Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans

preprint OA: closed
📄 Open PDF Full text JSON View at publisher

Abstract

CRISPR/Cas9 genome editing has become an important and routine method in C. elegans research to generate new mutants and endogenously tag genes. One complication of CRISPR experiments is that the efficiency of single-guide RNA sequences can vary dramatically. One solution to this problem is to create an intermediate entry strain using the efficient and well-characterised dpy-10 guide RNA sequence. This “d10 entry strain” can then be used to generate your knock-in of interest. However, the dpy-10 sequence is not always suitable when creating an entry strain. For example, if your gene of interest is closely linked to dpy-10 on LGII or if you want to use the dpy-10 as a co-CRISPR marker for the creation of the entry strain then you can not use the dpy-10 sequence. This publication reports a synthetic guide sequence, GCTATCAACTATCCATATCG, that is not present in the C. elegans genome and can be used to create entry strains. This guide sequence is demonstrated to be relatively robust with a knock-in efficiency that varies from 1-11%. While this is lower than the efficiency observed with d10 entry strains, it is still sufficient for most applications. This guide sequence can be added to the C. elegans CRISPR toolkit and is particularly useful for generating entry strains where the standard dpy-10 guide sequence is not suitable.
Full text 25,242 characters · extracted from preprint-html · click to expand
Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans View ORCID Profile Karen I. Lange doi: https://doi.org/10.1101/2025.06.16.659939 Karen I. Lange 1 School of Biomolecular and Biomedical Science, University College Dublin , Dublin, Ireland 2 UCD Conway Institute of Biomolecular and Biomedical Research , Dublin, Ireland Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Karen I. Lange For correspondence: karen.lange{at}ucd.ie Abstract Full Text Info/History Metrics Preview PDF Abstract CRISPR/Cas9 genome editing has become an important and routine method in C. elegans research to generate new mutants and endogenously tag genes. One complication of CRISPR experiments is that the efficiency of single-guide RNA sequences can vary dramatically. One solution to this problem is to create an intermediate entry strain using the efficient and well-characterised dpy-10 guide RNA sequence. This “d10 entry strain” can then be used to generate your knock-in of interest. However, the dpy-10 sequence is not always suitable when creating an entry strain. For example, if your gene of interest is closely linked to dpy-10 on LGII or if you want to use the dpy-10 as a co-CRISPR marker for the creation of the entry strain then you can not use the dpy-10 sequence. This publication reports a synthetic guide sequence, GCTATCAACTATCCATATCG, that is not present in the C. elegans genome and can be used to create entry strains. This guide sequence is demonstrated to be relatively robust with a knock-in efficiency that varies from 1-11%. While this is lower than the efficiency observed with d10 entry strains, it is still sufficient for most applications. This guide sequence can be added to the C. elegans CRISPR toolkit and is particularly useful for generating entry strains where the standard dpy-10 guide sequence is not suitable. Description Over the last decade, CRISPR/Cas9 genome editing has become an important and routine method in C. elegans research ( Kim et al., 2022 ). There are many applications for genome editing including engineering specific mutations and endogenously tagging genes. In C. elegans , a co-CRISPR strategy using dominant phenotypic markers ( Arribere et al., 2014 ) has been a very successful method to facilitate reproducible and reliable genome editing. The most widely used co-CRISPR gene is dpy-10; a specific dpy-10 missense mutation, Arg92Cys, exhibits a dominant roller (Rol) phenotype while imprecise edits cause a recessive dumpy (Dpy) phenotype. Cas9 cutting of the dpy-10 guide sequence is very efficient with homozygous Dpy or DpyRol worms frequently observed in the F1 generation of CRISPR edited worms ( Arribere et al., 2014 ). One difficulty in designing new CRISPR experiments is that there is no method to accurately predict the efficiency of a guide RNA a priori . It has previously been described that you can take advantage of the efficient dpy-10 guide sequence to create an entry strain for your gene of interest to facilitate genome editing with a single efficient guide RNA ( El Mouridi et al., 2017 ). You can create a “d10 entry” strain by inserting dpy-10 guide sequence at your region of interest and then use this strain in a second round of CRISPR genome editing to reliably introduce your desired edits ( El Mouridi et al., 2017 ). There are many advantages to this d10 entry strain approach including increasing the reliability of low efficiency knock-in edits, easily editing the same gene multiple times, and the ability to engineer scarless edits. This method has proven to be effective as evidenced by the many publications that cite this strategy ( Dietz et al., 2021 ; Lynch et al., 2022 ; Placentino et al., 2021 ; Schreier et al., 2022 ; Silva-García et al., 2019 ; Vigne et al., 2021 ). There are several situations where a d10 entry strain is not possible such as if your gene of interest is closely linked to dpy-10 on chromosome II or if you want to use the efficient dpy-10 co-CRISPR marker when you generate the entry strain. This publication reports an alternative guide sequence that can be used to generate reliable entry strains. I wanted to knock-in mNeonGreen(mNG) at the N-terminus of cep-290 and the closest adjacent PAM was 25 nucleotides from the start codon. After screening 4520 co-CRISPR positive F1 and not isolating the desired knock-in, I decided to attempt the “d10 entry” strain approach ( El Mouridi et al., 2017 ). I designed an ssODN repair template that included a 25bp deletion and insertion of the d10 guide sequence on the antisense strand directly after the start codon ( Figure 1A ). The repair template also included a mutation in a nearby EcoRI cut site to facilitate detection of the edit. I screened 124 unc-58 co-CRISPR positive F1 for the loss of the EcoRI site and identified one potential edit. This allele w as isolated named cep-290(oq120) . It was sequenced revealing that cep-290(oq120) differed significantly from the original repair template; the d10 sequence was partially inserted and there was no adjacent PAM ( Figure 1A ). I observed that a novel PAM site was unexpectedly generated in the cep-290(oq120) allele so it could potentially function as an entry strain. This new PAM has a guide sequence, GCTATCAACTATCCATATCG, that is a hybrid of the cep-290 and the dpy-10 sequences so I refer to it as a “synthetic guide”. I reasoned that this sequence may have high on-target efficiency because it exhibits some of the qualities that have been previously reported in efficient Cas9 guide sequences including a high GC content (40%), multiple CA or AC dinucleotides, and a G in the 20 position ( Doench et al., 2014 ; Wong et al., 2015 ). To check for off target sites in the C. elegans genome, I employed the CRISPR-Cas9 guide RNA design checker that is available on the Integrated DNA Technologies website. All identified off targets have at least 4 mismatches ( Figure 1B ). By targeting the synthetic guide sequence in the cep-290(oq120) entry strain I was able to efficiently generate the mNG:: cep-290 strain by screening only 184 co-CRISPR positive F1s and isolating two knock-in lines. Download figure Open in new tab Figure 1. Synthetic guide sequence generated when attempting to generate a d10 entry strain at the 5’ end of cep-290 . A) DNA sequences of wild-type cep-290 , the repair template for the designed “d10 entry” allele, and the actual allele isolated. The repair template (ssODN) was designed to introduce a 25 bp deletion and insertion of the d10 guide sequence directly after the start codon. The cep-290(oq120) allele (chromatogram shown) was detected and isolated due to the missense mutation that disrupts an EroRI site (red), however the sequence was not consistent with the engineered entry strain. A new guide with PAM (highlighted in purple) was generated in this allele. This sequence has partial homology with cep-290 and dpy-10 and we have termed it a synthetic guide sequence. Relevant guide sequences are bolded and PAMs are underlined. B) Predicted off target effects of the synthetic guide sequence identified with the CRISPR-Cas9 guide RNA design checker available on the Integrated DNA Technologies website. All identified off targets have at least 4 mismatches. Mismatches are red. Insertions are highlighted in yellow. C) Insertion of the synthetic guide sequence can be detected efficiently by a 2 primer PCR reaction where one primer is gene specific and the other binds to the synthetic guide sequence. A product will only be amplified if the synthetic guide sequence has been inserted in the genome. A sample gel is shown. D) Knock-in efficiency using this synthetic guide sequence at various loci in the C. elegans genome ranges from approximately 1-11%. Efficiency was calculated by taking the number of PCR positive F1 pools and dividing it by the total number of F1 that were screened. I have since used this synthetic guide sequence to make multiple entry strains and found it to be reliable and efficient. Insertion of the entry strain can be easily detected in F1 progeny using a 2 primer PCR reaction with one gene specific primer and one primer that is complementary to the synthetic guide sequence ( Figure 1C ). The efficiency of knock-in strains generated with this guide has ranged from 1% to 10% ( Figure 1D ). This is lower than the reported efficiency of d10 entry strains which ranged from 3-19% ( El Mouridi et al., 2017 ) but is still sufficient for use in generating entry strains. Interestingly, both of these guide sequences exhibited a wide range of efficiencies when inserted at different genomic loci; this observation highlights how CRISPR efficiency can be affected by non-sequence specific factors such as chromatin state ( Horlbeck et al., 2016 ; Isaac et al., 2016 ). The synthetic guide sequence reported here can be used in any C. elegans CRISPR application where you might use an entry strain. I have found it to be particularly useful in situations where the d10 guide sequence is not suitable, such as if the gene of interest is linked to dpy-10 on chromosome II or when you want to use dpy-10 as the co-CRISPR marker while generating the entry strain. The synthetic guide sequence described here was generated by accident and not designed. It may be possible to rationally design a more efficient synthetic guide sequence, but since the sequence described here is functional it may not be worth the time and resources that would be required to attempt to improve it. In conclusion, this sequence is another useful option that can be added to the C. elegans CRISPR tool kit. Methods Nematode strains Caenorhabditis elegans strains were maintained at 20°C on NGM agar plates seeded with E. coli (OP50) using standard worm maintenance techniques ( Brenner, 1974 ; Stiernagle, 2006 ). The following worm strains were used or generated in this study: N2 wild-type, OEB931 cep-290(oq120[entry strain]) I , and OEB932 cep-290(oq121[mNeonGreen::cep-290]) I . PCR to generate mNG::cep-290 repair template mNeonGreen(mNG) is licensed by Allele Biotechnology and Pharmaceuticals ( Shaner et al., 2013 ). C. elegans codon optimised mNeonGreen ( Hostettler et al., 2017 ) was amplified from a plasmid, dg353 (a gift from D. Glauser), and a 12 amino acid flexible linker (GTGGGGSGGGGS) was added to the 3’ end of the mNG sequence as previously described ( Lange et al., 2021 ). 35 base pair homology arms were added to the mNG sequence with two rounds of high-fidelity PCR as per manufacturer’s instructions (Velocity, BIO-21098, Meridian BioScience). Generation of entry strains and mNG::cep-290 with CRISPR CRISPR experiments were performed by microinjection of the Cas9 ribonucleoprotein complex ( Paix et al., 2015 ). CRISPR reagents were purchased from IDT: Alt-R Cas9 Nuclease V3 (IDT, #1081058), Alt-R tracrRNA (IDT, #1072533), and custom synthesised gene specific Alt-R crRNA. All RNA for CRISPR experiments was reconstituted with 5 mM Tris (pH 7.5) and stored at −75°C. Single-stranded oligonucleotides (ssODN) repair templates were ordered from Sigma-Merck and reconstituted with 1 M Tris pH 7.4 and kept at −20°C. CRISPR mixes were prepared as previously described ( Lange et al., 2021 ) and incubated at 37°C for 15 min prior to microinjection into the gonads of young adult hermaphrodites. A co-CRISPR approach with dpy-10 or unc-58 was used ( Arribere et al., 2014 ); F1 progeny with the co-CRISPR marker phenotype were pooled in groups of 3-8 worms and edits were detected by PCR. The d10::cep-290 entry allele was identified by loss of an EcoRI cut site; restriction digests were performed with EcoRI-HF (R3101S, NEB) as per the manufacturer’s instructions. Subsequent entry strains were identified by using a primer that was complementary to the synthetic guide sequence. Sanger sequencing by Eurofins Genomics was used to determine the sequence of all CRISPR alleles generated. Calculating efficiency of the synthetic guide RNA sequence Knock-in efficiency was calculated by dividing the number of PCR positive F1 pools by the total number of co-CRISPR positive F1 that were screened. Reagents crRNA* cep-290: TGCAAGAATTCTTCAAGTTG Synthetic guide: GCTATCAACTATCCATATCG dpy-10: GCTACCATAGGCACCACGAG unc-58: ATCCACGCACATGGTCACTA *For convenience crRNA sequences are shown as their corresponding DNA sequences. ssODN repair templates d10::cep-290 ssODN: GCACCTTTTTACTAGCACAAATGTACTGAGACATGCCGCTCGTGGTGCCTATGGTAGCAC TTGAAGAGTTCTTGCAAAATGATGGTCCTACCGAGGAAGAAGT dpy-10 ssODN: CACTTGAACTTCAATACGGCAAGATGAGAATGACTGGAAACCGTACCGCATGCGGTGCC TATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT unc-58 ssODN: GTGGTATAAAATAGCCGAGTTAGGAAACAAATTTTTCTTTCAGGTTTTTCTGTCGTTACCAT GTGCGTGGATCTTGCGTCCACACATCTCAAGGCGTACTT Primers to generate mNG::cep-290 repair template For: GCACCTTTTTACTAGCACAAATGTACTGAGACATGGTGTCGAAGGGAGAAGAGG Rev: TCTTCCTCGGTAGGACCATCATTTTGCAAGAACTCTTCAAGTTGTGGATAGTTGAT AGCAGCTAACTGAGATCCGCCACCTCCAG Nested For: GCACCTTTTTACTAGCACAAATG Nested Rev: TCTTCCTCGGTAGGACCATC Genotyping and sequencing primers for cep-290(oq121) mNG Rev: AGGCTCCATCCTCGAATTGC For: CTGTCAGTTTCTCATGGTGC Rev: ATCCTCTGCCTCCTTGGAC Seq: TCCACCCTCCTACACACTC Synthetic guide specific primer Rev: CGATATGGATAGTTGATAGC Funding KIL is supported by a Research Ireland grant (22/PATH-3/10738). Author Contributions KIL was responsible for conceptualization, investigation, validation, visualisation, writing, and editing. Acknowledgements I would like to acknowledge Oliver Blacque for supporting this project which began when was a postdoctoral researcher in his group. The C. elegans optimised mNeonGreen plasmid was a gift from Dominique Glauser (University of Fribourg, Switzerland). Some worms were provided by the Caenorhabditis Genetics Center, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). Funder Information Declared Research Ireland , 22/PATH-3/10738 References ↵ Arribere , J. A. , Bell , R. T. , Fu , B. X. H. , Artiles , K. L. , Hartman , P. S. , & Fire , A. Z. ( 2014 ). Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans . Genetics , 198 ( 3 ), 837 – 846 . doi: 10.1534/genetics.114.169730 OpenUrl Abstract / FREE Full Text ↵ Brenner , S. ( 1974 ). The genetics of Caenorhabditis elegans . Genetics , 77 ( 1 ), 71 – 94 . https://www.ncbi.nlm.nih.gov/pubmed/4366476 OpenUrl Abstract / FREE Full Text ↵ Dietz , S. , Almeida , M. V. , Nischwitz , E. , Schreier , J. , Viceconte , N. , Fradera-Sola , A. , Renz , C. , Ceron-Noriega , A. , Ulrich , H. D. , Kappei , D. , Ketting , R. F. , & Butter , F. ( 2021 ). The double-stranded DNA-binding proteins TEBP-1 and TEBP-2 form a telomeric complex with POT-1 . Nature Communications , 12 ( 1 ), 2668 . doi: 10.1038/s41467-021-22861-2 OpenUrl CrossRef PubMed ↵ Doench , J. G. , Hartenian , E. , Graham , D. B. , Tothova , Z. , Hegde , M. , Smith , I. , Sullender , M. , Ebert , B. L. , Xavier , R. J. , & Root , D. E. ( 2014 ). Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation . Nature Biotechnology , 32 ( 12 ), 1262 – 1267 . doi: 10.1038/nbt.3026 OpenUrl CrossRef PubMed ↵ El Mouridi , S. , Lecroisey , C. , Tardy , P. , Mercier , M. , Leclercq-Blondel , A. , Zariohi , N. , & Boulin , T. ( 2017 ). Reliable CRISPR/Cas9 Genome Engineering in Caenorhabditis elegans Using a Single Efficient sgRNA and an Easily Recognizable Phenotype . G3 , 7 ( 5 ), 1429 – 1437 . doi: 10.1534/g3.117.040824 OpenUrl Abstract / FREE Full Text ↵ Horlbeck , M. A. , Witkowsky , L. B. , Guglielmi , B. , Replogle , J. M. , Gilbert , L. A. , Villalta , J. E. , Torigoe , S. E. , Tjian , R. , & Weissman , J. S. ( 2016 ). Nucleosomes impede Cas9 access to DNA in vivo and in vitro . eLife , 5 . doi: 10.7554/eLife.12677 OpenUrl CrossRef PubMed ↵ Hostettler , L. , Grundy , L. , Käser-Pébernard , S. , Wicky , C. , Schafer , W. R. , & Glauser , D. A. ( 2017 ). The Bright Fluorescent Protein mNeonGreen Facilitates Protein Expression Analysis In Vivo . G3 , 7 ( 2 ), 607 – 615 . doi: 10.1534/g3.116.038133 OpenUrl Abstract / FREE Full Text ↵ Isaac , R. S. , Jiang , F. , Doudna , J. A. , Lim , W. A. , Narlikar , G. J. , & Almeida , R. ( 2016 ). Nucleosome breathing and remodeling constrain CRISPR-Cas9 function . eLife , 5 . doi: 10.7554/eLife.13450 OpenUrl CrossRef PubMed ↵ Kim , H.-M. , Hong , Y. , & Chen , J. ( 2022 ). A decade of CRISPR-Cas genome editing in C . elegans. International Journal of Molecular Sciences , 23 ( 24 ), 15863 . doi: 10.3390/ijms232415863 OpenUrl CrossRef PubMed ↵ Lange , K. I. , Tsiropoulou , S. , Kucharska , K. , & Blacque , O. E. ( 2021 ). Interpreting the pathogenicity of Joubert Syndrome missense variants in Caenorhabditis elegans . Disease Models & Mechanisms . doi: 10.1242/dmm.046631 OpenUrl Abstract / FREE Full Text ↵ Lynch , T. R. , Xue , M. , Czerniak , C. W. , Lee , C. , & Kimble , J. ( 2022 ). Notch-dependent DNA cis-regulatory elements and their dose-dependent control of C. elegans stem cell self-renewal . Development (Cambridge, England) , 149 ( 7 ), dev200332 . doi: 10.1242/dev.200332 OpenUrl CrossRef PubMed ↵ Paix , A. , Folkmann , A. , Rasoloson , D. , & Seydoux , G. ( 2015 ). High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes . Genetics , 201 ( 1 ), 47 – 54 . doi: 10.1534/genetics.115.179382 OpenUrl Abstract / FREE Full Text ↵ Placentino , M. , de Jesus Domingues , A. M. , Schreier , J. , Dietz , S. , Hellmann , S. , de Albuquerque , B. F. , Butter , F. , & Ketting , R. F. ( 2021 ). Intrinsically disordered protein PID-2 modulates Z granules and is required for heritable piRNA-induced silencing in the Caenorhabditis elegans embryo . The EMBO Journal , 40 ( 3 ), e105280 . doi: 10.15252/embj.2020105280 OpenUrl CrossRef PubMed ↵ Schreier , J. , Dietz , S. , Boermel , M. , Oorschot , V. , Seistrup , A.-S. , de Jesus Domingues , A. M. , Bronkhorst , A. W. , Nguyen , D. A. H. , Phillis , S. , Gleason , E. J. , L’Hernault , S. W. , Phillips , C. M. , Butter , F. , & Ketting , R. F. ( 2022 ). Membrane-associated cytoplasmic granules carrying the Argonaute protein WAGO-3 enable paternal epigenetic inheritance in Caenorhabditis elegans . Nature Cell Biology , 24 ( 2 ), 217 – 229 . doi: 10.1038/s41556-021-00827-2 OpenUrl CrossRef PubMed ↵ Shaner , N. C. , Lambert , G. G. , Chammas , A. , Ni , Y. , Cranfill , P. J. , Baird , M. A. , Sell , B. R. , Allen , J. R. , Day , R. N. , Israelsson , M. , Davidson , M. W. , & Wang , J. ( 2013 ). A bright monomeric green fluorescent protein derived from Branchiostoma lanceolatum . Nature Methods , 10 ( 5 ), 407 – 409 . doi: 10.1038/nmeth.2413 OpenUrl CrossRef PubMed Web of Science ↵ Silva-García , C. G. , Lanjuin , A. , Heintz , C. , Dutta , S. , Clark , N. M. , & Mair , W. B. ( 2019 ). Single-copy knock-in loci for defined gene expression in Caenorhabditis elegans . G3 (Bethesda, Md .), 9 ( 7 ), 2195 – 2198 . doi: 10.1534/g3.119.400314 OpenUrl Abstract / FREE Full Text ↵ Stiernagle , T. ( 2006 ). Maintenance of C. elegans . WormBook: The Online Review of C. Elegans Biology , 1 – 11 . doi: 10.1895/wormbook.1.101.1 OpenUrl CrossRef PubMed ↵ Vigne , P. , Gimond , C. , Ferrari , C. , Vielle , A. , Hallin , J. , Pino-Querido , A. , El Mouridi , S. , Mignerot , L. , Frøkjær-Jensen , C. , Boulin , T. , Teotónio , H. , & Braendle , C. ( 2021 ). A single-nucleotide change underlies the genetic assimilation of a plastic trait . Science Advances , 7 ( 6 ), eabd9941 . doi: 10.1126/sciadv.abd9941 OpenUrl FREE Full Text ↵ Wong , N. , Liu , W. , & Wang , X. ( 2015 ). WU-CRISPR: characteristics of functional guide RNAs for the CRISPR/Cas9 system . Genome Biology , 16 ( 1 ), 218 . doi: 10.1186/s13059-015-0784-0 OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted June 16, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans Karen I. Lange bioRxiv 2025.06.16.659939; doi: https://doi.org/10.1101/2025.06.16.659939 Share This Article: Copy Citation Tools Synthetic guide sequence to generate CRISPR-Cas9 entry strains in C. elegans Karen I. Lange bioRxiv 2025.06.16.659939; doi: https://doi.org/10.1101/2025.06.16.659939 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetics Subject Areas All Articles Animal Behavior and Cognition (7618) Biochemistry (17635) Bioengineering (13859) Bioinformatics (41846) Biophysics (21401) Cancer Biology (18534) Cell Biology (25422) Clinical Trials (138) Developmental Biology (13352) Ecology (19860) Epidemiology (2067) Evolutionary Biology (24285) Genetics (15582) Genomics (22463) Immunology (17700) Microbiology (40298) Molecular Biology (17141) Neuroscience (88424) Paleontology (666) Pathology (2825) Pharmacology and Toxicology (4813) Physiology (7633) Plant Biology (15107) Scientific Communication and Education (2042) Synthetic Biology (4284) Systems Biology (9808) Zoology (2267)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00