Astrocytic Bestrophin1 in the Anterior Cingulate Cortex Modulates the Formation and Persistence of Morphine Addiction Memory | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Astrocytic Bestrophin1 in the Anterior Cingulate Cortex Modulates the Formation and Persistence of Morphine Addiction Memory Linlin Sun, Zepeng Liu, Yifan Li, Xiaorui Lin, Yu Huo, Shengyang Guo, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4272120/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Emerging evidence indicates that astrocytes play a vital role in both the establishment and preservation of memories. However, their specific contribution to addiction-related memory remains largely unresolved. In this study, we observed alterations in Ca 2+ dynamics within astrocytes of the anterior cingulate cortex (ACC) during the acquisition, recent retrieval, and remote retrieval phases of morphine-conditioned place preference (CPP). Selective activation of Gi signaling in ACC astrocytes during the acquisition phase, rather than during retrieval or transfer phases, led to a significant and prolonged increase in the morphine CPP score. In contrast, activation of Gq signaling led to a reduction in the CPP score, which was both diminished and shortened. Additionally, we noted a significant increase in astrocytic Bestrophin 1 (BEST1) expression in the ACC during the morphine CPP acquisition phase. Selective knockdown of BEST1 from ACC astrocytes elevated astrocytic Ca 2+ dynamics, expanded astrocytic coverage, alleviated astrocytic glutamate release, and altered the density of synapses between the dorsal hippocampus (dCA1) and ACC within the astrocytic microdomains. Mice lacking astrocytic BEST1 displayed impaired activity in ACC dCA1 neurons and decreased CPP scores. These findings suggest that ACC astrocytes modulate the connectivity between dCA1 and ACC neurons, possibly through extrasynaptic glutamate activity, thereby regulating the strength and persistence of morphine-associated memory. Health sciences/Diseases/Psychiatric disorders/Addiction Biological sciences/Neuroscience Morphine addiction memory Anterior cingulate cortex Astrocyte Bestrophin1 Astrocytic glutamate release Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The role of astrocytes in memory is increasingly recognized as crucial, alongside neurons, in the complex processes of learning and memory formation, maintenance, retrieval, and extinction. Astrocytes undergo changes in their transcription and translation profiles [ 1 ], membrane ion dynamics [ 2 , 3 ], morphological coverage [ 4 – 6 ], metabolic support [ 7 – 10 ], neurotransmitter regulation [ 2 , 3 , 11 ], synapse phagocytosis [ 12 , 13 ], and other functions, thus contributing to the processes of memory formation and retention [ 1 , 2 , 9 , 14 , 15 ]. Previous research has demonstrated that these astrocytic alterations play a role in enhancing memory intensity and persistence through interactions with neurons, such as providing energy and nutrients, eliminating unnecessary synapses, and modulating synaptic strength beyond the synaptic cleft. However, recent studies suggest that astrocyte activation alone can initiate de novo neuronal potentiation and is required for memory persistence [ 15 , 16 ]. Bestrophin1 (Best1) is a calcium-activated anion channel identified from retinal pigment epithelium [ 17 – 19 ]. Subsequent investigations have revealed that Best1 is widely distributed in the brain, especially with higher levels in cortex, hippocampus, and cerebellum, and prominent expression in both neurons and astrocytes [ 20 , 21 ]. In the astrocytes, it plays a role in both tonic GABA release and glutamate transport, thereby influencing neuronal excitability, synaptic transmission, and synaptic plasticity [ 22 – 24 ]. Prior research has indicated that Best1 is specifically localized in microdomains of astrocytes proximal to synapses, facilitating slow glutamate release from astrocytes in a G αq -activation dependent manner [ 2 , 25 , 26 ]. Moreover, hippocampal astrocytic BEST1 has been found to co-release glutamate and D-serine, regulate N-methyl-D-aspartate receptor (NMDAR) tone, contribute to long-term depotentiation during learning, and modulate memory flexibility [ 23 ]. Multiple studies have delved into the involvement of astrocytes in addiction-related memory processes. Specifically, in the hippocampal CA1 region, astrocytes have been found to encode the anticipated location of rewards within spatial contexts [ 27 ]. Within the nucleus accumbens (NAc), research indicates that heightened glycolytic metabolism within astrocytes modulates the establishment of morphine addiction memory [ 28 ]. Additionally, increased release of thrombospondin from astrocytes in the NAc has been observed to facilitate the generation of silent synapses induced by cocaine and contribute to the reinstatement of addiction memory [ 29 ]. In the ventral tegmental area (VTA), astrocytes exert tonic GABA inhibition on local GABA neurons and contribute to the formation and retrieval of cocaine-associated context memory [ 3 ]. The anterior cingulate cortex (ACC) is recognized for its involvement in long-term memory processes. Recent findings suggest that neurons in the ACC are activated during initial memory formation but remain quiescent, gradually becoming active during the transfer of memories from recent to remote stages [ 30 , 31 ]. However, the specific function and underlying mechanisms of ACC astrocytes in addiction-related memory processes remain poorly understood. In this study, we utilized the morphine CPP paradigm along with astrocyte-specific recording and manipulation techniques to investigate the role of ACC astrocytes at various stages of morphine-associated memory. Our findings reveal that ACC astrocytes play a crucial role in shaping the strength and retention of morphine-conditioned memory during the acquisition phase. Specifically, selective knockdown of astrocytic BEST1 in the ACC during memory acquisition elevated astrocytic calcium dynamics, expanded astrocytic coverage, declined astrocytic glutamate release, induced alterations in the density of synapses between the dCA1 and ACC within astrocytic microdomains, attenuated the activity of ACC dCA1 neurons, and ultimately reduced morphine CPP scores. These results suggest that ACC astrocytes influence the connectivity between dCA1 and ACC neurons, potentially via extrasynaptic glutamate activity, thereby regulating the strength and persistence of morphine-associated memory. Materials and Methods Animals Male adult (6–8 weeks) C57BL/6J mice were group-housed on a 12-h reverse light-dark cycle with ad libitum access to food and water. All animal procedures were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the Biomedical Ethics Committee for animal use and protection of Peking University. Stereotaxic surgery and virus injection Mice were anesthetized with avertin (300 mg/kg, i.p.) and mounted into a stereotaxic instrument (RWD Life Science). The skull was exposed and a small craniotomy was performed. Virus was injected into the targeted brain region with a pulled glass capillary at slow rate (60 nL/min) using a pressure microinjector (Nanoject III, Drummond Scientific). Following each injection, the needle was left in place for 10 min before it was withdrawn. Mice were allowed at least 21 days to express the virus and recover before behavior training. Bilateral injection coordinates for ACC are AP: 0.3 mm, ML: ±0.4 mm, DV: -1.7 mm; for NAc are AP: 1.1 mm, ML: ±0.8 mm, DV: -4.6 mm; for VTA are AP: -3.4 mm, ML: ±0.35 mm, DV: -4.4 mm; for dCA1 are AP: -1.83 mm, ML: ±1.2 mm, DV: -1.6 mm. For fiber photometry recording, virus injection was followed by optical fiber implantation. The optical fiber with 400 µm core diameter and 0.5 numerical aperture (RWD Life Science) was implanted above injection sites of ACC. Information of respective viruses in each experiment used is provided in Supplementary Table 1 . Virus construction For astrocyte-specific BEST1 knockdown, the miR30-based shRNA AAV vector targeting mouse Best1 (TTTGCCAACTTGTCAATGAA) was used for in vivo BEST1 knockdown [ 32 ]. The designed AAV plasmids for Best1 shRNA and Scramble were constructed as AAV2/5-GfaABC1D- Best1 shRNA-EGFP-WPRE (OBiO, titer 4.89 × 10 12 v.g./mL) and AAV2/5-GfaABC1D-Scramble-EGFP-WPRE (titer 1.2 × 10 13 v.g./mL), respectively. The AAV plasmids expressing mCherry and targeting the same sequence were constructed as AAV2/8-GfaABC1D- Best1 shRNA-mCherry-WPRE (titer 1.15 × 10 13 v.g./mL) and AAV2/8-GfaABC1D-Scramble-mCherry-WPRE (titer 2.65 × 10 13 v.g./mL), respectively. Conditioned place preference (CPP) All mice were handled for at least three consecutive days before the experiment. An unbiased CPP paradigm was conducted with a three-chamber apparatus consisting of two side chambers measuring 15 × 15 × 15 cm each, and a middle chamber measuring 10 × 15 × 15 cm. Two side chambers had distinct visual (wall lamps with triangular pattern and wall lamps with square pattern) and tactile (a grid floor and a floor with horizontal stripes) context, connected by the middle chamber. A removable gate between the two boxes ensured that mice were free or restricted to cross the apparatus during different experimental periods. The establishment of morphine CPP model contains three phases. In the pre-test phase (day 1), mice were placed into the middle chamber for a 1 min habituation period and then allowed to freely explore all three chambers for 15 min to assess their baseline place preference. In the conditioning phase (day 2–5), these mice were injected with saline (5 mL/kg, i.p.) and confined in one lateral chamber for 45 min then returned to their home cage. At least six hours later, these mice were injected with morphine (15 mg/kg, i.p., [ 33 ]) and confined in the opposite chamber for 45 min then returned to their home cage. The training will performed for four consecutive days. In the test phase (day 6), mice were re-exposed to the CPP chamber and allowed to freely explore the entire apparatus for 15 min. During the pre-test and test sessions, time spent in each chamber was recorded by Any-maze tracking software. Mice showing over 80% preference for one chamber during pre-test were excluded, and rest were randomly assigned to counterbalance pairings on each side chamber. The CPP score was defined as the time spent in the morphine-paired chamber minus that spent in the saline-paired chamber. Fiber photometry recording and analysis Fiber photometry system (R810, RWD Life Science) was used to record the in vivo fluorescence signals (GCaMP, iGluSnFR or iGABASnFR). The 470 nm excitation fluorescence signal and the 410 nm excitation internal control signal were acquired at a 60 Hz sample rate [ 34 ]. The LED light power was adjusted at the tip of the optic fiber to 30–40 µW to minimize bleaching. Prior to behavior recording, mice were habituated to a patch cord attached to the implanted optical fiber for 1 min in the CPP chamber. Mice received virus injection were trained with the identical CPP protocol as above. Fiber photometry was taken within the first 15 min during CPP acquisition and retrieval session due to morphine concentrations in mouse plasma and brain increased rapidly and maintained at high levels [ 35 ]. Analysis of signal was done with supporting software OFRS (RWD Life Science). For CPP acquisition phase recording, fluorescence signals were collected from mice injected with saline or morphine for four consecutive days during training. Raw signals were normalized by 410 nm signal and converted to ΔF/F, calculated according to (470 nm signal - fitted 410 nm signal)/ (fitted 410 nm signal). The integrated Ca 2+ activity and area under the curve (AUC) were calculated as the sum of ΔF/F of the total duration. Significant calcium events were identified as periods of time in which ΔF/F rose above 2.91 median absolute deviations (MADs) from baseline [ 36 ]. The frequency and average peak of these identified events were included in the analysis. For CPP retrieval phase recording, mice stayed and traveled between the two chambers. Data analysis was identical to the acquisition phase when mice explored saline or morphine chambers for more than 15 s. When mice entry into the chamber (in the middle chamber or opposite side 5 s before entry and staying at least 15 s), valid shuttle events within 15 min were marked and their z-score were calculated as (ΔF/F - mean)/std. Chemogenetic manipulation Mice received virus injection and 21 days later underwent CPP training as described above. Clozapine N -oxide (CNO; 4936, Tocris) was dissolved in 0.9% saline. For chemogenetic manipulation during CPP acquisition phase, mice were injected with CNO (5 mg/kg, i.p.) 25 min before each morphine-paired training. The same volume of 0.9% saline served as vehicle was administered 25 min before each saline-paired training. Twenty-four hours after the final training session, mice were re-exposed to the CPP chamber and allowed to freely explore the entire apparatus for 15 min. For chemogenetic manipulation during recent and remote retrieval test, separate groups of mice received virus injection and 4 days of morphine CPP training. Twenty-four hours (recent) and 14 days (remote) after the final training session, mice were injected with CNO (5 mg/kg, i.p.) or vehicle 25 min before re-exposed and freely explore the CPP chamber (Test 1 and Test 2). For chemogenetic manipulation during CPP transfer, separate groups mice received virus injection, 4 days of morphine CPP training and Test 1. After the Test 1, mice were provided with access to CNO-treated or 0.9% saline-treated drinking water for 14 days until Test 2. CNO was dissolved in the animals' regular drinking water at a concentration of 5 µg/mL [ 37 ] and freshly prepared every day. The daily water intake of each cage was recorded. Quantitative real-time PCR Mice were anesthetized by avertin and decapitated three hours after the last training session. The brains were quickly dissected and stored at -80°C. Coronal sections were prepared in a cryostat microtome (model 1950, Leica), and bilateral ACC were collected carefully with a 8-gauge needle. Total RNA was extracted from tissue using RNAiso Plus (TaKaRa) according to the manufacturer’s protocol. RNA purity and integrity were analyzed by RNA electrophoresis and NanoDrop 2000 spectrophotometer (Thermo Scientific). cDNA First strand Kit (TIANScript) and SYBR FAST qPCR Kit (Kapa Biosystems) were employed for reverse transcription (1 µg RNA per sample) and quantitative real-time PCR (qRT-PCR), respectively. The amplification of qRT-PCR was performed on the 7500 real-time system (Applied Biosystems) and carried out as follows: 95°C for 30 s, followed by 45 cycles of 95°C for 5 s and 60°C for 30 s. Each experiment was performed in triplicate. The relative mRNA expression level was calculated using the 2 −ΔΔCT method. The housekeeping gene Gapdh was chosen as the reference for internal standardization. All the primers used were listed in Supplementary Table 2 . Immunohistochemistry Mice were anesthetized by avertin and perfused transcardially with 0.9% saline followed by 4% paraformaldehyde (PFA) three hours after the last training session. The brains were dissected and post-fixed in 4% PFA for 24 h at 4°C before they were dehydrated subsequently in 20% and 30% sucrose solution. Coronal sections (50 µm thick) were prepared in a cryostat microtome and wash for 3× 5 min in PBS. The brain sections were permeabilized with PBST (PBS with 0.3% Triton X-100) for 30 min and then blocked with PBST containing 5% donkey serum for 1 h at room temperature. Then, the sections were incubated with the primary antibody in PBST with 1% donkey serum for 24 h at 4°C. The following primary antibodies were used in our experiments: mouse anti-GFAP (1:300, 3670S, Cell Signaling Technology), rabbit anti-NeuN (1:500, 24307S, Cell Signaling Technology), mouse anti-S100β (1:500, S2532, Sigma Aldrich), mouse anti-NeuN (1:100, MAB377, Sigma Aldrich), rabbit anti-BEST1 (1:100, GTX14927, GeneTex), rabbit anti-Synaptophysin (1:100, ab32127, Abcam), mouse anti-CaMKIIα (1:100, sc13141, Santa Cruz Biotechnology), rabbit anti-PV (1:200, PA5-96209, ThermoFisher), rabbit anti-SST (1:100, PA5-85759, ThermoFisher) and rabbit anti-VIP (1:100, 20077, Immunostar). The sections were then washed 3 × 15 min in PBST and incubated with secondary antibodies in the dark for 1.5 h at room temperature. The following secondary antibodies were used in our experiments: Alexa Fluor 405 donkey anti-rabbit IgG (1:500, ab175651, Abcam), Alexa Fluor 488 donkey anti-mouse IgG (1:500, A21202, Invitrogen), Alexa Fluor 488 donkey anti-rabbit IgG (1:500, A21206, Invitrogen), Alexa Fluor 647 donkey anti-mouse IgG (1:500, A31571, Invitrogen) and Alexa Fluor 647 donkey anti-rabbit IgG (1:500, A31573, Invitrogen). Finally, after washing 3 × 15 min in PBST, the sections were mounted onto a glass slide with a coverglass and anti-fade solution with or without DAPI (S2100, Solarbio). Confocal imaging and analysis Confocal imaging was performed using a confocal microscope (TCS-SP8 DIVE, Leica) and image acquisition software LAS X (Leica). Three different objective lens were used: 10x objective was used to overview the ACC or CA1 regions to verify viral expression or fiber placement; 63x oil immersion objective was used to obtain z-stacks of 1 µm intervals to examine co-labeled cells and BEST1 fluorescent intensity; 63x objective at 2.5x zoom was used to obtain z-stacks of 0.5 µm intervals to analyze morphology and co-registration. For co-labeled cell counting, the maximum projection of z-stack images was adopted for analysis. For quantification of fluorescent intensity, sections from the two groups were stained and imaged with exactly the same protocol. The ROI of each astrocyte or neuron was manually traced and the quantification of BEST1 intensity were analyzed using the ImageJ software. For morphological analysis, astrocytes were obtained if and only if the entire cell volume could be clearly imaged within the tissue section and the boundaries of the cell were not overlapping with nearby labeled cells. The plugin of Sholl analysis applied in ImageJ automatically drew serial concentric circles at 10 µm intervals from soma to the end of the most distant process in each single astrocyte and analyzed the number of process intersections in each circle. Astrocytes were then identified based on characteristic morphology and EGFP signal intensity relative to noise and digitally rendered to obtain a metric of astroglial volume in the Imaris (Bitplane). Co-registration analysis was performed similarly as previously described [ 4 ]. Rendered astrocytes were used to mask SYP and mCherry signals. Voxels containing signal intensity greater than noise in each channel were determined empirically using the Coloc module and were used to build a colocalization channel. Astro-SYP co-registration was quantified by isolating SYP signal that co-registered with the rendered astrocyte. For determination of astrocyte association with dCA1 terminals, co-registration of isolated mCherry and SYP was determined using the Coloc module and quantified signal was normalized to volume of the rendered astrocytes. For determination of astrocyte association with non dCA1 terminals, the remaining SYP signals excluding the co-registration of mCherry and SYP were considered non-dCA1 and quantified by volume of the rendered astrocytes. The cell soma was identified based on size and fused with GFAP signal using Surface module. The distribution of these co-registered signals in astrocytes was measured to be co-localized with GFAP and EGFP signals, respectively. In all case, imaging and analysis were conducted blind to animal treatment. Whole-brain clearing and analysis Same mice that underwent Gi activation during acquisition (Fig. 2 C, E) were anesthetized and their brains were fixed by intracardial perfusion of 4% PFA 90 min after the final Test 7. Brains were post-fixed in PFA at 4°C overnight and washed with PBS for 3 × 20 min. A bio-tissue oil-based clearing reagent kit (td21001, Thousand Dimensions Science and Technology) were employed for whole-brain clearing. Brains were transferred to a new tube filled with 15 mL permeabilization solution on a shaker at 40 rpm for 4 days. Then brains were gradually defatted with a series of degreasing solution kept rotating at 4°C for 4 days. Brains were washed in TBST (0.025% Triton in TBS) for 3 × 20 min then transferred to a new tube filled with blocking solution (PBS containing 0.5% Triton X, 0.3 M glycine and 2% donkey serum) and left rotating for 4 days at 4°C. Brains were then transferred to primary antibody solution (PBS containing 2% donkey serum and rabbit anti-c-Fos (1:500, 2250S, Cell Signaling Technology)) and left rotating for 12 days at 4°C. Brains were washed in TBST for 3 × 20 min and then placed in secondary antibody solution (PBS containing 2% donkey serum and Alexa Fluor 647 donkey anti-rabbit IgG (1:500, A31573, Invitrogen)). Samples were kept rotating at 4°C for 12 days and exposed to minimal light from this step onward. After incubation samples were washed in TBST for 3 × 20 min, then dehydrated and matched to a uniform refractive index at 37°C on a shaker to achieve tissue transparency. Brains were imaged by a lightsheet scanning microscopy (LS18, Nuohai Life Science) at a resolution of 1.65 × 1.65 × 3.5 µm, which could clearly distinguish the positive signal. The data processing included preprocessing of the original image data, stitching and combining of thumbnail images, brightness correction, and other corrections such as image background fluorescence elimination and image rotation correction to optimize the two dimensional images. After three-dimensional data reconstruction, followed by atlas registration, regional graphics and cell quantification, the number of c-Fos + cells in different brain regions was collected using Imaris 3D analysis software. The number of c-Fos + cells per brain region was first normalized by the volume of the same area in the Allen Brain Atlas, then compared between different groups using the independent Multiple t tests. Statistical analysis Single variable comparisons were made with two-tail paired or unpaired Student’s t test. Groups comparisons were made using one-way repeated measures analysis of variance (ANOVA) with Dunnett's multiple comparisons test, two-way repeated measures ANOVA with Sidak's multiple comparisons test or with Tukey's multiple comparisons test. All statistics were analyzed using Graphpad Prism 9.0 (GraphPad Software). P < 0.05 was taken as statistically significant. Data was expressed as means ± SEM. Results ACC astrocytes display altered Ca 2+ dynamics during the acquisition and retrieval of morphine-conditioned memory To test whether ACC astrocytes change their activity during morphine conditioned memory, we microinjected AAV-GfaABC1D-jGCaMP7f virus and implanted optical fibers into the ACC for astrocytic Ca 2+ activity recording (Fig. 1 A). Twenty-one days after recovery from the surgery, mice received canonical CPP training, and spent more time in the morphine-associated context during post-training recent and remote tests (Test 1 vs. Pre-test, 151.0 ± 33.45 vs. -43.06 ± 38.23, P < 0.01; Test 2 vs. Pre-test, 160.9 ± 22.11 vs. -43.06 ± 38.23, P < 0.01; Fig. 1 B). Firstly, Ca 2+ activity of ACC astrocytes was recorded for 15 minutes each morphine or saline conditioning session per day during the 4-consecutive conditioning days (Fig. 1 C-D and Supplementary Fig. S1 ). Results showed that though the integrated astrocytic Ca 2+ activity were not of significant difference when mice were in saline- or morphine-paired chambers (Mor vs. Sal, 194.4 ± 24.42 vs. 235 ± 25.64, P = 0.1545; Fig. 1 E), confinement in the morphine-paired chamber significantly increased the frequency (Fig. 1 F) and reduced the average peak of astrocytic Ca 2+ events (Fig. 1 G), suggesting that the ACC astrocytes displayed altered Ca 2+ dynamics during the acquisition of morphine-conditioned memory. Further analysis of Ca 2+ transients across the 4 training days ( Supplementary Fig. S1 A-C ) and within the 15 minutes ( Supplementary Fig. S1 D-F ) showed that astrocytic Ca 2+ transients gradually increased their frequency and decreased peak amplitude as conditioning intensifies ( Supplementary Fig. S1 B-C ), and within each recording session, the frequency and peak were rather stable ( Supplementary Fig. S1 E-F ), though the integrated activity showed slightly decreased between the first and last recording 5 minutes ( Supplementary Fig. S1 D ). We then recorded the astrocytic Ca 2+ activity 1 day (Test 1) and 14 days (Test 2) after conditioning when mice were allowed to freely explore the saline- or morphine-paired chambers (Fig. 1 H-I). Exploring the morphine-paired chamber drastically elevated integrated activity with increased frequency and unchanged peak upon both recent and remote retrieval tests (Fig. 1 J-L). Further analysis also revealed substantial increase in astrocytic Ca 2+ activity upon the entry into the morphine-paired side compared with the saline-paired side (Fig. 1 M-O). Overall, these results showed that ACC astrocytes displayed altered Ca 2+ dynamics during the acquisition and retrieval of morphine-conditioned memory. ACC astrocytes modulate morphine-conditioned memory via acquisition phase To further identify the role of ACC astrocytes in the morphine-conditioned memory, we employed chemogenetic manipulation during different stages of morphine-conditioned memory (Fig. 2 A). We injected AAV encoding astrocytic hM4Di or hM3Dq into the ACC, and the mCherry expression was restricted to GFAP-positive cells (Fig. 2 B and Supplementary Fig. S2A-B ). Gi activation significantly decreased the frequency, while Gq activation increased the frequency of astrocytic Ca 2+ events ( Supplementary Fig. S2C-E ). With the CNO administered during conditioning, before retrieval or between retrievals (Fig. 2 A), we could specifically manipulate ACC astrocytes during acquisition, retrieval and transfer phase, and examine the alterations in memory strength and retention. Results showed that mice with astrocytic Gi activation during acquisition displayed robust preference for morphine-paired chamber during Test 1 (CNO vs. Veh, 370.32 ± 53.01 vs. 212.98 ± 40.74, P < 0.05; Fig. 2 C), and this enhanced preference retained for at least 7 weeks (hM4Di + CNO: Test 7 vs. Pre-test, 235.32 ± 62.45 vs. -4.86 ± 49.16, P < 0.001; Test 7: hM4Di + CNO vs. hM4Di + Veh, 235.32 ± 62.45 vs. 36.63 ± 43.81, P < 0.05; Fig. 2 E), while mice with astrocytic Gq activation displayed less and shortened preference for morphine-paired chamber (hM3Dq + CNO: Test 2 vs. Pre-test, -22.66 ± 63.63 vs. -56.65 ± 38.18, P = 0.9792; Test 2: hM3Dq + CNO vs. hM3Dq + Veh, -22.66 ± 63.63 vs. 207.68 ± 32.22, P < 0.05; Fig. 2 D-E). Furthermore, CNO (5 mg/kg, i.p.) or vehicle were given 25 min before the retrieval tests to selectively activate astrocytes during retrieval. Neither Gi nor Gq activation of ACC astrocytes upon recent (Fig. 2 F-G) and remote retrieval (Fig. 2 H-I) altered mice’s preference for morphine-paired chamber. In addition, CNO (5 µg/mL) or vehicle in drinking water were given to mice for 14 days between Test 1 and Test 2 to selectively activate ACC astrocytes during memory transfer. The daily water consumption of mice was measured and CNO did not affect the water intake ( Supplementary Fig. S2F ). Both groups of mice could form morphine CPP, and neither Gi nor Gq activation of ACC astrocytes during memory transfer altered mice’s preference for morphine-paired chamber (Fig. 2 J-L). Furthermore, Gi activation of neither VTA nor NAc astrocytes during acquisition changed mice’s preference for morphine-paired side ( Supplementary Fig. S2G-H ). In summary, Gi activation of ACC astrocytes during memory acquisition phase enhanced the strength and retention of morphine-conditioned memory, while Gq activation during acquisition impaired the strength and retention of memory. Gi or Gq activation of ACC astrocytes during retrieval or transfer had no effect on the memory performance. Therefore, it is through the memory acquisition phase that ACC astrocytes regulate this morphine-associated memory. Astrocytic deletion of BEST1 during acquisition impairs morphine-conditioned memory Next, we sought to investigate the molecular alterations occurring in these ACC astrocytes during the acquisition phase. We examined the expression level of key molecules previously reported in regulating astrocytic morphology - Swell1, Cx43, Ezrin [ 38 – 40 ], astrocytic nutrition – ENT1, MCT1, MCT4, LDHA, GRα, GRβ [ 10 , 41 – 45 ], and transmitter metabolism – GS, PAR1, GLAST, GLT1, BEST1, GAT3, Maob, Dao, Aldh1a1 [ 2 , 32 , 45 – 48 ] after the last conditioning session in morphine CPP (MCPP) or saline CPP (SCPP) groups, or the last home cage injection of saline or morphine (Fig. 3 A). Results showed that the expression of Best1 ( Bestrophin1 ) mRNA related to glutamate and GABA transmitter release increased specifically in MCPP group (Fig. 3 A). The expression level of Aldh1a1 mRNA increased in both SCPP and MCPP groups compared with home cage injection groups, suggesting that Aldh1a1 may participate in the associative learning of drug-context, not specifically morphine-context. Moreover, the increase in BEST1 protein level was mainly in S100β-positive astrocytes rather than NeuN-positive neurons (Fig. 3 B-C). Therefore, we constructed an adeno-associated virus with shRNA targeting Best1 gene driven by astrocyte-specific promoter GfaABC1D or its control scrambled RNA, and microinjected the viruses into the ACC (Fig. 3 D-E). Virus expression was restricted to GFAP-positive cells within the ACC region (Fig. 3 D), and BEST1 protein expression in astrocytes was downregulated by about 30% in shRNA group compared with scramble group during MCPP acquisition ( Best1 shRNA vs. Scramble, 10.14 ± 1.729% vs. 42.63 ± 2.233%, P < 0.001; Fig. 3 E). Astrocytic knockdown of BEST1 significantly increased the frequency of Ca 2+ events during acquisition (Fig. 3 F-I ) . These results suggest that our constructed Best1 shRNA virus was astrocytes-specific, efficient in BEST1 knockdown, and affected astrocytic Ca 2+ -dependent functions. Behaviorally, mice with this specific ablation of BEST1 from ACC astrocytes still displayed preference for morphine-paired chamber upon Test 1 and Test 2. Compared with scramble group, the extent of preference in Best1 shRNA group was significantly decreased, with the CPP score 131.72 ± 34.37 s in shRNA group, compared with 261.27 ± 34.51 s in scramble group in Test 1 ( P < 0.05), and CPP score 86.72 ± 31.39 s in shRNA group, compared with 247.48 ± 45.09 s in scramble group in Test 2 ( P < 0.05; Fig. 3 J-L). Overall, these results suggest that astrocytic BEST1 expression modulates the strength of formed morphine-context associative memory through intracellular Ca 2+ -dependent functions. Astrocytic BEST1 influences the proximity of astrocytes to synapses connecting the dCA1 region and the ACC Astrocytic Ca 2+ -dependent pathways play crucial roles in regulating its morphology [ 49 ], nutrition [ 50 ] and transmitter [ 51 ] dynamics. BEST1, as a volume-sensitive ion channel, was reported to regulate cell morphology [ 52 – 54 ], and morphology changes in astrocytes could affect the function of neuronal synapses within the astrocytic domains [ 4 , 55 , 56 ]. Therefore, we set out to examine how astrocytic BEST1 affect cell morphology and neuronal synapses within astrocytic microdomains. After the last conditioning session in MCPP, we examined the morphological changes in the astrocytes and the density of synapses within astrocytic microdomains. The AAV- GfaABC1D -EGFP marked out the territory of astrocytes, and GFAP staining labelled the primary branches of astrocytes [ 57 , 58 ] (Fig. 4 A). Compared with scramble in MCPP, knockdown of astrocytic BEST1 in MCPP mice increased the cell volume (Fig. 4 B), number of primary branches (Fig. 4 C), number of processes (Fig. 4 D) and process complexity (Fig. 4 E). We further examined neural synapses within astrocytic microdomains by immunohistochemical staining of synaptophysin (SYP), a presynaptic marker of neural connections (Fig. 4 F). Astrocytic knockdown of BEST1 increased the total number of SYP puncta within the astrocytic coverage (Fig. 4 G), with higher proportion of dense-synapse microdomains (Fig. 4 H) but not much change in synapse distribution within the microdomains (Fig. 4 I). Given that BEST1 knockdown drastically changed the overall synaptic density within astrocytic microdomains, and ACC receives neural projections from multiple brain regions, which synapses in the ACC are affected and might account for the BEST1-regulated memory strength? In Fig. 2 C-E, ACC astrocytic Gi activation significantly enhanced memory strength and retention. Post hoc analysis revealed higher c-Fos activation in the CA1 region from memory enhanced mice in CNO group (Fig. 5 A-E), and retro-AAV-EGFP injection in the ACC (Fig. 5 F) showed abundant dCA1 neurons that send specific projections to ACC (Fig. 5 G). We then employed circuit-specific viruses (Fig. 5 H) and successfully labelled nerve terminals in the ACC derived from dorsal hippocampal CA1 (dCA1). After the last conditioning session in MCPP, immunostaining revealed that SYP puncta and dCA1 synaptic terminals co-located significantly in the astrocytic coverage region (Fig. 5 I). Compared with scramble group, both dCA1-derived synapses (Fig. 5 J) and synapses from other brain regions (Fig. 5 K) increased in the Best1 shRNA group. Of note, dCA1-derived synapses, not the other brain regions-derived ones, preferentially reside around the astrocytic soma and primary branches in the Best1 shRNA group (Fig. 5 L-M). In all, during the formation of morphine-associative memory, the level of BEST1 expression in ACC astrocytes affected the density and distribution of dCA1-ACC synapses within the astrocytic microdomains, suggesting that astrocytic BEST1 might play a role in modulating the dCA1-ACC neural connectivity. BEST1 modulates astrocytic glutamate release and Ca 2+ activity of ACC dCA1 neurons Previous studies reported that BEST1, as a macromolecular permeable ion channel modulates the astrocytic release of glutamate and GABA [ 22 , 23 ], which through action on the extrasynaptic receptors within the microdomains [ 23 , 59 ], affects synaptic transmission. To test the hypothesis, we microinjected the astrocyte-specific glutamate sensor (Fig. 6 A) or GABA sensor (Fig. 6 D) in the ACC and recorded the astrocytic release of glutamate and GABA during the conditioning phase of MCPP. Results showed that, during conditioning when mice were confined to the saline-paired compartment, glutamate release was not changed in Best1 shRNA group compared with scramble group (Fig. 6 B-C); whereas during the conditioning when mice were confined to the morphine-paired compartment, glutamate release were significantly blunted in Best1 shRNA group (Fig. 6 B-C). In addition, neither the conditioning of saline/ morphine nor the Scramble/ Best1 shRNA changed the astrocytic GABA release (Fig. 6 E-F). These results showed that BEST1 specifically regulates astrocytic glutamate but not GABA release during the morphine-context pairing stage, and this alteration of astrocytic glutamate release might act through extrasynaptic metabolic/ionic glutamate receptors to affect the strength of synaptic transmission. To further examine how BEST1 modulate the neural connectivity from dCA1 to ACC, we first studied the ACC neural population receiving dCA1 projections, i.e. ACC dCA1 neurons. By cross-synaptic virus-specific labeling (Fig. 6 G), we found that ACC dCA1 neurons mainly reside in the layer V (Fig. 6 G-H). Further co-staining with different neuronal markers revealed that about 45.70 ± 2.159% and 31.95 ± 2.009% of ACC dCA1 neurons are CaMKII-positive and VIP-positive, respectively (Fig. 6 I-J). We specifically labelled these ACC dCA1 neurons with Ca 2+ indicator GCaMP6s and recorded the Ca 2+ activity of these neurons during the conditioning phase of MCPP (Fig. 6 K-L). Results showed that during conditioning when mice were confined to the saline-paired compartment, the integrated Ca 2+ activity was not changed in Best1 shRNA group compared with scramble group (Fig. 6 M-N); whereas during the conditioning when mice were confined to the morphine-paired compartment, the integrated Ca 2+ activity was significantly blunted in Best1 shRNA group (Fig. 6 M-N ) . This activity decrease in Best1 shRNA group was largely attributed to impaired Ca 2+ event peak rather than frequency (Fig. 6 O-P). In summary, ACC astrocytic BEST1 knockdown blunts the astrocytic glutamate release and impaired the activity of ACC dCA1 neurons during the conditioning phase of morphine CPP, suggesting that the change of BEST1 function may affect the activity of neurons and participate in the regulation of morphine-associative memory strength and maintenance. Discussion In this study, we explored the role of ACC astrocytes in morphine-conditioned memory. During this process, we found that ACC astrocytes displayed altered Ca 2+ dynamics during the acquisition and retrieval of morphine-conditioned memory. Chemogenetic manipulation revealed that it is through the memory acquisition phase which ACC astrocytes regulate this morphine-associated memory. Specifically, the function of astrocytes during acquisition was accompanied by increased expression of BEST1 channel. Astrocytic BEST1 modulate cell morphology and density of synapses in microdomains during acquisition. The BEST1 expression in ACC astrocytes affected the density and distribution of dCA1-ACC synapses within the astrocytic microdomains. Moreover, ACC astrocytic BEST1 knockdown blunts the astrocytic glutamate release and impaired the activity of ACC dCA1 neurons during the conditioning phase of morphine CPP. These data showed the contribution of ACC astrocytic BEST1 to the morphine addiction memory formation and maintenance. Previous studies have found that astrocytes in brain regions associated with addiction can profoundly influence addiction memories with diverse pathways [ 60 , 61 ]. In VTA, cocaine CPP enhanced tonic GABA release from astrocytes mediated by the volume-regulated anion channel VRAC and increased neuronal firing rates, resulting in significant decreases in motor activity and CPP scores in cocaine-addicted mice [ 3 ]. In NAc, regression of heroin-addicted memories reduces the number of synapses in astrocyte-covered areas and is restored during subsequent transient drug seeking [ 56 ]. In our findings, Gi activation of astrocytes in VTA and NAc during the formative phase of addiction memory did not affect the intensity and duration of morphine CPP formation. Gi activation in ACC astrocytes during memory formation increased the intensity of morphine CPP and prolonged the duration of addiction memory, suggesting that ACC astrocytes may have a unique role in the study of astrocytes affecting addiction memory. Furthermore, when ACC astrocytes are regulated at other stages, our results show no effect on short-term memory retrieval, memory transfer, and long-term memory retrieval, suggesting that ACC astrocytes play a key role only in morphine addiction memory formation. Ca 2+ signal is an important indicator of astrocyte activity. Regulation of Ca 2+ activity can affect local synaptic function and memory behavior [ 51 , 62 ]. Some studies have shown that Gq activation of hippocampal CA1 astrocytes in mice can significantly increase intracellular Ca 2+ activity and Ca 2+ event frequency, which in turn enhances the spontaneous firing of pyramidal neurons and the induction of NMDA dependent LTP, and improves the retrieval of spatial memory and fear memory in mice [ 14 ]. An increase in intracellular Ca 2+ activity or frequency is considered a marker of altered astrocyte activity [ 63 , 64 ]. In contrast, Gi activation significantly decreased baseline Ca 2+ levels and peak responses to Ca 2+ events in CA1 astrocytes, and Gi activation during memory formation decreased retrieval of long-term fear memories in mice [ 15 ]. Our results showed that ACC astrocytes Ca 2+ activity increased significantly during morphine CPP formation, short-term and long-term morphine CPP extraction, and showed an increase in signal frequency and a decrease in peak value, suggesting that ACC astrocytes were activated during morphine addiction memory formation and extraction, and participated in the regulation of addiction memory. Astrocytes can affect memory through morphological changes, nutritional regulation, and transmitter metabolism. Morphologically, for example, knockout of actin Ezrin in CA1 astrocytes shortened astrocyte lobules and increased spacing from the postsynaptic dense zone, resulting in increased extrasynaptic glutamate diffusion, which in turn significantly increased NMDA receptor-mediated EPSC on CA1 pyramidal neurons, enhancing retrieval of recent fear memories in mice [ 65 ]. In terms of nutritional regulation, for example, extraction of cocaine addiction memory can increase protein levels of monocarboxylic acid transporter MCT1 mainly expressed on astrocytes in BLA, while interference with translation of Mct1 gene can reduce phosphorylation of plasticity-related proteins CREB, cofilin and ERK1/2, impairing the consolidation of cocaine addiction memory and can be rescued by exogenous L-lactic acid [ 66 ]. In terms of affecting transmitter metabolism, some studies have found that in the hippocampus of BEST1 knockout mice, there is a decrease in the co-release of glutamate and D-serine, a decrease in the functionality of NMDA receptors in the extrasynaptic region, and an abnormal induction of LTD, resulting in cognitive flexibility defects and impaired formation of flexible memory in mice. These abnormalities can be rescued by specifically enhancing the expression of BEST1 in astrocytes [ 23 ]. Our results show that Best1 , associated with Glu and GABA release, is significantly upregulated during morphine CPP formation. Based on this, we specifically knocked down BEST1 in ACC astrocytes and found that it could significantly reduce the formation intensity and maintenance time of morphine CPP, indicating that BEST1 plays an important role in the formation of morphine CPP and mediates the formation and maintenance of morphine addiction memory. The morphological changes of astrocytes affect the memory process [ 65 , 67 ]. Although there is no direct report on the morphological effect of BEST1 on astrocytes, it has been found that BEST1 expression can impair cell volume retraction in BEST1 knockout mice or in the hippocampus-specific knockdown, and cell volume can be restored to normal when astrocyte-derived BEST1 is supplemented [ 52 , 68 ]. This is in agreement with the trends we have reported in the results. During the formation of morphine CPP, knockdown of BEST1 in ACC astrocytes can increase cell volume, number of main branches and complexity, and significantly increase the number of synapses in the microdomain. We also found that the increased synapses come from not only the dorsal hippocampal CA1, but also the synaptic connections between ACC and other brain regions. These results suggest that BEST1 may regulate the morphological plasticity of ACC astrocytes, influence the possibility of direct interaction between astrocytes and neurons, and participate in the formation and maintenance of addiction memory. As for the changes in synaptic distribution within astrocyte microdomains, especially from dorsal CA1 synapses, we found that CA1 synaptic terminals were more co-localized with astrocyte soma and main branches after knockdown of BEST1. It has been found that in astrocyte microdomains of hippocampus CA1 of APP/PS1 mice, the expression intensity of BEST1 is reduced, and the distribution in cell body and process is increased, which is accompanied by target transformation with reduced co-localization with glutamate transporter vGLUT2 and increased co-localization of GABA transporter vGAT [ 2 , 26 ]. In addiction memories, heroin regression training increased selective modulation of co-localization with NAc D1-MSN synaptic terminals in VP astrocyte microdomains without altering co-localization with D2-MSN synaptic terminals [ 4 ]. Compared with soma and main branch, branchlets within astrocyte microdomains are widely thought to be sites of high frequency interaction with synapses [ 69 , 70 ]. These results suggest that the level of BEST1 may be involved in the regulation of trilateral synapses during the formation of morphine addiction memory, and its distribution may interact with synaptic terminals from brain regions closely related to the formation of addiction memory, such as dCA1, so as to release transmitters to preferentially regulate dCA1-ACC neural pathway. BEST1 mediates the release of glutamate and GABA from astrocytes and is involved in neuroregulation affecting behavioral phenotypes [ 23 , 71 ]. Our results show that, during morphine CPP formation, knockdown of ACC astrocytes BEST1 reduces glutamate release, while GABA total activity remains unchanged, suggesting that astrocytes are involved in addiction memory formation through BEST1-mediated glutamate release. This is consistent with other studies showing that chronic morphine exposure reduces glutamate levels in multiple brain regions, including ACC [ 72 – 74 ]. Furthermore, deletion of BEST1 in astrocytes resulted in decreased activity of ACC dCA1 neurons, which were mostly CaMKII positive and VIP positive neurons, and their activity changes were generally consistent. Recently, it has been found that there are engram neurons in the prefrontal cortex that encode fear memories [ 75 , 76 ]. Therefore, we hypothesized that ACC dCA1 neurons were probably engram cells encoding memory. ACC astrocytes facilitated their activation by BEST1-mediated glutamate release, which increased the number of imprinted cells at this stage, resulting in significantly increased memory formation intensity and maintenance time. Declarations Conflicts of interest There is no conflict of interest for the studies in this article. Author contributions L.S. conceived the project. L.S. and YJ.L. supervised all experiments. L.S., YJ.L. and Z.L. designed the experiments. Z.L. and YF.L. performed the experiments and analyzed the data. Z.L., X.L. and Y.H. analyzed behavioral data. Z.L., S.G., X.F., X.Y., Y.Y., J.L., N.W. and S.S. analyzed immunohistochemical data. Z.L. and L.S. wrote the manuscript. All of the authors contributed to data interpretation. Acknowledgements This work was supported by National Natural Science Foundation of China grants 82101312 (L.S.), 82371231 (L.S.), 81901350 (N.W.), 81771433 (YJ.L.) as well as Natural Science Foundation of Beijing (7222110) (L.S.). References Sun W, Liu Z, Jiang X, Chen M, Dong H, Liu J et al . Spatial transcriptomics reveal neuron-astrocyte synergy in long-term memory. Nature 2024; 627: 374–381. Jo S, Yarishkin O, Hwang Y, Chun Y, Park M, Woo D et al . GABA from reactive astrocytes impairs memory in mouse models of Alzheimer's disease. Nat Med 2014; 20: 886–896. Yang J, Chen J, Liu Y, Chen K, Baraban J, Qiu Z. Ventral tegmental area astrocytes modulate cocaine reward by tonically releasing GABA. Neuron 2023; 111: 1104–1117. Kruyer A, Dixon D, Angelis A, Amato D, Kalivas P. Astrocytes in the ventral pallidum extinguish heroin seeking through GAT-3 upregulation and morphological plasticity at D1-MSN terminals. Mol Psychiatry 2022; 27: 855–864. Aten S, Kiyoshi C, Arzola E, Patterson J, Taylor A, Du Y et al . Ultrastructural view of astrocyte arborization, astrocyte-astrocyte and astrocyte-synapse contacts, intracellular vesicle-like structures, and mitochondrial network. Prog Neurobiol 2022; 213: 102264. Chi S, Cui Y, Wang H, Jiang J, Zhang T, Sun S et al . Astrocytic Piezo1-mediated mechanotransduction determines adult neurogenesis and cognitive functions. Neuron 2022; 110: 2984–2999. Iqbal Z, Lei Z, Ramkrishnan A, Liu S, Hasan M, Akter M et al . Adrenergic signalling to astrocytes in anterior cingulate cortex contributes to pain-related aversive memory in rats. Commun Biol 2023; 6: 10. Li X, Zhang J, Li D, He C, He K, Xue T et al . Astrocytic ApoE reprograms neuronal cholesterol metabolism and histone-acetylation-mediated memory. Neuron 2021; 109: 957–970. Suzuki A, Stern SA, Bozdagi O, Huntley G, Walker R, Magistretti P et al . Astrocyte-neuron lactate transport is required for long-term memory formation. Cell 2011; 144: 810–823. Skupio U, Tertil M, Bilecki W, Barut J, Korostynski M, Golda S et al . Astrocytes determine conditioned response to morphine via glucocorticoid receptor-dependent regulation of lactate release. Neuropsychopharmacology 2020; 45: 404–415. Xiong S, Xiao H, Sun M, Liu Y, Gao L, Xu K et al . Glutamate-releasing BEST1 channel is a new target for neuroprotection against ischemic stroke with wide time window. Acta Pharm Sin B 2023; 13: 3008–3026. Byun Y, Kim N, Kim G, Jeon Y, Choi J, Park C et al . Stress induces behavioral abnormalities by increasing expression of phagocytic receptor MERTK in astrocytes to promote synapse phagocytosis. Immunity 2023; 56: 2105–2120. Lee J, Kim J, Noh S, Lee H, Lee S, Mun J et al . Astrocytes phagocytose adult hippocampal synapses for circuit homeostasis. Nature 2021; 590: 612–617. Adamsky A, Kol A, Kreisel T, Doron A, Ozeri-Engelhard N, Melcer T et al . Astrocytic activation generates de novo neuronal potentiation and memory enhancement. Cell 2018; 174: 59–71. Kol A, Adamsky A, Groysman M, Kreisel T, London M, Goshen I. Astrocytes contribute to remote memory formation by modulating hippocampal-cortical communication during learning. Nat Neurosci 2020; 23: 1229–1239. Zhang K, Förster R, He W, Liao X, Li J, Yang C et al . Fear learning induces α7-nicotinic acetylcholine receptor-mediated astrocytic responsiveness that is required for memory persistence. Nat Neurosci 2021; 24: 1686–1698. Oh S, Lee C. Distribution and function of the Bestrophin-1 (Best1) channel in the brain. Exp Neurobiol 2017; 26: 113–121. Petrukhin K, Koisti M, Bakall B, Li W, Xie G, Marknell T et al . Identification of the gene responsible for Best macular dystrophy. Nat Genet 1998; 19: 241–247. Marquardt A, Stöhr H, Passmore L, Krämer F, Rivera A, Weber B. Mutations in a novel gene, VMD2 , encoding a protein of unknown properties cause juvenile-onset vitelliform macular dystrophy (Best's disease). Hum Mol Genet 1998; 7: 1517–1525. Park H, Oh S, Han K, Woo D, Park H, Mannaioni G et al . Bestrophin-1 encodes for the Ca 2+ -activated anion channel in hippocampal astrocytes. J Neurosci 2009; 29: 13063–13073. Oh S, Han K, Park H, Woo D, Kim H, Traynelis S et al . Protease activated receptor 1-induced glutamate release in cultured astrocytes is mediated by Bestrophin-1 channel but not by vesicular exocytosis. Mol Brain 2012; 5: 38. Lee S, Yoon B, Berglund K, Oh S, Park H, Shin H et al . Channel-mediated tonic GABA release from glia. Science 2010; 330: 790–796. Koh W, Park M, Chun Y, Lee J, Shim H, Park M et al . Astrocytes render memory flexible by releasing D-Serine and regulating NMDA receptor tone in the hippocampus. Biol Psychiatry 2022; 91: 740–752. Woo J, Min J, Kang D, Kim Y, Jung G, Park H et al . Control of motor coordination by astrocytic tonic GABA release through modulation of excitation/inhibition balance in cerebellum. Proc Natl Acad Sci U S A 2018; 115: 5004–5009. Woo D, Han K, Shim J, Yoon B, Kim E, Bae J et al . TREK-1 and Best1 channels mediate fast and slow glutamate release in astrocytes upon GPCR activation. Cell 2012; 151: 25–40. An H, Koh W, Kang S, Nam M, Lee C. Differential proximity of perisynaptic astrocytic Best1 at the excitatory and inhibitory tripartite synapses in APP/PS1 and MAOB-KO mice revealed by lattice structured illumination microscopy. Exp Neurobiol 2021; 30: 213–221. Doron A, Rubin A, Benmelech-Chovav A, Benaim N, Carmi T, Refaeli R et al . Hippocampal astrocytes encode reward location. Nature 2022; 609: 772–778. Rao J, Sun W, Wang X, Li J, Zhang Z, Zhou F. A novel role for astrocytic fragmented mitochondria in regulating morphine addiction. Brain, Behav, Immun 2023; 113: 328–339. Wang J, Li K, Shukla A, Beroun A, Ishikawa M, Huang X et al . Cocaine triggers astrocyte-mediated synaptogenesis. Biol Psychiatry 2021; 89: 386–397. Kitamura T, Ogawa S, Roy D, Okuyama T, Morrissey M, Smith L et al . Engrams and circuits crucial for systems consolidation of a memory. Science 2017; 356: 73–78. Sun N, Chi N, Lauzon N, Bishop S, Tan H, Laviolette S. Acquisition, extinction, and recall of opiate reward memory are signaled by dynamic neuronal activity patterns in the prefrontal cortex. Cereb Cortex 2011; 21: 2665–2680. Kwak H, Koh W, Kim S, Song K, Shin J, Lee J et al . Astrocytes control sensory acuity via tonic inhibition in the thalamus. Neuron 2020; 108: 691–706. Keyes P, Adams E, Chen Z, Bi L, Nachtrab G, Wang V et al . Orchestrating opiate-associated memories in thalamic circuits. Neuron 2020; 107: 1113–1123. Ni T, Zhu L, Wang S, Zhu W, Xue Y, Zhu Y et al . Medial prefrontal cortex Notch1 signalling mediates methamphetamine-induced psychosis via Hes1-dependent suppression of GABA B1 receptor expression. Mol Psychiatry 2022; 27: 4009–4022. van Crugten J, Somogyi A, Nation R, Reynolds G. Concentration-effect relationships of morphine and morphine-6 beta-glucuronide in the rat. Clin Exp Pharma Physio 1997; 24: 359–364. Gunaydin L, Grosenick L, Finkelstein J, Kauvar I, Fenno L, Adhikari A et al . Natural neural projection dynamics underlying social behavior. Cell 2014; 157: 1535–1551. Zhan J, Komal R, Keenan W, Hattar S, Fernandez D. Non-invasive strategies for chronic manipulation of dreadd-controlled neuronal activity. J Visualized Exp 2019; 2019. Cheung G, Bataveljic D, Visser J, Kumar N, Moulard J, Dallérac G et al . Physiological synaptic activity and recognition memory require astroglial glutamine. Nat Commun 2022; 13: 753. Zhou B, Chen L, Liao P, Huang L, Chen Z, Liao D et al . Astroglial dysfunctions drive aberrant synaptogenesis and social behavioral deficits in mice with neonatal exposure to lengthy general anesthesia. PLoS Biol 2019; 17: e3000086. Qiu Z, Dubin A, Mathur J, Tu B, Reddy K, Miraglia L et al . SWELL1, a plasma membrane protein, is an essential component of volume-regulated anion channel. Cell 2014; 157: 447–458. Kang S, Hong S, Lee J, Peyton L, Baker M, Choi S et al . Activation of astrocytes in the dorsomedial striatum facilitates transition from habitual to goal-directed reward-seeking behavior. Biol Psychiatry 2020; 88: 797–808. Boury-Jamot B, Carrard A, Martin J, Halfon O, Magistretti P, Boutrel B. Disrupting astrocyte-neuron lactate transfer persistently reduces conditioned responses to cocaine. Mol Psychiatry 2016; 21: 1070–1076. Yin Y, Hu J, Wei Y, Li Z, Luo Z, Wang R et al . Astrocyte-derived lactate modulates the passive coping response to behavioral challenge in male mice. Neurosci Bull 2021; 37: 1–14. Muraleedharan R, Gawali M, Tiwari D, Sukumaran A, Oatman N, Anderson J et al . AMPK-regulated astrocytic lactate shuttle plays a non-cell-autonomous role in neuronal survival. Cell Rep 2020; 32: 108092. Kazazoglou T, Panagiotou C, Mihailidou C, Kokkinopoulou I, Papadopoulou A, Moutsatsou P. Glutamine synthetase regulation by dexamethasone, RU486, and compound A in astrocytes derived from aged mouse cerebral hemispheres is mediated via glucocorticoid receptor. Mol Cell Biochem 2021; 476: 4471–4485. Dematteis G, Restelli E, Chiesa R, Aronica E, Genazzani A, Lim D et al . Calcineurin controls expression of EAAT1/GLAST in mouse and human cultured astrocytes through dynamic regulation of protein synthesis and degradation. Int J Mol Sci 2020; 21: 2213. Boender A, Bontempi L, Nava L, Pelloux Y, Tonini R. Striatal astrocytes shape behavioral flexibility via regulation of the glutamate transporter EAAT2. Biol Psychiatry 2021; 89: 1045–1057. Wearne T, Parker L, Franklin J, Goodchild A, Cornish J. GABAergic mRNA expression is differentially expressed across the prelimbic and orbitofrontal cortices of rats sensitized to methamphetamine: relevance to psychosis. Neuropharmacology 2016; 111: 107–118. Semyanov A, Verkhratsky A. Astrocytic processes: from tripartite synapses to the active milieu. Trends Neurosci 2021; 44: 781–792. Bohmbach K, Henneberger C, Hirrlinger J, Bolaños J. Astrocytes in memory formation and maintenance. Essays Biochem 2023; 67: 107–117. Goenaga J, Araque A, Kofuji P, Herrera Moro Chao D. Calcium signaling in astrocytes and gliotransmitter release. Front Synaptic Neurosci 2023; 15: 1138577. Woo J, Jang M, Lee J, Koh W, Mikoshiba K, Lee C. The molecular mechanism of synaptic activity-induced astrocytic volume transient. J Physiol 2020; 598: 4555–4572. Cheng H, Chen D, Li X, Al-Sheikh U, Duan D, Fan Y et al . Phasic/tonic glial GABA differentially transduce for olfactory adaptation and neuronal aging. Neuron 2024 (in press). Milenkovic A, Brandl C, Milenkovic V, Jendryke T, Sirianant L, Wanitchakool P et al . Bestrophin1 is indispensable for volume regulation in human retinal pigment epithelium cells. Proc Natl Acad Sci U S A 2015; 112. Santello M, Toni N, Volterra A. Astrocyte function from information processing to cognition and cognitive impairment. Nat Neurosci 2019; 22: 154–166. Kruyer A, Scofield M, Wood D, Reissner K, Kalivas P. Heroin cue-evoked astrocytic structural plasticity at nucleus accumbens synapses inhibits heroin seeking. Biol Psychiatry 2019; 86: 811–819. Sofroniew MV, Vinters HV. Astrocytes: biology and pathology. Acta Neuropathol 2010; 119: 7–35. Shigetomi E, Bushong E, Haustein M, Tong X, Jackson-Weaver O, Kracun S et al . Imaging calcium microdomains within entire astrocyte territories and endfeet with GCaMPs expressed using adeno-associated viruses. J Gen Physiol 2013; 141: 633–647. Park H, Han K, Seo J, Lee J, Dravid S, Woo J et al . Channel-mediated astrocytic glutamate modulates hippocampal synaptic plasticity by activating postsynaptic NMDA receptors. Mol Brain 2015; 8: 7. Kruyer A, Chioma V, Kalivas P. The opioid-addicted tetrapartite synapse. Biol Psychiatry 2020; 87: 34–43. Kim R, Healey K, Sepulveda-Orengo M, Reissner K. Astroglial correlates of neuropsychiatric disease: From astrocytopathy to astrogliosis. Prog Neuro-Psychopharmacol Biol Psychiatry 2018; 87: 126–146. Srinivasan R, Huang B, Venugopal S, Johnston A, Chai H, Zeng H et al . Ca 2+ signaling in astrocytes from Ip3r2 –/– mice in brain slices and during startle responses in vivo . Nat Neurosci 2015; 18: 708–717. Bazargani N, Attwell D. Astrocyte calcium signaling: the third wave. Nat Neurosci 2016; 19: 182–189. Codeluppi S, Xu M, Bansal Y, Lepack A, Duric V, Chow M et al . Prefrontal cortex astroglia modulate anhedonia-like behavior. Mol Psychiatry 2023; 28: 4632–4641. Badia-Soteras A, Heistek T, Kater M, Mak A, Negrean A, van den Oever M et al . Retraction of Astrocyte Leaflets From the Synapse Enhances Fear Memory. Biol Psychiatry 2023; 94: 226–238. Zhang Y, Xue Y, Meng S, Luo Y, Liang J, Li J et al . Inhibition of lactate transport erases drug memory and prevents drug relapse. Biol Psychiatry 2016; 79: 928–939. Zhou B, Zuo Y, Jiang R. Astrocyte morphology: Diversity, plasticity, and role in neurological diseases. CNS Neurosci Ther 2019; 25: 665–673. Woo J, Han Y, Koh W, Won J, Park M, An H et al . Pharmacological dissection of intrinsic optical signal reveals a functional coupling between synaptic activity and astrocytic volume transient. Exp Neurobiol 2019; 28: 30–42. Allen N, Eroglu C. Cell biology of astrocyte-synapse interactions. Neuron 2017; 96: 697–708. Octeau J, Chai H, Jiang R, Bonanno S, Martin K, Khakh B. An optical neuron-astrocyte proximity assay at synaptic distance scales. Neuron 2018; 98: 49–66. Cheng Y, Woo J, Luna-Figueroa E, Maleki E, Harmanci A, Deneen B. Social deprivation induces astrocytic TRPA1-GABA suppression of hippocampal circuits. Neuron 2023; 111: 1301–1315. Hao Y, Yang J, Guo M, Wu C, Wu M. Morphine decreases extracellular levels of glutamate in the anterior cingulate cortex: an in vivo microdialysis study in freely moving rats. Brain Res 2005; 1040: 191–196. Xiang Y, Gao H, Zhu H, Sun N, Ma Y, Lei H. Neurochemical changes in brain induced by chronic morphine treatment: NMR studies in thalamus and somatosensory cortex of rats. Neurochem Res 2006; 31: 1255–1261. Greenwald M, Woodcock E, Khatib D, Stanley J. Methadone maintenance dose modulates anterior cingulate glutamate levels in heroin-dependent individuals: A preliminary in vivo 1 H MRS study. Psychiatry Res Neuroimaging 2015; 233: 218–224. Lee J, Kim W, Park E, Cho J. Neocortical synaptic engrams for remote contextual memories. Nat Neurosci 2023; 26: 259–273. Rajasethupathy P, Sankaran S, Marshel J, Kim C, Ferenczi E, Lee S et al . Projections from neocortex mediate top-down control of memory retrieval. Nature 2015; 526: 653–659. Additional Declarations The authors have declared there is NO conflict of interest to disclose Supplementary Files 2024.4.15Supplementary.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4272120","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":316135522,"identity":"b4ccdf7e-7328-409c-9c61-e2407cfa2720","order_by":0,"name":"Linlin Sun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA10lEQVRIiWNgGAWjYBACPmYGxgMJYCbzAcYGEH2AgBY2ZqAaiBa2BCK1INTwGBCphZ33wIGHOxjsDW73fHs4s41Bju9GAuPnArwO40s4kHiGIXHDnbPbDTe2MRhL3khglp6BVwuPwYHENoYEgxu52yQftgH13kgAChKhxd7gRs4zkJZ6orUwbriRwya5EWwdcVokEmfeSDM3nHFOwnDmmYfN0vi08POfMXz4s83Gnu9G8rOHPWU28nzHkw9+xqcFCiTANkIZkOghCrARrXIUjIJRMApGFgAAsX1JzTLSgGoAAAAASUVORK5CYII=","orcid":"","institution":"Peking University","correspondingAuthor":true,"prefix":"","firstName":"Linlin","middleName":"","lastName":"Sun","suffix":""},{"id":316135523,"identity":"b4a19252-2ab5-4200-953f-aa78f1ab1ca7","order_by":1,"name":"Zepeng Liu","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Zepeng","middleName":"","lastName":"Liu","suffix":""},{"id":316135524,"identity":"df388878-08e8-4f0d-843b-57315f268e7a","order_by":2,"name":"Yifan Li","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Yifan","middleName":"","lastName":"Li","suffix":""},{"id":316135525,"identity":"00332dbb-8c86-416c-9b2d-9dd2ad421961","order_by":3,"name":"Xiaorui Lin","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Xiaorui","middleName":"","lastName":"Lin","suffix":""},{"id":316135526,"identity":"93394deb-dc10-42c5-9e97-9c308295171e","order_by":4,"name":"Yu Huo","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Huo","suffix":""},{"id":316135527,"identity":"7f37c9f8-fd1d-4213-b6e3-6abb9e0d3af2","order_by":5,"name":"Shengyang Guo","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Shengyang","middleName":"","lastName":"Guo","suffix":""},{"id":316135528,"identity":"f54493d4-d918-4409-ab5d-bb73e62b1702","order_by":6,"name":"Xiang Fan","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Xiang","middleName":"","lastName":"Fan","suffix":""},{"id":316135529,"identity":"b326c125-a5c3-4d8e-bf68-48b88fc390d9","order_by":7,"name":"Xinzhi Ye","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Xinzhi","middleName":"","lastName":"Ye","suffix":""},{"id":316135530,"identity":"2f738b00-33da-498a-9cb7-494fd0511942","order_by":8,"name":"Yun Yao","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Yun","middleName":"","lastName":"Yao","suffix":""},{"id":316135531,"identity":"6232bbe7-a862-474d-bacd-759b6424c5ba","order_by":9,"name":"Jiao Liu","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Jiao","middleName":"","lastName":"Liu","suffix":""},{"id":316135532,"identity":"5d835193-6bf3-4093-8f53-0b199b4ac947","order_by":10,"name":"Ning Wang","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Ning","middleName":"","lastName":"Wang","suffix":""},{"id":316135533,"identity":"a513e412-a624-4446-8286-e770feca0981","order_by":11,"name":"Sen Song","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Sen","middleName":"","lastName":"Song","suffix":""},{"id":316135534,"identity":"7b7255ac-7ae8-4dde-901a-1dc93e17b9ee","order_by":12,"name":"Yijing Li","email":"","orcid":"","institution":"Peking University","correspondingAuthor":false,"prefix":"","firstName":"Yijing","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-04-15 23:30:14","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-4272120/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4272120/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":59647217,"identity":"79528483-a4ba-4455-a9fb-d9eebb992e57","added_by":"auto","created_at":"2024-07-04 09:03:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2515755,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eACC astrocytes display altered Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e dynamics during the acquisition and retrieval of morphine-conditioned memory. (A)\u003c/strong\u003e Diagram of virus injection and fiber placement (left) and representative images of GCaMP7f expression (right). Scale bar = 250 μm. \u003cstrong\u003e(B)\u003c/strong\u003e Representative heatmap (left) and CPP score (right) illustrate the establishment of morphine induced conditioned place preference model. Mor-paired or Sal-paired means morphine-paired or saline-paired chamber. n = 7 mice. One-way ANOVA (\u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1.863, 11.18)\u003c/sub\u003e = 16.95, \u003cem\u003eP\u003c/em\u003e = 0.0005) followed by Dunnett’s multiple comparisons test. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01. \u003cstrong\u003e(C)\u003c/strong\u003e Experimental timeline of astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity recording during acquisition for (\u003cstrong\u003eD-G\u003c/strong\u003e). Coloring means fiber photometry session. \u003cstrong\u003e(D)\u003c/strong\u003e Example traces of ACC astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e signals during saline or morphine conditioning. Scale bar, 30 s, 1% ΔF/F. \u003cstrong\u003e(E-G)\u003c/strong\u003e The integrated astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity (\u003cem\u003eP\u003c/em\u003e = 0.1545; \u003cstrong\u003eE\u003c/strong\u003e), frequency (\u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; \u003cstrong\u003eF\u003c/strong\u003e) and average peak (\u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; \u003cstrong\u003eG\u003c/strong\u003e) during acquisition. Each dot represents a training session per mouse. n = 7 mice. Two-tailed paired t test. \u003cstrong\u003e(H)\u003c/strong\u003e Experimental timeline of astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity recording during recent (Test 1) and remote (Test 2) retrieval tests for (\u003cstrong\u003eI-O\u003c/strong\u003e). Coloring means fiber photometry session. \u003cstrong\u003e(I)\u003c/strong\u003e Example traces of ACC astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e signals during retrieval test. Scale bar, 30 s, 1% ΔF/F. \u003cstrong\u003e(J-L)\u003c/strong\u003e The integrated astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity (\u003cstrong\u003eJ\u003c/strong\u003e), frequency (\u003cstrong\u003eK\u003c/strong\u003e) and average peak (\u003cstrong\u003eL\u003c/strong\u003e) when mice explored the conditioned chamber during Test 1 and Test 2. Each dot represents a mouse. n = 7 mice. Two-way ANOVA with Sidak's multiple comparisons test. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05. \u003cstrong\u003e(M)\u003c/strong\u003e Heatmaps of astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e signals as mice entry into the chamber. Each row plots one shuttle trial, and a total of 40 trials were illustrated. The color scale on the right indicates Z-scores. \u003cstrong\u003e(N)\u003c/strong\u003e Average Z-score traces of Ca\u003csup\u003e2+\u003c/sup\u003e signals aligned to the onset of entry. \u003cstrong\u003e(O)\u003c/strong\u003e The integrated astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity as mice entry into the chamber. Two-way ANOVA (main effect of group \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 12)\u003c/sub\u003e = 24.12, \u003cem\u003eP\u003c/em\u003e = 0.0004; main effect of test \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 12)\u003c/sub\u003e = 4.339, \u003cem\u003eP\u003c/em\u003e = 0.0593; interaction \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 12)\u003c/sub\u003e = 2.425, \u003cem\u003eP\u003c/em\u003e = 0.1454) with Sidak's multiple comparisons test. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, Mor \u003cem\u003evs.\u003c/em\u003e Sal. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Test 1 \u003cem\u003evs.\u003c/em\u003e Test 2. Data are presented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4272120/v1/9cc7500f5922080909aada40.png"},{"id":59647213,"identity":"faa506f1-4c51-4fe8-aa71-945ba7359ac8","added_by":"auto","created_at":"2024-07-04 09:03:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1841865,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eACC astrocytes modulates morphine-conditioned memory via acquisition phase. (A)\u003c/strong\u003e Experimental timeline for chemogenetic manipulation during different stages of morphine-conditioned memory. Coloring means Gi activation (red), Gq activation (blue) or vector control (white). Top panel for acquisition (\u003cstrong\u003eC-E\u003c/strong\u003e). Second panel for recent retrieval (\u003cstrong\u003eF-G\u003c/strong\u003e). Third panel for remote retrieval (\u003cstrong\u003eH-I\u003c/strong\u003e). Bottom panel for transfer (\u003cstrong\u003eJ-L\u003c/strong\u003e). \u003cstrong\u003e(B)\u003c/strong\u003e Schematic of virus injection and expression. mCherry is restricted in ACC astrocytes rather than neurons. Scale bar, 250 μm (left) and 50 μm (right). \u003cstrong\u003e(C-E)\u003c/strong\u003e CPP score for Test 1 (\u003cstrong\u003eC-D\u003c/strong\u003e) and Test 1-7 (\u003cstrong\u003eE\u003c/strong\u003e) after Gi or Gq activation during acquisition. n = 10 mice. \u003cstrong\u003e(F-G)\u003c/strong\u003e CPP score for Test 1 when Gi or Gq activation before recent retrieval. n = 10 mice. \u003cstrong\u003e(H-I)\u003c/strong\u003e CPP score for Test 2 when Gi or Gq activation before remote retrieval. n = 10 mice. \u003cstrong\u003e(J-L)\u003c/strong\u003e CPP score for Test 1-2 (\u003cstrong\u003eJ-K\u003c/strong\u003e) and Test 1-7 (\u003cstrong\u003eL\u003c/strong\u003e) after Gi or Gq activation during transfer. n = 10 mice. Two-way ANOVA with Sidak's multiple comparisons test. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, Test \u003cem\u003evs.\u003c/em\u003e Pre-test. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, CNO \u003cem\u003evs.\u003c/em\u003e Veh. Data are presented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4272120/v1/433b6f42db51c7da1f4bf490.png"},{"id":59647219,"identity":"e1407914-3aff-4815-9d58-62f577a31d73","added_by":"auto","created_at":"2024-07-04 09:03:51","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6802886,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAstrocytic deletion of BEST1 during acquisition impairs morphine-conditioned memory. (A)\u003c/strong\u003e The mRNA expression level of key molecules regulating astrocytic morphology, nutrition and transmitter metabolism after the last conditioning session in morphine CPP or saline CPP groups, or the last home cage injection of saline or morphine. Genes and encoded proteins are as follows: \u003cem\u003eLrrc8a\u003c/em\u003e, Swell1; \u003cem\u003eGJA1\u003c/em\u003e, Connexin 43; \u003cem\u003eEzr\u003c/em\u003e, Ezrin; \u003cem\u003eSlc29a1\u003c/em\u003e, Equilibrative nucleoside transporter type 1; \u003cem\u003eMct1\u003c/em\u003e, Monocarboxylate transporter 1; \u003cem\u003eMct4\u003c/em\u003e, Monocarboxylate transporter 4; \u003cem\u003eLdha\u003c/em\u003e, Lactate dehydrogenase A; \u003cem\u003eGrα\u003c/em\u003e, Glucocorticoid receptor α; \u003cem\u003eGrβ\u003c/em\u003e, Glucocorticoid receptor β; \u003cem\u003eGs\u003c/em\u003e, Glutamine synthetase; \u003cem\u003ePar1\u003c/em\u003e, Protease-activated receptor 1; \u003cem\u003eSlc1a3\u003c/em\u003e, Glutamate aspartate transporter 1; \u003cem\u003eSlc1a2\u003c/em\u003e, Glutamate transporter 1; \u003cem\u003eBest1\u003c/em\u003e, Bestrophin1; \u003cem\u003eSlc6a11\u003c/em\u003e, GABA transporter type 3; \u003cem\u003eMaob\u003c/em\u003e, Monoamine oxidase B; \u003cem\u003eDao\u003c/em\u003e, Diamine oxidase; \u003cem\u003eAldh1a1\u003c/em\u003e, Aldehyde dehydrogenase 1 family member A1. n = 6 mice. Two-way ANOVA (main effect of group \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(2.657, 239.2)\u003c/sub\u003e = 4.111, \u003cem\u003ep\u003c/em\u003e = 0.0097; main effect of gene \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(17, 90)\u003c/sub\u003e = 1.346, \u003cem\u003ep\u003c/em\u003e = 0.1837; interaction \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(51, 270)\u003c/sub\u003e = 1.148, \u003cem\u003ep\u003c/em\u003e = 0.2428) with Tukey's multiple comparisons test. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Mor \u003cem\u003evs.\u003c/em\u003e Sal. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, CPP \u003cem\u003evs.\u003c/em\u003e Homecage. \u003cstrong\u003e(B-C)\u003c/strong\u003e BEST1 protein level in ACC astrocytes (\u003cstrong\u003eB\u003c/strong\u003e) or neurons (\u003cstrong\u003eC\u003c/strong\u003e). Scale bar, 10 μm. Bar graph showing quantification of BEST1 intensity. n = 12 slices from 4 mice. Two-tailed unpaired t test. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Mor CPP \u003cem\u003evs.\u003c/em\u003e Sal CPP. \u003cstrong\u003e(D)\u003c/strong\u003e AAV with shRNA targeting \u003cem\u003eBest1 \u003c/em\u003emicroinjected into the ACC and viral expression. Scale bar, 100 μm. \u003cstrong\u003e(E)\u003c/strong\u003e BEST1 protein level in shRNA group and scramble group during acquisition. Scale bar, 10 μm. n = 12 slices from 4 mice. Two-tailed unpaired t test. \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, \u003cem\u003eBest1 \u003c/em\u003eshRNA \u003cem\u003evs.\u003c/em\u003e Scramble. \u003cstrong\u003e(F)\u003c/strong\u003e Example traces of the ACC astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e signals knocking down BEST1 during saline or morphine conditioning. Scale bar, 30 s, 1% ΔF/F. \u003cstrong\u003e(G-I) \u003c/strong\u003eThe integrated astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity (\u003cstrong\u003eG\u003c/strong\u003e), frequency (\u003cstrong\u003eH\u003c/strong\u003e) and average peak (\u003cstrong\u003eI\u003c/strong\u003e) during acquisition. Each dot represents a training session per mouse. n = 6 mice. Two-way ANOVA with Sidak's multiple comparisons test. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, Mor \u003cem\u003evs.\u003c/em\u003e Sal. \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003cem\u003eBest1 \u003c/em\u003eshRNA \u003cem\u003evs.\u003c/em\u003e Scramble. \u003cstrong\u003e(J)\u003c/strong\u003e Experimental timeline of morphine CPP modeling after ACC astrocytic BEST1 knockdown. \u003cstrong\u003e(K-L)\u003c/strong\u003e CPP score for Test 1-2 (\u003cstrong\u003eK\u003c/strong\u003e) and Test 1-5 (\u003cstrong\u003eL\u003c/strong\u003e) after BEST1 knockdown. n = 12 mice. Two-way ANOVA (main effect of group \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 22)\u003c/sub\u003e = 6.542, \u003cem\u003ep\u003c/em\u003e = 0.0179; main effect of test \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1.928, 42.41)\u003c/sub\u003e = 32.42, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001; interaction \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(2, 44)\u003c/sub\u003e = 3.888, \u003cem\u003ep\u003c/em\u003e = 0.0279) with Sidak's multiple comparisons test. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, Test \u003cem\u003evs.\u003c/em\u003e Pre-test. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003cem\u003eBest1 \u003c/em\u003eshRNA \u003cem\u003evs.\u003c/em\u003e Scramble. Data are presented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4272120/v1/af6048e71cf0659f128d7d77.png"},{"id":59647965,"identity":"f3002fef-655e-4fa1-9c65-e255bf5569f6","added_by":"auto","created_at":"2024-07-04 09:11:51","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":8459675,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAstrocytic deletion of BEST1 influences its morphology and neural synapses within microdomains. (A)\u003c/strong\u003e Morphological changes of astrocytes after knockdown BEST1 during morphine CPP acquisition. Imaged astrocytes were digitally rendered (green), and GFAP staining labelled the primary branches of astrocytes (magenta). Scale bar, 25 μm (left) and 5 μm (right magnification). \u003cstrong\u003e(B-E)\u003c/strong\u003e ACC astrocytic volume (\u003cstrong\u003eB\u003c/strong\u003e), branch number (\u003cstrong\u003eC\u003c/strong\u003e), total process intersections (\u003cstrong\u003eD\u003c/strong\u003e) and complexity (\u003cstrong\u003eE\u003c/strong\u003e) after knockdown BEST1. n = 12 slices from 4 mice. Unpaired t test for (B-D) and two-way ANOVA with Sidak's multiple comparisons test for (E). \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, \u003cem\u003eBest1 \u003c/em\u003eshRNA \u003cem\u003evs.\u003c/em\u003e Scramble. \u003cstrong\u003e(F)\u003c/strong\u003e Co-registration of neural synapses within astrocytic microdomains after knockdown BEST1. Presynaptic marker synaptophysin (SYP, blue) labelled neural connections. Scale bar, 5 μm. \u003cstrong\u003e(G-I)\u003c/strong\u003e The degree of astrocyte-SYP co-registration (\u003cstrong\u003eG\u003c/strong\u003e), cumulative frequency of dense-synapse microdomains (\u003cstrong\u003eH\u003c/strong\u003e) and synapse distribution (\u003cstrong\u003eI\u003c/strong\u003e) after knockdown BEST1. Unpaired t test. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003cem\u003eBest1 \u003c/em\u003eshRNA \u003cem\u003evs.\u003c/em\u003e Scramble. Data are presented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4272120/v1/6b9bbe60f9d228744877813c.png"},{"id":59647220,"identity":"2cd23f7e-039d-478c-a076-0f5b92d33487","added_by":"auto","created_at":"2024-07-04 09:03:52","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":6614266,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAstrocytic BEST1 influences the proximity of astrocytes to synapses connecting the dCA1 region and the ACC. (A)\u003c/strong\u003e Schematics of whole-brain c-Fos mapping after Gi activation in ACC astrocytes during MCPP acquisition. \u003cstrong\u003e(B)\u003c/strong\u003e Mouse brain before and after clearing. \u003cstrong\u003e(C)\u003c/strong\u003e c-Fos signal of hemisphere and CA1 brain slices from lightsheet imaging. Scale bar, 500 μm (left) and 50 μm (right). \u003cstrong\u003e(D)\u003c/strong\u003e Total c-Fos\u003csup\u003e+\u003c/sup\u003e cells per hemisphere in Gi activation mice (red) and control mice (grey). n = 4 mice. Unpaired t test, \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05. \u003cstrong\u003e(E)\u003c/strong\u003e Quantification of regions of difference in c-Fos expression between Gi activation mice and control mice. Abbreviations are as follows: DRN, dorsal raphe nucleus; ACC, anterior cingulate cortex; CA1, hippocampal subfield 1; NAc, nucleus accumbens; AMY, amygdala; ATN, anterior thalamic nuclei; DS, dorsal striatum; LH, lateral hypothalamus; VP, ventral pallidum; VTA, ventral tegmental area. Multiple t tests, \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01. \u003cstrong\u003e(F)\u003c/strong\u003e Representative image of retrograde tracer injection into ACC. Scale bar, 200 μm. \u003cstrong\u003e(G)\u003c/strong\u003e Representative image of the CA1 infected by retroAAV-hSyn-EGFP. Scale bar, 200 μm. \u003cstrong\u003e(H)\u003c/strong\u003e Schematic diagram of viral injection to knockdown BEST1 and label dCA1 terminals in ACC. \u003cstrong\u003e(I)\u003c/strong\u003e Co-registration dCA1 terminals (red) within astrocytic microdomains after knockdown BEST1. Scale bar, 5 μm. \u003cstrong\u003e(J-M)\u003c/strong\u003e The degree of triple co-registration containing dCA1 (\u003cstrong\u003eJ\u003c/strong\u003e) or non-dCA1 terminals (\u003cstrong\u003eK\u003c/strong\u003e) and their distribution (\u003cstrong\u003eL-M\u003c/strong\u003e). n = 12 slices from 4 mice. Unpaired t test. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, \u003cem\u003eBest1 \u003c/em\u003eshRNA \u003cem\u003evs.\u003c/em\u003e Scramble. Data are presented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4272120/v1/b9e63fbdd379f510f2a02958.png"},{"id":59647964,"identity":"7b7d0217-2d93-46bb-beb9-60ac3155d0a7","added_by":"auto","created_at":"2024-07-04 09:11:51","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":5648494,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBEST1 modulates astrocytic glutamate release and Ca\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e2+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e activity of ACC\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003edCA1\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e neurons. (A-F)\u003c/strong\u003e Schematic diagram of virus injection to knockdown BEST1 and express the glutamate sensor iGluSnFR (\u003cstrong\u003eA\u003c/strong\u003e) or GABA sensor iGABASnFR (\u003cstrong\u003eD\u003c/strong\u003e) in ACC. Example traces of glutamate (\u003cstrong\u003eB\u003c/strong\u003e) and GABA (\u003cstrong\u003eE\u003c/strong\u003e) signals. Scale bar, 30 s, 1% ΔF/F. Total area under of the curve (AUC) for glutamate (Glu, \u003cstrong\u003eC\u003c/strong\u003e) and GABA (\u003cstrong\u003eF\u003c/strong\u003e) transient during acquisition. n = 6 mice. Two-way ANOVA (Glu: main effect of group \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 10)\u003c/sub\u003e = 21.37, \u003cem\u003ep\u003c/em\u003e = 0.0009; main effect of test \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 10)\u003c/sub\u003e = 2.339, \u003cem\u003ep\u003c/em\u003e = 0.1571; interaction \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 10)\u003c/sub\u003e = 5.224, \u003cem\u003ep\u003c/em\u003e = 0.0453. GABA: main effect of group \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 10)\u003c/sub\u003e = 1.671, \u003cem\u003ep\u003c/em\u003e = 0.2252; main effect of test \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 10)\u003c/sub\u003e = 3.993, \u003cem\u003ep\u003c/em\u003e = 0.0736; interaction \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 10)\u003c/sub\u003e = 0.6096, \u003cem\u003ep\u003c/em\u003e = 0.4530) with Sidak's multiple comparisons test. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Mor \u003cem\u003evs.\u003c/em\u003e Sal. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003cem\u003eBest1 \u003c/em\u003eshRNA \u003cem\u003evs.\u003c/em\u003e Scramble. \u003cstrong\u003e(G)\u003c/strong\u003e Schematic and image of viral injection to label ACC\u003csup\u003edCA1\u003c/sup\u003e neurons with EGFP. Scale bar, 100 μm. \u003cstrong\u003e(H)\u003c/strong\u003e Distribution of EGFP\u003csup\u003e+\u003c/sup\u003e neurons across layers in the ACC. n = 12 slices from 4 mice. \u003cstrong\u003e(I)\u003c/strong\u003e Colocalization of EGFP\u003csup\u003e+\u003c/sup\u003e neurons with different neuronal markers. Scale bar, 10 μm. \u003cstrong\u003e(J)\u003c/strong\u003e Percentages of EGFP\u003csup\u003e+\u003c/sup\u003e neurons colocalized with glutamatergic or GABAergic neurons. n = 12 slices from 4 mice. \u003cstrong\u003e(K)\u003c/strong\u003e Experimental timeline of ACC\u003csup\u003edCA1\u003c/sup\u003e neuronal Ca\u003csup\u003e2+\u003c/sup\u003e activity recording during acquisition for (\u003cstrong\u003eL-P\u003c/strong\u003e). Coloring means fiber photometry session. \u003cstrong\u003e(L)\u003c/strong\u003e Diagram of virus injection and fiber placement (left), and representative images of GCaMP7s (green) and shRNA (red) expression (right). Scale bar, 250 μm. \u003cstrong\u003e(M)\u003c/strong\u003e Example traces of the ACC\u003csup\u003edCA1\u003c/sup\u003e neuronal Ca\u003csup\u003e2+\u003c/sup\u003e signals knocking down astrocytic BEST1 during saline or morphine conditioning. Scale bar, 15 s, 1% ΔF/F. \u003cstrong\u003e(N-P) \u003c/strong\u003eThe integrated neuronal Ca\u003csup\u003e2+\u003c/sup\u003e activity (\u003cstrong\u003eN\u003c/strong\u003e), frequency (\u003cstrong\u003eO\u003c/strong\u003e) and average peak (\u003cstrong\u003eP\u003c/strong\u003e) during acquisition. Each dot represents a training session per mouse. n = 6 mice. Two-way ANOVA (integrated activity: main effect of group \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 46)\u003c/sub\u003e = 7.593, \u003cem\u003ep\u003c/em\u003e = 0.0084; main effect of test \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 46)\u003c/sub\u003e = 1.391, \u003cem\u003ep\u003c/em\u003e = 0.2443; interaction \u003cem\u003eF\u003c/em\u003e\u003csub\u003e(1, 46)\u003c/sub\u003e = 6.361, \u003cem\u003ep\u003c/em\u003e = 0.0152) with Sidak's multiple comparisons test. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Mor \u003cem\u003evs.\u003c/em\u003e Sal. \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003cem\u003eBest1 \u003c/em\u003eshRNA \u003cem\u003evs.\u003c/em\u003e Scramble. Data are presented as mean ± SEM.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4272120/v1/7867ed5cb3caf79ec4a98478.png"},{"id":62878243,"identity":"14e64e1e-541a-45b5-9954-5ecb666d10af","added_by":"auto","created_at":"2024-08-20 14:21:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":38065996,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4272120/v1/92c20623-7a1b-444e-a26d-dd092b01b021.pdf"},{"id":59647215,"identity":"4eed8579-e04d-4ed1-8888-8f443bf39483","added_by":"auto","created_at":"2024-07-04 09:03:51","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3189243,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"2024.4.15Supplementary.docx","url":"https://assets-eu.researchsquare.com/files/rs-4272120/v1/867141851d81189ea4d808c3.docx"}],"financialInterests":"The authors have declared there is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose","formattedTitle":"Astrocytic Bestrophin1 in the Anterior Cingulate Cortex Modulates the Formation and Persistence of Morphine Addiction Memory","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe role of astrocytes in memory is increasingly recognized as crucial, alongside neurons, in the complex processes of learning and memory formation, maintenance, retrieval, and extinction. Astrocytes undergo changes in their transcription and translation profiles [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], membrane ion dynamics [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], morphological coverage [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], metabolic support [\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], neurotransmitter regulation [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], synapse phagocytosis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], and other functions, thus contributing to the processes of memory formation and retention [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Previous research has demonstrated that these astrocytic alterations play a role in enhancing memory intensity and persistence through interactions with neurons, such as providing energy and nutrients, eliminating unnecessary synapses, and modulating synaptic strength beyond the synaptic cleft. However, recent studies suggest that astrocyte activation alone can initiate de novo neuronal potentiation and is required for memory persistence [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBestrophin1 (Best1) is a calcium-activated anion channel identified from retinal pigment epithelium [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Subsequent investigations have revealed that Best1 is widely distributed in the brain, especially with higher levels in cortex, hippocampus, and cerebellum, and prominent expression in both neurons and astrocytes [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In the astrocytes, it plays a role in both tonic GABA release and glutamate transport, thereby influencing neuronal excitability, synaptic transmission, and synaptic plasticity [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Prior research has indicated that Best1 is specifically localized in microdomains of astrocytes proximal to synapses, facilitating slow glutamate release from astrocytes in a G\u003csub\u003eαq\u003c/sub\u003e-activation dependent manner [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Moreover, hippocampal astrocytic BEST1 has been found to co-release glutamate and D-serine, regulate N-methyl-D-aspartate receptor (NMDAR) tone, contribute to long-term depotentiation during learning, and modulate memory flexibility [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMultiple studies have delved into the involvement of astrocytes in addiction-related memory processes. Specifically, in the hippocampal CA1 region, astrocytes have been found to encode the anticipated location of rewards within spatial contexts [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Within the nucleus accumbens (NAc), research indicates that heightened glycolytic metabolism within astrocytes modulates the establishment of morphine addiction memory [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Additionally, increased release of thrombospondin from astrocytes in the NAc has been observed to facilitate the generation of silent synapses induced by cocaine and contribute to the reinstatement of addiction memory [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In the ventral tegmental area (VTA), astrocytes exert tonic GABA inhibition on local GABA neurons and contribute to the formation and retrieval of cocaine-associated context memory [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The anterior cingulate cortex (ACC) is recognized for its involvement in long-term memory processes. Recent findings suggest that neurons in the ACC are activated during initial memory formation but remain quiescent, gradually becoming active during the transfer of memories from recent to remote stages [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. However, the specific function and underlying mechanisms of ACC astrocytes in addiction-related memory processes remain poorly understood.\u003c/p\u003e \u003cp\u003eIn this study, we utilized the morphine CPP paradigm along with astrocyte-specific recording and manipulation techniques to investigate the role of ACC astrocytes at various stages of morphine-associated memory. Our findings reveal that ACC astrocytes play a crucial role in shaping the strength and retention of morphine-conditioned memory during the acquisition phase. Specifically, selective knockdown of astrocytic BEST1 in the ACC during memory acquisition elevated astrocytic calcium dynamics, expanded astrocytic coverage, declined astrocytic glutamate release, induced alterations in the density of synapses between the dCA1 and ACC within astrocytic microdomains, attenuated the activity of ACC\u003csup\u003edCA1\u003c/sup\u003e neurons, and ultimately reduced morphine CPP scores. These results suggest that ACC astrocytes influence the connectivity between dCA1 and ACC neurons, potentially via extrasynaptic glutamate activity, thereby regulating the strength and persistence of morphine-associated memory.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eMale adult (6\u0026ndash;8 weeks) C57BL/6J mice were group-housed on a 12-h reverse light-dark cycle with ad libitum access to food and water. All animal procedures were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the Biomedical Ethics Committee for animal use and protection of Peking University.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eStereotaxic surgery and virus injection\u003c/h2\u003e \u003cp\u003eMice were anesthetized with avertin (300 mg/kg, i.p.) and mounted into a stereotaxic instrument (RWD Life Science). The skull was exposed and a small craniotomy was performed. Virus was injected into the targeted brain region with a pulled glass capillary at slow rate (60 nL/min) using a pressure microinjector (Nanoject III, Drummond Scientific). Following each injection, the needle was left in place for 10 min before it was withdrawn. Mice were allowed at least 21 days to express the virus and recover before behavior training. Bilateral injection coordinates for ACC are AP: 0.3 mm, ML: \u0026plusmn;0.4 mm, DV: -1.7 mm; for NAc are AP: 1.1 mm, ML: \u0026plusmn;0.8 mm, DV: -4.6 mm; for VTA are AP: -3.4 mm, ML: \u0026plusmn;0.35 mm, DV: -4.4 mm; for dCA1 are AP: -1.83 mm, ML: \u0026plusmn;1.2 mm, DV: -1.6 mm. For fiber photometry recording, virus injection was followed by optical fiber implantation. The optical fiber with 400 \u0026micro;m core diameter and 0.5 numerical aperture (RWD Life Science) was implanted above injection sites of ACC. Information of respective viruses in each experiment used is provided in \u003cb\u003eSupplementary Table\u0026nbsp;1\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eVirus construction\u003c/h2\u003e \u003cp\u003eFor astrocyte-specific BEST1 knockdown, the miR30-based shRNA AAV vector targeting mouse \u003cem\u003eBest1\u003c/em\u003e (TTTGCCAACTTGTCAATGAA) was used for \u003cem\u003ein vivo\u003c/em\u003e BEST1 knockdown [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The designed AAV plasmids for \u003cem\u003eBest1\u003c/em\u003e shRNA and Scramble were constructed as AAV2/5-GfaABC1D-\u003cem\u003eBest1\u003c/em\u003e shRNA-EGFP-WPRE (OBiO, titer 4.89 \u0026times; 10\u003csup\u003e12\u003c/sup\u003e v.g./mL) and AAV2/5-GfaABC1D-Scramble-EGFP-WPRE (titer 1.2 \u0026times; 10\u003csup\u003e13\u003c/sup\u003e v.g./mL), respectively. The AAV plasmids expressing mCherry and targeting the same sequence were constructed as AAV2/8-GfaABC1D-\u003cem\u003eBest1\u003c/em\u003e shRNA-mCherry-WPRE (titer 1.15 \u0026times; 10\u003csup\u003e13\u003c/sup\u003e v.g./mL) and AAV2/8-GfaABC1D-Scramble-mCherry-WPRE (titer 2.65 \u0026times; 10\u003csup\u003e13\u003c/sup\u003e v.g./mL), respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eConditioned place preference (CPP)\u003c/h2\u003e \u003cp\u003eAll mice were handled for at least three consecutive days before the experiment. An unbiased CPP paradigm was conducted with a three-chamber apparatus consisting of two side chambers measuring 15 \u0026times; 15 \u0026times; 15 cm each, and a middle chamber measuring 10 \u0026times; 15 \u0026times; 15 cm. Two side chambers had distinct visual (wall lamps with triangular pattern and wall lamps with square pattern) and tactile (a grid floor and a floor with horizontal stripes) context, connected by the middle chamber. A removable gate between the two boxes ensured that mice were free or restricted to cross the apparatus during different experimental periods. The establishment of morphine CPP model contains three phases. In the pre-test phase (day 1), mice were placed into the middle chamber for a 1 min habituation period and then allowed to freely explore all three chambers for 15 min to assess their baseline place preference. In the conditioning phase (day 2\u0026ndash;5), these mice were injected with saline (5 mL/kg, i.p.) and confined in one lateral chamber for 45 min then returned to their home cage. At least six hours later, these mice were injected with morphine (15 mg/kg, i.p., [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]) and confined in the opposite chamber for 45 min then returned to their home cage. The training will performed for four consecutive days. In the test phase (day 6), mice were re-exposed to the CPP chamber and allowed to freely explore the entire apparatus for 15 min.\u003c/p\u003e \u003cp\u003eDuring the pre-test and test sessions, time spent in each chamber was recorded by Any-maze tracking software. Mice showing over 80% preference for one chamber during pre-test were excluded, and rest were randomly assigned to counterbalance pairings on each side chamber. The CPP score was defined as the time spent in the morphine-paired chamber minus that spent in the saline-paired chamber.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eFiber photometry recording and analysis\u003c/h2\u003e \u003cp\u003eFiber photometry system (R810, RWD Life Science) was used to record the \u003cem\u003ein vivo\u003c/em\u003e fluorescence signals (GCaMP, iGluSnFR or iGABASnFR). The 470 nm excitation fluorescence signal and the 410 nm excitation internal control signal were acquired at a 60 Hz sample rate [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The LED light power was adjusted at the tip of the optic fiber to 30\u0026ndash;40 \u0026micro;W to minimize bleaching. Prior to behavior recording, mice were habituated to a patch cord attached to the implanted optical fiber for 1 min in the CPP chamber. Mice received virus injection were trained with the identical CPP protocol as above. Fiber photometry was taken within the first 15 min during CPP acquisition and retrieval session due to morphine concentrations in mouse plasma and brain increased rapidly and maintained at high levels [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Analysis of signal was done with supporting software OFRS (RWD Life Science). For CPP acquisition phase recording, fluorescence signals were collected from mice injected with saline or morphine for four consecutive days during training. Raw signals were normalized by 410 nm signal and converted to ΔF/F, calculated according to (470 nm signal - fitted 410 nm signal)/ (fitted 410 nm signal). The integrated Ca\u003csup\u003e2+\u003c/sup\u003e activity and area under the curve (AUC) were calculated as the sum of ΔF/F of the total duration. Significant calcium events were identified as periods of time in which ΔF/F rose above 2.91 median absolute deviations (MADs) from baseline [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The frequency and average peak of these identified events were included in the analysis. For CPP retrieval phase recording, mice stayed and traveled between the two chambers. Data analysis was identical to the acquisition phase when mice explored saline or morphine chambers for more than 15 s. When mice entry into the chamber (in the middle chamber or opposite side 5 s before entry and staying at least 15 s), valid shuttle events within 15 min were marked and their z-score were calculated as (ΔF/F - mean)/std.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eChemogenetic manipulation\u003c/h2\u003e \u003cp\u003eMice received virus injection and 21 days later underwent CPP training as described above. Clozapine \u003cem\u003eN\u003c/em\u003e-oxide (CNO; 4936, Tocris) was dissolved in 0.9% saline. For chemogenetic manipulation during CPP acquisition phase, mice were injected with CNO (5 mg/kg, i.p.) 25 min before each morphine-paired training. The same volume of 0.9% saline served as vehicle was administered 25 min before each saline-paired training. Twenty-four hours after the final training session, mice were re-exposed to the CPP chamber and allowed to freely explore the entire apparatus for 15 min. For chemogenetic manipulation during recent and remote retrieval test, separate groups of mice received virus injection and 4 days of morphine CPP training. Twenty-four hours (recent) and 14 days (remote) after the final training session, mice were injected with CNO (5 mg/kg, i.p.) or vehicle 25 min before re-exposed and freely explore the CPP chamber (Test 1 and Test 2). For chemogenetic manipulation during CPP transfer, separate groups mice received virus injection, 4 days of morphine CPP training and Test 1. After the Test 1, mice were provided with access to CNO-treated or 0.9% saline-treated drinking water for 14 days until Test 2. CNO was dissolved in the animals' regular drinking water at a concentration of 5 \u0026micro;g/mL [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] and freshly prepared every day. The daily water intake of each cage was recorded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR\u003c/h2\u003e \u003cp\u003eMice were anesthetized by avertin and decapitated three hours after the last training session. The brains were quickly dissected and stored at -80\u0026deg;C. Coronal sections were prepared in a cryostat microtome (model 1950, Leica), and bilateral ACC were collected carefully with a 8-gauge needle. Total RNA was extracted from tissue using RNAiso Plus (TaKaRa) according to the manufacturer\u0026rsquo;s protocol. RNA purity and integrity were analyzed by RNA electrophoresis and NanoDrop 2000 spectrophotometer (Thermo Scientific). cDNA First strand Kit (TIANScript) and SYBR FAST qPCR Kit (Kapa Biosystems) were employed for reverse transcription (1 \u0026micro;g RNA per sample) and quantitative real-time PCR (qRT-PCR), respectively. The amplification of qRT-PCR was performed on the 7500 real-time system (Applied Biosystems) and carried out as follows: 95\u0026deg;C for 30 s, followed by 45 cycles of 95\u0026deg;C for 5 s and 60\u0026deg;C for 30 s. Each experiment was performed in triplicate. The relative mRNA expression level was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method. The housekeeping gene \u003cem\u003eGapdh\u003c/em\u003e was chosen as the reference for internal standardization. All the primers used were listed in \u003cb\u003eSupplementary Table\u0026nbsp;2\u003c/b\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e \u003cp\u003eMice were anesthetized by avertin and perfused transcardially with 0.9% saline followed by 4% paraformaldehyde (PFA) three hours after the last training session. The brains were dissected and post-fixed in 4% PFA for 24 h at 4\u0026deg;C before they were dehydrated subsequently in 20% and 30% sucrose solution. Coronal sections (50 \u0026micro;m thick) were prepared in a cryostat microtome and wash for 3\u0026times; 5 min in PBS. The brain sections were permeabilized with PBST (PBS with 0.3% Triton X-100) for 30 min and then blocked with PBST containing 5% donkey serum for 1 h at room temperature. Then, the sections were incubated with the primary antibody in PBST with 1% donkey serum for 24 h at 4\u0026deg;C. The following primary antibodies were used in our experiments: mouse anti-GFAP (1:300, 3670S, Cell Signaling Technology), rabbit anti-NeuN (1:500, 24307S, Cell Signaling Technology), mouse anti-S100β (1:500, S2532, Sigma Aldrich), mouse anti-NeuN (1:100, MAB377, Sigma Aldrich), rabbit anti-BEST1 (1:100, GTX14927, GeneTex), rabbit anti-Synaptophysin (1:100, ab32127, Abcam), mouse anti-CaMKIIα (1:100, sc13141, Santa Cruz Biotechnology), rabbit anti-PV (1:200, PA5-96209, ThermoFisher), rabbit anti-SST (1:100, PA5-85759, ThermoFisher) and rabbit anti-VIP (1:100, 20077, Immunostar). The sections were then washed 3 \u0026times; 15 min in PBST and incubated with secondary antibodies in the dark for 1.5 h at room temperature. The following secondary antibodies were used in our experiments: Alexa Fluor 405 donkey anti-rabbit IgG (1:500, ab175651, Abcam), Alexa Fluor 488 donkey anti-mouse IgG (1:500, A21202, Invitrogen), Alexa Fluor 488 donkey anti-rabbit IgG (1:500, A21206, Invitrogen), Alexa Fluor 647 donkey anti-mouse IgG (1:500, A31571, Invitrogen) and Alexa Fluor 647 donkey anti-rabbit IgG (1:500, A31573, Invitrogen). Finally, after washing 3 \u0026times; 15 min in PBST, the sections were mounted onto a glass slide with a coverglass and anti-fade solution with or without DAPI (S2100, Solarbio).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eConfocal imaging and analysis\u003c/h2\u003e \u003cp\u003eConfocal imaging was performed using a confocal microscope (TCS-SP8 DIVE, Leica) and image acquisition software LAS X (Leica). Three different objective lens were used: 10x objective was used to overview the ACC or CA1 regions to verify viral expression or fiber placement; 63x oil immersion objective was used to obtain z-stacks of 1 \u0026micro;m intervals to examine co-labeled cells and BEST1 fluorescent intensity; 63x objective at 2.5x zoom was used to obtain z-stacks of 0.5 \u0026micro;m intervals to analyze morphology and co-registration. For co-labeled cell counting, the maximum projection of z-stack images was adopted for analysis. For quantification of fluorescent intensity, sections from the two groups were stained and imaged with exactly the same protocol. The ROI of each astrocyte or neuron was manually traced and the quantification of BEST1 intensity were analyzed using the ImageJ software. For morphological analysis, astrocytes were obtained if and only if the entire cell volume could be clearly imaged within the tissue section and the boundaries of the cell were not overlapping with nearby labeled cells. The plugin of Sholl analysis applied in ImageJ automatically drew serial concentric circles at 10 \u0026micro;m intervals from soma to the end of the most distant process in each single astrocyte and analyzed the number of process intersections in each circle. Astrocytes were then identified based on characteristic morphology and EGFP signal intensity relative to noise and digitally rendered to obtain a metric of astroglial volume in the Imaris (Bitplane). Co-registration analysis was performed similarly as previously described [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Rendered astrocytes were used to mask SYP and mCherry signals. Voxels containing signal intensity greater than noise in each channel were determined empirically using the Coloc module and were used to build a colocalization channel. Astro-SYP co-registration was quantified by isolating SYP signal that co-registered with the rendered astrocyte. For determination of astrocyte association with dCA1 terminals, co-registration of isolated mCherry and SYP was determined using the Coloc module and quantified signal was normalized to volume of the rendered astrocytes. For determination of astrocyte association with non dCA1 terminals, the remaining SYP signals excluding the co-registration of mCherry and SYP were considered non-dCA1 and quantified by volume of the rendered astrocytes. The cell soma was identified based on size and fused with GFAP signal using Surface module. The distribution of these co-registered signals in astrocytes was measured to be co-localized with GFAP and EGFP signals, respectively. In all case, imaging and analysis were conducted blind to animal treatment.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWhole-brain clearing and analysis\u003c/h2\u003e \u003cp\u003eSame mice that underwent Gi activation during acquisition (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, E) were anesthetized and their brains were fixed by intracardial perfusion of 4% PFA 90 min after the final Test 7. Brains were post-fixed in PFA at 4\u0026deg;C overnight and washed with PBS for 3 \u0026times; 20 min. A bio-tissue oil-based clearing reagent kit (td21001, Thousand Dimensions Science and Technology) were employed for whole-brain clearing. Brains were transferred to a new tube filled with 15 mL permeabilization solution on a shaker at 40 rpm for 4 days. Then brains were gradually defatted with a series of degreasing solution kept rotating at 4\u0026deg;C for 4 days. Brains were washed in TBST (0.025% Triton in TBS) for 3 \u0026times; 20 min then transferred to a new tube filled with blocking solution (PBS containing 0.5% Triton X, 0.3 M glycine and 2% donkey serum) and left rotating for 4 days at 4\u0026deg;C. Brains were then transferred to primary antibody solution (PBS containing 2% donkey serum and rabbit anti-c-Fos (1:500, 2250S, Cell Signaling Technology)) and left rotating for 12 days at 4\u0026deg;C. Brains were washed in TBST for 3 \u0026times; 20 min and then placed in secondary antibody solution (PBS containing 2% donkey serum and Alexa Fluor 647 donkey anti-rabbit IgG (1:500, A31573, Invitrogen)). Samples were kept rotating at 4\u0026deg;C for 12 days and exposed to minimal light from this step onward. After incubation samples were washed in TBST for 3 \u0026times; 20 min, then dehydrated and matched to a uniform refractive index at 37\u0026deg;C on a shaker to achieve tissue transparency. Brains were imaged by a lightsheet scanning microscopy (LS18, Nuohai Life Science) at a resolution of 1.65 \u0026times; 1.65 \u0026times; 3.5 \u0026micro;m, which could clearly distinguish the positive signal. The data processing included preprocessing of the original image data, stitching and combining of thumbnail images, brightness correction, and other corrections such as image background fluorescence elimination and image rotation correction to optimize the two dimensional images. After three-dimensional data reconstruction, followed by atlas registration, regional graphics and cell quantification, the number of c-Fos\u003csup\u003e+\u003c/sup\u003e cells in different brain regions was collected using Imaris 3D analysis software. The number of c-Fos\u003csup\u003e+\u003c/sup\u003e cells per brain region was first normalized by the volume of the same area in the Allen Brain Atlas, then compared between different groups using the independent Multiple t tests.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eSingle variable comparisons were made with two-tail paired or unpaired Student\u0026rsquo;s t test. Groups comparisons were made using one-way repeated measures analysis of variance (ANOVA) with Dunnett's multiple comparisons test, two-way repeated measures ANOVA with Sidak's multiple comparisons test or with Tukey's multiple comparisons test. All statistics were analyzed using Graphpad Prism 9.0 (GraphPad Software). \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was taken as statistically significant. Data was expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eACC astrocytes display altered Ca\u003csup\u003e2+\u003c/sup\u003e dynamics during the acquisition and retrieval of morphine-conditioned memory\u003c/h2\u003e \u003cp\u003eTo test whether ACC astrocytes change their activity during morphine conditioned memory, we microinjected AAV-GfaABC1D-jGCaMP7f virus and implanted optical fibers into the ACC for astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity recording (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Twenty-one days after recovery from the surgery, mice received canonical CPP training, and spent more time in the morphine-associated context during post-training recent and remote tests (Test 1 \u003cem\u003evs.\u003c/em\u003e Pre-test, 151.0\u0026thinsp;\u0026plusmn;\u0026thinsp;33.45 \u003cem\u003evs.\u003c/em\u003e -43.06\u0026thinsp;\u0026plusmn;\u0026thinsp;38.23, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Test 2 \u003cem\u003evs.\u003c/em\u003e Pre-test, 160.9\u0026thinsp;\u0026plusmn;\u0026thinsp;22.11 \u003cem\u003evs.\u003c/em\u003e -43.06\u0026thinsp;\u0026plusmn;\u0026thinsp;38.23, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Firstly, Ca\u003csup\u003e2+\u003c/sup\u003e activity of ACC astrocytes was recorded for 15 minutes each morphine or saline conditioning session per day during the 4-consecutive conditioning days (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eC-D and \u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e\u003c/b\u003e). Results showed that though the integrated astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity were not of significant difference when mice were in saline- or morphine-paired chambers (Mor \u003cem\u003evs.\u003c/em\u003e Sal, 194.4\u0026thinsp;\u0026plusmn;\u0026thinsp;24.42 \u003cem\u003evs.\u003c/em\u003e 235\u0026thinsp;\u0026plusmn;\u0026thinsp;25.64, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.1545; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), confinement in the morphine-paired chamber significantly increased the frequency (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eF) and reduced the average peak of astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e events (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eG), suggesting that the ACC astrocytes displayed altered Ca\u003csup\u003e2+\u003c/sup\u003e dynamics during the acquisition of morphine-conditioned memory. Further analysis of Ca\u003csup\u003e2+\u003c/sup\u003e transients across the 4 training days (\u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA-C\u003c/b\u003e) and within the 15 minutes (\u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD-F\u003c/b\u003e) showed that astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e transients gradually increased their frequency and decreased peak amplitude as conditioning intensifies (\u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB-C\u003c/b\u003e), and within each recording session, the frequency and peak were rather stable (\u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eE-F\u003c/b\u003e), though the integrated activity showed slightly decreased between the first and last recording 5 minutes (\u003cb\u003eSupplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD\u003c/b\u003e).\u003c/p\u003e \u003cp\u003eWe then recorded the astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity 1 day (Test 1) and 14 days (Test 2) after conditioning when mice were allowed to freely explore the saline- or morphine-paired chambers (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eH-I). Exploring the morphine-paired chamber drastically elevated integrated activity with increased frequency and unchanged peak upon both recent and remote retrieval tests (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ-L). Further analysis also revealed substantial increase in astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e activity upon the entry into the morphine-paired side compared with the saline-paired side (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eM-O). Overall, these results showed that ACC astrocytes displayed altered Ca\u003csup\u003e2+\u003c/sup\u003e dynamics during the acquisition and retrieval of morphine-conditioned memory.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eACC astrocytes modulate morphine-conditioned memory via acquisition phase\u003c/h2\u003e \u003cp\u003eTo further identify the role of ACC astrocytes in the morphine-conditioned memory, we employed chemogenetic manipulation during different stages of morphine-conditioned memory (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). We injected AAV encoding astrocytic hM4Di or hM3Dq into the ACC, and the mCherry expression was restricted to GFAP-positive cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eB and \u003cb\u003eSupplementary Fig. S2A-B\u003c/b\u003e). Gi activation significantly decreased the frequency, while Gq activation increased the frequency of astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e events (\u003cb\u003eSupplementary Fig. S2C-E\u003c/b\u003e). With the CNO administered during conditioning, before retrieval or between retrievals (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), we could specifically manipulate ACC astrocytes during acquisition, retrieval and transfer phase, and examine the alterations in memory strength and retention. Results showed that mice with astrocytic Gi activation during acquisition displayed robust preference for morphine-paired chamber during Test 1 (CNO \u003cem\u003evs.\u003c/em\u003e Veh, 370.32\u0026thinsp;\u0026plusmn;\u0026thinsp;53.01 \u003cem\u003evs.\u003c/em\u003e 212.98\u0026thinsp;\u0026plusmn;\u0026thinsp;40.74, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), and this enhanced preference retained for at least 7 weeks (hM4Di\u0026thinsp;+\u0026thinsp;CNO: Test 7 \u003cem\u003evs.\u003c/em\u003e Pre-test, 235.32\u0026thinsp;\u0026plusmn;\u0026thinsp;62.45 \u003cem\u003evs.\u003c/em\u003e -4.86\u0026thinsp;\u0026plusmn;\u0026thinsp;49.16, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Test 7: hM4Di\u0026thinsp;+\u0026thinsp;CNO \u003cem\u003evs.\u003c/em\u003e hM4Di\u0026thinsp;+\u0026thinsp;Veh, 235.32\u0026thinsp;\u0026plusmn;\u0026thinsp;62.45 \u003cem\u003evs.\u003c/em\u003e 36.63\u0026thinsp;\u0026plusmn;\u0026thinsp;43.81, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), while mice with astrocytic Gq activation displayed less and shortened preference for morphine-paired chamber (hM3Dq\u0026thinsp;+\u0026thinsp;CNO: Test 2 \u003cem\u003evs.\u003c/em\u003e Pre-test, -22.66\u0026thinsp;\u0026plusmn;\u0026thinsp;63.63 \u003cem\u003evs.\u003c/em\u003e -56.65\u0026thinsp;\u0026plusmn;\u0026thinsp;38.18, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.9792; Test 2: hM3Dq\u0026thinsp;+\u0026thinsp;CNO \u003cem\u003evs.\u003c/em\u003e hM3Dq\u0026thinsp;+\u0026thinsp;Veh, -22.66\u0026thinsp;\u0026plusmn;\u0026thinsp;63.63 \u003cem\u003evs.\u003c/em\u003e 207.68\u0026thinsp;\u0026plusmn;\u0026thinsp;32.22, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-E). Furthermore, CNO (5 mg/kg, i.p.) or vehicle were given 25 min before the retrieval tests to selectively activate astrocytes during retrieval. Neither Gi nor Gq activation of ACC astrocytes upon recent (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eF-G) and remote retrieval (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eH-I) altered mice\u0026rsquo;s preference for morphine-paired chamber. In addition, CNO (5 \u0026micro;g/mL) or vehicle in drinking water were given to mice for 14 days between Test 1 and Test 2 to selectively activate ACC astrocytes during memory transfer. The daily water consumption of mice was measured and CNO did not affect the water intake (\u003cb\u003eSupplementary Fig. S2F\u003c/b\u003e). Both groups of mice could form morphine CPP, and neither Gi nor Gq activation of ACC astrocytes during memory transfer altered mice\u0026rsquo;s preference for morphine-paired chamber (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ-L). Furthermore, Gi activation of neither VTA nor NAc astrocytes during acquisition changed mice\u0026rsquo;s preference for morphine-paired side (\u003cb\u003eSupplementary Fig. S2G-H\u003c/b\u003e). In summary, Gi activation of ACC astrocytes during memory acquisition phase enhanced the strength and retention of morphine-conditioned memory, while Gq activation during acquisition impaired the strength and retention of memory. Gi or Gq activation of ACC astrocytes during retrieval or transfer had no effect on the memory performance. Therefore, it is through the memory acquisition phase that ACC astrocytes regulate this morphine-associated memory.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eAstrocytic deletion of BEST1 during acquisition impairs morphine-conditioned memory\u003c/h2\u003e \u003cp\u003eNext, we sought to investigate the molecular alterations occurring in these ACC astrocytes during the acquisition phase. We examined the expression level of key molecules previously reported in regulating astrocytic morphology - Swell1, Cx43, Ezrin [\u003cspan additionalcitationids=\"CR39\" citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], astrocytic nutrition \u0026ndash; ENT1, MCT1, MCT4, LDHA, GRα, GRβ [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan additionalcitationids=\"CR42 CR43 CR44\" citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], and transmitter metabolism \u0026ndash; GS, PAR1, GLAST, GLT1, BEST1, GAT3, Maob, Dao, Aldh1a1 [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan additionalcitationids=\"CR46 CR47\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] after the last conditioning session in morphine CPP (MCPP) or saline CPP (SCPP) groups, or the last home cage injection of saline or morphine (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Results showed that the expression of \u003cem\u003eBest1\u003c/em\u003e (\u003cem\u003eBestrophin1\u003c/em\u003e) mRNA related to glutamate and GABA transmitter release increased specifically in MCPP group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The expression level of \u003cem\u003eAldh1a1\u003c/em\u003e mRNA increased in both SCPP and MCPP groups compared with home cage injection groups, suggesting that \u003cem\u003eAldh1a1\u003c/em\u003e may participate in the associative learning of drug-context, not specifically morphine-context. Moreover, the increase in BEST1 protein level was mainly in S100β-positive astrocytes rather than NeuN-positive neurons (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB-C). Therefore, we constructed an adeno-associated virus with shRNA targeting \u003cem\u003eBest1\u003c/em\u003e gene driven by astrocyte-specific promoter \u003cem\u003eGfaABC1D\u003c/em\u003e or its control scrambled RNA, and microinjected the viruses into the ACC (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-E). Virus expression was restricted to GFAP-positive cells within the ACC region (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), and BEST1 protein expression in astrocytes was downregulated by about 30% in shRNA group compared with scramble group during MCPP acquisition (\u003cem\u003eBest1\u003c/em\u003e shRNA \u003cem\u003evs.\u003c/em\u003e Scramble, 10.14\u0026thinsp;\u0026plusmn;\u0026thinsp;1.729% vs. 42.63\u0026thinsp;\u0026plusmn;\u0026thinsp;2.233%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Astrocytic knockdown of BEST1 significantly increased the frequency of Ca\u003csup\u003e2+\u003c/sup\u003e events during acquisition (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF-I\u003cb\u003e)\u003c/b\u003e. These results suggest that our constructed \u003cem\u003eBest1\u003c/em\u003e shRNA virus was astrocytes-specific, efficient in BEST1 knockdown, and affected astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e-dependent functions. Behaviorally, mice with this specific ablation of BEST1 from ACC astrocytes still displayed preference for morphine-paired chamber upon Test 1 and Test 2. Compared with scramble group, the extent of preference in \u003cem\u003eBest1\u003c/em\u003e shRNA group was significantly decreased, with the CPP score 131.72\u0026thinsp;\u0026plusmn;\u0026thinsp;34.37 s in shRNA group, compared with 261.27\u0026thinsp;\u0026plusmn;\u0026thinsp;34.51 s in scramble group in Test 1 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and CPP score 86.72\u0026thinsp;\u0026plusmn;\u0026thinsp;31.39 s in shRNA group, compared with 247.48\u0026thinsp;\u0026plusmn;\u0026thinsp;45.09 s in scramble group in Test 2 (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ-L). Overall, these results suggest that astrocytic BEST1 expression modulates the strength of formed morphine-context associative memory through intracellular Ca\u003csup\u003e2+\u003c/sup\u003e-dependent functions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAstrocytic BEST1 influences the proximity of astrocytes to synapses connecting the dCA1 region and the ACC\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAstrocytic Ca\u003csup\u003e2+\u003c/sup\u003e-dependent pathways play crucial roles in regulating its morphology [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], nutrition [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] and transmitter [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] dynamics. BEST1, as a volume-sensitive ion channel, was reported to regulate cell morphology [\u003cspan additionalcitationids=\"CR53\" citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e], and morphology changes in astrocytes could affect the function of neuronal synapses within the astrocytic domains [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Therefore, we set out to examine how astrocytic BEST1 affect cell morphology and neuronal synapses within astrocytic microdomains. After the last conditioning session in MCPP, we examined the morphological changes in the astrocytes and the density of synapses within astrocytic microdomains. The AAV-\u003cem\u003eGfaABC1D\u003c/em\u003e-EGFP marked out the territory of astrocytes, and GFAP staining labelled the primary branches of astrocytes [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Compared with scramble in MCPP, knockdown of astrocytic BEST1 in MCPP mice increased the cell volume (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), number of primary branches (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC), number of processes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD) and process complexity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). We further examined neural synapses within astrocytic microdomains by immunohistochemical staining of synaptophysin (SYP), a presynaptic marker of neural connections (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Astrocytic knockdown of BEST1 increased the total number of SYP puncta within the astrocytic coverage (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG), with higher proportion of dense-synapse microdomains (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH) but not much change in synapse distribution within the microdomains (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGiven that BEST1 knockdown drastically changed the overall synaptic density within astrocytic microdomains, and ACC receives neural projections from multiple brain regions, which synapses in the ACC are affected and might account for the BEST1-regulated memory strength? In Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-E, ACC astrocytic Gi activation significantly enhanced memory strength and retention. \u003cem\u003ePost hoc\u003c/em\u003e analysis revealed higher c-Fos activation in the CA1 region from memory enhanced mice in CNO group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-E), and retro-AAV-EGFP injection in the ACC (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF) showed abundant dCA1 neurons that send specific projections to ACC (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). We then employed circuit-specific viruses (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH) and successfully labelled nerve terminals in the ACC derived from dorsal hippocampal CA1 (dCA1). After the last conditioning session in MCPP, immunostaining revealed that SYP puncta and dCA1 synaptic terminals co-located significantly in the astrocytic coverage region (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI). Compared with scramble group, both dCA1-derived synapses (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ) and synapses from other brain regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eK) increased in the \u003cem\u003eBest1\u003c/em\u003e shRNA group. Of note, dCA1-derived synapses, not the other brain regions-derived ones, preferentially reside around the astrocytic soma and primary branches in the \u003cem\u003eBest1\u003c/em\u003e shRNA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eL-M). In all, during the formation of morphine-associative memory, the level of BEST1 expression in ACC astrocytes affected the density and distribution of dCA1-ACC synapses within the astrocytic microdomains, suggesting that astrocytic BEST1 might play a role in modulating the dCA1-ACC neural connectivity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eBEST1 modulates astrocytic glutamate release and Ca\u003csup\u003e2+\u003c/sup\u003e activity of ACC\u003csup\u003edCA1\u003c/sup\u003e neurons\u003c/h2\u003e \u003cp\u003ePrevious studies reported that BEST1, as a macromolecular permeable ion channel modulates the astrocytic release of glutamate and GABA [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], which through action on the extrasynaptic receptors within the microdomains [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], affects synaptic transmission. To test the hypothesis, we microinjected the astrocyte-specific glutamate sensor (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) or GABA sensor (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD) in the ACC and recorded the astrocytic release of glutamate and GABA during the conditioning phase of MCPP. Results showed that, during conditioning when mice were confined to the saline-paired compartment, glutamate release was not changed in \u003cem\u003eBest1\u003c/em\u003e shRNA group compared with scramble group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB-C); whereas during the conditioning when mice were confined to the morphine-paired compartment, glutamate release were significantly blunted in \u003cem\u003eBest1\u003c/em\u003e shRNA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB-C). In addition, neither the conditioning of saline/ morphine nor the Scramble/ \u003cem\u003eBest1\u003c/em\u003e shRNA changed the astrocytic GABA release (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE-F). These results showed that BEST1 specifically regulates astrocytic glutamate but not GABA release during the morphine-context pairing stage, and this alteration of astrocytic glutamate release might act through extrasynaptic metabolic/ionic glutamate receptors to affect the strength of synaptic transmission.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further examine how BEST1 modulate the neural connectivity from dCA1 to ACC, we first studied the ACC neural population receiving dCA1 projections, \u003cem\u003ei.e.\u003c/em\u003e ACC\u003csup\u003edCA1\u003c/sup\u003e neurons. By cross-synaptic virus-specific labeling (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG), we found that ACC\u003csup\u003edCA1\u003c/sup\u003e neurons mainly reside in the layer V (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG-H). Further co-staining with different neuronal markers revealed that about 45.70\u0026thinsp;\u0026plusmn;\u0026thinsp;2.159% and 31.95\u0026thinsp;\u0026plusmn;\u0026thinsp;2.009% of ACC\u003csup\u003edCA1\u003c/sup\u003e neurons are CaMKII-positive and VIP-positive, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI-J). We specifically labelled these ACC\u003csup\u003edCA1\u003c/sup\u003e neurons with Ca\u003csup\u003e2+\u003c/sup\u003e indicator GCaMP6s and recorded the Ca\u003csup\u003e2+\u003c/sup\u003e activity of these neurons during the conditioning phase of MCPP (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eK-L). Results showed that during conditioning when mice were confined to the saline-paired compartment, the integrated Ca\u003csup\u003e2+\u003c/sup\u003e activity was not changed in \u003cem\u003eBest1\u003c/em\u003e shRNA group compared with scramble group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eM-N); whereas during the conditioning when mice were confined to the morphine-paired compartment, the integrated Ca\u003csup\u003e2+\u003c/sup\u003e activity was significantly blunted in \u003cem\u003eBest1\u003c/em\u003e shRNA group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eM-N\u003cb\u003e)\u003c/b\u003e. This activity decrease in \u003cem\u003eBest1\u003c/em\u003e shRNA group was largely attributed to impaired Ca\u003csup\u003e2+\u003c/sup\u003e event peak rather than frequency (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eO-P). In summary, ACC astrocytic BEST1 knockdown blunts the astrocytic glutamate release and impaired the activity of ACC\u003csup\u003edCA1\u003c/sup\u003e neurons during the conditioning phase of morphine CPP, suggesting that the change of BEST1 function may affect the activity of neurons and participate in the regulation of morphine-associative memory strength and maintenance.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we explored the role of ACC astrocytes in morphine-conditioned memory. During this process, we found that ACC astrocytes displayed altered Ca\u003csup\u003e2+\u003c/sup\u003e dynamics during the acquisition and retrieval of morphine-conditioned memory. Chemogenetic manipulation revealed that it is through the memory acquisition phase which ACC astrocytes regulate this morphine-associated memory. Specifically, the function of astrocytes during acquisition was accompanied by increased expression of BEST1 channel. Astrocytic BEST1 modulate cell morphology and density of synapses in microdomains during acquisition. The BEST1 expression in ACC astrocytes affected the density and distribution of dCA1-ACC synapses within the astrocytic microdomains. Moreover, ACC astrocytic BEST1 knockdown blunts the astrocytic glutamate release and impaired the activity of ACC\u003csup\u003edCA1\u003c/sup\u003e neurons during the conditioning phase of morphine CPP. These data showed the contribution of ACC astrocytic BEST1 to the morphine addiction memory formation and maintenance.\u003c/p\u003e \u003cp\u003ePrevious studies have found that astrocytes in brain regions associated with addiction can profoundly influence addiction memories with diverse pathways [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. In VTA, cocaine CPP enhanced tonic GABA release from astrocytes mediated by the volume-regulated anion channel VRAC and increased neuronal firing rates, resulting in significant decreases in motor activity and CPP scores in cocaine-addicted mice [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In NAc, regression of heroin-addicted memories reduces the number of synapses in astrocyte-covered areas and is restored during subsequent transient drug seeking [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. In our findings, Gi activation of astrocytes in VTA and NAc during the formative phase of addiction memory did not affect the intensity and duration of morphine CPP formation. Gi activation in ACC astrocytes during memory formation increased the intensity of morphine CPP and prolonged the duration of addiction memory, suggesting that ACC astrocytes may have a unique role in the study of astrocytes affecting addiction memory. Furthermore, when ACC astrocytes are regulated at other stages, our results show no effect on short-term memory retrieval, memory transfer, and long-term memory retrieval, suggesting that ACC astrocytes play a key role only in morphine addiction memory formation.\u003c/p\u003e \u003cp\u003eCa\u003csup\u003e2+\u003c/sup\u003e signal is an important indicator of astrocyte activity. Regulation of Ca\u003csup\u003e2+\u003c/sup\u003e activity can affect local synaptic function and memory behavior [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Some studies have shown that Gq activation of hippocampal CA1 astrocytes in mice can significantly increase intracellular Ca\u003csup\u003e2+\u003c/sup\u003e activity and Ca\u003csup\u003e2+\u003c/sup\u003e event frequency, which in turn enhances the spontaneous firing of pyramidal neurons and the induction of NMDA dependent LTP, and improves the retrieval of spatial memory and fear memory in mice [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. An increase in intracellular Ca\u003csup\u003e2+\u003c/sup\u003e activity or frequency is considered a marker of altered astrocyte activity [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e]. In contrast, Gi activation significantly decreased baseline Ca\u003csup\u003e2+\u003c/sup\u003e levels and peak responses to Ca\u003csup\u003e2+\u003c/sup\u003e events in CA1 astrocytes, and Gi activation during memory formation decreased retrieval of long-term fear memories in mice [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Our results showed that ACC astrocytes Ca\u003csup\u003e2+\u003c/sup\u003e activity increased significantly during morphine CPP formation, short-term and long-term morphine CPP extraction, and showed an increase in signal frequency and a decrease in peak value, suggesting that ACC astrocytes were activated during morphine addiction memory formation and extraction, and participated in the regulation of addiction memory.\u003c/p\u003e \u003cp\u003eAstrocytes can affect memory through morphological changes, nutritional regulation, and transmitter metabolism. Morphologically, for example, knockout of actin Ezrin in CA1 astrocytes shortened astrocyte lobules and increased spacing from the postsynaptic dense zone, resulting in increased extrasynaptic glutamate diffusion, which in turn significantly increased NMDA receptor-mediated EPSC on CA1 pyramidal neurons, enhancing retrieval of recent fear memories in mice [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. In terms of nutritional regulation, for example, extraction of cocaine addiction memory can increase protein levels of monocarboxylic acid transporter MCT1 mainly expressed on astrocytes in BLA, while interference with translation of \u003cem\u003eMct1\u003c/em\u003e gene can reduce phosphorylation of plasticity-related proteins CREB, cofilin and ERK1/2, impairing the consolidation of cocaine addiction memory and can be rescued by exogenous L-lactic acid [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. In terms of affecting transmitter metabolism, some studies have found that in the hippocampus of BEST1 knockout mice, there is a decrease in the co-release of glutamate and D-serine, a decrease in the functionality of NMDA receptors in the extrasynaptic region, and an abnormal induction of LTD, resulting in cognitive flexibility defects and impaired formation of flexible memory in mice. These abnormalities can be rescued by specifically enhancing the expression of BEST1 in astrocytes [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Our results show that \u003cem\u003eBest1\u003c/em\u003e, associated with Glu and GABA release, is significantly upregulated during morphine CPP formation. Based on this, we specifically knocked down BEST1 in ACC astrocytes and found that it could significantly reduce the formation intensity and maintenance time of morphine CPP, indicating that BEST1 plays an important role in the formation of morphine CPP and mediates the formation and maintenance of morphine addiction memory.\u003c/p\u003e \u003cp\u003eThe morphological changes of astrocytes affect the memory process [\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e, \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. Although there is no direct report on the morphological effect of BEST1 on astrocytes, it has been found that BEST1 expression can impair cell volume retraction in BEST1 knockout mice or in the hippocampus-specific knockdown, and cell volume can be restored to normal when astrocyte-derived BEST1 is supplemented [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. This is in agreement with the trends we have reported in the results. During the formation of morphine CPP, knockdown of BEST1 in ACC astrocytes can increase cell volume, number of main branches and complexity, and significantly increase the number of synapses in the microdomain. We also found that the increased synapses come from not only the dorsal hippocampal CA1, but also the synaptic connections between ACC and other brain regions. These results suggest that BEST1 may regulate the morphological plasticity of ACC astrocytes, influence the possibility of direct interaction between astrocytes and neurons, and participate in the formation and maintenance of addiction memory.\u003c/p\u003e \u003cp\u003eAs for the changes in synaptic distribution within astrocyte microdomains, especially from dorsal CA1 synapses, we found that CA1 synaptic terminals were more co-localized with astrocyte soma and main branches after knockdown of BEST1. It has been found that in astrocyte microdomains of hippocampus CA1 of APP/PS1 mice, the expression intensity of BEST1 is reduced, and the distribution in cell body and process is increased, which is accompanied by target transformation with reduced co-localization with glutamate transporter vGLUT2 and increased co-localization of GABA transporter vGAT [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In addiction memories, heroin regression training increased selective modulation of co-localization with NAc D1-MSN synaptic terminals in VP astrocyte microdomains without altering co-localization with D2-MSN synaptic terminals [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Compared with soma and main branch, branchlets within astrocyte microdomains are widely thought to be sites of high frequency interaction with synapses [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e]. These results suggest that the level of BEST1 may be involved in the regulation of trilateral synapses during the formation of morphine addiction memory, and its distribution may interact with synaptic terminals from brain regions closely related to the formation of addiction memory, such as dCA1, so as to release transmitters to preferentially regulate dCA1-ACC neural pathway.\u003c/p\u003e \u003cp\u003eBEST1 mediates the release of glutamate and GABA from astrocytes and is involved in neuroregulation affecting behavioral phenotypes [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e]. Our results show that, during morphine CPP formation, knockdown of ACC astrocytes BEST1 reduces glutamate release, while GABA total activity remains unchanged, suggesting that astrocytes are involved in addiction memory formation through BEST1-mediated glutamate release. This is consistent with other studies showing that chronic morphine exposure reduces glutamate levels in multiple brain regions, including ACC [\u003cspan additionalcitationids=\"CR73\" citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e]. Furthermore, deletion of BEST1 in astrocytes resulted in decreased activity of ACC\u003csup\u003edCA1\u003c/sup\u003e neurons, which were mostly CaMKII positive and VIP positive neurons, and their activity changes were generally consistent. Recently, it has been found that there are engram neurons in the prefrontal cortex that encode fear memories [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e, \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. Therefore, we hypothesized that ACC\u003csup\u003edCA1\u003c/sup\u003e neurons were probably engram cells encoding memory. ACC astrocytes facilitated their activation by BEST1-mediated glutamate release, which increased the number of imprinted cells at this stage, resulting in significantly increased memory formation intensity and maintenance time.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eConflicts of interest\u003c/h2\u003e \u003cp\u003eThere is no conflict of interest for the studies in this article.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor contributions\u003c/h2\u003e \u003cp\u003eL.S. conceived the project. L.S. and YJ.L. supervised all experiments. L.S., YJ.L. and Z.L. designed the experiments. Z.L. and YF.L. performed the experiments and analyzed the data. Z.L., X.L. and Y.H. analyzed behavioral data. Z.L., S.G., X.F., X.Y., Y.Y., J.L., N.W. and S.S. analyzed immunohistochemical data. Z.L. and L.S. wrote the manuscript. All of the authors contributed to data interpretation.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThis work was supported by National Natural Science Foundation of China grants 82101312 (L.S.), 82371231 (L.S.), 81901350 (N.W.), 81771433 (YJ.L.) as well as Natural Science Foundation of Beijing (7222110) (L.S.).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSun W, Liu Z, Jiang X, Chen M, Dong H, Liu J \u003cem\u003eet al\u003c/em\u003e. Spatial transcriptomics reveal neuron-astrocyte synergy in long-term memory. Nature 2024; 627: 374\u0026ndash;381.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo S, Yarishkin O, Hwang Y, Chun Y, Park M, Woo D \u003cem\u003eet al\u003c/em\u003e. GABA from reactive astrocytes impairs memory in mouse models of Alzheimer's disease. Nat Med 2014; 20: 886\u0026ndash;896.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang J, Chen J, Liu Y, Chen K, Baraban J, Qiu Z. Ventral tegmental area astrocytes modulate cocaine reward by tonically releasing GABA. Neuron 2023; 111: 1104\u0026ndash;1117.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKruyer A, Dixon D, Angelis A, Amato D, Kalivas P. Astrocytes in the ventral pallidum extinguish heroin seeking through GAT-3 upregulation and morphological plasticity at D1-MSN terminals. Mol Psychiatry 2022; 27: 855\u0026ndash;864.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAten S, Kiyoshi C, Arzola E, Patterson J, Taylor A, Du Y \u003cem\u003eet al\u003c/em\u003e. Ultrastructural view of astrocyte arborization, astrocyte-astrocyte and astrocyte-synapse contacts, intracellular vesicle-like structures, and mitochondrial network. Prog Neurobiol 2022; 213: 102264.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChi S, Cui Y, Wang H, Jiang J, Zhang T, Sun S \u003cem\u003eet al\u003c/em\u003e. Astrocytic Piezo1-mediated mechanotransduction determines adult neurogenesis and cognitive functions. Neuron 2022; 110: 2984\u0026ndash;2999.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIqbal Z, Lei Z, Ramkrishnan A, Liu S, Hasan M, Akter M \u003cem\u003eet al\u003c/em\u003e. Adrenergic signalling to astrocytes in anterior cingulate cortex contributes to pain-related aversive memory in rats. Commun Biol 2023; 6: 10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi X, Zhang J, Li D, He C, He K, Xue T \u003cem\u003eet al\u003c/em\u003e. Astrocytic ApoE reprograms neuronal cholesterol metabolism and histone-acetylation-mediated memory. Neuron 2021; 109: 957\u0026ndash;970.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki A, Stern SA, Bozdagi O, Huntley G, Walker R, Magistretti P \u003cem\u003eet al\u003c/em\u003e. Astrocyte-neuron lactate transport is required for long-term memory formation. Cell 2011; 144: 810\u0026ndash;823.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkupio U, Tertil M, Bilecki W, Barut J, Korostynski M, Golda S \u003cem\u003eet al\u003c/em\u003e. Astrocytes determine conditioned response to morphine via glucocorticoid receptor-dependent regulation of lactate release. Neuropsychopharmacology 2020; 45: 404\u0026ndash;415.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiong S, Xiao H, Sun M, Liu Y, Gao L, Xu K \u003cem\u003eet al\u003c/em\u003e. Glutamate-releasing BEST1 channel is a new target for neuroprotection against ischemic stroke with wide time window. Acta Pharm Sin B 2023; 13: 3008\u0026ndash;3026.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eByun Y, Kim N, Kim G, Jeon Y, Choi J, Park C \u003cem\u003eet al\u003c/em\u003e. Stress induces behavioral abnormalities by increasing expression of phagocytic receptor MERTK in astrocytes to promote synapse phagocytosis. Immunity 2023; 56: 2105\u0026ndash;2120.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee J, Kim J, Noh S, Lee H, Lee S, Mun J \u003cem\u003eet al\u003c/em\u003e. Astrocytes phagocytose adult hippocampal synapses for circuit homeostasis. Nature 2021; 590: 612\u0026ndash;617.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdamsky A, Kol A, Kreisel T, Doron A, Ozeri-Engelhard N, Melcer T \u003cem\u003eet al\u003c/em\u003e. Astrocytic activation generates de novo neuronal potentiation and memory enhancement. Cell 2018; 174: 59\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKol A, Adamsky A, Groysman M, Kreisel T, London M, Goshen I. Astrocytes contribute to remote memory formation by modulating hippocampal-cortical communication during learning. Nat Neurosci 2020; 23: 1229\u0026ndash;1239.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang K, F\u0026ouml;rster R, He W, Liao X, Li J, Yang C \u003cem\u003eet al\u003c/em\u003e. Fear learning induces α7-nicotinic acetylcholine receptor-mediated astrocytic responsiveness that is required for memory persistence. Nat Neurosci 2021; 24: 1686\u0026ndash;1698.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOh S, Lee C. Distribution and function of the Bestrophin-1 (Best1) channel in the brain. Exp Neurobiol 2017; 26: 113\u0026ndash;121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetrukhin K, Koisti M, Bakall B, Li W, Xie G, Marknell T \u003cem\u003eet al\u003c/em\u003e. Identification of the gene responsible for Best macular dystrophy. Nat Genet 1998; 19: 241\u0026ndash;247.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarquardt A, St\u0026ouml;hr H, Passmore L, Kr\u0026auml;mer F, Rivera A, Weber B. Mutations in a novel gene, \u003cem\u003eVMD2\u003c/em\u003e, encoding a protein of unknown properties cause juvenile-onset vitelliform macular dystrophy (Best's disease). Hum Mol Genet 1998; 7: 1517\u0026ndash;1525.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark H, Oh S, Han K, Woo D, Park H, Mannaioni G \u003cem\u003eet al\u003c/em\u003e. Bestrophin-1 encodes for the Ca\u003csup\u003e2+\u003c/sup\u003e-activated anion channel in hippocampal astrocytes. J Neurosci 2009; 29: 13063\u0026ndash;13073.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOh S, Han K, Park H, Woo D, Kim H, Traynelis S \u003cem\u003eet al\u003c/em\u003e. Protease activated receptor 1-induced glutamate release in cultured astrocytes is mediated by Bestrophin-1 channel but not by vesicular exocytosis. Mol Brain 2012; 5: 38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee S, Yoon B, Berglund K, Oh S, Park H, Shin H \u003cem\u003eet al\u003c/em\u003e. Channel-mediated tonic GABA release from glia. Science 2010; 330: 790\u0026ndash;796.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoh W, Park M, Chun Y, Lee J, Shim H, Park M \u003cem\u003eet al\u003c/em\u003e. Astrocytes render memory flexible by releasing D-Serine and regulating NMDA receptor tone in the hippocampus. Biol Psychiatry 2022; 91: 740\u0026ndash;752.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoo J, Min J, Kang D, Kim Y, Jung G, Park H \u003cem\u003eet al\u003c/em\u003e. Control of motor coordination by astrocytic tonic GABA release through modulation of excitation/inhibition balance in cerebellum. Proc Natl Acad Sci U S A 2018; 115: 5004\u0026ndash;5009.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoo D, Han K, Shim J, Yoon B, Kim E, Bae J \u003cem\u003eet al\u003c/em\u003e. TREK-1 and Best1 channels mediate fast and slow glutamate release in astrocytes upon GPCR activation. Cell 2012; 151: 25\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAn H, Koh W, Kang S, Nam M, Lee C. Differential proximity of perisynaptic astrocytic Best1 at the excitatory and inhibitory tripartite synapses in APP/PS1 and MAOB-KO mice revealed by lattice structured illumination microscopy. Exp Neurobiol 2021; 30: 213\u0026ndash;221.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDoron A, Rubin A, Benmelech-Chovav A, Benaim N, Carmi T, Refaeli R \u003cem\u003eet al\u003c/em\u003e. Hippocampal astrocytes encode reward location. Nature 2022; 609: 772\u0026ndash;778.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRao J, Sun W, Wang X, Li J, Zhang Z, Zhou F. A novel role for astrocytic fragmented mitochondria in regulating morphine addiction. Brain, Behav, Immun 2023; 113: 328\u0026ndash;339.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Li K, Shukla A, Beroun A, Ishikawa M, Huang X \u003cem\u003eet al\u003c/em\u003e. Cocaine triggers astrocyte-mediated synaptogenesis. Biol Psychiatry 2021; 89: 386\u0026ndash;397.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKitamura T, Ogawa S, Roy D, Okuyama T, Morrissey M, Smith L \u003cem\u003eet al\u003c/em\u003e. Engrams and circuits crucial for systems consolidation of a memory. Science 2017; 356: 73\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun N, Chi N, Lauzon N, Bishop S, Tan H, Laviolette S. Acquisition, extinction, and recall of opiate reward memory are signaled by dynamic neuronal activity patterns in the prefrontal cortex. Cereb Cortex 2011; 21: 2665\u0026ndash;2680.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwak H, Koh W, Kim S, Song K, Shin J, Lee J \u003cem\u003eet al\u003c/em\u003e. Astrocytes control sensory acuity via tonic inhibition in the thalamus. Neuron 2020; 108: 691\u0026ndash;706.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeyes P, Adams E, Chen Z, Bi L, Nachtrab G, Wang V \u003cem\u003eet al\u003c/em\u003e. Orchestrating opiate-associated memories in thalamic circuits. Neuron 2020; 107: 1113\u0026ndash;1123.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNi T, Zhu L, Wang S, Zhu W, Xue Y, Zhu Y \u003cem\u003eet al\u003c/em\u003e. Medial prefrontal cortex Notch1 signalling mediates methamphetamine-induced psychosis via Hes1-dependent suppression of GABA\u003csub\u003eB1\u003c/sub\u003e receptor expression. Mol Psychiatry 2022; 27: 4009\u0026ndash;4022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Crugten J, Somogyi A, Nation R, Reynolds G. Concentration-effect relationships of morphine and morphine-6 beta-glucuronide in the rat. Clin Exp Pharma Physio 1997; 24: 359\u0026ndash;364.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGunaydin L, Grosenick L, Finkelstein J, Kauvar I, Fenno L, Adhikari A \u003cem\u003eet al\u003c/em\u003e. Natural neural projection dynamics underlying social behavior. Cell 2014; 157: 1535\u0026ndash;1551.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhan J, Komal R, Keenan W, Hattar S, Fernandez D. Non-invasive strategies for chronic manipulation of dreadd-controlled neuronal activity. \u003cem\u003eJ Visualized Exp\u003c/em\u003e 2019; 2019.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheung G, Bataveljic D, Visser J, Kumar N, Moulard J, Dall\u0026eacute;rac G \u003cem\u003eet al\u003c/em\u003e. Physiological synaptic activity and recognition memory require astroglial glutamine. Nat Commun 2022; 13: 753.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou B, Chen L, Liao P, Huang L, Chen Z, Liao D \u003cem\u003eet al\u003c/em\u003e. Astroglial dysfunctions drive aberrant synaptogenesis and social behavioral deficits in mice with neonatal exposure to lengthy general anesthesia. PLoS Biol 2019; 17: e3000086.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiu Z, Dubin A, Mathur J, Tu B, Reddy K, Miraglia L \u003cem\u003eet al\u003c/em\u003e. SWELL1, a plasma membrane protein, is an essential component of volume-regulated anion channel. Cell 2014; 157: 447\u0026ndash;458.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang S, Hong S, Lee J, Peyton L, Baker M, Choi S \u003cem\u003eet al\u003c/em\u003e. Activation of astrocytes in the dorsomedial striatum facilitates transition from habitual to goal-directed reward-seeking behavior. Biol Psychiatry 2020; 88: 797\u0026ndash;808.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoury-Jamot B, Carrard A, Martin J, Halfon O, Magistretti P, Boutrel B. Disrupting astrocyte-neuron lactate transfer persistently reduces conditioned responses to cocaine. Mol Psychiatry 2016; 21: 1070\u0026ndash;1076.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin Y, Hu J, Wei Y, Li Z, Luo Z, Wang R \u003cem\u003eet al\u003c/em\u003e. Astrocyte-derived lactate modulates the passive coping response to behavioral challenge in male mice. Neurosci Bull 2021; 37: 1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuraleedharan R, Gawali M, Tiwari D, Sukumaran A, Oatman N, Anderson J \u003cem\u003eet al\u003c/em\u003e. AMPK-regulated astrocytic lactate shuttle plays a non-cell-autonomous role in neuronal survival. Cell Rep 2020; 32: 108092.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKazazoglou T, Panagiotou C, Mihailidou C, Kokkinopoulou I, Papadopoulou A, Moutsatsou P. Glutamine synthetase regulation by dexamethasone, RU486, and compound A in astrocytes derived from aged mouse cerebral hemispheres is mediated via glucocorticoid receptor. Mol Cell Biochem 2021; 476: 4471\u0026ndash;4485.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDematteis G, Restelli E, Chiesa R, Aronica E, Genazzani A, Lim D \u003cem\u003eet al\u003c/em\u003e. Calcineurin controls expression of EAAT1/GLAST in mouse and human cultured astrocytes through dynamic regulation of protein synthesis and degradation. Int J Mol Sci 2020; 21: 2213.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoender A, Bontempi L, Nava L, Pelloux Y, Tonini R. Striatal astrocytes shape behavioral flexibility via regulation of the glutamate transporter EAAT2. Biol Psychiatry 2021; 89: 1045\u0026ndash;1057.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWearne T, Parker L, Franklin J, Goodchild A, Cornish J. GABAergic mRNA expression is differentially expressed across the prelimbic and orbitofrontal cortices of rats sensitized to methamphetamine: relevance to psychosis. Neuropharmacology 2016; 111: 107\u0026ndash;118.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSemyanov A, Verkhratsky A. Astrocytic processes: from tripartite synapses to the active milieu. Trends Neurosci 2021; 44: 781\u0026ndash;792.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBohmbach K, Henneberger C, Hirrlinger J, Bola\u0026ntilde;os J. Astrocytes in memory formation and maintenance. Essays Biochem 2023; 67: 107\u0026ndash;117.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoenaga J, Araque A, Kofuji P, Herrera Moro Chao D. Calcium signaling in astrocytes and gliotransmitter release. Front Synaptic Neurosci 2023; 15: 1138577.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoo J, Jang M, Lee J, Koh W, Mikoshiba K, Lee C. The molecular mechanism of synaptic activity-induced astrocytic volume transient. J Physiol 2020; 598: 4555\u0026ndash;4572.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng H, Chen D, Li X, Al-Sheikh U, Duan D, Fan Y \u003cem\u003eet al\u003c/em\u003e. Phasic/tonic glial GABA differentially transduce for olfactory adaptation and neuronal aging. Neuron 2024 (in press).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMilenkovic A, Brandl C, Milenkovic V, Jendryke T, Sirianant L, Wanitchakool P \u003cem\u003eet al\u003c/em\u003e. Bestrophin1 is indispensable for volume regulation in human retinal pigment epithelium cells. Proc Natl Acad Sci U S A 2015; 112.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSantello M, Toni N, Volterra A. Astrocyte function from information processing to cognition and cognitive impairment. Nat Neurosci 2019; 22: 154\u0026ndash;166.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKruyer A, Scofield M, Wood D, Reissner K, Kalivas P. Heroin cue-evoked astrocytic structural plasticity at nucleus accumbens synapses inhibits heroin seeking. Biol Psychiatry 2019; 86: 811\u0026ndash;819.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSofroniew MV, Vinters HV. Astrocytes: biology and pathology. Acta Neuropathol 2010; 119: 7\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShigetomi E, Bushong E, Haustein M, Tong X, Jackson-Weaver O, Kracun S \u003cem\u003eet al\u003c/em\u003e. Imaging calcium microdomains within entire astrocyte territories and endfeet with GCaMPs expressed using adeno-associated viruses. J Gen Physiol 2013; 141: 633\u0026ndash;647.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark H, Han K, Seo J, Lee J, Dravid S, Woo J \u003cem\u003eet al\u003c/em\u003e. Channel-mediated astrocytic glutamate modulates hippocampal synaptic plasticity by activating postsynaptic NMDA receptors. Mol Brain 2015; 8: 7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKruyer A, Chioma V, Kalivas P. The opioid-addicted tetrapartite synapse. Biol Psychiatry 2020; 87: 34\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim R, Healey K, Sepulveda-Orengo M, Reissner K. Astroglial correlates of neuropsychiatric disease: From astrocytopathy to astrogliosis. Prog Neuro-Psychopharmacol Biol Psychiatry 2018; 87: 126\u0026ndash;146.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrinivasan R, Huang B, Venugopal S, Johnston A, Chai H, Zeng H \u003cem\u003eet al\u003c/em\u003e. Ca\u003csup\u003e2+\u003c/sup\u003e signaling in astrocytes from Ip3r2\u003csup\u003e\u0026ndash;/\u0026ndash;\u003c/sup\u003e mice in brain slices and during startle responses \u003cem\u003ein vivo\u003c/em\u003e. Nat Neurosci 2015; 18: 708\u0026ndash;717.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBazargani N, Attwell D. Astrocyte calcium signaling: the third wave. Nat Neurosci 2016; 19: 182\u0026ndash;189.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCodeluppi S, Xu M, Bansal Y, Lepack A, Duric V, Chow M \u003cem\u003eet al\u003c/em\u003e. Prefrontal cortex astroglia modulate anhedonia-like behavior. Mol Psychiatry 2023; 28: 4632\u0026ndash;4641.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBadia-Soteras A, Heistek T, Kater M, Mak A, Negrean A, van den Oever M \u003cem\u003eet al\u003c/em\u003e. Retraction of Astrocyte Leaflets From the Synapse Enhances Fear Memory. Biol Psychiatry 2023; 94: 226\u0026ndash;238.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Xue Y, Meng S, Luo Y, Liang J, Li J \u003cem\u003eet al\u003c/em\u003e. Inhibition of lactate transport erases drug memory and prevents drug relapse. Biol Psychiatry 2016; 79: 928\u0026ndash;939.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou B, Zuo Y, Jiang R. Astrocyte morphology: Diversity, plasticity, and role in neurological diseases. CNS Neurosci Ther 2019; 25: 665\u0026ndash;673.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoo J, Han Y, Koh W, Won J, Park M, An H \u003cem\u003eet al\u003c/em\u003e. Pharmacological dissection of intrinsic optical signal reveals a functional coupling between synaptic activity and astrocytic volume transient. Exp Neurobiol 2019; 28: 30\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllen N, Eroglu C. Cell biology of astrocyte-synapse interactions. Neuron 2017; 96: 697\u0026ndash;708.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOcteau J, Chai H, Jiang R, Bonanno S, Martin K, Khakh B. An optical neuron-astrocyte proximity assay at synaptic distance scales. Neuron 2018; 98: 49\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng Y, Woo J, Luna-Figueroa E, Maleki E, Harmanci A, Deneen B. Social deprivation induces astrocytic TRPA1-GABA suppression of hippocampal circuits. Neuron 2023; 111: 1301\u0026ndash;1315.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHao Y, Yang J, Guo M, Wu C, Wu M. Morphine decreases extracellular levels of glutamate in the anterior cingulate cortex: an in vivo microdialysis study in freely moving rats. Brain Res 2005; 1040: 191\u0026ndash;196.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiang Y, Gao H, Zhu H, Sun N, Ma Y, Lei H. Neurochemical changes in brain induced by chronic morphine treatment: NMR studies in thalamus and somatosensory cortex of rats. Neurochem Res 2006; 31: 1255\u0026ndash;1261.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGreenwald M, Woodcock E, Khatib D, Stanley J. Methadone maintenance dose modulates anterior cingulate glutamate levels in heroin-dependent individuals: A preliminary \u003cem\u003ein vivo\u003c/em\u003e \u003csup\u003e1\u003c/sup\u003eH MRS study. Psychiatry Res Neuroimaging 2015; 233: 218\u0026ndash;224.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee J, Kim W, Park E, Cho J. Neocortical synaptic engrams for remote contextual memories. Nat Neurosci 2023; 26: 259\u0026ndash;273.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRajasethupathy P, Sankaran S, Marshel J, Kim C, Ferenczi E, Lee S \u003cem\u003eet al\u003c/em\u003e. Projections from neocortex mediate top-down control of memory retrieval. Nature 2015; 526: 653\u0026ndash;659.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Morphine addiction memory, Anterior cingulate cortex, Astrocyte, Bestrophin1, Astrocytic glutamate release","lastPublishedDoi":"10.21203/rs.3.rs-4272120/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4272120/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEmerging evidence indicates that astrocytes play a vital role in both the establishment and preservation of memories. However, their specific contribution to addiction-related memory remains largely unresolved. In this study, we observed alterations in Ca\u003csup\u003e2+\u003c/sup\u003e dynamics within astrocytes of the anterior cingulate cortex (ACC) during the acquisition, recent retrieval, and remote retrieval phases of morphine-conditioned place preference (CPP). Selective activation of Gi signaling in ACC astrocytes during the acquisition phase, rather than during retrieval or transfer phases, led to a significant and prolonged increase in the morphine CPP score. In contrast, activation of Gq signaling led to a reduction in the CPP score, which was both diminished and shortened. Additionally, we noted a significant increase in astrocytic Bestrophin 1 (BEST1) expression in the ACC during the morphine CPP acquisition phase. Selective knockdown of BEST1 from ACC astrocytes elevated astrocytic Ca\u003csup\u003e2+\u003c/sup\u003e dynamics, expanded astrocytic coverage, alleviated astrocytic glutamate release, and altered the density of synapses between the dorsal hippocampus (dCA1) and ACC within the astrocytic microdomains. Mice lacking astrocytic BEST1 displayed impaired activity in ACC\u003csup\u003edCA1\u003c/sup\u003e neurons and decreased CPP scores. These findings suggest that ACC astrocytes modulate the connectivity between dCA1 and ACC neurons, possibly through extrasynaptic glutamate activity, thereby regulating the strength and persistence of morphine-associated memory.\u003c/p\u003e","manuscriptTitle":"Astrocytic Bestrophin1 in the Anterior Cingulate Cortex Modulates the Formation and Persistence of Morphine Addiction Memory","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-04 09:03:46","doi":"10.21203/rs.3.rs-4272120/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f935098a-94cd-4900-bed2-6059f05d0266","owner":[],"postedDate":"July 4th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":33431202,"name":"Health sciences/Diseases/Psychiatric disorders/Addiction"},{"id":33431203,"name":"Biological sciences/Neuroscience"}],"tags":[],"updatedAt":"2024-08-20T14:12:59+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-04 09:03:46","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4272120","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4272120","identity":"rs-4272120","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.