIC, while for E. coli , it exceeded 20 mg/mL [ 22 ]. We conducted further experiments to determine the Minimum Biofilm Eradication Concentration (MBEC) of both compounds. CAR displayed moderate antibiofilm activity, reducing biofilm formation in E. coli isolates by an average of 24.12%, whereas LBA exhibited a markedly stronger effect, achieving an average reduction rate of 57.7%. These results indicate that both compounds are effective against E. coli biofilms, with LBA demonstrating greater potential as a biofilm-eradicating agent. In a study by Fan et al. [ 6 ], LBA significantly inhibited Salmonella Typhimurium biofilm formation on stainless-steel and chicken-meat surfaces by suppressing cell motility as well as the production of extracellular polysaccharides and proteins. Another study demonstrated that CAR possesses notable antibiofilm activity against L. monocytogenes and P. aeruginosa biofilms formed in the MBEK™ biofilm device and on polypropylene surfaces [ 23 ]. While CAR and LBA demonstrated individual antibacterial and antibiofilm activities, their combination exhibited robust synergistic effects, reducing the MIC values of both agents by 2- to 32-fold across various E. coli isolates. Furthermore, biofilm inhibition rates for CAR and LBA alone ranged from 20.49–41.52% to 6.42–43.29%, respectively; however, their combination dramatically increased the inhibition rate to 79.86–87.74%, demonstrating strong synergistic antibiofilm activity. These findings indicate that CAR and LBA can effectively inhibit planktonic E. coli even at very low concentrations when used together. Overall, these results highlight the promise of these natural products for developing alternative strategies to combat biofilm-associated E. coli infections and sustainable approaches to addressing bacterial resistance. E. coli utilizes a range of virulence genes to establish infections in diverse environments and adapt to varying conditions. Among these, luxS , pfs , rpoS , and csgA play key roles in regulating virulence, stress responses, and biofilm formation. This study examined the effects of CAR and LBA, both individually and in combination, on the expression of these genes. Both compounds inhibited key virulence-associated genes, with CAR showing the strongest individual effect, particularly on luxS , pfs , and rpoS . Notably, the combination of the two compounds produced the greatest suppression of csgA (10-fold reduction). Since csgA is critical for adhesion and biofilm formation, its downregulation suggests that these treatments could effectively reduce bacterial colonization and biofilm development. To our knowledge, this is the first study to evaluate the effects of LBA on the expression of key virulence genes in E. coli , providing new insights into its anti-virulence potential. Similarly, previous studies have reported that CAR effectively suppressed the expression of genes involved in motility ( motA ), adhesion ( faeG ), toxin production (heat-labile and heat-stable toxins), quorum sensing ( luxS ), and biofilm formation ( bssS and tnaA ) in E. coli K88 strains [ 24 ]. Another study revealed that a combination of CAR and cineole reduced the transcription levels of key virulence genes, including stx1 , eae , flhD , and luxS , in E. coli O157:H7 [ 25 ]. Furthermore, transcriptomic analysis by Wang et al. [ 25 ] demonstrated that CAR significantly reduced biofilm formation in P. fluorescens by disrupting luxR/I -mediated quorum sensing and modulating c-di-GMP-related gene expression [ 26 ]. CAR has also been shown to inhibit biofilm formation in Chromobacterium violaceum ATCC 12472 by downregulating cviI , the gene responsible for N-acyl-L-homoserine lactone synthase. This suppression was accompanied by reductions in quorum-sensing-regulated activities, such as violacein production and chitinase activity, suggesting its antibiofilm effects are linked to QS disruption [ 27 ]. Finally, in E. coli O157:H7, CAR has been reported to downregulate the ler gene, which controls various virulence factors, and reduce the expression of flagellin ( fliC ) and Shiga toxin genes [ 28 ]. Together, these findings underscore carvacrol’s multi-target anti-virulence strategy, establishing it as a promising natural agent for reducing bacterial pathogenicity and controlling biofilm-associated infections. Together, these findings underscore carvacrol’s multi-target anti-virulence strategy. 5. Conclusion This study presents a novel and effective strategy for combating biofilm-associated infections by highlighting the potent capacity of natural compounds to function as biofilm-disrupting and antivirulence agents. Our findings demonstrate that carvacrol and lactobionic acid—especially in combination—significantly modulate quorum sensing, suppress primary adhesion, and disrupt the structural integrity of mature E. coli biofilms. Importantly, this research provides the first molecular evidence that lactobionic acid can downregulate genes critical to quorum sensing (luxS, pfs), adhesion (csgA), and stress response (rpoS). By attenuating bacterial pathogenicity without necessarily exerting the selective pressure associated with conventional antibiotics, this combinatorial approach represents a sustainable path forward in antimicrobial therapy. Declarations Competing Interests The authors have no relevant financial or non-financial interests to disclose. Ethics Approval Isolates were obtained from existing laboratory archives as part of a retrospective collection. Since the isolates were previously collected during routine diagnostic procedures and were analyzed in a fully anonymized manner without any access to patient-identifiable data, this study did not require formal ethical approval according to the institutional guidelines and the Declaration of Helsinki. Funding This work was financially supported by the Ankara University Scientific Research Projects Office (BAP) (Project No: FDK-2023-2911). Author Contribution Fatemeh Mottaghizadeh (Conceptualization, Investigation, Methodology, Validation, Writing – original draft, Writing – review & editing, Data analysis), Mehri Haeili (Data analysis, Writing – review & editing), Nefise Akcelik (Conceptualization, Methodology, Project administration, Supervision). Acknowledgments: We would like to express our heartfelt gratitude to the Institute of Biotechnology at Ankara University for their generous support and for providing the essential equipment and materials for our study. Additionally, we gratefully acknowledge the financial support of the Ankara University Scientific Research Projects Coordination Unit (BAP) through project number FDK-2023-2911. Data Availability The datasets used during the current study are available from the corresponding author upon reasonable request. References Kaper JB, Nataro JP, Mobley HLT. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004 Feb;2(2):123–40. Stoodley P, Sauer K, Davies DG, Costerton JW. Biofilms as complex differentiated communities. Annu Rev Microbiol. 2002;56:187–209. Zafer MM, Mohamed GA, Ibrahim SRM, Ghosh S, Bornman C, Elfaky MA. Biofilm-mediated infections by multidrug-resistant microbes: a comprehensive exploration and forward perspectives. Arch Microbiol. 2024 Feb 14;206(3):101. Juszczuk-Kubiak E. Molecular Aspects of the Functioning of Pathogenic Bacteria Biofilm Based on Quorum Sensing (QS) Signal-Response System and Innovative Non-Antibiotic Strategies for Their Elimination. Int J Mol Sci. 2024 Feb 24;25(5):2655. Mayer C, Borges A, Flament-Simon SC, Simões M. Quorum sensing architecture network in Escherichia coli virulence and pathogenesis. FEMS Microbiol Rev. 2023 July 5;47(4):fuad031. Fan Q, He Q, Zhang T, Song W, Sheng Q, Yuan Y, et al. Antibiofilm potential of lactobionic acid against Salmonella Typhimurium. LWT. 2022 June 1;162:113461. Kang S, Kong F, Shi X, Han H, Li M, Guan B, et al. Antibacterial activity and mechanism of lactobionic acid against Pseudomonas fluorescens and Methicillin-resistant Staphylococcus aureus and its application on whole milk. Food Control. 2020 Feb 1;108:106876. Khwaza V, Aderibigbe BA. Antibacterial Activity of Selected Essential Oil Components and Their Derivatives: A Review. Antibiot Basel Switz. 2025 Jan 10;14(1):68. Stepanović S, Vuković D, Hola V, Di Bonaventura G, Djukić S, Cirković I, et al. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS Acta Pathol Microbiol Immunol Scand. 2007 Aug;115(8):891–9. Doern CD. When does 2 plus 2 equal 5. A review of antimicrobial synergy testing. J Clin Microbiol. 2014 Dec;52(12):4124–8. Han X, Bai H, Tu J, Yang L, Xu D, Wang S, et al. Deletion of luxS further attenuates the virulence of the avian pathogenic Escherichia coli aroA mutant. Microb Pathog. 2015 Nov 1;88:39–47. Wasfi R, Elkhatib WF, Khairalla AS. Effects of Selected Egyptian Honeys on the Cellular Ultrastructure and the Gene Expression Profile of Escherichia coli. PLOS ONE. 2016 Mar 8;11(3):e0150984. Dong T, Schellhorn HE. Global effect of RpoS on gene expression in pathogenic Escherichia coli O157:H7 strain EDL933. BMC Genomics. 2009 Aug 3;10(1):349. AlSheikh HMA, Sultan I, Kumar V, Rather IA, Al-Sheikh H, Tasleem Jan A, et al. Plant-Based Phytochemicals as Possible Alternative to Antibiotics in Combating Bacterial Drug Resistance. Antibiot Basel Switz. 2020 Aug 4;9(8):480. Zhai X, Wu G, Tao X, Yang S, Lv L, Zhu Y, et al. Success stories of natural product-derived compounds from plants as multidrug resistance modulators in microorganisms. RSC Adv. 13(12):7798–817. Woo S, Marquez L, Crandall WJ, Risener CJ, Quave CL. Recent advances in the discovery of plant-derived antimicrobial natural products to combat antimicrobial resistant pathogens: insights from 2018-2022. Nat Prod Rep. 2023 July 19;40(7):1271–90. Köse E, Koyuncu Ozyurt O. In vitro Evaluation of Carvacrol and Colistin Combination Against Colistin Resistant Acinetobacter baumanni Strains. Türk Mikrobiyoloji Cemiy Derg. 2019 Jan 1; Fan Q, Yuan Y, Zhang T, Song W, Sheng Q, Yue T. Inhibitory effects of lactobionic acid on Vibrio parahaemolyticus planktonic cells and biofilms. Food Microbiol. 2022 May;103:103963. Peng Q, Tang X, Dong W, Zhi Z, Zhong T, Lin S, et al. Carvacrol inhibits bacterial polysaccharide intracellular adhesin synthesis and biofilm formation of mucoid Staphylococcus aureus: an in vitro and in vivo study. RSC Adv. 2023 Sept 26;13(41):28743–52. Khan I, Bahuguna A, Kumar P, Bajpai VK, Kang SC. Antimicrobial Potential of Carvacrol against Uropathogenic Escherichia coli via Membrane Disruption, Depolarization, and Reactive Oxygen Species Generation. Front Microbiol. 2017 Dec 6;8:2421. Boyer E, Galán-Relaño Á, Romero-Salmoral A, Barraza P, Gómez-Gascón L, Tarradas C, et al. Post-Antibiotic and Post-Antibiotic Sub-Minimum Inhibitory Concentration Effects of Carvacrol against Salmonella Typhimurium. Anim Open Access J MDPI. 2024 Sept 11;14(18):2631. Chen H, Zhong Q. Lactobionic acid enhances the synergistic effect of nisin and thymol against Listeria monocytogenes Scott A in tryptic soy broth and milk. Int J Food Microbiol. 2017 Nov 2;260:36–41. Ashrafudoulla Md, Rahaman Mizan MdF, Park SH, Ha SD. Antibiofilm activity of carvacrol against Listeria monocytogenes and Pseudomonas aeruginosa biofilm on MBECTM biofilm device and polypropylene surface. LWT. 2021 July 1;147:111575. Bonetti A, Tugnoli B, Rossi B, Giovagnoni G, Piva A, Grilli E. Nature-Identical Compounds and Organic Acids Reduce E. coli K88 Growth and Virulence Gene Expression In Vitro. Toxins. 2020 July 23;12(8):468. Wang Y, Zhang Y, Song X, Fang C, Xing R, Liu L, et al. 1,8-Cineole inhibits biofilm formation and bacterial pathogenicity by suppressing luxS gene expression in Escherichia coli. Front Pharmacol. 2022 Oct 14;13:988245. Wang Y, Feng L, Lu H, Zhu J, Kumar V, Liu X. Transcriptomic analysis of the food spoilers Pseudomonas fluorescens reveals the antibiofilm of carvacrol by interference with intracellular signaling processes. Food Control. 2021 Sept 1;127:108115. Burt SA, Ojo-Fakunle VTA, Woertman J, Veldhuizen EJA. The Natural Antimicrobial Carvacrol Inhibits Quorum Sensing in Chromobacterium violaceum and Reduces Bacterial Biofilm Formation at Sub-Lethal Concentrations. PLOS ONE. 2014 Apr 1;9(4):e93414. Mith H, Clinquart A, Zhiri A, Daube G, Delcenserie V. The impact of oregano (Origanum heracleoticum) essential oil and carvacrol on virulence gene transcription by Escherichia coli O157:H7. FEMS Microbiol Lett. 2015 Jan;362(1):1–7. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 17 Apr, 2026 Read the published version in Molecular Biology Reports → Version 1 posted Editorial decision: Revision requested 25 Feb, 2026 Reviews received at journal 20 Feb, 2026 Reviewers agreed at journal 09 Feb, 2026 Reviewers invited by journal 27 Jan, 2026 Editor assigned by journal 23 Jan, 2026 Submission checks completed at journal 23 Jan, 2026 First submitted to journal 22 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8668470","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":581307692,"identity":"992cd4e8-a8cc-4512-9dd1-4f52d9eb6189","order_by":0,"name":"Fatemeh Mottaghizadeh","email":"","orcid":"","institution":"Ankara University","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"","lastName":"Mottaghizadeh","suffix":""},{"id":581307694,"identity":"b408ea57-d29a-47c1-858d-6000d33f4d16","order_by":1,"name":"Nefise Akçelik","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA7UlEQVRIie3OMUvDQBTA8QcH7XKQ9R2In+GVB6mC6FexHMTlkI6FgnWqSyCrX8O9w5NAu0RcMzqlS4Z0s9ChV3AQtEndHO4PdzwOfscDCIX+ZT1/xkgRgPp6uT2FEJJ5/E6kmwCRnEqG/eWoaeiCefWW03ZxDVHfkdosjpPLNMnNM2EcF/d2lFYWTFoTSHWckNzNlSa8isWxaFFApfOkZTN6X8/VzhPOan7dyQxuOkmZLP3PGBM6tlpyP3eSypqUkLGsmc9kpbGoxlK0LpYMms/JwyDLHJtapufRk335mLSQH+nD9RcQCoVCoV/aA+ETUT8K/c1mAAAAAElFTkSuQmCC","orcid":"","institution":"Ankara University","correspondingAuthor":true,"prefix":"","firstName":"Nefise","middleName":"","lastName":"Akçelik","suffix":""},{"id":581307696,"identity":"8f9954c1-5bcf-402b-a24d-8e72b818148c","order_by":2,"name":"Mehri HAEILI","email":"","orcid":"","institution":"University of Tabriz","correspondingAuthor":false,"prefix":"","firstName":"Mehri","middleName":"","lastName":"HAEILI","suffix":""}],"badges":[],"createdAt":"2026-01-22 10:38:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8668470/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8668470/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11033-026-11808-9","type":"published","date":"2026-04-17T15:58:03+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":101752093,"identity":"4ebd60f3-2609-4d32-9214-d3591df26f5c","added_by":"auto","created_at":"2026-02-03 10:25:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":87202,"visible":true,"origin":"","legend":"\u003cp\u003eThe MIC distribution of carvacrol and lactobionic acid against \u003cem\u003eE. coli\u003c/em\u003e isolates. The numbers above represent the MIC values in µg/mL, while the numbers below indicate the percentage of isolates exhibiting that MIC.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8668470/v1/0906e6e7ba7b999fde0e517f.png"},{"id":101444431,"identity":"d2904b50-2d2a-4a85-b4b6-7f24c0be3e64","added_by":"auto","created_at":"2026-01-29 18:05:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":52000,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of Carvacrol and Lactobionic acid combinations on \u003cem\u003eE. coli\u003c/em\u003e biofilms\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8668470/v1/9c5d5e04d4afe396f05c8cfa.png"},{"id":101444433,"identity":"a5560b08-bef1-4977-bfb7-487bdbc71de4","added_by":"auto","created_at":"2026-01-29 18:05:46","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":70711,"visible":true,"origin":"","legend":"\u003cp\u003eRelative Expression levels of selected genes in \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 determined by RT-qPCR a: \u003cem\u003eluxS \u003c/em\u003egene\u003cem\u003e, \u003c/em\u003eb: \u003cem\u003ecsgA \u003c/em\u003egene c: \u003cem\u003epfs \u003c/em\u003egene\u003cem\u003e \u003c/em\u003ed: \u003cem\u003erpoS \u003c/em\u003egene.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8668470/v1/73e5a5a90eebdb058a553a7c.png"},{"id":107350840,"identity":"523ae77f-9cf6-4e14-845b-37d4e51c49b5","added_by":"auto","created_at":"2026-04-20 16:05:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1068055,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8668470/v1/59998a7e-d6ab-4b4b-a18c-d255cc4a54c2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Investigation of Antimicrobial and Antivirulence Effects of Lactobionic Acid and Carvacrol, Individually and in Combination, Against Escherichia coli Isolates","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cem\u003eEscherichia coli\u003c/em\u003e is a prominent Gram-negative pathogen responsible for a diverse clinical spectrum, ranging from self-limiting gastrointestinal distress to life-threatening systemic infections. A critical factor in its pathogenicity is the ability to transition from a planktonic state to a biofilm community, a process that significantly enhances antimicrobial resistance (AMR) and infection persistence [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The architecture of \u003cem\u003eE. coli\u003c/em\u003e biofilm development typically follows four distinct stages: (i) the reversible attachment of planktonic cells mediated by surface appendages such as pili and flagella; (ii) the formation of microcolonies characterized by the secretion of an extracellular polymeric substance (EPS) matrix; (iii) biofilm maturation, driven by synchronized gene expression and intercellular signaling; and (iv) the active dispersion of cells to colonize novel ecological niches [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. These mature structures exhibit profound tolerance to both antimicrobial agents and host immune responses, facilitating the establishment of chronic infections. Notably, the U.S. National Institutes of Health (NIH) estimates that up to 80% of human microbial infections are associated with biofilm phenotypes [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eA fundamental regulatory mechanism underlying biofilm development and virulence is quorum sensing (QS), a density-dependent chemical communication system mediated by signaling molecules termed autoinducers. QS enables bacterial populations to monitor their density and collectively orchestrate the expression of genes involved in matrix production, virulence factor secretion, and toxin synthesis [37, 38]. By facilitating both intra- and inter-species communication, QS regulates complex behaviors that underpin the pathogenicity and resilience of biofilm-associated infections. Consequently, the disruption of QS-regulated pathways emerges as a highly promising therapeutic strategy to combat multidrug-resistant \u003cem\u003eE. coli\u003c/em\u003e [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLactobionic acid (LBA), a naturally occurring polyhydroxy acid and chelating agent derived from lactose, possesses diverse biological properties, including antioxidant, prebiotic, and potent antimicrobial activities. A notable feature of LBA is its selective toxicity; while it supports the proliferation of beneficial gut microbiota, it significantly suppresses the growth of various pathogenic species [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The antimicrobial efficacy of LBA is primarily attributed to its ability to disrupt bacterial cell membrane integrity, interfere with protein synthesis, and inhibit the early stages of biofilm assembly, thereby compromising microbial viability [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCarvacrol (CAR), a predominant monoterpenoid phenol found in the essential oils of the Lamiaceae family, has demonstrated broad-spectrum antimicrobial activity, particularly against MDR and biofilm-producing bacteria. Its mode of action primarily involves the destabilization of the lipid bilayer and the alteration of membrane fluidity, which leads to the leakage of intracellular constituents and subsequent cell death [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDespite the established individual antimicrobial and antibiofilm properties of LBA and CAR, their potential synergistic interaction against MDR \u003cem\u003eE. coli\u003c/em\u003e remains largely unexplored. Given their distinct and potentially complementary mechanisms of action-membrane disruption and metabolic interference-a combinatorial approach may enhance therapeutic efficacy while minimizing the effective concentrations required for each compound. Consequently, this study was designed to evaluate the individual and synergistic effects of LBA and CAR on the growth, biofilm formation, and virulence profiles of clinical MDR \u003cem\u003eE. coli\u003c/em\u003e isolates, providing a comprehensive analysis of their potential as an alternative antimicrobial strategy.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Bacterial Strains and Culture Conditions\u003c/h2\u003e \u003cp\u003eA total of 50 \u003cem\u003eE. coli\u003c/em\u003e isolates were investigated in this study. Forty isolates were recovered from various clinical specimens, primarily catheter-associated infections, prosthetic-related infections, and sepsis, at the Ankara University Faculty of Medicine, İbn-i Sina Hospital. To enhance the genetic and phenotypic diversity of the study population, 10 additional isolates were obtained from the culture collections of the General Hospital Medical Microbiology Department, Etlik City Hospital (T\u0026uuml;rkiye), and the Microbiology Laboratory of Tabriz University (Iran). \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 was utilized as the reference control strain. All isolates were preserved in Tryptic Soy Broth (TSB) supplemented with 10% (v/v) glycerol at -80\u0026deg;C for long-term storage. Before each experiment, isolates were subcultured on appropriate agar media to ensure viability and purity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Determination of Biofilm-Forming Capacity\u003c/h2\u003e \u003cp\u003eThe biofilm-forming capacity of the isolates was assessed using a modified microtiter plate (MTP) assay, as previously described by Stepanović et al. [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Briefly, overnight cultures were standardized to a 0.5 McFarland turbidity (approx. 10\u003csup\u003e8\u003c/sup\u003e CFU/mL) in Luria-Bertani (LB) broth. Subsequently, 30 \u0026micro;L of the standardized inoculum was added to 96-well microplates containing 100 \u0026micro;L of LB broth (without NaCl) and incubated at 37\u0026deg;C for 48 h under static conditions. Following the incubation, the supernatant was discarded, and wells were gently washed three times with 200 \u0026micro;L of phosphate-buffered saline (PBS, pH 7.2) to remove non-adherent (planktonic) cells. The remaining adherent biofilm was fixed with 140 \u0026micro;L of 95% methanol for 15 min and subsequently stained with 140 \u0026micro;L of 0.1% (w/v) crystal violet (CV) solution for 30 min at room temperature. After washing the plates to remove excess dye, the bound CV was eluted using 140 \u0026micro;L of 33% (v/v) glacial acetic acid. The optical density (OD) of each well was measured at 595 nm using a microplate reader. To account for background interference, the cut-off OD (OD c) was established as three standard deviations above the mean OD of the negative controls (sterile medium). Isolates were categorized based on their adherence capabilities according to the following criteria [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]: OD test\u0026thinsp;\u0026le;\u0026thinsp;OD c (Non-biofilm former) OD c\u0026thinsp;\u0026lt;\u0026thinsp;OD test\u0026thinsp;\u0026le;\u0026thinsp;2 \u0026times; OD c (Weak biofilm former) 2 \u0026times; OD c\u0026thinsp;\u0026lt;\u0026thinsp;OD test\u0026thinsp;\u0026le;\u0026thinsp;4 \u0026times; OD c (Moderate biofilm former) 4 \u0026times; OD c\u0026thinsp;\u0026lt;\u0026thinsp;OD test (Strong biofilm former) All experiments were performed in three biological replicates, each with three technical replicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Determination of Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC)\u003c/h2\u003e \u003cp\u003eCarvacrol (\u0026ge;\u0026thinsp;99%, FG W224511) and Lactobionic acid (\u0026ge;\u0026thinsp;97%, 153516) were procured from Sigma-Aldrich (USA) and maintained at \u0026minus;\u0026thinsp;20\u0026deg;C until analysis. The MIC and MBC of both compounds were determined using the broth microdilution method according to CLSI guidelines. To determine the MIC, two fold serial dilutions of the agents were prepared in LB broth within 96-well microplates. Each well was inoculated with a final bacterial concentration of approximately 5x10\u003csup\u003e5\u003c/sup\u003e CFU/mL and incubated at 37\u0026deg;C for 18\u0026ndash;24 h. The MIC was defined as the lowest concentration of the antimicrobial agent that completely inhibited visible bacterial growth.\u003c/p\u003e \u003cp\u003eFollowing MIC determination, the percentage of viable cell reduction was quantified. Aliquots from the MIC wells and untreated control wells were serially diluted and plated onto LB agar. After incubation at 37\u0026deg;C for 24 h, colonies were enumerated, and the percentage of inhibition was calculated using the formula:\u003c/p\u003e \u003cp\u003e% inhibition= [(CFU/ml control - CFU/ml treatment) / CFU/ml control] \u0026times;100.\u003c/p\u003e \u003cp\u003eTo establish the MBC, 10 \u0026micro;L aliquots from all wells showing no visible growth were subcultured onto LB agar plates and incubated at 37\u0026deg;C for an additional 24 h. The MBC was recorded as the lowest concentration that resulted in a reduction (3-log reduction) in the initial bacterial inoculum. All assays were conducted in triplicate (three biological replicates), each performed with three technical replicates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Determination of Minimum Biofilm Eradication Concentration (MBEC)\u003c/h2\u003e \u003cp\u003eThe MBEC of CAR and LBA, both individually and in combination, was determined against pre-established biofilms of \u003cem\u003eE. coli\u003c/em\u003e isolates. The individual efficacy of CAR and LBA was assessed across 43 isolates (comprising \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922, 17 moderate, and 25 strong biofilm producers). For combinatorial analysis, the reference strain \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 and two representative strong biofilm-forming isolates were selected. To establish mature biofilms, isolates were cultured in 96-well microtiter plates under standard conditions. Following the 48-hour maturation period, the supernatant was removed, and pre-established biofilms were challenged with varying concentrations of the agents, ranging from 1\u0026times; MIC to 4\u0026times; MIC. After a 24-hour incubation period at 37\u0026deg;C, biofilms were quantified using the crystal violet staining method OD 595 nm [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. MBEC was defined as the lowest concentration of the agent(s) required to eradicate the pre-formed biofilm, resulting in an OD value comparable to the negative control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Checkerboard Analysis for Synergy Determination\u003c/h2\u003e \u003cp\u003eTo evaluate potential synergistic interactions between LBA and CAR, a checkerboard microdilution assay was performed. In a 96-well plate, LBA was serially diluted two-fold along the x-axis, while CAR was diluted along the y-axis. Each well was inoculated with active bacterial culture to achieve a final concentration of approximately 10\u003csup\u003e5\u003c/sup\u003e CFU/mL. Following incubation at 37\u0026deg;C for 24 h, the interaction was quantified by determining the Fractional Inhibitory Concentration Index (FICI) using the formula:\u003c/p\u003e \u003cp\u003eFIC index\u0026thinsp;=\u0026thinsp;FICA\u0026thinsp;+\u0026thinsp;FICB = (MIC of lactobionic acid in combination acid / MIC of lactobionic acid alone) + (MIC of carvacrol in combination / MIC of carvacrol alone).\u003c/p\u003e \u003cp\u003eThe interactions were interpreted as follows: Synergy: FIC index\u0026thinsp;\u0026le;\u0026thinsp;0.5; Additive effect: 0.5\u0026thinsp;\u0026lt;\u0026thinsp;FIC index\u0026thinsp;\u0026le;\u0026thinsp;1, Indifferent: 1\u0026thinsp;\u0026lt;\u0026thinsp;FIC index\u0026thinsp;\u0026le;\u0026thinsp;4, Antagonism: FIC index\u0026thinsp;\u0026gt;\u0026thinsp;4 (10). All experiments were performed in triplicate on separate days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Gene Expression Analysis via RT-qPCR\u003c/h2\u003e \u003cp\u003eThe impact of CAR and LBA on the expression profiles of quorum sensing (QS), biofilm-related, and virulence-associated genes was evaluated using Reverse Transcription-quantitative PCR (RT-qPCR). Total RNA was extracted from \u003cem\u003eE. coli\u003c/em\u003e cultures treated with sub-inhibitory concentrations of the agents using the GeneMATRIX Universal RNA Purification Kit (EURx, Poland), according to the manufacturer\u0026rsquo;s protocol. RNA concentration and purity were determined using a NanoDrop ND-1000 spectrophotometer (Thermo Scientific, USA), and structural integrity was verified via agarose gel electrophoresis. Subsequently, 1 \u0026micro;g of total RNA was reverse-transcribed into cDNA using the smART First Strand cDNA Synthesis Kit (EURx, Poland). Quantitative PCR amplification was performed on a LightCycler 480 system (Roche, Germany) using 5\u0026times; HOT FIREPol EvaGreen qPCR Supermix (Solis BioDyne, Estonia). Specific primers were utilized to target key genetic markers: \u003cem\u003eluxS\u003c/em\u003e (QS), \u003cem\u003ecsgA\u003c/em\u003e (biofilm/adhesion), \u003cem\u003epfs\u003c/em\u003e (SAH nucleosidase), and \u003cem\u003erpoS\u003c/em\u003e (stress response) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The 16S rRNA gene was employed as an internal reference for normalization. Relative fold changes in gene expression were calculated using the method, comparing treated samples against the untreated control group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNucleotide sequences of the primers used for RT-qPCR analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;\u0026minus;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFunction\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eProduct size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16S rRNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGAGACTGCCAGTGATAAAC\u003c/p\u003e \u003cp\u003eR: GGACTACGACGCACTTTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReference gene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e151\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eluxS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCAATGGAAGACGTGCTGAA\u003c/p\u003e \u003cp\u003eR: TGCAACTTCTCTTTCGGCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQS regulator\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e182\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ecsgA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCAGCAATCGTATTCTCCGG\u003c/p\u003e \u003cp\u003eR: ATCAGAACCTTGGCCCACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVirulence, motility\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e234\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epfs\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CGGCAACAGCCAGGAACTCA\u003c/p\u003e \u003cp\u003eR: GCGAAAATCCGCCACAACTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVirulence\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e169\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e(11)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003erpoS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CTCAACATACGCAACCTG\u003c/p\u003e \u003cp\u003eR: GTCATCAACTGGCTTATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eStress, growth, and virulence\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e199\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e(12,13)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Statistical Analysis\u003c/h2\u003e \u003cp\u003eAll experimental assays were performed in at least three independent biological replicates, each containing three technical replicates. Data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical significance was evaluated using GraphPad Prism version 10.0 (GraphPad Software, San Diego, CA, USA). Differences between treated groups and the untreated control were analyzed using one-way analysis of variance (ANOVA), followed by Tukey\u0026rsquo;s post-hoc test for multiple comparisons. A p-value of less than 0.05 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Biofilm-Forming Phenotypes of Clinical Isolates\u003c/h2\u003e \u003cp\u003eThe biofilm production capacity of 50 clinical \u003cem\u003eE. coli\u003c/em\u003e isolates and the reference strain \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 was quantitatively assessed. Based on the classification criteria, the isolates exhibited diverse biofilm-forming phenotypes. Specifically, 49.01% (n\u0026thinsp;=\u0026thinsp;25) were identified as strong biofilm producers, while 33.33% (n\u0026thinsp;=\u0026thinsp;17) were categorized as moderate producers. Weak biofilm formation was observed in 11.76% (n\u0026thinsp;=\u0026thinsp;6) of the strains, and only 3.92% (n\u0026thinsp;=\u0026thinsp;2) were classified as non-biofilm producers. The reference strain \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 was confirmed as a strong biofilm producer, consistent with its role as a positive control. These results highlight a high prevalence (82.34%) of moderate-to-strong biofilm-forming capacity among the clinical isolates, underlining the clinical significance of these strains in persistent infections.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Antimicrobial Efficacy of LBA and CAR (MIC and MBC)\u003c/h2\u003e \u003cp\u003eThe antimicrobial activities of LBA and CAR were evaluated against the panel of \u003cem\u003eE. coli\u003c/em\u003e isolates. CAR exhibited potent antibacterial activity, with MIC values ranging from 256 to 4096 \u0026micro;g/mL. In comparison, LBA demonstrated higher MIC values, spanning from 2048 to 16,384 \u0026micro;g/mL. Despite differences in inhibitory concentrations, both agents exhibited a strong bactericidal profile. The MBC values for CAR and LBA were found to be either equal to or within two-fold of their respective MICs. Notably, MBC/MIC ratios of the tested compounds were \u0026le;\u0026thinsp;4 for 98.03% (n\u0026thinsp;=\u0026thinsp;50 out of 51 isolates) and 100% (n\u0026thinsp;=\u0026thinsp;51) of the isolates, indicating strong bactericidal activity against \u003cem\u003eE. coli\u003c/em\u003e. Live cell count assays further confirmed these effects, with inhibition rates ranging from 84\u0026ndash;100% for carvacrol and 99\u0026ndash;100% for lactobiotic assay. For the reference strain \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922, the MIC values for CAR and LBA were recorded at 1024 \u0026micro;g/mL and 8192 \u0026micro;g/mL, respectively. These findings establish that while CAR is effective at lower concentrations, both compounds possess the capacity to eradicate planktonic cells of multidrug-resistant isolates.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe MIC and MBC values of carvacrol and lactobionic acid against 50 clinical \u003cem\u003eE. coli\u003c/em\u003e isolates.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"9\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eIsolate code\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003eCarvacrol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c9\" namest=\"c6\"\u003e \u003cp\u003eLactobionic acid\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMIC (\u0026micro;g/ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMBC (\u0026micro;g/ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eInhibition percentage (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEffect\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMIC (\u0026micro;g/ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMBC (\u0026micro;g/ml)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eInhibition percentage (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c9\"\u003e \u003cp\u003eEffect\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e 25922\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e97.64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC/BS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e345\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e336\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e246\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e171\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e348\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e166\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e170\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e173\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e84.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e292\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e302\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e650\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e203\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e658\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e652\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e161\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e657\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e607\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e282\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e653\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e181\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e208\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e266\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e661\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e654\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e666\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e621\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e663\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e163\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e169\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e172\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e174\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e640\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e194\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e291\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e317\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e651\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e624\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e274\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e668\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e662\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e670\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e667\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e656\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e659\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e664\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e669\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e655\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e310\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e665\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e32768\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e99.99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003eBC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003eBC: Bactericidal\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"9\"\u003eBS: Bacteriostatic\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe susceptibility profiles showed a heterogeneous distribution. The MIC distribution for CAR demonstrated that the majority of isolates were inhibited at concentrations between 512 and 1024 \u0026micro;g/mL. Specifically, 18% of the isolates exhibited an MIC of 512 \u0026micro;g/mL, while 14% required 1024 \u0026micro;g/mL for complete growth inhibition. In contrast, the MIC distribution for LBA shifted toward higher concentration ranges. The most frequent MIC value was observed at 8192 \u0026micro;g/mL, accounting for 64% of the tested population. Despite the broader range of LBA concentrations required, a clear dose-dependent inhibitory effect was observed across all MDR isolates.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Minimum Biofilm Eradication Concentration (MBEC)\u003c/h2\u003e \u003cp\u003eThe MBEC of CAR and LBA was determined for 43 \u003cem\u003eE. coli\u003c/em\u003e isolates. Results demonstrated that significantly higher concentrations were required to eradicate established biofilms compared to those needed to inhibit planktonic growth.\u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e3.3.1. Biofilm Eradication Profile of Carvacrol\u003c/h2\u003e \u003cp\u003eCAR effectively eradicated mature biofilms across a range of concentrations. The most frequent MBEC values were recorded at 2048 \u0026micro;g/mL and 4096 \u0026micro;g/mL, each accounting for 25.58% of the isolates. Lower MBEC values of 512 \u0026micro;g/mL and 1024 \u0026micro;g/mL were observed in 16.27% and 9.30% of the strains, respectively. In terms of overall efficacy, CAR exhibited its most substantial antibiofilm activity at 2\u0026times; and 4\u0026times; MIC levels, achieving an average biofilm inhibition rate of 24.12% across the entire panel.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e \u003ch2\u003e3.3.2. Biofilm Eradication Profile of Lactobionic Acid\u003c/h2\u003e \u003cp\u003eLBA demonstrated a distinct MBEC distribution, with more than half of the isolates (51.16%) being eradicated at a concentration of 8192 \u0026micro;g/mL. This was followed by 4096 \u0026micro;g/mL, which was effective against 25.58% of the isolates. Notably, LBA showed superior antibiofilm potency compared to CAR when used individually, with an average biofilm reduction rate of 57.7% at its MIC (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe MBEC values of carvacrol and lactobionic acid\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCarvacrol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLactobionic acid\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIsolate code\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMBEC (\u0026micro;g/ml)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInhibition rate (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMBEC (\u0026micro;g/ml)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eInhibition rate (%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e ATCC25922\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e43.29\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e345\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e32.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24567 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e17.29\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e246\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e44.47\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e166\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6144 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e32768 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e170\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e80.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e348\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e54.72\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e173\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.81\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2048 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e51.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e292\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e68.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e302\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e85.18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e203\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e512 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e88.24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e658\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e512 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16384(2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e54.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e652\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e56.55\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e161\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1024 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e78.68\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e657\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e512 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e41.07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e607\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e512 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21,17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e90.28\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e282\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1024 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e85.68\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e653\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3072 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e32.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16384 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e46.06\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e181\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e512 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e66.71\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e266\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e256 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e84.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e666\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e75.77\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e621\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1536 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.74\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16384 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e53.51\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e661\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e512 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192(MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e75.77\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e654\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e512 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.71\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2048 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e66.89\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e169\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1536 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e16.66\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e86.03\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e663\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1536 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e68.32\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e174\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1024 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e43.67\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e640\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e63.45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e194\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e58.17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e291\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e23.73\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e68.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e317\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e44.84\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e651\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e35,37\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e624\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8192 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e57.08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e274\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e41.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e49153 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6.42\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e668\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e38.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24567 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e38.49\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e662\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e47.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e67.49\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e670\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10.63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e24567 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e24.74\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e667\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e34.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e43.72\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e656\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2048 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6.57\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e83.88\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e659\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8192 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e42.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e37.87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e664\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12288 (3 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e15.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192(MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e41.45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e669\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8192 (4 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4096 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e92.41\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e655\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4096 (2 MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e51.92\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e665\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1024 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e21.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8192 (MIC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Synergistic Interactions of LBA and CAR (Checkerboard Assay)\u003c/h2\u003e \u003cp\u003eTo our knowledge, this is the first study to employ the checkerboard-based FIC method to characterize the interaction between LBA and CAR against \u003cem\u003eE. coli.\u003c/em\u003e This evaluation was conducted on seven representative isolates, including \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 and six clinical isolates (strains 640, 274, 345, 208, 162, and 171) with diverse biofilm phenotypes. The combinatorial analysis revealed a predominant synergistic relationship. Synergy (FICI 0.5) was observed in 85.7% (6 out of 7) of the tested isolates, while an additive effect (0.5\u0026thinsp;\u0026lt;\u0026thinsp;FICI 1) was identified in only one isolate (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Notably, the combined application of CAR and LBA resulted in a dramatic reduction in their individual MIC values, ranging from 2-fold to 32-fold. These findings underscore the potentiation effect of LBA on CAR efficacy.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCheckerboard assay results showing the interaction of tested compounds against \u003cem\u003eEscherichia coli\u003c/em\u003e isolates.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eBacterial isolates\u003c/span\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eBiofilm Formation Ability\u003c/span\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eCarvacrol MIC (\u0026micro;g/ml)\u003c/span\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eLactobionic Acid MIC (\u0026micro;g/ml)\u003c/span\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eFICI\u003c/span\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eEffect\u003c/span\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE.\u003c/em\u003e \u003cspan type=\"ItalicSmallCaps\" class=\"ItalicSmallCaps\" name=\"Emphasis\"\u003ecoli\u003c/span\u003e ATCC25922\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStrong\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSynergistic effect\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e640\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStrong\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAdditive effect\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e274\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStrong\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e16384\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSynergistic effect\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e345\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStrong\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSynergistic effect\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e208\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWeak\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e256\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSynergistic effect\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e162\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWeak\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSynergistic effect\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e171\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2048\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4096\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSynergistic effect\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Synergistic Inhibition of Biofilm Formation by CAR and LBA\u003c/h2\u003e \u003cp\u003eThe combinatorial effect of CAR and LBA on biofilm assembly\u0026mdash;an interaction not previously documented\u0026mdash;was evaluated against \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 and two strong biofilm-producing clinical isolates (345 and 274). In the reference strain \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922, individual treatments with CAR and LBA reduced biofilm formation by 20.49% and 43.29%, respectively. Notably, their simultaneous application resulted in a significantly enhanced inhibition rate of 79.86%. A consistent synergistic trend was observed across the clinical isolates. For isolate 345, CAR and LBA alone achieved inhibition rates of 32.66% and 17.29%; however, the combined treatment yielded a superior inhibition of 83.72%. The most pronounced synergistic effect was recorded in isolate 274; while LBA alone showed marginal efficacy (6.42%) and CAR moderate efficacy (41.52%), their combination led to a robust biofilm reduction of 87.74% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). These results demonstrate that the CAR-LBA combination exerts a potent synergistic potentiation, effectively suppressing biofilm formation in highly resilient clinical isolates.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"6. Quantification of Gene Expression Levels (RT-qPCR)","content":"\u003cp\u003eThe regulatory effects of CAR and LBA on the transcriptional levels of key virulence and biofilm-associated genes were quantified via RT-qPCR. Both compounds exhibited a consistent suppressive effect on target genes, albeit to varying degrees. Individually, LBA induced a downregulation in the expression of \u003cem\u003eluxS\u003c/em\u003e, \u003cem\u003ecsgA\u003c/em\u003e, \u003cem\u003epfs\u003c/em\u003e, and \u003cem\u003erpoS\u003c/em\u003e by 1.92, 4.34, 20.0, and 7.69-fold, respectively. CAR demonstrated a more pronounced inhibitory impact, reducing the expression of these genes by 3.36, 1.13, 33.78, and 33.33-fold. While CAR exhibited the most potent suppressive effect on \u003cem\u003eluxS\u003c/em\u003e, \u003cem\u003epfs\u003c/em\u003e, and rpoS, the synergistic combination achieved the most significant inhibitory effect on \u003cem\u003ecsgA\u003c/em\u003e. Specifically, the combined treatment resulted in a 10-fold reduction in \u003cem\u003ecsgA\u003c/em\u003e expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This marked downregulation is particularly critical, as \u003cem\u003ecsgA e\u003c/em\u003encodes the major subunit of curli fimbriae, essential for initial surface adhesion and the structural integrity of \u003cem\u003eE. coli\u003c/em\u003e biofilms.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe escalating threat of antibiotic resistance has intensified global efforts to identify alternative therapeutic options. Natural products, particularly plant-derived compounds, are increasingly recognized as promising alternatives for combating drug resistance. Indeed, various bioactive compounds\u0026mdash;including alkaloids, flavonoids, and terpenoids\u0026mdash;can act independently or synergistically with conventional antibiotics to restore or enhance antimicrobial efficacy [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Numerous studies now support the potential of these natural molecules to target bacterial virulence and pathogenesis pathways or to counteract drug-resistant infections by sensitizing bacteria to clinically relevant classes of antibiotics [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Lactobionic acid (LBA) is one such natural compound known to inhibit various pathogenic bacteria. Previous research on \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e and methicillin-resistant \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (MRSA) suggests that LBA disrupts the integrity of bacterial cell walls and membranes, negatively impacting protein content and enzymatic activity. Similarly, carvacrol (CAR), a monoterpenoid phenol, targets bacterial cell membranes and modulates the expression of genes involved in biofilm formation. A study conducted in T\u0026uuml;rkiye reported that CAR exhibited significant antibacterial properties against \u003cem\u003eAcinetobacter baumannii\u003c/em\u003e and effectively reduced colistin resistance when used in combination with colistin, demonstrating both synergistic and additive effects [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the present study, we assessed for the first time the anti-virulence and antibiofilm effects of LBA and CAR\u0026mdash;both individually and in combination\u0026mdash;against extra-intestinal and catheter-associated \u003cem\u003eE. coli\u003c/em\u003e isolates. Our results revealed that MIC values for CAR and LBA ranged from 256 to 4096 \u0026micro;g/mL and 2048 to 16,384 \u0026micro;g/mL, respectively. Furthermore, viable cell count assays showed that CAR achieved an inhibitory effect ranging from 84% to 100% across all isolates, while LBA demonstrated an inhibitory effect of 99% to 100%. Based on the obtained MBC/MIC ratios, both CAR and LBA exhibited potent bactericidal activity against \u003cem\u003eE. coli\u003c/em\u003e, which is consistent with existing literature [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. A study by Khan et al. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] reported that CAR exhibited MIC values of 450 \u0026micro;g/mL against uropathogenic \u003cem\u003eE. coli\u003c/em\u003e, including ESBL-producing strains, while Boyer et al. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] observed an MIC of 600 \u0026micro;g/mL against \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. These findings closely align with the results of the present study. Regarding LBA, previous reports indicated MIC values of 12.5 mg/mL and 18.75 mg/mL against \u003cem\u003eP. fluorescens\u003c/em\u003e and MRSA, respectively [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In our study, however, 65% of \u003cem\u003eE. coli\u003c/em\u003e isolates were inhibited at significantly lower MICs of approximately 8 mg/mL, suggesting that LBA may be more effective against \u003cem\u003eE. coli\u003c/em\u003e than against those species. Comparable findings were reported by Chen and Zhong [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], who demonstrated that LBA exhibited an MIC of 10 mg/mL against both \u003cem\u003eListeria monocytogenes\u003c/em\u003e and \u003cem\u003eE. coli\u003c/em\u003e. In their study, the MBC for \u003cem\u003eL. monocytogenes\u003c/em\u003e was twice the MIC, while for \u003cem\u003eE. coli\u003c/em\u003e, it exceeded 20 mg/mL [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWe conducted further experiments to determine the Minimum Biofilm Eradication Concentration (MBEC) of both compounds. CAR displayed moderate antibiofilm activity, reducing biofilm formation in \u003cem\u003eE. coli\u003c/em\u003e isolates by an average of 24.12%, whereas LBA exhibited a markedly stronger effect, achieving an average reduction rate of 57.7%. These results indicate that both compounds are effective against \u003cem\u003eE. coli\u003c/em\u003e biofilms, with LBA demonstrating greater potential as a biofilm-eradicating agent. In a study by Fan et al. [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], LBA significantly inhibited \u003cem\u003eSalmonella\u003c/em\u003e Typhimurium biofilm formation on stainless-steel and chicken-meat surfaces by suppressing cell motility as well as the production of extracellular polysaccharides and proteins. Another study demonstrated that CAR possesses notable antibiofilm activity against \u003cem\u003eL. monocytogenes\u003c/em\u003e and \u003cem\u003eP. aeruginosa\u003c/em\u003e biofilms formed in the MBEK\u0026trade; biofilm device and on polypropylene surfaces [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWhile CAR and LBA demonstrated individual antibacterial and antibiofilm activities, their combination exhibited robust synergistic effects, reducing the MIC values of both agents by 2- to 32-fold across various \u003cem\u003eE. coli\u003c/em\u003e isolates. Furthermore, biofilm inhibition rates for CAR and LBA alone ranged from 20.49\u0026ndash;41.52% to 6.42\u0026ndash;43.29%, respectively; however, their combination dramatically increased the inhibition rate to 79.86\u0026ndash;87.74%, demonstrating strong synergistic antibiofilm activity. These findings indicate that CAR and LBA can effectively inhibit planktonic \u003cem\u003eE. coli\u003c/em\u003e even at very low concentrations when used together. Overall, these results highlight the promise of these natural products for developing alternative strategies to combat biofilm-associated \u003cem\u003eE. coli\u003c/em\u003e infections and sustainable approaches to addressing bacterial resistance.\u003c/p\u003e \u003cp\u003e \u003cem\u003eE. coli\u003c/em\u003e utilizes a range of virulence genes to establish infections in diverse environments and adapt to varying conditions. Among these, \u003cem\u003eluxS\u003c/em\u003e, \u003cem\u003epfs\u003c/em\u003e, \u003cem\u003erpoS\u003c/em\u003e, and \u003cem\u003ecsgA\u003c/em\u003e play key roles in regulating virulence, stress responses, and biofilm formation. This study examined the effects of CAR and LBA, both individually and in combination, on the expression of these genes. Both compounds inhibited key virulence-associated genes, with CAR showing the strongest individual effect, particularly on \u003cem\u003eluxS\u003c/em\u003e, \u003cem\u003epfs\u003c/em\u003e, and \u003cem\u003erpoS\u003c/em\u003e. Notably, the combination of the two compounds produced the greatest suppression of \u003cem\u003ecsgA\u003c/em\u003e (10-fold reduction). Since \u003cem\u003ecsgA\u003c/em\u003e is critical for adhesion and biofilm formation, its downregulation suggests that these treatments could effectively reduce bacterial colonization and biofilm development. To our knowledge, this is the first study to evaluate the effects of LBA on the expression of key virulence genes in \u003cem\u003eE. coli\u003c/em\u003e, providing new insights into its anti-virulence potential.\u003c/p\u003e \u003cp\u003eSimilarly, previous studies have reported that CAR effectively suppressed the expression of genes involved in motility (\u003cem\u003emotA\u003c/em\u003e), adhesion (\u003cem\u003efaeG\u003c/em\u003e), toxin production (heat-labile and heat-stable toxins), quorum sensing (\u003cem\u003eluxS\u003c/em\u003e), and biofilm formation (\u003cem\u003ebssS\u003c/em\u003e and \u003cem\u003etnaA\u003c/em\u003e) in \u003cem\u003eE. coli\u003c/em\u003e K88 strains [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Another study revealed that a combination of CAR and cineole reduced the transcription levels of key virulence genes, including \u003cem\u003estx1\u003c/em\u003e, \u003cem\u003eeae\u003c/em\u003e, \u003cem\u003eflhD\u003c/em\u003e, and \u003cem\u003eluxS\u003c/em\u003e, in \u003cem\u003eE. coli\u003c/em\u003e O157:H7 [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Furthermore, transcriptomic analysis by Wang et al. [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] demonstrated that CAR significantly reduced biofilm formation in \u003cem\u003eP. fluorescens\u003c/em\u003e by disrupting \u003cem\u003eluxR/I\u003c/em\u003e-mediated quorum sensing and modulating c-di-GMP-related gene expression [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. CAR has also been shown to inhibit biofilm formation in \u003cem\u003eChromobacterium violaceum\u003c/em\u003e ATCC 12472 by downregulating \u003cem\u003ecviI\u003c/em\u003e, the gene responsible for N-acyl-L-homoserine lactone synthase. This suppression was accompanied by reductions in quorum-sensing-regulated activities, such as violacein production and chitinase activity, suggesting its antibiofilm effects are linked to QS disruption [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Finally, in \u003cem\u003eE. coli\u003c/em\u003e O157:H7, CAR has been reported to downregulate the \u003cem\u003eler\u003c/em\u003e gene, which controls various virulence factors, and reduce the expression of flagellin (\u003cem\u003efliC\u003c/em\u003e) and Shiga toxin genes [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Together, these findings underscore carvacrol\u0026rsquo;s multi-target anti-virulence strategy, establishing it as a promising natural agent for reducing bacterial pathogenicity and controlling biofilm-associated infections. Together, these findings underscore carvacrol\u0026rsquo;s multi-target anti-virulence strategy.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThis study presents a novel and effective strategy for combating biofilm-associated infections by highlighting the potent capacity of natural compounds to function as biofilm-disrupting and antivirulence agents. Our findings demonstrate that carvacrol and lactobionic acid\u0026mdash;especially in combination\u0026mdash;significantly modulate quorum sensing, suppress primary adhesion, and disrupt the structural integrity of mature E. coli biofilms. Importantly, this research provides the first molecular evidence that lactobionic acid can downregulate genes critical to quorum sensing (luxS, pfs), adhesion (csgA), and stress response (rpoS). By attenuating bacterial pathogenicity without necessarily exerting the selective pressure associated with conventional antibiotics, this combinatorial approach represents a sustainable path forward in antimicrobial therapy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\u003ch2\u003eEthics Approval\u003c/h2\u003e \u003cp\u003eIsolates were obtained from existing laboratory archives as part of a retrospective collection. Since the isolates were previously collected during routine diagnostic procedures and were analyzed in a fully anonymized manner without any access to patient-identifiable data, this study did not require formal ethical approval according to the institutional guidelines and the Declaration of Helsinki.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was financially supported by the Ankara University Scientific Research Projects Office (BAP) (Project No: FDK-2023-2911).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eFatemeh Mottaghizadeh (Conceptualization, Investigation, Methodology, Validation, Writing \u0026ndash; original draft, Writing \u0026ndash; review \u0026amp; editing, Data analysis), Mehri Haeili (Data analysis, Writing \u0026ndash; review \u0026amp; editing), Nefise Akcelik (Conceptualization, Methodology, Project administration, Supervision).\u003c/p\u003e\u003ch2\u003eAcknowledgments:\u003c/h2\u003e \u003cp\u003eWe would like to express our heartfelt gratitude to the Institute of Biotechnology at Ankara University for their generous support and for providing the essential equipment and materials for our study. Additionally, we gratefully acknowledge the financial support of the Ankara University Scientific Research Projects Coordination Unit (BAP) through project number FDK-2023-2911.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKaper JB, Nataro JP, Mobley HLT. Pathogenic Escherichia coli. Nat Rev Microbiol. 2004 Feb;2(2):123\u0026ndash;40.\u003c/li\u003e\n\u003cli\u003eStoodley P, Sauer K, Davies DG, Costerton JW. Biofilms as complex differentiated communities. Annu Rev Microbiol. 2002;56:187\u0026ndash;209.\u003c/li\u003e\n\u003cli\u003eZafer MM, Mohamed GA, Ibrahim SRM, Ghosh S, Bornman C, Elfaky MA. Biofilm-mediated infections by multidrug-resistant microbes: a comprehensive exploration and forward perspectives. Arch Microbiol. 2024 Feb 14;206(3):101.\u003c/li\u003e\n\u003cli\u003eJuszczuk-Kubiak E. Molecular Aspects of the Functioning of Pathogenic Bacteria Biofilm Based on Quorum Sensing (QS) Signal-Response System and Innovative Non-Antibiotic Strategies for Their Elimination. Int J Mol Sci. 2024 Feb 24;25(5):2655.\u003c/li\u003e\n\u003cli\u003eMayer C, Borges A, Flament-Simon SC, Sim\u0026otilde;es M. Quorum sensing architecture network in Escherichia coli virulence and pathogenesis. FEMS Microbiol Rev. 2023 July 5;47(4):fuad031.\u003c/li\u003e\n\u003cli\u003eFan Q, He Q, Zhang T, Song W, Sheng Q, Yuan Y, et al. Antibiofilm potential of lactobionic acid against Salmonella Typhimurium. LWT. 2022 June 1;162:113461.\u003c/li\u003e\n\u003cli\u003eKang S, Kong F, Shi X, Han H, Li M, Guan B, et al. Antibacterial activity and mechanism of lactobionic acid against Pseudomonas fluorescens and Methicillin-resistant Staphylococcus aureus and its application on whole milk. Food Control. 2020 Feb 1;108:106876.\u003c/li\u003e\n\u003cli\u003eKhwaza V, Aderibigbe BA. Antibacterial Activity of Selected Essential Oil Components and Their Derivatives: A Review. Antibiot Basel Switz. 2025 Jan 10;14(1):68.\u003c/li\u003e\n\u003cli\u003eStepanović S, Vuković D, Hola V, Di Bonaventura G, Djukić S, Cirković I, et al. Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS Acta Pathol Microbiol Immunol Scand. 2007 Aug;115(8):891\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eDoern CD. When does 2 plus 2 equal 5. A review of antimicrobial synergy testing. J Clin Microbiol. 2014 Dec;52(12):4124\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eHan X, Bai H, Tu J, Yang L, Xu D, Wang S, et al. Deletion of luxS further attenuates the virulence of the avian pathogenic Escherichia coli aroA mutant. Microb Pathog. 2015 Nov 1;88:39\u0026ndash;47.\u003c/li\u003e\n\u003cli\u003eWasfi R, Elkhatib WF, Khairalla AS. Effects of Selected Egyptian Honeys on the Cellular Ultrastructure and the Gene Expression Profile of Escherichia coli. PLOS ONE. 2016 Mar 8;11(3):e0150984.\u003c/li\u003e\n\u003cli\u003eDong T, Schellhorn HE. Global effect of RpoS on gene expression in pathogenic Escherichia coli O157:H7 strain EDL933. BMC Genomics. 2009 Aug 3;10(1):349.\u003c/li\u003e\n\u003cli\u003eAlSheikh HMA, Sultan I, Kumar V, Rather IA, Al-Sheikh H, Tasleem Jan A, et al. Plant-Based Phytochemicals as Possible Alternative to Antibiotics in Combating Bacterial Drug Resistance. Antibiot Basel Switz. 2020 Aug 4;9(8):480.\u003c/li\u003e\n\u003cli\u003eZhai X, Wu G, Tao X, Yang S, Lv L, Zhu Y, et al. Success stories of natural product-derived compounds from plants as multidrug resistance modulators in microorganisms. RSC Adv. 13(12):7798\u0026ndash;817.\u003c/li\u003e\n\u003cli\u003eWoo S, Marquez L, Crandall WJ, Risener CJ, Quave CL. Recent advances in the discovery of plant-derived antimicrobial natural products to combat antimicrobial resistant pathogens: insights from 2018-2022. Nat Prod Rep. 2023 July 19;40(7):1271\u0026ndash;90.\u003c/li\u003e\n\u003cli\u003eK\u0026ouml;se E, Koyuncu Ozyurt O. In vitro Evaluation of Carvacrol and Colistin Combination Against Colistin Resistant Acinetobacter baumanni Strains. T\u0026uuml;rk Mikrobiyoloji Cemiy Derg. 2019 Jan 1;\u003c/li\u003e\n\u003cli\u003eFan Q, Yuan Y, Zhang T, Song W, Sheng Q, Yue T. Inhibitory effects of lactobionic acid on Vibrio parahaemolyticus planktonic cells and biofilms. Food Microbiol. 2022 May;103:103963.\u003c/li\u003e\n\u003cli\u003ePeng Q, Tang X, Dong W, Zhi Z, Zhong T, Lin S, et al. Carvacrol inhibits bacterial polysaccharide intracellular adhesin synthesis and biofilm formation of mucoid Staphylococcus aureus: an in vitro and in vivo study. RSC Adv. 2023 Sept 26;13(41):28743\u0026ndash;52.\u003c/li\u003e\n\u003cli\u003eKhan I, Bahuguna A, Kumar P, Bajpai VK, Kang SC. Antimicrobial Potential of Carvacrol against Uropathogenic Escherichia coli via Membrane Disruption, Depolarization, and Reactive Oxygen Species Generation. Front Microbiol. 2017 Dec 6;8:2421.\u003c/li\u003e\n\u003cli\u003eBoyer E, Gal\u0026aacute;n-Rela\u0026ntilde;o \u0026Aacute;, Romero-Salmoral A, Barraza P, G\u0026oacute;mez-Gasc\u0026oacute;n L, Tarradas C, et al. Post-Antibiotic and Post-Antibiotic Sub-Minimum Inhibitory Concentration Effects of Carvacrol against Salmonella Typhimurium. Anim Open Access J MDPI. 2024 Sept 11;14(18):2631.\u003c/li\u003e\n\u003cli\u003eChen H, Zhong Q. Lactobionic acid enhances the synergistic effect of nisin and thymol against Listeria monocytogenes Scott A in tryptic soy broth and milk. Int J Food Microbiol. 2017 Nov 2;260:36\u0026ndash;41.\u003c/li\u003e\n\u003cli\u003eAshrafudoulla Md, Rahaman Mizan MdF, Park SH, Ha SD. Antibiofilm activity of carvacrol against Listeria monocytogenes and Pseudomonas aeruginosa biofilm on MBECTM biofilm device and polypropylene surface. LWT. 2021 July 1;147:111575.\u003c/li\u003e\n\u003cli\u003eBonetti A, Tugnoli B, Rossi B, Giovagnoni G, Piva A, Grilli E. Nature-Identical Compounds and Organic Acids Reduce E. coli K88 Growth and Virulence Gene Expression In Vitro. Toxins. 2020 July 23;12(8):468.\u003c/li\u003e\n\u003cli\u003eWang Y, Zhang Y, Song X, Fang C, Xing R, Liu L, et al. 1,8-Cineole inhibits biofilm formation and bacterial pathogenicity by suppressing luxS gene expression in Escherichia coli. Front Pharmacol. 2022 Oct 14;13:988245.\u003c/li\u003e\n\u003cli\u003eWang Y, Feng L, Lu H, Zhu J, Kumar V, Liu X. Transcriptomic analysis of the food spoilers Pseudomonas fluorescens reveals the antibiofilm of carvacrol by interference with intracellular signaling processes. Food Control. 2021 Sept 1;127:108115.\u003c/li\u003e\n\u003cli\u003eBurt SA, Ojo-Fakunle VTA, Woertman J, Veldhuizen EJA. The Natural Antimicrobial Carvacrol Inhibits Quorum Sensing in Chromobacterium violaceum and Reduces Bacterial Biofilm Formation at Sub-Lethal Concentrations. PLOS ONE. 2014 Apr 1;9(4):e93414.\u003c/li\u003e\n\u003cli\u003eMith H, Clinquart A, Zhiri A, Daube G, Delcenserie V. The impact of oregano (Origanum heracleoticum) essential oil and carvacrol on virulence gene transcription by Escherichia coli O157:H7. FEMS Microbiol Lett. 2015 Jan;362(1):1\u0026ndash;7.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Escherichia coli, Biofilms, Multidrug-resistant, Carvacrol, Lactobionic acid, Synergism","lastPublishedDoi":"10.21203/rs.3.rs-8668470/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8668470/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e The proliferation of multidrug-resistant (MDR) \u003cem\u003eEscherichia coli \u003c/em\u003erepresents a critical global health challenge, driven primarily by the bacterium's robust biofilm-forming capacity, which facilitates antimicrobial tolerance and infection persistence. This study aimed to investigate the individual and synergistic antibiofilm and antivirulence activities of lactobionic acid (LBA) and carvacrol (CAR) against MDR \u003cem\u003eE. coli\u003c/em\u003e clinical isolates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods and Results:\u003c/strong\u003e Biofilm formation was characterized in 51 clinical isolates, including the reference strain \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922. The antimicrobial efficacy of LBA and CAR was determined via Minimum Inhibitory Concentration (MIC) and Minimum Bactericidal Concentration (MBC) assays. For 43 isolates identified as strong or moderate biofilm producers, the Minimum Biofilm Eradication Concentration (MBEC) was established. Synergistic effects were evaluated using the checkerboard method. Furthermore, RT-qPCR was employed to quantify the expression of \u003cem\u003eluxS, csgA, pfs, \u003c/em\u003eand\u003cem\u003e rpoS\u003c/em\u003e genes critical to quorum sensing, adhesion, and stress response. MIC \u0026nbsp;values for CAR and LBA ranged from 256-4096 µg/mL and 2048-16,384 µg/mL, \u0026nbsp;respectively, with MBC/MIC ratios ≤ 4, indicating potent bactericidal \u0026nbsp;activity. Individually, CAR and LBA inhibited biofilm formation by 24.12% and \u0026nbsp;57.7%, respectively; however, their combination achieved up to 87.7% \u0026nbsp;inhibition in strong biofilm-formers. Checkerboard assays demonstrated synergy \u0026nbsp;(FICI ≤ 0.5) in 85% of the tested isolates, resulting in a 32-fold reduction \u0026nbsp;in the MIC. LBA was found to be more effective than CAR for the eradication of \u0026nbsp;biofilm structures. Molecular analysis revealed a significant downregulation \u0026nbsp;of all target genes, with the combined treatment resulting in a 10-fold \u0026nbsp;reduction in \u003cem\u003ecsgA \u003c/em\u003eexpression.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e These results demonstrate that the combination of LBA and CAR effectively suppresses the growth, biofilm maturity, and virulence of MDR \u003cem\u003eE. coli\u003c/em\u003e. This synergistic approach represents a promising alternative therapeutic strategy for managing persistent infections caused by multidrug-resistant pathogens.\u003c/p\u003e","manuscriptTitle":"Investigation of Antimicrobial and Antivirulence Effects of Lactobionic Acid and Carvacrol, Individually and in Combination, Against Escherichia coli Isolates","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-29 18:05:41","doi":"10.21203/rs.3.rs-8668470/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-25T13:52:07+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-20T19:50:00+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"253868148100305422307104449845983021628","date":"2026-02-10T03:08:32+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-27T17:01:31+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-24T03:17:55+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-24T03:16:39+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Biology Reports","date":"2026-01-22T09:55:15+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-biology-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mole","sideBox":"Learn more about [Molecular Biology Reports](https://www.springer.com/journal/11033)","snPcode":"11033","submissionUrl":"https://submission.nature.com/new-submission/11033/3","title":"Molecular Biology Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"72bc1bdb-6b65-46e5-9138-80752f3d2e76","owner":[],"postedDate":"January 29th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-04-20T16:02:53+00:00","versionOfRecord":{"articleIdentity":"rs-8668470","link":"https://doi.org/10.1007/s11033-026-11808-9","journal":{"identity":"molecular-biology-reports","isVorOnly":false,"title":"Molecular Biology Reports"},"publishedOn":"2026-04-17 15:58:03","publishedOnDateReadable":"April 17th, 2026"},"versionCreatedAt":"2026-01-29 18:05:41","video":"","vorDoi":"10.1007/s11033-026-11808-9","vorDoiUrl":"https://doi.org/10.1007/s11033-026-11808-9","workflowStages":[]},"version":"v1","identity":"rs-8668470","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8668470","identity":"rs-8668470","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}