Prolonged ischemia induces oxidative stress, affects extra cellular matrix gene expression and compromises the viability of cancellous bone grafts | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Prolonged ischemia induces oxidative stress, affects extra cellular matrix gene expression and compromises the viability of cancellous bone grafts Maximilian M Menger, Tina Histing, Franziska Poeske, Lina P. Schäfer, and 9 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8186169/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Despite growing insights into the pathophysiology of non-union formation, failed fracture healing remains a major complication in trauma and orthopedic surgery. The transplantation of cancellous bone grafts represents the gold standard for the treatment of atrophic non-unions and large-scaled bone defects. Depending on the type of procedure and the available personnel, the bone grafts may be exposed to a significant period of intraoperative ischemia before the transplantation to the defect site. This ischemia may have detrimental effects on the quality and functionality of the grafts. Methods Therefore, we analyzed in this study the effects of different periods of ischemia (0, 30, 60 and 90 minutes) on oxidative stress, gene expression and viability of autologous bone grafts, to determine a critical ischemia time window for cancellous bone graft transplantation. Graft samples were harvested from 24 patients undergoing revision surgery due to bone healing failure. The samples were analyzed by mRNA profiler arrays, reverse transcription polymerase chain reaction (RT-PCR) and immunohistochemistry. Results An ischemia of 60 minutes or longer induced the expression of pro-inflammatory and stress-induced genes, such as CXCL8 , JUN and DUSP1 . This was associated with early cell stress within the grafts, as indicated by the presence of hypoxia-inducible factor (HIF)-1α-positive cells and an increased number of senescent p16-positive cells. Additional immunohistochemical analyses revealed a significantly higher number of apoptotic cleaved caspase-3-positive cells at 60 and 90 minutes of ischemia, demonstrating a compromised viability of the grafts. RT-PCR analyses revealed a shift from a pro-osteogenic towards a pro-chondrogenic extracellular matrix (ECM) gene expression profile, along with evidence for potentially compromised angiogenesis and hematoma formation at the later transplantation site. Conclusion Taken together, these findings indicate that periods of ischemia of 60 minutes or longer should be avoided during cancellous bone graft transplantation to preserve graft function and regenerative capacity. autologous bone graft ischemia viability oxidative stress extracellular matrix Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Despite an increasing knowledge of the cellular and molecular mechanisms of bone regeneration, 2–10% of all fractures result in delayed healing or non-union formation [ 1 , 2 ]. Thus, non-unions remain a major burden in trauma and orthopedic surgery. For the patient, failed fracture healing results in substantial pain and an impaired function of the affected limb with a subsequent reduction in the quality of life. Moreover, a prolonged rehabilitation process as well as the loss in work force and productivity cause a significant economic burden to our society and health care system [ 3 , 4 ]. The transplantation of cancellous autologous bone grafts remains the gold standard in the treatment of atrophic non-unions and substantial bone tissue defects. Autologous bone grafts exhibit a high regenerative activity, due to their osteogenic, osteoinductive and osteoconductive properties [ 5 , 6 ]. In fact, bone grafts provide structural support, induce de novo bone formation by pro-osteogenic precursor cells, and stimulate the recruitment of mesenchymal stem cells (MSCs). Moreover, the grafts provide a connective tissue matrix serving as a scaffold for hosting cells to induce bone regeneration [ 6 – 9 ]. Typical donor sites include the iliac crest, the distal femur and the proximal tibia [ 6 ]. However, depending on the type of procedure and the available personnel, there may be a significant delay between harvesting of the cancellous bone graft and its transplantation into the bone defect. During intraoperative ex situ storage at room temperature, the supply of vital nutrients and oxygen is interrupted, resulting in tissue ischemia. This, in turn, may lead to significant tissue damage, impairing the functionality and viability of the graft [ 10 ]. Therefore, we analyzed in the present study the effects of different periods of ischemia on oxidative stress, gene expression and viability of cancellous bone grafts using mRNA profiler arrays, reverse transcription polymerase chain reaction (RT-PCR) and immunohistochemistry. By this, a critical ischemic threshold for the transplantation of autologous bone grafts may be determined. Material and methods Ethics Patients undergoing revision surgery due to delayed bone healing or non-union formation in a level 1 trauma center were included in the present study. The patients' written informed consent was obtained. The analyses of the patients' specimens and blood samples from healthy volunteers were carried out in accordance with the corresponding ethics vote (240/2022BO2 and 844/2020BO2, respectively) of the local Ethics Committee of the Eberhard-Karls-University, Tuebingen, Germany. Graft retrieval and experimental protocol Small tissue samples of autologous bone grafts (1–2 cm 3 ) were retrieved from patients undergoing revision surgery due to delayed bone healing or non-union formation (total number of grafts: N = 24). The samples were either obtained from the iliac crest or by a reamer-irrigator-aspiration (RIA) procedure of long tubular bones. The procedure of harvesting the autologous bone grafts took approximately 10 to 15 minutes. Subsequently, the grafts were stored for 0, 30, 60 and 90 minutes in sterile Ringer’s solution at room temperature and then processed for further analyses. These included cryopreservation in trifast for total mRNA extraction and cDNA synthesis for RT 2 profiler arrays and RT-PCR, as well as formalin fixation, paraffin embedding, and tissue sectioning for immunohistochemistry (Fig. 1 ). RT² Profiler™ PCR array human osteogenesis and oxidative stress Total mRNA was isolated by phenol-chloroform extraction with following purification using the RNeasy Mini Kit (#74104, Qiagen, Hilden, Germany). Total mRNA content was quantified photometrically. After confirming the mRNA integrity by agarose gel electrophoresis, the RT² First Strand Kit was used to transcribe pooled mRNAs (equal ratios of N = 6 donors) into cDNA (#330404, Qiagen). Uniform cDNA synthesis was confirmed by 18s RT-PCR before performing the RT² Profiler™ PCR arrays Human Nitric Oxide Signaling Pathway (#330231, GeneGlobe-ID PAHS-062ZC, Qiagen) and Human Osteogenesis (#330231, GeneGlobe-ID PAHS-026ZC, Qiagen). For this purpose,1 µg of the cDNA pool mixed with the RT² SYBR Green ROX qPCR Mastermix (#330523, Qiagen) were applied to each array plate. The sealed plates were run in the StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) with the protocol provided by Qiagen. After confirming the specificity of the qPCR by melting curve analysis, the obtained data were analyzed using the online tool from GeneGlobe (https://geneglobe.qiagen.com/us/analyze). Relative expression changes were used for a gene set enrichment analysis (GSEA – Panther Pathway) using the online platform https://www.webgestalt.org/#. The heat map, the gene clustering and the chord diagrams were generated with the help of the online platform https://bioinformatics.com.cn/en. RT-PCR The individual mRNAs were converted into cDNA using the first strand cDNA synthesis kit (ThermoFisher Scientific, Waltham, MA, USA) according to the manufacturers’ instructions (N = 10). RT-PCR was carried out in duplicates (n = 2) with the 2x Red Taq Mastermix (Biozym, Oldendorf, Germany). Optimized PCR conditions for each primer set are given in Table 1 . PCR products were visualized by Ethidiumbromid (EthBr) following gel electrophoresis on a 2% agarose gel. Table 1 List of primers, their sequences, and the corresponding PCR conditions. Primers were designed with the help of primer blast with the respective gene bank accession number listed in the table. Target Gene Bank Accession Number Sequence Forward Primer Sequence Reverse Primer Ta [°C] # of Cycles Amplicon Size [bp] 18S NR_003286 GGACAGGATTGACAGATTGAT AGTCTCGTTCGTTATCGGAAT 56 25 111 CXCL8 (Interleukin-8) NM_000584.3 TAGCAAAATTGAGGCCAAGG AAACCAAGGCACAGTGGAAC 60 40 227 DUSP1 NM_004417.4 CTGTCAACGTGCGCTTCAG GAAAACGCTTCGTATCCTCCTTTG 63 40 258 JUN NM_002228.4 GTGCCGAAAAAGGAAGCTGG CTGCGTTAGCATGAGTTGGC 63 35 175 COL1A1 NM_000088.3 CAGCCGCTTCACCTACAGC TTTTGTATTCAATCACTGTCTTGCC 56 40 83 COL1A2 NM_000089.4 GGCCCTCAAGGTTTCCAAGG CACCCTGTGGTCCAACAACTC 60 35 166 COL2A1 NM_001844.4 TGGATGCCACACTCAAGTCC GCTGCTCCACCAGTTCTTCT 63 40 254 COL10A1 NM_000493.3 AAACCTGGACAACAGGGACC CGACCAGGAGCACCATATCC 63 40 125 BGN NM_001711.5 CGCCTCGTGTCTCTGCTGGC TGGCTGAAGGAACAGCTGAG 58 40 194 FBLN1 NM_006487.3 GAACGCGCTGTGTTGATGTG ATCCTGCTGATGCCGTCAAA 63 40 136 FBLN2 NM_001004019.2 GCCCCGCGGGTCTTAC CGCCTCCTCAATGCAGTTCT 63 40 193 COMP NM_000095.3 CCCAAGTGGGCTACATCAGG GGTGTCATTGCAGCGGTAA 60 35 164 COL15A1 NM_001855.5 CGCCGCCTTTGTTCCCTG TGTTCCTCCTTGGTGCCATC 60 40 147 Immunohistochemistry For immunohistochemical analyses of hypoxia-inducible factor (HIF)-1α and cleaved caspase-3 expression, specimens were fixed in paraformaldehyde (N = 8) and embedded in paraffin. Sections were cut and stained with the corresponding primary (HIF-1α: 1:50; Abcam, Cambridge, UK and caspase-3: 1:100; Cell Signaling Technology, Danvers, Massachusetts, USA) and corresponding secondary antibodies. For quantification, positive cells were counted automatically by the QuPath software v.0.5.1 in 3–6 high power fields (400x magnification) [ 11 ]. For immunohistochemical analyses of Ki67 and p16 expression additional specimens were fixed in paraformaldehyde (N = 6). Subsequently, decalcification was performed in ethylenediaminetetraacetic acid (EDTA) for preservation of the tissue and staining characteristics [ 12 ]. After decalcification, the specimens were embedded in paraffin. Immunohistochemistry was done according to standard protocols as previously described [ 13 ] on a BenchMark Ultra Plus Autostainer (Roche, Oro Valley, Arizona, USA) using antibodies against p16 (E6H4, CINtec, Roche, Oro Valley, Arizona, USA) and Ki67 (Mouse anti-Ki-67, Zytomed Systems, Bargteheide, Germany). For quantification of p16-positive cells, 3 high power fields (400x magnification, 0,26 mm 2 ) were examined and positive osteoblasts and osteocytes were counted. To assess the Ki67-index, the whole slide was examined, and positive osteoblasts and osteocytes were compared to the number of all osteoblasts/osteocytes. Blood coagulation analysis For the analysis of the effects of cartilage oligomeric matrix protein (COMP) on blood coagulation, blood from human donors (N = 6) was collected in Na-citrate monovettes and centrifuged for 10 minutes at 2,500g to obtain platelet free plasma. Subsequently, the prothrombin time (PT) and the activated partial thromboplastin time (aPTT) were measured using a Start4 hemostasis analyzer (Diagnostica Stago) according to the manufacturer’s protocol upon a 10 minutes pretreatment with 5 µg/mL recombinant human COMP (#PDEH100417, Elabscience, Houston Texas, USA) or the corresponding solvent control (phosphate-buffered saline (PBS)). Statistical analysis Results are presented as box plots with median, interquartile range, extrema and individual data points from both biological (N) and technical (n) replicated to show the stability of the data for RT-PCR and blood coagulation analysis. For the immunohistochemical analysis the mean of each patient sample is given. Statistical analyses were performed using the GraphPad Prism Software version 8 (GraphPad, El Camino Real, USA) comparing the total number of replicates (N*n) for RT-PCR and blood coagulation analysis, and the mean of each patient (N) for immunohistochemical analysis. The non-parametric Wilcoxon test was used to compare early time points of ischemia (0 and 30 minutes) versus late time points of ischemia (60 and 90 minutes). Moreover, data were compared by the non-parametric Friedman test for paired data (changes over time for each donor sample) and Dunn’s multiple comparisons post hoc test. Data of the coagulation analysis were compared by the Mann Whitney test. A p-value below 0.05 was considered statistically significant. Results Patients’ characteristics The age of the included patients ranged from 19 to 79 years, with a median age of 52 years. The body mass index (BMI) ranged from 18.3 to 39.6 kg/m², with a median of 26.89 kg/m². Of the 24 patients, 10 patients were female (41.2%) and 14 male (58.8%) (Figs. 2 a-c). Profiler arrays for oxidative stress and osteogenesis The RT 2 profiler arrays revealed distinct changes in gene expression, as early as 30 minutes after the harvesting of the autologous bone grafts (Figs. 3 a and b). Genes could be clustered into three main groups based on the expression changes (Fig. 3 c). A Gene Set Enrichment Analysis (GSEA) with the Panther signaling database used as reference revealed that most regulated genes are involved in integrin, transforming growth factor (TGF)-β, Wnt, angiogenesis, and inflammation signaling via cytokines and chemokines (Fig. 3 d). Already at the 30 minutes time point, alterations affecting integrin signaling and also genes of the extracellular matrix (ECM), e.g. , COL1A1 , COL1A2 , COL2A1 , COL10A1 , or fibronectin (FN)1 , were strongly upregulated, while genes involved in TGF-β and Wnt signaling were moderately upregulated. In contrast, the effects on gene expression involved in cytokine- and chemokine-mediated inflammation increased over time, with upregulation of CXCL8 as key regulator gene that code for interleukin (IL)-8 transcription (Figs. 3 e-g). Inflammation and oxidative stress within cancellous bone grafts Expression changes of CXCL8 and JUN were confirmed by RT-PCR of samples from 10 individual donors. The expression of both genes was significantly upregulated after 60 and 90 minutes when compared to the early time points 0 and 30 minutes (Figs. 4 a and b). Further statistical comparison confirmed a significantly upregulated expression between freshly isolated grafts (0 minutes) and grafts exposed to 90 minutes of ischemia. Moreover, the expression of DUSP1 was strongly increased after 90 minutes (Fig. 4 c). Additional immunohistochemical analysis demonstrated that the fraction of HIF-1α-positive cells within the grafts already exceeded 50% at the early ischemic time points of 0 and 30 minutes, indicating cellular stress immediately after removal of the graft (Figs. 4 d and e). Viability of cancellous bone grafts Additional immunohistochemical analyses assessed the viability of the autologous bone grafts. These analyses showed a lower expression of proliferative Ki67-positive cells at the late time points of ischemia when compared to 0 and 30 minutes (Figs. 5 a and d). Moreover, the number of apoptotic cleaved caspase-3-positive cells was significantly increased at the late time points of ischemia (Figs. 5 b and e). Furthermore, the number of senescent p16-positive cells was significantly lower at 60 and 90 minutes after harvesting when compared to the early ischemia time points (Figs. 5 c and f). Gene expression of ECM in autologous bone grafts The analysis of ECM gene expression demonstrated only a slight decrease in the expression of the pro-osteogenic collagen COL1A1 with time after harvesting, and a significantly reduced expression of the pro-osteogenic COL1A2 at the late ischemia time points when compared to the early ischemia time points (Figs. 6 a and b). In contrast, the expression of the pro-chondrogenic collagens COL2A1 und COL10A1 was significantly increased within autologous bone grafts at 60 and 90 minutes after harvesting (Figs. 6 c and d). Additionally, the mRNA levels of FN1, fibulin (FBLN)2 and biglycan ( BGN) were significantly elevated at the late time points of ischemia when compared to 0 and 30 minutes (Figs. 6 e, f and h). In contrast, the expression of FBLN1 significantly decreased with time after harvesting (Fig. 6 g). Effects of COMP on blood coagulation Additional RT-PCR analyses of markers related to coagulation and angiogenesis revealed a higher expression of COL15A1 and COMP , at 60 and 90 minutes after harvesting, when compared to the early time points of ischemia (Figs. 7 a and b). The effects of COMP on blood coagulation were further assessed by in vitro coagulation analyses. The results revealed a significantly higher PT and aPTT in blood clots with COMP treatment when compared to controls (Figs. 7 c and d). Discussion The present study demonstrates that prolonged ischemia for at least 60 minutes induces oxidative stress, affects the ECM gene expression and reduces the viability of cancellous bone grafts. This condition is associated with a significantly upregulated gene expression of the oxidative stress markers, including CXCL8 , JUN and DUSP1 , along with an increased number of apoptotic cells. Moreover, prolonged ischemia decreased the mRNA expression of the pro-osteogenic COL1A2 , while increasing the expression of the pro-chondrogenic COL2A1 and COL10A1 . Cancellous autologous bone grafts remain the gold standard for the treatment of large bone defects and non-unions, which is due to their excellent osteogenic, osteoconductive, and osteoconductive properties. These characteristics substantially enhance bone regeneration and contribute to overcome fracture healing failure [ 14 ]. Notably, a significant period of intraoperative ischemia can occur between the harvesting of the bone grafts and their transplantation to the recipient site. There is evidence that this ischemic period may compromise the viability of autologous bone grafts and, as a result, the success of the transplantation procedure. In fact, Sun et al. [ 15 ] demonstrated in an experimental study in mice that apoptosis and necrosis significantly increases within isolated bone tissue as early as 5 minutes post-harvesting. Besides this finding, there is no knowledge about the critical threshold for ischemia in human bone tissue as well as on the molecular basis by which ischemia induces damage to the bone graft. The results of our RT-PCR analysis revealed a significant upregulation of the pro-inflammatory and oxidative stress markers CXCL8 , JUN and DUSP1 after prolonged ischemia. CXCL8 represents a prototypical chemokine, which belongs to the CXC-family. It induces the recruitment and activation of pro-inflammatory cells such as granulocytes and macrophages to the inflammation site. CXCL8 is almost undetectable under physiological conditions, but is rapidly upregulated by pro-inflammatory cytokines such as tumor necrosis factor(TNF)-α and IL-1β [ 16 , 17 ]. CXCL8 exerts its function by interacting with specific cell surface G protein-coupled receptors (GPCR) including C-X-C motif chemokine receptor (CXCR)1 and CXCR2 [ 18 ]. Interestingly, CXCL8 expression is upregulated in organ transplantation during both hypoxia and subsequent tissue reperfusion. The infiltration of neutrophilic granulocytes induced by CXCL8 can exert tissue damage by the release of reactive oxidative species (ROS) and destructive enzymes [ 19 ]. Accordingly, several preclinical and clinical studies indicate that an upregulation of CXCL8 is associated with critical ischemia and transplantation failure. Klimiec-Moscal et al. [ 20 ] demonstrated that high CXCL8 levels within the blood plasma samples of patients suffering from ischemic stroke predict poor functional outcome. Furthermore, the CXCL8 receptor-blocker, reparixin, improved the long-term neurological recovery in a cerebral ischemia model in rats [ 21 ]. In lung transplant recipients, elevated CXCL8 levels and increased neutrophil counts have been detected in bronchoalveolar lavage (BAL) fluid from patients with bronchiolitis obliterans syndrome (BOS) and restrictive allograft syndrome (RAS), two forms of chronic rejection that represent major causes of long-term mortality after transplantation [ 19 , 22 ]. c-JUN and its related pathway, the c-Jun N-terminal kinase (JNK) pathway are activated by a variety of stimuli including oxidative stress, heat and osmotic shock as well as ischemia-reperfusion injury of brain and heart tissue [ 23 ]. Moreover, there is evidence that JNK activation plays a crucial role in both death receptor-initiated extrinsic and mitochondrial intrinsic pathways that trigger apoptosis [ 24 ]. In line with these findings, our immunohistochemical analysis demonstrated a significantly higher number of apoptotic cells after prolonged ischemia. Notably, the induction of CXCL8 and JUN was most likely caused by early hypoxia and oxidative stress within the transplants, as indicated by the substantial presence of HIF1-α positive cells at early ischemic time points. In addition, a significantly higher number of senescent p16-positive cells was observed during early compared with late time points of ischemia. Interestingly, our RT-PCR analysis also showed the significant upregulation of DUSP1 during later stages of ischemia. DUSP1 is expressed during oxidative stress and is responsible for the inhibition of mitogen-activated protein kinases (MAPKs), such as JNK by dephosphorylation during inflammation [ 25 ]. Moreover, DUSP1 has been shown to play a crucial role in the regulation of the inflammatory response of lipopolysaccharide genes, including IL-6 and IL-10 [ 26 ]. In the present study the upregulation of DUSP1 after prolonged ischemia indicates a persisting inflammatory state, which may have contributed to the increased number of apoptotic cells observed after prolonged ischemia. Additional RT-PCR analyses revealed significant alterations in the expression of ECM-related genes during the time course of ischemia. Collagens are abundant within the extracellular matrix and play a critical role in maintaining the structural integrity of the body. Type I collagen, a triple helical molecule synthesized from the two genes, COL1A1 and COL1A2 , is the most common collagen within the human body and represents the major structural protein of bone tissue, compromising for 90% of its organic matrix [ 27 ]. Notably, it is assembled as a heterotrimer composed of two proα1(I) and one proα2(I) chains, which undergo post-translational modifications such as hydroxylation and glycosylation [ 28 ]. Osteogenesis imperfecta, an inherited skeletal dysplasia characterized by bone fragility and skeletal deformities, is caused in most cases by mutations within the COL1A1 and COL1A2 genes. Accordingly, it is well established that type I collagen plays a crucial role in bone development and mineralization [ 29 ]. Moreover, Besio et al. [ 30 ] demonstrated in a transgenic osteogenesis imperfecta mouse model that mutations of COL1A2 result in a delay in fracture healing. Our analysis showed a significantly reduced expression of COL1A2 after prolonged ischemia, and a slight reduction of COL1A1 expression at 90 minutes of ischemia. On the other hand, the expression of genes of collagens predominant in cartilage tissue, such as COL2A1 and COL10A1 [ 31 ], were significantly increased at 60 and 90 minutes of ischemia. These findings indicate a reduced pro-osteogenic capacity of the bone grafts at later stages of ischemia with a shift in the ECM-related gene expression toward a pro-chondrogenic and away from a pro-osteogenic profile. Further changes of ECM-related gene expression included a significant upregulation of FN1 and BGN after prolonged ischemia. Notably, FN1 plays not only a vital role in cellular adhesion and growth [ 32 ], but is also upregulated during myocardial ischemia and ischemia-reperfusion injury due to hypoxic cell stress [ 33 ]. Thereby, FN1 induces the proliferation of progenitor cells and the migration of inflammatory cells [ 33 , 34 ]. BGN, is a ECM-derived danger associated molecular pattern (DAMP), which is proteolytically released during ischemia reperfusion injury of the kidney and heart failure in myocardial tissue [ 35 , 36 ]. Upon its release BGN coordinates the inflammatory response as high-affinity ligand of TLR2 and TLR4 in macrophages [ 37 ], regulating the production of various cytokines and immune cell recruitment [ 35 ]. Hence, the increased expression of FN1 and BGN within bone grafts during later stages of ischemia does not only reflect hypoxic cellular stress but may also contribute to the stimulation of an inflammatory response within the grafts. Additional analyses demonstrated a decreased expression of FBLN1 at later stages of ischemia, whereas the expression of FBLN2 was significantly increased. Interestingly, previous studies could demonstrate that FBLN1 is directly involved in the process of osteogenesis. Cooley et al. [ 38 ] reported that the skulls of FBLN1-deficient mice suffer from a reduced formation of both endochondral and membranous bone tissue. This was most likely due to a reduced BMP-2-mediated induction of osterix, resulting in a compromised osteoblast differentiation [ 38 ]. These findings are supported by various in vitro studies highlighting the crucial role of FBLN1 for the pro-osteogenic differentiation of MSCs. FBLN2, on the other hand, is upregulated in various organs, such as the heart, liver, and brain, where it promotes tissue fibrosis and hinders remyelination [ 39 – 41 ]. The present data indicate that FBLN2 is also involved in ischemia-induced processes within bone tissue, possibly contributing to fibrotic tissue remodeling under ischemic conditions. Interestingly, our analysis also demonstrated a significantly increased expression of COL15A1 within bone grafts exposed to prolonged ischemia. There is evidence that collagen-derived endostatins from collagens 15 and 18 inhibit endothelial cell migration and angiogenesis. Sasaki et al. [ 42 ] demonstrated in vitro that endostatins from collagens 15 and 18 inhibit angiogenesis induced by fibroblast growth factor (FGF)-2 or vascular endothelial growth factor (VEGF) in a chorioallantoic membrane model. Adequate angiogenesis and vascularization are crucial for the survival of bone grafts and the subsequent process of bone regeneration [ 43 ]. Hence, the increased expression of COL15A1 during prolonged ischemia may not only impair the pro-angiogenic capacity of the grafts, but also negatively affect graft integration and healing outcome. Since autologous bone grafts are often transplanted as smaller fragments, hematoma formation and its subsequent coagulation are crucial to keep the grafts in place within the defect site and avoid secondary dislocation. The glycoprotein COMP is not only expressed within cartilage tissue but also appears to play an essential role in the blood coagulation process. In fact, Lang et al. [ 44 ] demonstrated that COMP deficiency in mice shortens tail-bleeding and clotting time. Moreover, the authors revealed that a high concentration of exogenously purified COMP increases the PT and aPPT of platelet-free plasma from wildtype mice and humans. Apparently, COMP acts as an endogenous inhibitor of thrombin and suppresses hemostasis [ 44 ]. Interestingly, our coagulation analysis confirmed these findings using platelet free plasma of healthy human donors, with a significantly increased PT and aPPT after the application of rhCOMP in vitro . Furthermore, our RT-PCR analysis showed a higher expression of COMP at later stages of ischemia. These results indicate that a prolonged ischemia for at least 60 minutes may hamper blood coagulation and may therefore compromise graft stabilization at the transplantation site and subsequent bone regeneration. Taken together, the present study demonstrates that prolonged ischemia in bone grafts for at least 60 minutes stimulates oxidative stress and the expression of pro-inflammatory genes, reduces graft viability and induces a shift from a pro-osteogenic towards a pro-chondrogenic ECM gene expression profile. Moreover, prolonged ischemia may compromise angiogenesis and hematoma coagulation at the transplantation site. Therefore, revision surgeries involving autologous bone graft transplantation should be coordinated accordingly to avoid periods of ischemia lasting 60 minutes or longer to preserve bone graft function and regeneration capacity. Declarations Ethics approval and consent to participate All necessary declerations are listed in the manuscript. Consent for publication Not applicable Funding This research received no external funding. Authors' contributions Conceptualization: Maximilian M. Menger, Sabrina Ehnert, Steven C. Herath; Methodology: Maximilian M. Menger, Sabrina Ehnert, Steven C. Herath, Franziska Poeske, Lina P. Schäfer Konrad Steinestel, Lena Löwer-Kiem, Patrick Münzer, Oliver Borst; Formal analysis and investigation: Maximilian M. Menger, Sabrina Ehnert, J Franziska Poeske, Lina P. Schäfer, Konrad Steinestel, Lena Löwer-Kiem, Patrick Münzer, Oliver Borst; Data curation: Maximilian M. Menger, Sabrina Ehnert, Steven C. Herath, Tina Histing, Matthias W. Laschke, Benedikt J. Braun, Michael D. Menger; Writing - original draft preparation: Maximilian M. Menger; Writing - review and editing: Sabrina Ehnert, Matthias W. Laschke, Steven C. Herath, Michael D. Menger; Resources: Tina Histing and Steven C. Herath; Supervision: Sabrina Ehnert and Steven C. Herath. Acknowledgements We are grateful for the excellent technical assistance of Sandra Hans (Institute for Clinical and Experimental Surgery, Saarland University). Servier Medical Art was used to create Fig. 1, which is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0). Availability of data and material The data generated and analyzed during the current study are available from the corresponding author upon reasonable request. Competing interests The authors declare no conflicts of interest. References Einhorn TA, Gerstenfeld LC. Fracture healing: mechanisms and interventions. Nat Rev Rheumatol. 2015;11(1):45–54. Mills LA, Aitken SA, Simpson A. The risk of non-union per fracture: current myths and revised figures from a population of over 4 million adults. Acta Orthop. 2017;88(4):434–9. Victoria G, et al. Bone stimulation for fracture healing: What's all the fuss? Indian J Orthop. 2009;43(2):117–20. Hak DJ, et al. Delayed union and nonunions: epidemiology, clinical issues, and financial aspects. Injury. 2014;45(Suppl 2):S3–7. Azi ML, et al. Autologous bone graft in the treatment of post-traumatic bone defects: a systematic review and meta-analysis. BMC Musculoskelet Disord. 2016;17(1):465. Schmidt AH. Autologous bone graft: Is it still the gold standard? Injury. 2021;52(Suppl 2):S18–22. Fillingham Y, Jacobs J. Bone grafts and their substitutes. Bone Joint J, 2016. 98-B(1 Suppl A): pp. 6–9. Khan SN, et al. The biology of bone grafting. J Am Acad Orthop Surg. 2005;13(1):77–86. Kamal M, et al. Comparison of Bone Grafts From Various Donor Sites in Human Bone Specimens. J Craniofac Surg. 2018;29(6):1661–5. Eltzschig HK, Eckle T. Ischemia and reperfusion–from mechanism to translation. Nat Med. 2011;17(11):1391–401. Bankhead P, et al. QuPath: Open source software for digital pathology image analysis. Sci Rep. 2017;7(1):16878. Choube A, et al. Comparison of decalcifying agents and techniques for human dental tissues. Biotech Histochem. 2018;93(2):99–108. Steinestel K, et al. Expression of Abelson interactor 1 (Abi1) correlates with inflammation, KRAS mutation and adenomatous change during colonic carcinogenesis. PLoS ONE. 2012;7(7):e40671. Pape HC, Evans A, Kobbe P. Autologous bone graft: properties and techniques. J Orthop Trauma. 2010;24(Suppl 1):S36–40. Sun Q, et al. Improving intraoperative storage conditions for autologous bone grafts: An experimental investigation in mice. J Tissue Eng Regen Med. 2019;13(12):2169–80. Liu Q, et al. The CXCL8-CXCR1/2 pathways in cancer. Cytokine Growth Factor Rev. 2016;31:61–71. Hoffmann E, et al. Multiple control of interleukin-8 gene expression. J Leukoc Biol. 2002;72(5):847–55. Brat DJ, Bellail AC, Van Meir EG. The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 2005;7(2):122–33. Cambier S, Gouwy M, Proost P. The chemokines CXCL8 and CXCL12: molecular and functional properties, role in disease and efforts towards pharmacological intervention. Cell Mol Immunol. 2023;20(3):217–51. Klimiec-Moskal E, et al. Circulating Chemokines and Short- and Long-Term Outcomes After Ischemic Stroke. Mol Neurobiol. 2025;62(1):421–8. Villa P, et al. The interleukin-8 (IL-8/CXCL8) receptor inhibitor reparixin improves neurological deficits and reduces long-term inflammation in permanent and transient cerebral ischemia in rats. Mol Med. 2007;13(3–4):125–33. Verleden SE, et al. Differential cytokine, chemokine and growth factor expression in phenotypes of chronic lung allograft dysfunction. Transplantation. 2015;99(1):86–93. Shvedova M, et al. c-Jun N-Terminal Kinases (JNKs) in Myocardial and Cerebral Ischemia/Reperfusion Injury. Front Pharmacol. 2018;9:715. Dhanasekaran DN, Reddy EP. JNK signaling in apoptosis. Oncogene. 2008;27(48):6245–51. Liu YX, et al. DUSP1 is controlled by p53 during the cellular response to oxidative stress. Mol Cancer Res. 2008;6(4):624–33. Hammer M, et al. Dual specificity phosphatase 1 (DUSP1) regulates a subset of LPS-induced genes and protects mice from lethal endotoxin shock. J Exp Med. 2006;203(1):15–20. Selvaraj V, et al. Type 1 collagen: Synthesis, structure and key functions in bone mineralization. Differentiation. 2024;136:100757. Marini JC, Blissett AR. New genes in bone development: what's new in osteogenesis imperfecta. J Clin Endocrinol Metab. 2013;98(8):3095–103. Marom R, Rabenhorst BM, Morello R. Osteogenesis imperfecta: an update on clinical features and therapies. Eur J Endocrinol. 2020;183(4):R95–106. Besio R, et al. Early Fracture Healing is Delayed in the Col1a2(+/G610C) Osteogenesis Imperfecta Murine Model. Calcif Tissue Int. 2018;103(6):653–62. Gelse K, Poschl E, Aigner T. Collagens–structure, function, and biosynthesis. Adv Drug Deliv Rev. 2003;55(12):1531–46. Wang Y, Ni H. Fibronectin maintains the balance between hemostasis and thrombosis. Cell Mol Life Sci. 2016;73(17):3265–77. Konstandin MH, et al. Fibronectin is essential for reparative cardiac progenitor cell response after myocardial infarction. Circ Res. 2013;113(2):115–25. Chang SS, et al. Epithelial CEBPD activates fibronectin and enhances macrophage adhesion in renal ischemia-reperfusion injury. Cell Death Discov. 2024;10(1):328. Poluzzi C, et al. Biglycan evokes autophagy in macrophages via a novel CD44/Toll-like receptor 4 signaling axis in ischemia/reperfusion injury. Kidney Int. 2019;95(3):540–62. Ahmed MS, et al. Induction of myocardial biglycan in heart failure in rats–an extracellular matrix component targeted by AT(1) receptor antagonism. Cardiovasc Res. 2003;60(3):557–68. Schaefer L, et al. The matrix component biglycan is proinflammatory and signals through Toll-like receptors 4 and 2 in macrophages. J Clin Invest. 2005;115(8):2223–33. Cooley MA, et al. Fibulin-1 is required for bone formation and Bmp-2-mediated induction of Osterix. Bone. 2014;69:30–8. Khan SA, et al. Fibulin-2 is essential for angiotensin II-induced myocardial fibrosis mediated by transforming growth factor (TGF)-beta. Lab Invest. 2016;96(7):773–83. Ghorbani S et al. Fibulin-2 is an extracellular matrix inhibitor of oligodendrocytes relevant to multiple sclerosis. J Clin Invest, 2024. 134(13). Balog S, et al. Emergence of highly profibrotic and proinflammatory Lrat + Fbln2 + HSC subpopulation in alcoholic hepatitis. Hepatology. 2023;78(1):212–24. Sasaki T, et al. Endostatins derived from collagens XV and XVIII differ in structural and binding properties, tissue distribution and anti-angiogenic activity. J Mol Biol. 2000;301(5):1179–90. Menger MM, et al. Vascularization Strategies in the Prevention of Nonunion Formation. Tissue Eng Part B Rev. 2021;27(2):107–32. Liang Y, et al. Cartilage oligomeric matrix protein is a natural inhibitor of thrombin. Blood. 2015;126(7):905–14. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8186169","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":560545195,"identity":"376fd4d6-9e5e-4edc-8d1b-c23c5cbd2abb","order_by":0,"name":"Maximilian M Menger","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+UlEQVRIiWNgGAWjYJCCAwwGFjwILnsDMzFaJJC08BwgrAUIJJDZCfi16LafMTx0o0BChn92A+uGjztq5cxnvjE2/MFgk9iAQ4vZmbSEwzlAh0ncOcB2c+aZ48Yyt3OMk3kY0nBrOZB8AKyF4UYC223etmOJM6RzjA8zMBzGreX8wwawFnmQlr9tx+pnSJ4xPviD4T9uLTegthiAtDC21SRISPAYJ/AwHMCj5RnEL4Y3Ettu9rYdMJzBk1ZszGOQbIzbYTnGn3P+2NjL3Ug+duNnW528BPvhzZI/KuxkcWlBAowgNYehHAPC6mGgjnilo2AUjIJRMGIAABN7WlnfQMXfAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0002-1261-9877","institution":"Eberhard Karls Universität Tübingen: Eberhard Karls Universitat Tubingen","correspondingAuthor":true,"prefix":"","firstName":"Maximilian","middleName":"M","lastName":"Menger","suffix":""},{"id":560545196,"identity":"e982c76f-e991-4024-9274-58760976049a","order_by":1,"name":"Tina Histing","email":"","orcid":"","institution":"Eberhard-Karls-Universität Tübingen Medizinische Fakultät: Eberhard-Karls-Universitat Tubingen Medizinische Fakultat","correspondingAuthor":false,"prefix":"","firstName":"Tina","middleName":"","lastName":"Histing","suffix":""},{"id":560545197,"identity":"80ba6a31-f9b4-4f39-8ef7-cfaa2b9094c8","order_by":2,"name":"Franziska Poeske","email":"","orcid":"","institution":"Eberhard-Karls-Universität Tübingen Medizinische Fakultät: Eberhard-Karls-Universitat Tubingen Medizinische Fakultat","correspondingAuthor":false,"prefix":"","firstName":"Franziska","middleName":"","lastName":"Poeske","suffix":""},{"id":560545198,"identity":"9247856c-3122-4946-8b75-9cfa047af9b3","order_by":3,"name":"Lina P. Schäfer","email":"","orcid":"","institution":"Eberhard-Karls-Universität Tübingen Medizinische Fakultät: Eberhard-Karls-Universitat Tubingen Medizinische Fakultat","correspondingAuthor":false,"prefix":"","firstName":"Lina","middleName":"P.","lastName":"Schäfer","suffix":""},{"id":560545199,"identity":"b79a9cae-4f0b-4e6f-8a6f-338706c12c39","order_by":4,"name":"Konrad Steinestel","email":"","orcid":"","institution":"Bundeswehrkrankenhaus Ulm","correspondingAuthor":false,"prefix":"","firstName":"Konrad","middleName":"","lastName":"Steinestel","suffix":""},{"id":560545200,"identity":"92447542-1580-4d4e-aa54-368ec4536a22","order_by":5,"name":"Lena Löwer-Kiem","email":"","orcid":"","institution":"Bundeswehrkrankenhaus Ulm","correspondingAuthor":false,"prefix":"","firstName":"Lena","middleName":"","lastName":"Löwer-Kiem","suffix":""},{"id":560545201,"identity":"ed069283-e3b3-40f0-8ac5-f549a6178c3f","order_by":6,"name":"Michael D. Menger","email":"","orcid":"","institution":"Saarland University: Universitat des Saarlandes","correspondingAuthor":false,"prefix":"","firstName":"Michael","middleName":"D.","lastName":"Menger","suffix":""},{"id":560545202,"identity":"005e277d-d9bf-4bb9-90ec-78d69d130196","order_by":7,"name":"Matthias W. Laschke","email":"","orcid":"","institution":"Saarland University: Universitat des Saarlandes","correspondingAuthor":false,"prefix":"","firstName":"Matthias","middleName":"W.","lastName":"Laschke","suffix":""},{"id":560545203,"identity":"40592b5a-3911-45af-86d3-dacb18eafdf8","order_by":8,"name":"Patrick Münzer","email":"","orcid":"","institution":"Eberhard-Karls-Universität Tübingen Medizinische Fakultät: Eberhard-Karls-Universitat Tubingen Medizinische Fakultat","correspondingAuthor":false,"prefix":"","firstName":"Patrick","middleName":"","lastName":"Münzer","suffix":""},{"id":560545204,"identity":"7f8f2a9f-3215-4af5-bde6-05af1a443f06","order_by":9,"name":"Oliver Borst","email":"","orcid":"","institution":"Eberhard-Karls-Universität Tübingen Medizinische Fakultät: Eberhard-Karls-Universitat Tubingen Medizinische Fakultat","correspondingAuthor":false,"prefix":"","firstName":"Oliver","middleName":"","lastName":"Borst","suffix":""},{"id":560545205,"identity":"e721d081-b7a5-4500-8a02-272f1001d527","order_by":10,"name":"Benedikt J. Braun","email":"","orcid":"","institution":"Eberhard Karls Universität Tübingen: Eberhard Karls Universitat Tubingen","correspondingAuthor":false,"prefix":"","firstName":"Benedikt","middleName":"J.","lastName":"Braun","suffix":""},{"id":560545206,"identity":"fea2bf90-2773-4309-9edc-b895277a5f0f","order_by":11,"name":"Sabrina Ehnert","email":"","orcid":"","institution":"Eberhard-Karls-Universität Tübingen Medizinische Fakultät: Eberhard-Karls-Universitat Tubingen Medizinische Fakultat","correspondingAuthor":false,"prefix":"","firstName":"Sabrina","middleName":"","lastName":"Ehnert","suffix":""},{"id":560545207,"identity":"7757fbed-7296-4279-a10c-dd0574e8ce73","order_by":12,"name":"Steven C. Herath","email":"","orcid":"","institution":"Eberhard-Karls-Universität Tübingen Medizinische Fakultät: Eberhard-Karls-Universitat Tubingen Medizinische Fakultat","correspondingAuthor":false,"prefix":"","firstName":"Steven","middleName":"C.","lastName":"Herath","suffix":""}],"badges":[],"createdAt":"2025-11-23 14:44:56","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8186169/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8186169/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98780174,"identity":"94508ad8-c403-4727-87e1-b847ca47648c","added_by":"auto","created_at":"2025-12-22 12:31:08","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2704580,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/3053cc6fa02ac5f60a622a55.tif"},{"id":98755921,"identity":"7cb07231-e050-4094-ae68-fed719bed0f3","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2509400,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/f989d4a88cc995e8bf9da9f2.tif"},{"id":98778784,"identity":"11c34327-a57f-4f49-8a9c-f2bb63f10406","added_by":"auto","created_at":"2025-12-22 12:29:39","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7213078,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/662aaa46982bf3e7901b8a51.tif"},{"id":98755935,"identity":"97cc7a53-23d3-4956-b057-16e6733316ae","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12433114,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/26661d18d8888724c939e575.tif"},{"id":98780497,"identity":"1545b885-655f-4706-a400-c0849a4ecce5","added_by":"auto","created_at":"2025-12-22 12:31:23","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13815134,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/74ff524cd6ed4969d503a07a.tif"},{"id":98778815,"identity":"d66e4654-7ee7-4b65-a112-a871965a9929","added_by":"auto","created_at":"2025-12-22 12:29:41","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3654070,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/9e4616c9b9d7c1a9cba5475b.tif"},{"id":98755938,"identity":"3c293696-90dd-49e2-9500-5b844974be61","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2749300,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.7.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/41b1466eea12bb597e991c87.tif"},{"id":98778674,"identity":"4b647871-26c7-4096-bf49-16765b67d015","added_by":"auto","created_at":"2025-12-22 12:29:29","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17773,"visible":true,"origin":"","legend":"","description":"","filename":"jtrmJTRMD2520791.xml","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/21a593840c2a6d7ac238f1cb.xml"},{"id":98780064,"identity":"0363d85e-e900-4a08-b271-6bf05f95408b","added_by":"auto","created_at":"2025-12-22 12:31:01","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1200,"visible":true,"origin":"","legend":"","description":"","filename":"JTRMD2520791157544.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/969d2156f5854d8681dce6e5.xml"},{"id":98780033,"identity":"4e70e6de-3d60-4547-9c5e-0fec6f593131","added_by":"auto","created_at":"2025-12-22 12:30:59","extension":"xml","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":944,"visible":true,"origin":"","legend":"","description":"","filename":"JTRMD2520791Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/9fda082a6dfa7652b03d4894.xml"},{"id":98755931,"identity":"f9034edd-ef1c-4308-bc95-2ac4d3c08996","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110420,"visible":true,"origin":"","legend":"","description":"","filename":"JTRMD25207910enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/03c7873388ebe3731d01fb39.xml"},{"id":98755944,"identity":"f10a3b0b-7c27-4db6-a7b8-7533a41ccf47","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2704580,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.1.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/5a811f389633e6dbe2b11c80.tif"},{"id":98755943,"identity":"70760d45-c5a6-4052-bfce-ee7b50c3afd8","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2509400,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.2.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/0580c264630ff18f555cc67d.tif"},{"id":98777401,"identity":"afc34e21-9104-4a0e-ab27-be0c4d0d39c3","added_by":"auto","created_at":"2025-12-22 12:26:47","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7213078,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.3.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/7439d294666835b51fb2ee80.tif"},{"id":98755939,"identity":"0e3bc171-312b-437c-b6ac-59aca1b6b07d","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12433114,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.4.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/e3b0a154884bf9c03bba96b3.tif"},{"id":98755947,"identity":"c94503e4-0120-42b7-bed0-975c22e80897","added_by":"auto","created_at":"2025-12-22 09:30:20","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13815134,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.5.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/220be23a39db6b7faef9e84b.tif"},{"id":98780069,"identity":"ba254ffa-214e-4da1-8e66-af66ac07ab51","added_by":"auto","created_at":"2025-12-22 12:31:01","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3654070,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.6.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/9289895604fb70773d782cce.tif"},{"id":98755945,"identity":"be20161f-10c0-400c-acef-7255053179b0","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2749300,"visible":true,"origin":"","legend":"","description":"","filename":"Fig.7.tif","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/4177f0a79a356c6ab14cc0e5.tif"},{"id":98755941,"identity":"6eb1e2d4-ebde-488b-8418-04358a580dc7","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"xml","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":108428,"visible":true,"origin":"","legend":"","description":"","filename":"JTRMD25207910structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/8e16066b62605f69c55c1f39.xml"},{"id":98778043,"identity":"18990099-d78b-47b0-9fad-61e46b15868e","added_by":"auto","created_at":"2025-12-22 12:28:50","extension":"html","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":123104,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/149421514314b58029557602.html"},{"id":98755925,"identity":"7901425f-501f-4259-9700-899565ac5a1e","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":427837,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental protocol. Samples of autologous bone grafts were harvested in patients undergoing revision surgery due to compromised fracture healing and non-union formation. The harvesting procedure took approximately 10-15 minutes. Afterwards the sample were stored for 0,30 ,60 and 90 minutes in sterile Ringers' solution under room temperature. Subsequently, the samples were cryopreserved in Trifast. Profiler arrays for markers of oxidative stress and osteogenesis were performed, with a subsequent RT-PCR verification. Moreover, the samples were analyzed by immunohistochemistry with HIF-1α, cleaved caspase-3, Ki67 and p16 for the quantification of hypoxia, apoptosis, proliferation and senescence within the bone grafts.\u003c/p\u003e","description":"","filename":"OnlineFig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/7fb05539ae5974629ac8c3c1.png"},{"id":98778060,"identity":"9d699f28-ef24-4b4d-83fb-bfc6d7d03e49","added_by":"auto","created_at":"2025-12-22 12:28:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":182966,"visible":true,"origin":"","legend":"\u003cp\u003ePatients' characteristics\u003cstrong\u003e. (a \u003c/strong\u003eand\u003cstrong\u003eb) \u003c/strong\u003eAge and BMI of the included patients are presented as box plots with individual data points (n = 24). Dark blue circles: samples used for RT-PCR analysis; bright blue circles: samples used for array pooling and additional RT-PCR analysis; dark orange squares: immunohistochemical analysis for HIF-1α and cleaved caspase-3; bright orange squares: immunohistochemical analysis for Ki67 and p16. \u003cstrong\u003e(c) \u003c/strong\u003eMoreover, the sex of the included patients is illustrated. Dark blue columns: samples used for RT-PCR analysis; bright blue columns: samples used for array pooling and additional RT-PCR analysis; dark orange columns: immunohistochemical analysis for HIF-1α and cleaved caspase-3; bright orange columns: immunohistochemical analysis for Ki67 and p16.\u003c/p\u003e","description":"","filename":"OnlineFig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/af73b8c4a912a26161bdde32.png"},{"id":98755923,"identity":"2e5fd56a-3f9a-4e10-8cc9-aa88e6931c57","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":887960,"visible":true,"origin":"","legend":"\u003cp\u003eProfiler arrays of oxidative stress and osteogenesis.\u003cstrong\u003e (a) \u003c/strong\u003eFold changes of gene expression after 30, 60 and 90 minutes. \u003cstrong\u003e(b) \u003c/strong\u003eHeatmap of profiler arrays of oxidative stress and osteogenesis illustrating expression changes. \u003cstrong\u003e(c) \u003c/strong\u003eClustering of genes into three main groups according to expression changes. \u003cstrong\u003e(d) \u003c/strong\u003eGene Set Enrichment Analysis (GSEA) with the Panther signaling database used as reference: Most regulated genes are involved in integrin, TGF-β, Wnt, angiogenesis, and inflammation signaling via cytokines and chemokines. \u003cstrong\u003e(e-g) \u003c/strong\u003eExpression changes of different genes involving integrin, TGF-β, WNT, angiogenesis and inflammation signaling after 30 minutes (e), 60 minutes (f) and 90 minutes (g) are illustrated.\u003c/p\u003e","description":"","filename":"OnlineFig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/e93d1bc88bc2775836d73c9f.png"},{"id":98779558,"identity":"3b3fb7fa-d287-4a53-8f35-0b2fc12f54d3","added_by":"auto","created_at":"2025-12-22 12:30:27","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2667464,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of inflammation and oxidative stress in autologous bone grafts. \u003cstrong\u003e(a-c) \u003c/strong\u003eRT-PCR analyses\u003cem\u003e \u003c/em\u003eof\u003cem\u003e CXCL8 \u003c/em\u003e(a), \u003cem\u003eJUN \u003c/em\u003e(b) and \u003cem\u003eDUSP1 \u003c/em\u003e(c)\u003cem\u003e \u003c/em\u003egene expression within autologous bone grafts at 0, 30, 60 and 90 minutes of ischemia. All data were normalized as z-scores and are displayed as box plots with individual data points (N = 10, n = 2). \u003cstrong\u003e(d) \u003c/strong\u003eImmunohistochemical analysis of HIF-1α expression within autologous bone grafts at 0, 30, 60 and 90 minutes of ischemia. All data are displayed as box plots with individual data points (N = 8) \u003cstrong\u003e(e) \u003c/strong\u003eRepresentative immunohistochemical images of HIF-1α staining at 0, 30, 60 and 90 minutes of ischemia. Scale bars: 50 µm. Early (0 and 30 min) and late (60 and 90 min) time points were compared by the non-parametric Wilcoxon test. Individual time points were compared with the non-parametric Friedman test and Dunn’s multiple comparisons post hoc test. *p \u0026lt; 0.05: 0 and 30 min vs. 60 and 90 min; \u003csup\u003ea\u003c/sup\u003ep \u0026lt; 0.05 vs. 0 min.\u003c/p\u003e","description":"","filename":"OnlineFig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/b96652b753d7525362b1c850.png"},{"id":98755930,"identity":"c14aea96-1458-4475-9b67-20d24f7ece3c","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3248080,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of the viability of autologous bone grafts. \u003cstrong\u003e(a-c) \u003c/strong\u003eImmunohistochemical analysis\u003cem\u003e \u003c/em\u003eof Ki67, cleaved caspase-3 and p16 within autologous bone grafts at 0, 30, 60 and 90 minutes of ischemia. All data are displayed as box plots with individual data points (N = 6-8). \u003cstrong\u003e(d-f) \u003c/strong\u003eRepresentative immunohistochemical images of Ki67 (d) (scale bars: 20 µm), cleaved caspase-3 (e) (scale bars: 50 µm) and p16 (f) (scale bars: 20 µm) at 0, 30, 60 and 90 minutes of ischemia. Early (0 and 30 min) and late (60 and 90 min) time points were compared by the non-parametric Wilcoxon test. Individual time points were compared with the non-parametric Friedman test and Dunn’s multiple comparisons post hoc test. *p \u0026lt; 0.05: 0 and 30 min vs. 60 and 90 min; \u003csup\u003ea\u003c/sup\u003ep \u0026lt; 0.05 vs. 0 min.\u003c/p\u003e","description":"","filename":"OnlineFig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/29ce58334e969f000b66e2f6.png"},{"id":98780276,"identity":"3aa80b34-47ad-4bd3-aa9d-28761184ba10","added_by":"auto","created_at":"2025-12-22 12:31:12","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":718027,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of ECM gene expression within autologous bone grafts. \u003cstrong\u003e(a-h) \u003c/strong\u003eRT-PCR analyses\u003cem\u003e \u003c/em\u003eof\u003cem\u003e COL1A1\u003c/em\u003e (a), \u003cem\u003eCOL1A2 \u003c/em\u003e(b), \u003cem\u003eCOL2A1 \u003c/em\u003e(c), \u003cem\u003eCOL10A1 \u003c/em\u003e(d), \u003cem\u003eFN1 \u003c/em\u003e(e), \u003cem\u003eBGN \u003c/em\u003e(f), \u003cem\u003eFBLN1 \u003c/em\u003e(g) and \u003cem\u003eFBLN2 \u003c/em\u003e(h) gene expression within autologous bone grafts at 0, 30, 60 and 90 minutes of ischemia. All data were normalized as z-scores and are displayed as box plots with individual data points (N = 10, n = 2). Early (0 and 30 min) and late (60 and 90 min) time points were compared by the non-parametric Wilcoxon test. Individual time points were compared with the non-parametric Friedman test and Dunn’s multiple comparisons post hoc test. \u0026nbsp;*p \u0026lt; 0.05: 0 and 30 min vs. 60 and 90 min; \u003csup\u003ea\u003c/sup\u003ep \u0026lt; 0.05 vs. 0 min.\u003c/p\u003e","description":"","filename":"OnlineFig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/d6884d0fffa12ee21a4af277.png"},{"id":98755928,"identity":"7562d8c5-9327-4d67-8c50-e7ea976fdd38","added_by":"auto","created_at":"2025-12-22 09:30:19","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":338022,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of \u003cem\u003eCOL15A1\u003c/em\u003e and\u003cem\u003e COMP\u003c/em\u003e gene expression and coagulation analysis. \u003cstrong\u003e(a-b) \u003c/strong\u003eRT-PCR analyses\u003cem\u003e \u003c/em\u003eof\u003cem\u003e COL15A1 \u003c/em\u003e(a) and \u003cem\u003eCOMP\u003c/em\u003e (b) gene expression within autologous bone grafts at 0, 30, 60 and 90 minutes of ischemia. All data were normalized as z-scores and are displayed as box plots with individual data points (N = 10, n = 2). Early (0 and 30 min) and late (60 and 90 min) time points were compared by the non-parametric Wilcoxon test. Individual time points were compared with the non-parametric Friedman test and Dunn’s multiple comparisons post hoc test. \u003cstrong\u003e(c-d)\u003c/strong\u003e PT and aPPT of human plasma with 0 and 5 µg rhCOMP/mL. All data are displayed as box plots with individual data points (N = 6, n= 2). Individual values were compared using the Mann Whitney test. *p \u0026lt; 0.05: 0 vs. 5 µg rhCOMP/mL.\u003c/p\u003e","description":"","filename":"OnlineFig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/e7f05b6a943db0385a9911cd.png"},{"id":104403570,"identity":"f04f5dd3-fc1f-4559-8a4e-e10d1f76cd00","added_by":"auto","created_at":"2026-03-11 12:18:35","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":13321582,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8186169/v1/903f6d28-448f-4682-be70-4ef77302fdca.pdf"}],"financialInterests":"","formattedTitle":"Prolonged ischemia induces oxidative stress, affects extra cellular matrix gene expression and compromises the viability of cancellous bone grafts","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDespite an increasing knowledge of the cellular and molecular mechanisms of bone regeneration, 2\u0026ndash;10% of all fractures result in delayed healing or non-union formation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Thus, non-unions remain a major burden in trauma and orthopedic surgery. For the patient, failed fracture healing results in substantial pain and an impaired function of the affected limb with a subsequent reduction in the quality of life. Moreover, a prolonged rehabilitation process as well as the loss in work force and productivity cause a significant economic burden to our society and health care system [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe transplantation of cancellous autologous bone grafts remains the gold standard in the treatment of atrophic non-unions and substantial bone tissue defects. Autologous bone grafts exhibit a high regenerative activity, due to their osteogenic, osteoinductive and osteoconductive properties [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In fact, bone grafts provide structural support, induce \u003cem\u003ede novo\u003c/em\u003e bone formation by pro-osteogenic precursor cells, and stimulate the recruitment of mesenchymal stem cells (MSCs). Moreover, the grafts provide a connective tissue matrix serving as a scaffold for hosting cells to induce bone regeneration [\u003cspan additionalcitationids=\"CR7 CR8\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Typical donor sites include the iliac crest, the distal femur and the proximal tibia [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, depending on the type of procedure and the available personnel, there may be a significant delay between harvesting of the cancellous bone graft and its transplantation into the bone defect. During intraoperative ex situ storage at room temperature, the supply of vital nutrients and oxygen is interrupted, resulting in tissue ischemia. This, in turn, may lead to significant tissue damage, impairing the functionality and viability of the graft [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Therefore, we analyzed in the present study the effects of different periods of ischemia on oxidative stress, gene expression and viability of cancellous bone grafts using mRNA profiler arrays, reverse transcription polymerase chain reaction (RT-PCR) and immunohistochemistry. By this, a critical ischemic threshold for the transplantation of autologous bone grafts may be determined.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eEthics\u003c/h2\u003e \u003cp\u003ePatients undergoing revision surgery due to delayed bone healing or non-union formation in a level 1 trauma center were included in the present study. The patients' written informed consent was obtained. The analyses of the patients' specimens and blood samples from healthy volunteers were carried out in accordance with the corresponding ethics vote (240/2022BO2 and 844/2020BO2, respectively) of the local Ethics Committee of the Eberhard-Karls-University, Tuebingen, Germany.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGraft retrieval and experimental protocol\u003c/h3\u003e\n \u003cp\u003eSmall tissue samples of autologous bone grafts (1\u0026ndash;2 cm\u003csup\u003e3\u003c/sup\u003e) were retrieved from patients undergoing revision surgery due to delayed bone healing or non-union formation (total number of grafts: N\u0026thinsp;=\u0026thinsp;24). The samples were either obtained from the iliac crest or by a reamer-irrigator-aspiration (RIA) procedure of long tubular bones. The procedure of harvesting the autologous bone grafts took approximately 10 to 15 minutes. Subsequently, the grafts were stored for 0, 30, 60 and 90 minutes in sterile Ringer\u0026rsquo;s solution at room temperature and then processed for further analyses. These included cryopreservation in trifast for total mRNA extraction and cDNA synthesis for RT\u003csup\u003e2\u003c/sup\u003e profiler arrays and RT-PCR, as well as formalin fixation, paraffin embedding, and tissue sectioning for immunohistochemistry (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRT² Profiler™ PCR array human osteogenesis and oxidative stress\nTotal mRNA was isolated by phenol-chloroform extraction with following purification using the RNeasy Mini Kit (#74104, Qiagen, Hilden, Germany). Total mRNA content was quantified photometrically. After confirming the mRNA integrity by agarose gel electrophoresis, the RT² First Strand Kit was used to transcribe pooled mRNAs (equal ratios of N = 6 donors) into cDNA (#330404, Qiagen). Uniform cDNA synthesis was confirmed by 18s RT-PCR before performing the RT² Profiler™ PCR arrays Human Nitric Oxide Signaling Pathway (#330231, GeneGlobe-ID PAHS-062ZC, Qiagen) and Human Osteogenesis (#330231, GeneGlobe-ID PAHS-026ZC, Qiagen). For this purpose,1 µg of the cDNA pool mixed with the RT² SYBR Green ROX qPCR Mastermix (#330523, Qiagen) were applied to each array plate. The sealed plates were run in the StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) with the protocol provided by Qiagen. After confirming the specificity of the qPCR by melting curve analysis, the obtained data were analyzed using the online tool from GeneGlobe (https://geneglobe.qiagen.com/us/analyze). Relative expression changes were used for a gene set enrichment analysis (GSEA – Panther Pathway) using the online platform https://www.webgestalt.org/#. The heat map, the gene clustering and the chord diagrams were generated with the help of the online platform https://bioinformatics.com.cn/en.\u003c/p\u003e\n\u003ch3\u003eRT-PCR\u003c/h3\u003e\n\u003cp\u003eThe individual mRNAs were converted into cDNA using the first strand cDNA synthesis kit (ThermoFisher Scientific, Waltham, MA, USA) according to the manufacturers\u0026rsquo; instructions (N\u0026thinsp;=\u0026thinsp;10). RT-PCR was carried out in duplicates (n\u0026thinsp;=\u0026thinsp;2) with the 2x Red Taq Mastermix (Biozym, Oldendorf, Germany). Optimized PCR conditions for each primer set are given in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. PCR products were visualized by Ethidiumbromid (EthBr) following gel electrophoresis on a 2% agarose gel.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers, their sequences, and the corresponding PCR conditions. Primers were designed with the help of primer blast with the respective gene bank accession number listed in the table.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene Bank Accession Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence Forward Primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSequence Reverse Primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTa [\u0026deg;C]\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e# of Cycles\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAmplicon Size [bp]\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e18S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNR_003286\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGACAGGATTGACAGATTGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGTCTCGTTCGTTATCGGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e111\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCXCL8 (Interleukin-8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_000584.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGCAAAATTGAGGCCAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAACCAAGGCACAGTGGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e227\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDUSP1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_004417.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGTCAACGTGCGCTTCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGAAAACGCTTCGTATCCTCCTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e258\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eJUN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_002228.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGCCGAAAAAGGAAGCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTGCGTTAGCATGAGTTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e175\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL1A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_000088.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGCCGCTTCACCTACAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTTTGTATTCAATCACTGTCTTGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e83\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL1A2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_000089.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCCCTCAAGGTTTCCAAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACCCTGTGGTCCAACAACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e166\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL2A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001844.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGATGCCACACTCAAGTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCTGCTCCACCAGTTCTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e254\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL10A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_000493.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAACCTGGACAACAGGGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGACCAGGAGCACCATATCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e125\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBGN\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001711.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCCTCGTGTCTCTGCTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGGCTGAAGGAACAGCTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e194\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFBLN1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_006487.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAACGCGCTGTGTTGATGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eATCCTGCTGATGCCGTCAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e136\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFBLN2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001004019.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCCCCGCGGGTCTTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGCCTCCTCAATGCAGTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e63\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e193\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOMP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_000095.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCAAGTGGGCTACATCAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGTGTCATTGCAGCGGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e164\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCOL15A1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNM_001855.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCCGCCTTTGTTCCCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGTTCCTCCTTGGTGCCATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e147\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003eImmunohistochemistry\u003c/h3\u003e\n\u003cp\u003eFor immunohistochemical analyses of hypoxia-inducible factor (HIF)-1α and cleaved caspase-3 expression, specimens were fixed in paraformaldehyde (N\u0026thinsp;=\u0026thinsp;8) and embedded in paraffin. Sections were cut and stained with the corresponding primary (HIF-1α: 1:50; Abcam, Cambridge, UK and caspase-3: 1:100; Cell Signaling Technology, Danvers, Massachusetts, USA) and corresponding secondary antibodies. For quantification, positive cells were counted automatically by the QuPath software v.0.5.1 in 3\u0026ndash;6 high power fields (400x magnification) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFor immunohistochemical analyses of Ki67 and p16 expression additional specimens were fixed in paraformaldehyde (N\u0026thinsp;=\u0026thinsp;6). Subsequently, decalcification was performed in ethylenediaminetetraacetic acid (EDTA) for preservation of the tissue and staining characteristics [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. After decalcification, the specimens were embedded in paraffin. Immunohistochemistry was done according to standard protocols as previously described [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] on a BenchMark Ultra Plus Autostainer (Roche, Oro Valley, Arizona, USA) using antibodies against p16 (E6H4, CINtec, Roche, Oro Valley, Arizona, USA) and Ki67 (Mouse anti-Ki-67, Zytomed Systems, Bargteheide, Germany). For quantification of p16-positive cells, 3 high power fields (400x magnification, 0,26 mm\u003csup\u003e2\u003c/sup\u003e) were examined and positive osteoblasts and osteocytes were counted. To assess the Ki67-index, the whole slide was examined, and positive osteoblasts and osteocytes were compared to the number of all osteoblasts/osteocytes.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eBlood coagulation analysis\u003c/h2\u003e \u003cp\u003eFor the analysis of the effects of cartilage oligomeric matrix protein (COMP) on blood coagulation, blood from human donors (N\u0026thinsp;=\u0026thinsp;6) was collected in Na-citrate monovettes and centrifuged for 10 minutes at 2,500g to obtain platelet free plasma. Subsequently, the prothrombin time (PT) and the activated partial thromboplastin time (aPTT) were measured using a Start4 hemostasis analyzer (Diagnostica Stago) according to the manufacturer\u0026rsquo;s protocol upon a 10 minutes pretreatment with 5 \u0026micro;g/mL recombinant human COMP (#PDEH100417, Elabscience, Houston Texas, USA) or the corresponding solvent control (phosphate-buffered saline (PBS)).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eResults are presented as box plots with median, interquartile range, extrema and individual data points from both biological (N) and technical (n) replicated to show the stability of the data for RT-PCR and blood coagulation analysis. For the immunohistochemical analysis the mean of each patient sample is given. Statistical analyses were performed using the GraphPad Prism Software version 8 (GraphPad, El Camino Real, USA) comparing the total number of replicates (N*n) for RT-PCR and blood coagulation analysis, and the mean of each patient (N) for immunohistochemical analysis. The non-parametric Wilcoxon test was used to compare early time points of ischemia (0 and 30 minutes) versus late time points of ischemia (60 and 90 minutes). Moreover, data were compared by the non-parametric Friedman test for paired data (changes over time for each donor sample) and Dunn\u0026rsquo;s multiple comparisons post hoc test. Data of the coagulation analysis were compared by the Mann Whitney test. A p-value below 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePatients\u0026rsquo; characteristics\u003c/h2\u003e \u003cp\u003eThe age of the included patients ranged from 19 to 79 years, with a median age of 52 years. The body mass index (BMI) ranged from 18.3 to 39.6 kg/m\u0026sup2;, with a median of 26.89 kg/m\u0026sup2;. Of the 24 patients, 10 patients were female (41.2%) and 14 male (58.8%) (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-c).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eProfiler arrays for oxidative stress and osteogenesis\u003c/h2\u003e \u003cp\u003eThe RT\u003csup\u003e2\u003c/sup\u003e profiler arrays revealed distinct changes in gene expression, as early as 30 minutes after the harvesting of the autologous bone grafts (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea and b). Genes could be clustered into three main groups based on the expression changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). A Gene Set Enrichment Analysis (GSEA) with the Panther signaling database used as reference revealed that most regulated genes are involved in integrin, transforming growth factor (TGF)-β, Wnt, angiogenesis, and inflammation signaling via cytokines and chemokines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). Already at the 30 minutes time point, alterations affecting integrin signaling and also genes of the extracellular matrix (ECM), \u003cem\u003ee.g.\u003c/em\u003e, \u003cem\u003eCOL1A1\u003c/em\u003e, \u003cem\u003eCOL1A2\u003c/em\u003e, \u003cem\u003eCOL2A1\u003c/em\u003e, \u003cem\u003eCOL10A1\u003c/em\u003e, or \u003cem\u003efibronectin (FN)1\u003c/em\u003e, were strongly upregulated, while genes involved in TGF-β and Wnt signaling were moderately upregulated. In contrast, the effects on gene expression involved in cytokine- and chemokine-mediated inflammation increased over time, with upregulation of \u003cem\u003eCXCL8\u003c/em\u003e as key regulator gene that code for interleukin (IL)-8 transcription (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee-g).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eInflammation and oxidative stress within cancellous bone grafts\u003c/h2\u003e \u003cp\u003eExpression changes of \u003cem\u003eCXCL8\u003c/em\u003e and \u003cem\u003eJUN\u003c/em\u003e were confirmed by RT-PCR of samples from 10 individual donors. The expression of both genes was significantly upregulated after 60 and 90 minutes when compared to the early time points 0 and 30 minutes (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and b). Further statistical comparison confirmed a significantly upregulated expression between freshly isolated grafts (0 minutes) and grafts exposed to 90 minutes of ischemia. Moreover, the expression of \u003cem\u003eDUSP1\u003c/em\u003e was strongly increased after 90 minutes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). Additional immunohistochemical analysis demonstrated that the fraction of HIF-1α-positive cells within the grafts already exceeded 50% at the early ischemic time points of 0 and 30 minutes, indicating cellular stress immediately after removal of the graft (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed and e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eViability of cancellous bone grafts\u003c/h2\u003e \u003cp\u003eAdditional immunohistochemical analyses assessed the viability of the autologous bone grafts. These analyses showed a lower expression of proliferative Ki67-positive cells at the late time points of ischemia when compared to 0 and 30 minutes (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea and d). Moreover, the number of apoptotic cleaved caspase-3-positive cells was significantly increased at the late time points of ischemia (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb and e). Furthermore, the number of senescent p16-positive cells was significantly lower at 60 and 90 minutes after harvesting when compared to the early ischemia time points (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec and f).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eGene expression of ECM in autologous bone grafts\u003c/h2\u003e \u003cp\u003eThe analysis of ECM gene expression demonstrated only a slight decrease in the expression of the pro-osteogenic collagen \u003cem\u003eCOL1A1\u003c/em\u003e with time after harvesting, and a significantly reduced expression of the pro-osteogenic \u003cem\u003eCOL1A2\u003c/em\u003e at the late ischemia time points when compared to the early ischemia time points (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea and b). In contrast, the expression of the pro-chondrogenic collagens \u003cem\u003eCOL2A1\u003c/em\u003e und \u003cem\u003eCOL10A1\u003c/em\u003e was significantly increased within autologous bone grafts at 60 and 90 minutes after harvesting (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec and d). Additionally, the mRNA levels of \u003cem\u003eFN1, fibulin (FBLN)2\u003c/em\u003e and \u003cem\u003ebiglycan\u003c/em\u003e (\u003cem\u003eBGN)\u003c/em\u003e were significantly elevated at the late time points of ischemia when compared to 0 and 30 minutes (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ee, f and h). In contrast, the expression of FBLN1 significantly decreased with time after harvesting (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eg).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eEffects of COMP on blood coagulation\u003c/h2\u003e \u003cp\u003eAdditional RT-PCR analyses of markers related to coagulation and angiogenesis revealed a higher expression of \u003cem\u003eCOL15A1\u003c/em\u003e and \u003cem\u003eCOMP\u003c/em\u003e, at 60 and 90 minutes after harvesting, when compared to the early time points of ischemia (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea and b). The effects of COMP on blood coagulation were further assessed by \u003cem\u003ein vitro\u003c/em\u003e coagulation analyses. The results revealed a significantly higher PT and aPTT in blood clots with COMP treatment when compared to controls (Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ec and d).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study demonstrates that prolonged ischemia for at least 60 minutes induces oxidative stress, affects the ECM gene expression and reduces the viability of cancellous bone grafts. This condition is associated with a significantly upregulated gene expression of the oxidative stress markers, including \u003cem\u003eCXCL8\u003c/em\u003e, \u003cem\u003eJUN\u003c/em\u003e and \u003cem\u003eDUSP1\u003c/em\u003e, along with an increased number of apoptotic cells. Moreover, prolonged ischemia decreased the mRNA expression of the pro-osteogenic \u003cem\u003eCOL1A2\u003c/em\u003e, while increasing the expression of the pro-chondrogenic \u003cem\u003eCOL2A1\u003c/em\u003e and \u003cem\u003eCOL10A1\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eCancellous autologous bone grafts remain the gold standard for the treatment of large bone defects and non-unions, which is due to their excellent osteogenic, osteoconductive, and osteoconductive properties. These characteristics substantially enhance bone regeneration and contribute to overcome fracture healing failure [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Notably, a significant period of intraoperative ischemia can occur between the harvesting of the bone grafts and their transplantation to the recipient site. There is evidence that this ischemic period may compromise the viability of autologous bone grafts and, as a result, the success of the transplantation procedure. In fact, Sun et al. [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] demonstrated in an experimental study in mice that apoptosis and necrosis significantly increases within isolated bone tissue as early as 5 minutes post-harvesting. Besides this finding, there is no knowledge about the critical threshold for ischemia in human bone tissue as well as on the molecular basis by which ischemia induces damage to the bone graft.\u003c/p\u003e \u003cp\u003eThe results of our RT-PCR analysis revealed a significant upregulation of the pro-inflammatory and oxidative stress markers \u003cem\u003eCXCL8\u003c/em\u003e, \u003cem\u003eJUN\u003c/em\u003e and \u003cem\u003eDUSP1\u003c/em\u003e after prolonged ischemia. CXCL8 represents a prototypical chemokine, which belongs to the CXC-family. It induces the recruitment and activation of pro-inflammatory cells such as granulocytes and macrophages to the inflammation site. CXCL8 is almost undetectable under physiological conditions, but is rapidly upregulated by pro-inflammatory cytokines such as tumor necrosis factor(TNF)-α and IL-1β [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. CXCL8 exerts its function by interacting with specific cell surface G protein-coupled receptors (GPCR) including C-X-C motif chemokine receptor (CXCR)1 and CXCR2 [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Interestingly, CXCL8 expression is upregulated in organ transplantation during both hypoxia and subsequent tissue reperfusion. The infiltration of neutrophilic granulocytes induced by CXCL8 can exert tissue damage by the release of reactive oxidative species (ROS) and destructive enzymes [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Accordingly, several preclinical and clinical studies indicate that an upregulation of CXCL8 is associated with critical ischemia and transplantation failure. Klimiec-Moscal et al. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] demonstrated that high CXCL8 levels within the blood plasma samples of patients suffering from ischemic stroke predict poor functional outcome. Furthermore, the CXCL8 receptor-blocker, reparixin, improved the long-term neurological recovery in a cerebral ischemia model in rats [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In lung transplant recipients, elevated CXCL8 levels and increased neutrophil counts have been detected in bronchoalveolar lavage (BAL) fluid from patients with bronchiolitis obliterans syndrome (BOS) and restrictive allograft syndrome (RAS), two forms of chronic rejection that represent major causes of long-term mortality after transplantation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ec-JUN and its related pathway, the c-Jun N-terminal kinase (JNK) pathway are activated by a variety of stimuli including oxidative stress, heat and osmotic shock as well as ischemia-reperfusion injury of brain and heart tissue [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Moreover, there is evidence that JNK activation plays a crucial role in both death receptor-initiated extrinsic and mitochondrial intrinsic pathways that trigger apoptosis [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In line with these findings, our immunohistochemical analysis demonstrated a significantly higher number of apoptotic cells after prolonged ischemia. Notably, the induction of \u003cem\u003eCXCL8\u003c/em\u003e and \u003cem\u003eJUN\u003c/em\u003e was most likely caused by early hypoxia and oxidative stress within the transplants, as indicated by the substantial presence of HIF1-α positive cells at early ischemic time points. In addition, a significantly higher number of senescent p16-positive cells was observed during early compared with late time points of ischemia. Interestingly, our RT-PCR analysis also showed the significant upregulation of \u003cem\u003eDUSP1\u003c/em\u003e during later stages of ischemia. DUSP1 is expressed during oxidative stress and is responsible for the inhibition of mitogen-activated protein kinases (MAPKs), such as JNK by dephosphorylation during inflammation [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Moreover, DUSP1 has been shown to play a crucial role in the regulation of the inflammatory response of lipopolysaccharide genes, including IL-6 and IL-10 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In the present study the upregulation of DUSP1 after prolonged ischemia indicates a persisting inflammatory state, which may have contributed to the increased number of apoptotic cells observed after prolonged ischemia.\u003c/p\u003e \u003cp\u003eAdditional RT-PCR analyses revealed significant alterations in the expression of ECM-related genes during the time course of ischemia. Collagens are abundant within the extracellular matrix and play a critical role in maintaining the structural integrity of the body. Type I collagen, a triple helical molecule synthesized from the two genes, \u003cem\u003eCOL1A1\u003c/em\u003e and \u003cem\u003eCOL1A2\u003c/em\u003e, is the most common collagen within the human body and represents the major structural protein of bone tissue, compromising for 90% of its organic matrix [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Notably, it is assembled as a heterotrimer composed of two proα1(I) and one proα2(I) chains, which undergo post-translational modifications such as hydroxylation and glycosylation [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Osteogenesis imperfecta, an inherited skeletal dysplasia characterized by bone fragility and skeletal deformities, is caused in most cases by mutations within the \u003cem\u003eCOL1A1\u003c/em\u003e and \u003cem\u003eCOL1A2\u003c/em\u003e genes. Accordingly, it is well established that type I collagen plays a crucial role in bone development and mineralization [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Moreover, Besio et al. [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] demonstrated in a transgenic osteogenesis imperfecta mouse model that mutations of \u003cem\u003eCOL1A2\u003c/em\u003e result in a delay in fracture healing. Our analysis showed a significantly reduced expression of \u003cem\u003eCOL1A2\u003c/em\u003e after prolonged ischemia, and a slight reduction of \u003cem\u003eCOL1A1\u003c/em\u003e expression at 90 minutes of ischemia. On the other hand, the expression of genes of collagens predominant in cartilage tissue, such as \u003cem\u003eCOL2A1\u003c/em\u003e and \u003cem\u003eCOL10A1\u003c/em\u003e [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], were significantly increased at 60 and 90 minutes of ischemia. These findings indicate a reduced pro-osteogenic capacity of the bone grafts at later stages of ischemia with a shift in the ECM-related gene expression toward a pro-chondrogenic and away from a pro-osteogenic profile.\u003c/p\u003e \u003cp\u003eFurther changes of ECM-related gene expression included a significant upregulation of \u003cem\u003eFN1\u003c/em\u003e and \u003cem\u003eBGN\u003c/em\u003e after prolonged ischemia. Notably, FN1 plays not only a vital role in cellular adhesion and growth [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], but is also upregulated during myocardial ischemia and ischemia-reperfusion injury due to hypoxic cell stress [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Thereby, FN1 induces the proliferation of progenitor cells and the migration of inflammatory cells [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. BGN, is a ECM-derived danger associated molecular pattern (DAMP), which is proteolytically released during ischemia reperfusion injury of the kidney and heart failure in myocardial tissue [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Upon its release BGN coordinates the inflammatory response as high-affinity ligand of TLR2 and TLR4 in macrophages [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], regulating the production of various cytokines and immune cell recruitment [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Hence, the increased expression of \u003cem\u003eFN1\u003c/em\u003e and \u003cem\u003eBGN\u003c/em\u003e within bone grafts during later stages of ischemia does not only reflect hypoxic cellular stress but may also contribute to the stimulation of an inflammatory response within the grafts.\u003c/p\u003e \u003cp\u003eAdditional analyses demonstrated a decreased expression of \u003cem\u003eFBLN1\u003c/em\u003e at later stages of ischemia, whereas the expression of \u003cem\u003eFBLN2\u003c/em\u003e was significantly increased. Interestingly, previous studies could demonstrate that FBLN1 is directly involved in the process of osteogenesis. Cooley et al. [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] reported that the skulls of FBLN1-deficient mice suffer from a reduced formation of both endochondral and membranous bone tissue. This was most likely due to a reduced BMP-2-mediated induction of osterix, resulting in a compromised osteoblast differentiation [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. These findings are supported by various in vitro studies highlighting the crucial role of FBLN1 for the pro-osteogenic differentiation of MSCs. FBLN2, on the other hand, is upregulated in various organs, such as the heart, liver, and brain, where it promotes tissue fibrosis and hinders remyelination [\u003cspan additionalcitationids=\"CR40\" citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The present data indicate that FBLN2 is also involved in ischemia-induced processes within bone tissue, possibly contributing to fibrotic tissue remodeling under ischemic conditions.\u003c/p\u003e \u003cp\u003eInterestingly, our analysis also demonstrated a significantly increased expression of \u003cem\u003eCOL15A1\u003c/em\u003e within bone grafts exposed to prolonged ischemia. There is evidence that collagen-derived endostatins from collagens 15 and 18 inhibit endothelial cell migration and angiogenesis. Sasaki et al. [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] demonstrated \u003cem\u003ein vitro\u003c/em\u003e that endostatins from collagens 15 and 18 inhibit angiogenesis induced by fibroblast growth factor (FGF)-2 or vascular endothelial growth factor (VEGF) in a chorioallantoic membrane model. Adequate angiogenesis and vascularization are crucial for the survival of bone grafts and the subsequent process of bone regeneration [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Hence, the increased expression of \u003cem\u003eCOL15A1\u003c/em\u003e during prolonged ischemia may not only impair the pro-angiogenic capacity of the grafts, but also negatively affect graft integration and healing outcome.\u003c/p\u003e \u003cp\u003eSince autologous bone grafts are often transplanted as smaller fragments, hematoma formation and its subsequent coagulation are crucial to keep the grafts in place within the defect site and avoid secondary dislocation. The glycoprotein COMP is not only expressed within cartilage tissue but also appears to play an essential role in the blood coagulation process. In fact, Lang et al. [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] demonstrated that COMP deficiency in mice shortens tail-bleeding and clotting time. Moreover, the authors revealed that a high concentration of exogenously purified COMP increases the PT and aPPT of platelet-free plasma from wildtype mice and humans. Apparently, COMP acts as an endogenous inhibitor of thrombin and suppresses hemostasis [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Interestingly, our coagulation analysis confirmed these findings using platelet free plasma of healthy human donors, with a significantly increased PT and aPPT after the application of rhCOMP \u003cem\u003ein vitro\u003c/em\u003e. Furthermore, our RT-PCR analysis showed a higher expression of \u003cem\u003eCOMP\u003c/em\u003e at later stages of ischemia. These results indicate that a prolonged ischemia for at least 60 minutes may hamper blood coagulation and may therefore compromise graft stabilization at the transplantation site and subsequent bone regeneration.\u003c/p\u003e \u003cp\u003eTaken together, the present study demonstrates that prolonged ischemia in bone grafts for at least 60 minutes stimulates oxidative stress and the expression of pro-inflammatory genes, reduces graft viability and induces a shift from a pro-osteogenic towards a pro-chondrogenic ECM gene expression profile. Moreover, prolonged ischemia may compromise angiogenesis and hematoma coagulation at the transplantation site. Therefore, revision surgeries involving autologous bone graft transplantation should be coordinated accordingly to avoid periods of ischemia lasting 60 minutes or longer to preserve bone graft function and regeneration capacity.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003eAll necessary declerations are listed in the manuscript.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003e \u003cem\u003eNot applicable\u003c/em\u003e \u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research received no external funding.\u003c/p\u003e\u003ch2\u003eAuthors' contributions\u003c/h2\u003e \u003cp\u003eConceptualization: Maximilian M. Menger, Sabrina Ehnert, Steven C. Herath; Methodology: Maximilian M. Menger, Sabrina Ehnert, Steven C. Herath, Franziska Poeske, Lina P. Sch\u0026auml;fer Konrad Steinestel, Lena L\u0026ouml;wer-Kiem, Patrick M\u0026uuml;nzer, Oliver Borst; Formal analysis and investigation: Maximilian M. Menger, Sabrina Ehnert, J Franziska Poeske, Lina P. Sch\u0026auml;fer, Konrad Steinestel, Lena L\u0026ouml;wer-Kiem, Patrick M\u0026uuml;nzer, Oliver Borst; Data curation: Maximilian M. Menger, Sabrina Ehnert, Steven C. Herath, Tina Histing, Matthias W. Laschke, Benedikt J. Braun, Michael D. Menger; Writing - original draft preparation: Maximilian M. Menger; Writing - review and editing: Sabrina Ehnert, Matthias W. Laschke, Steven C. Herath, Michael D. Menger; Resources: Tina Histing and Steven C. Herath; Supervision: Sabrina Ehnert and Steven C. Herath.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe are grateful for the excellent technical assistance of Sandra Hans (Institute for Clinical and Experimental Surgery, Saarland University). Servier Medical Art was used to create Fig.\u0026nbsp;1, which is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).\u003c/p\u003e\u003ch2\u003eAvailability of data and material\u003c/h2\u003e \u003cp\u003eThe data generated and analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e \u003cp\u003e\u003cb\u003eCompeting interests\u003c/p\u003e \u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eEinhorn TA, Gerstenfeld LC. Fracture healing: mechanisms and interventions. Nat Rev Rheumatol. 2015;11(1):45\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMills LA, Aitken SA, Simpson A. The risk of non-union per fracture: current myths and revised figures from a population of over 4 million adults. Acta Orthop. 2017;88(4):434\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVictoria G, et al. Bone stimulation for fracture healing: What's all the fuss? Indian J Orthop. 2009;43(2):117\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHak DJ, et al. Delayed union and nonunions: epidemiology, clinical issues, and financial aspects. Injury. 2014;45(Suppl 2):S3\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAzi ML, et al. Autologous bone graft in the treatment of post-traumatic bone defects: a systematic review and meta-analysis. BMC Musculoskelet Disord. 2016;17(1):465.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmidt AH. Autologous bone graft: Is it still the gold standard? Injury. 2021;52(Suppl 2):S18\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFillingham Y, Jacobs J. \u003cem\u003eBone grafts and their substitutes.\u003c/em\u003e Bone Joint J, 2016. 98-B(1 Suppl A): pp. 6\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan SN, et al. The biology of bone grafting. J Am Acad Orthop Surg. 2005;13(1):77\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKamal M, et al. Comparison of Bone Grafts From Various Donor Sites in Human Bone Specimens. J Craniofac Surg. 2018;29(6):1661\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEltzschig HK, Eckle T. Ischemia and reperfusion\u0026ndash;from mechanism to translation. Nat Med. 2011;17(11):1391\u0026ndash;401.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBankhead P, et al. QuPath: Open source software for digital pathology image analysis. Sci Rep. 2017;7(1):16878.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoube A, et al. Comparison of decalcifying agents and techniques for human dental tissues. Biotech Histochem. 2018;93(2):99\u0026ndash;108.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteinestel K, et al. Expression of Abelson interactor 1 (Abi1) correlates with inflammation, KRAS mutation and adenomatous change during colonic carcinogenesis. PLoS ONE. 2012;7(7):e40671.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePape HC, Evans A, Kobbe P. Autologous bone graft: properties and techniques. J Orthop Trauma. 2010;24(Suppl 1):S36\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Q, et al. Improving intraoperative storage conditions for autologous bone grafts: An experimental investigation in mice. J Tissue Eng Regen Med. 2019;13(12):2169\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Q, et al. The CXCL8-CXCR1/2 pathways in cancer. Cytokine Growth Factor Rev. 2016;31:61\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoffmann E, et al. Multiple control of interleukin-8 gene expression. J Leukoc Biol. 2002;72(5):847\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrat DJ, Bellail AC, Van Meir EG. The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 2005;7(2):122\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCambier S, Gouwy M, Proost P. The chemokines CXCL8 and CXCL12: molecular and functional properties, role in disease and efforts towards pharmacological intervention. Cell Mol Immunol. 2023;20(3):217\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlimiec-Moskal E, et al. Circulating Chemokines and Short- and Long-Term Outcomes After Ischemic Stroke. Mol Neurobiol. 2025;62(1):421\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVilla P, et al. The interleukin-8 (IL-8/CXCL8) receptor inhibitor reparixin improves neurological deficits and reduces long-term inflammation in permanent and transient cerebral ischemia in rats. Mol Med. 2007;13(3\u0026ndash;4):125\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVerleden SE, et al. Differential cytokine, chemokine and growth factor expression in phenotypes of chronic lung allograft dysfunction. Transplantation. 2015;99(1):86\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShvedova M, et al. c-Jun N-Terminal Kinases (JNKs) in Myocardial and Cerebral Ischemia/Reperfusion Injury. Front Pharmacol. 2018;9:715.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDhanasekaran DN, Reddy EP. JNK signaling in apoptosis. Oncogene. 2008;27(48):6245\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu YX, et al. DUSP1 is controlled by p53 during the cellular response to oxidative stress. Mol Cancer Res. 2008;6(4):624\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHammer M, et al. Dual specificity phosphatase 1 (DUSP1) regulates a subset of LPS-induced genes and protects mice from lethal endotoxin shock. J Exp Med. 2006;203(1):15\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvaraj V, et al. Type 1 collagen: Synthesis, structure and key functions in bone mineralization. Differentiation. 2024;136:100757.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarini JC, Blissett AR. New genes in bone development: what's new in osteogenesis imperfecta. J Clin Endocrinol Metab. 2013;98(8):3095\u0026ndash;103.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarom R, Rabenhorst BM, Morello R. Osteogenesis imperfecta: an update on clinical features and therapies. Eur J Endocrinol. 2020;183(4):R95\u0026ndash;106.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBesio R, et al. Early Fracture Healing is Delayed in the Col1a2(+/G610C) Osteogenesis Imperfecta Murine Model. Calcif Tissue Int. 2018;103(6):653\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGelse K, Poschl E, Aigner T. Collagens\u0026ndash;structure, function, and biosynthesis. Adv Drug Deliv Rev. 2003;55(12):1531\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Ni H. Fibronectin maintains the balance between hemostasis and thrombosis. Cell Mol Life Sci. 2016;73(17):3265\u0026ndash;77.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKonstandin MH, et al. Fibronectin is essential for reparative cardiac progenitor cell response after myocardial infarction. Circ Res. 2013;113(2):115\u0026ndash;25.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang SS, et al. Epithelial CEBPD activates fibronectin and enhances macrophage adhesion in renal ischemia-reperfusion injury. Cell Death Discov. 2024;10(1):328.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePoluzzi C, et al. Biglycan evokes autophagy in macrophages via a novel CD44/Toll-like receptor 4 signaling axis in ischemia/reperfusion injury. Kidney Int. 2019;95(3):540\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmed MS, et al. Induction of myocardial biglycan in heart failure in rats\u0026ndash;an extracellular matrix component targeted by AT(1) receptor antagonism. Cardiovasc Res. 2003;60(3):557\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchaefer L, et al. The matrix component biglycan is proinflammatory and signals through Toll-like receptors 4 and 2 in macrophages. J Clin Invest. 2005;115(8):2223\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCooley MA, et al. Fibulin-1 is required for bone formation and Bmp-2-mediated induction of Osterix. Bone. 2014;69:30\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan SA, et al. Fibulin-2 is essential for angiotensin II-induced myocardial fibrosis mediated by transforming growth factor (TGF)-beta. Lab Invest. 2016;96(7):773\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhorbani S et al. Fibulin-2 is an extracellular matrix inhibitor of oligodendrocytes relevant to multiple sclerosis. J Clin Invest, 2024. 134(13).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBalog S, et al. Emergence of highly profibrotic and proinflammatory Lrat\u0026thinsp;+\u0026thinsp;Fbln2\u0026thinsp;+\u0026thinsp;HSC subpopulation in alcoholic hepatitis. Hepatology. 2023;78(1):212\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSasaki T, et al. Endostatins derived from collagens XV and XVIII differ in structural and binding properties, tissue distribution and anti-angiogenic activity. J Mol Biol. 2000;301(5):1179\u0026ndash;90.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMenger MM, et al. Vascularization Strategies in the Prevention of Nonunion Formation. Tissue Eng Part B Rev. 2021;27(2):107\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang Y, et al. Cartilage oligomeric matrix protein is a natural inhibitor of thrombin. Blood. 2015;126(7):905\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"autologous, bone graft, ischemia, viability, oxidative stress, extracellular matrix","lastPublishedDoi":"10.21203/rs.3.rs-8186169/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8186169/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eDespite growing insights into the pathophysiology of non-union formation, failed fracture healing remains a major complication in trauma and orthopedic surgery. The transplantation of cancellous bone grafts represents the gold standard for the treatment of atrophic non-unions and large-scaled bone defects. Depending on the type of procedure and the available personnel, the bone grafts may be exposed to a significant period of intraoperative ischemia before the transplantation to the defect site. This ischemia may have detrimental effects on the quality and functionality of the grafts.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eTherefore, we analyzed in this study the effects of different periods of ischemia (0, 30, 60 and 90 minutes) on oxidative stress, gene expression and viability of autologous bone grafts, to determine a critical ischemia time window for cancellous bone graft transplantation. Graft samples were harvested from 24 patients undergoing revision surgery due to bone healing failure. The samples were analyzed by mRNA profiler arrays, reverse transcription polymerase chain reaction (RT-PCR) and immunohistochemistry.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eAn ischemia of 60 minutes or longer induced the expression of pro-inflammatory and stress-induced genes, such as \u003cem\u003eCXCL8\u003c/em\u003e, \u003cem\u003eJUN\u003c/em\u003e and \u003cem\u003eDUSP1\u003c/em\u003e. This was associated with early cell stress within the grafts, as indicated by the presence of hypoxia-inducible factor (HIF)-1α-positive cells and an increased number of senescent p16-positive cells. Additional immunohistochemical analyses revealed a significantly higher number of apoptotic cleaved caspase-3-positive cells at 60 and 90 minutes of ischemia, demonstrating a compromised viability of the grafts. RT-PCR analyses revealed a shift from a pro-osteogenic towards a pro-chondrogenic extracellular matrix (ECM) gene expression profile, along with evidence for potentially compromised angiogenesis and hematoma formation at the later transplantation site.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eTaken together, these findings indicate that periods of ischemia of 60 minutes or longer should be avoided during cancellous bone graft transplantation to preserve graft function and regenerative capacity.\u003c/p\u003e","manuscriptTitle":"Prolonged ischemia induces oxidative stress, affects extra cellular matrix gene expression and compromises the viability of cancellous bone grafts","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-22 09:30:14","doi":"10.21203/rs.3.rs-8186169/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2d0a6ab2-5a3c-4016-8e48-ac05158c7004","owner":[],"postedDate":"December 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-03-08T10:52:29+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-22 09:30:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8186169","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8186169","identity":"rs-8186169","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.