Transcriptomic study of acute nitrite stress on ovary development stages of river shrimp (Macrobrachium nipponense) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Transcriptomic study of acute nitrite stress on ovary development stages of river shrimp (Macrobrachium nipponense) Zhao Li, Huadong Li, Han Zhao, Zhongmeng Zhao, Lu Zhang, Chengyan Mou, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4229192/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract River shrimp ( Macrobranchium nipponense ) is a species of shrimp that is widely farmed in China. As the scale of farming expands, the demand for juvenile shrimp will also increase. Their ovarian development time is short, and they are easily affected by environmental factors. Nitrite is a common water pollutant. Excessive exogenous nitrite concentration can affect the gonad development of some animals. However, the effect of nitrite on ovarian development in crustaceans remains to be studied. This experiment conducted a transcriptomic study of ovaries in stage III of development by exposing M. nipponense (3.42 ± 0.12g) to nitrite in LC50 48h (10.2 mg/L) for 48 hours. The results showed that the 11,592 differential genes (DEGs) included 3,243 up-regulated genes and 8,349 down-regulated genes. These DEGs are mainly enriched in pathways such as lipid metabolism, carbohydrate metabolism, lysosomal pathway and vitellogenesis. In order to resist nitrite stress, energy supply needs to be enhanced, and the expression levels of carbohydrate metabolism pathways and triglyceride synthesis and metabolism pathways increase. in the lysosomal pathway. The expression levels of Cathepsin L ( CTSL ) and Lysosomal aspartic protease were down-regulated. The expression levels of genes related to vitellogenin formation, juvenile hormone acid methyltransferase ( JHAMT ), vitellogenin receptor ( VgR ), and vitellogenin 2 ( Vg2 ) were down-regulated. This shows that nitrite stress inhibits the ovarian development of M. nipponense , and there may be a mechanism similar to that of fish in regulating ovarian development by nitrite. M. nipponense ovary development nitrite transcriptome lipid metabolism Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction M. nipponense is widely distributed in rivers, lakes, and ditches throughout various regions of China (Qiao et al., 2013 ). As a native shrimp, it is widely cultured in China with an aquaculture production of 226,312 tons in 2022 (Bureau of Fishery et al., 2023). With the development of China's economy, people's consumption of M. nipponense has increased, which has prompted the scale of M. nipponense culture to increase year by year (Cui et al., 2018 ), and the corresponding demand for juvenile shrimp will also increase. However, artificial breeding of M. nipponense is still in its initial stages. Due to the short development cycle of female shrimp ovaries, the development process is easily affected by environmental factors (Qiao et al., 2017 ; Fu et al., 2019 ). External environmental factors have an important impact on crustacean ovarian development. For example, lower salinity (5) and temperature (20°C) can hinder the maturation of the ovaries of Palaemon macrodactylus (Vázquez et al., 2013 ). The temperature, salinity, and acidity/alkalinity of the water body will affect the gene expression of heat stress protein 70 in the pacific white shrimp ( Litopenaeus vannamei ), thereby affecting the development of ovaries (Chen et al., 2018 ). At present, most research on the impact of environmental factors on crustacean ovary development focuses on temperature, salinity, pH, etc. However, nitrite, a common pollutant in the breeding process, needs to be studied. Nitrite is produced due to the imbalance of the proportion of nitrifying bacteria in the water body during the absorption and utilization of ammonia nitrogen (Wang et al., 2004 ; Mevel and Chamroux, 1981 ). The toxicity of nitrite to aquatic animals is multifaceted (Kocour Kroupová et al., 2018 ). For fish, nitrite will oxidize the divalent iron ions in hemoglobin to ferric ions, reducing the oxygen transport capacity and causing immune damage and oxidative damage (Hanson and Grizzle, 1985 ; Carballo and Munoz, 1991 ). Crustaceans are more sensitive to changes in nitrite levels than fish (Kocour Kroupová et al., 2018 ). Excessive nitrite levels in the environment can cause oxidative damage, immune damage, and other adverse effects on the hepatopancreas of M. nipponense (Wang et al., 2004 ; Yu et al., 2019 ). Studies have shown that excessive concentrations of exogenous nitrite can affect the gonadal development process of animals. Excessive nitrite intake can inhibit follicle development in mice ( Mus musculus ), leading to infertility in mice ( M. musculus ) (Wu et al., 2022 ). Excessively high nitrite levels in the water environment can cause the gonadal index of zebrafish ( Danio rerio ) and green sea urchin ( Strongylocentrotus droebachiensis ) to decrease, inhibit D. rerio testosterone secretion and cell proliferation, thereby inhibiting testis development (Lin et al., 2018 ; Siikavuopio et al., 2004 ). The effects of nitrite on the development of crustacean ovaries need to be studied. Based on the above background, we selected the appropriate nitrite concentration in the water body (< 0.2 mg/L) as the control group (Ctrl), and the experimentally predicted LC50 48h (10.2 mg/L) of M. nipponense as the treatment group (PG). Through 48 hours of acute nitrite stress, the effect on ovary development of M. nipponense was explored to provide theoretical support to solve the adverse effects of nitrite stress on ovary development of M. nipponense .· 2. Materials and Methods 2.1 Experimental animals Female individuals of M. nipponense (3.42 ± 0.12 g) were obtained from an aquaculture base in Qianwei County, Sichuan Province, China. Female shrimps of the same size with complete appendages were selected. All shrimps were placed in a tank (2×0.5×0.8m) containing 400L of water for one week before the experiment. They were fed four times a day (at 7:00, 11:00, 17:00, and 23:00) to acclimate to the environment. 2.2 LC50 48h Water was used as a solvent to prepare a mother liquor with a nitrite concentration of 3g/L. The preliminary experiment was divided into four groups with nitrite concentrations of 6, 9, 12, and 15 mg/L, respectively. Each group had three replicates, and each replicate contained 30 shrimps. The above concentrations were diluted with the mother liquor and prepared. Each water tank was filled with 200L of water. The mortality rate was recorded at 48 hours, and Probit regression analysis was performed on the concentration and mortality rate using SPSS. The LC50 48h was predicted to be 10.2 mg/L. During the experiment, the nitrite concentration in the water was detected using the kit provided by Shanghai Beibo Biotechnology Co., Ltd (Shanghai, China), and the detection method recommended by the manufacturer was followed. 2.3 Nitrite stress and sample collection Selected 180 shrimps and placed them into the control group (Ctrl) with a nitrite concentration of 0 mg/L, and the treatment group (PG) with a nitrite concentration of 10.2 mg/L. Each group had three replicates with 30 shrimps each. After 48 hours, all surviving shrimps were sampled, and the ovaries in stage III of development were selected. They were then placed in RNALater preservation solution (Nanjing Jiancheng Bioengineering Institute Co., Ltd, Nanjing, China) and stored at -20°C. 2.4 RNA extraction and library preparation Four ovaries were randomly selected from each group, and total RNA was extracted using TRIzol reagent (HongYe Biotech Co., Ltd, Shanghai, China) according to the method described by Wen et al. ( 2014 ). After enriching eukaryotic mRNA with polyA tail using magnetic beads with Oligo(dT), the mRNA was fragmented with buffer. The first strand of cDNA was synthesized in the M-MuLV reverse transcriptase system, using the fragmented mRNA as a template and random oligonucleotides as primers. RNaseH was then used to degrade the RNA chain, and dNTPs were used as the primer in the DNA polymerase I system to synthesize the second strand of cDNA. The purified double-stranded cDNA was end-repaired, A-tailed, and connected to sequencing adapters. AMPure XP beads were used to screen about 200 bp of cDNA, PCR amplification was performed, and AMPure XP beads were used again to purify the PCR product to finally obtain a library. The quality of the library was analyzed using agarose gel electrophoresis. To ensure data quality, the original data were filtered before information analysis to reduce analysis interference caused by invalid data. First, fastp was used to perform quality control on the raw reads that were downloaded, filter low-quality data, and obtain clean reads (Chen et al., 2018 ). After data filtering, we analyzed the composition and mass distribution of bases to visually demonstrate the data quality. The more balanced the base composition, the higher the quality. After passing the quality inspection, the M. nipponense genome GigaDB 100843 ( http://gigadb.org/dataset/view/id/100843 ) was used as the reference genome, and HISAT2 software was used to carry out comparative analysis based on the reference genome (Kim et al., 2015 ). 2.5 Differential gene analysis The read count data obtained from the gene expression level analysis were analyzed using DESeq2 software (Love et al., 2014 ). Hierarchical clustering of differential gene expression patterns was performed, and a heat map was used to present the clustering results. These genes with similar expression patterns may have common functions or participate in common metabolic pathways and signaling pathways. The DEGs were compared with the Gene Ontology (GO) database and the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, respectively. Then, the hypergeometric test was applied to identify significantly enriched GO entries and KEGG pathways among the DEGs compared to the background ( P < 0.05). Transcriptome data has been uploaded to NCBI SRA database (PRJNA1098363). 2.6 Transcriptome validation Eight samples per group were used to extract RNA. Total RNA was extracted using TRIzol reagent (HongYe Biotech Co., Ltd, Shanghai, China) following the method described by Wen et al. ( 2014 ). The total RNA concentration was adjusted to 500 ng/µL using a microvolume spectrophotometer (WI 53711, Thermo Fisher Scientific, USA). Reverse transcription was performed using a reverse transcription kit. Primers for β-Actin, which was used as an internal reference gene, were designed using Primer 5 software (Table 2 ). Three pairs of primers were designed for each gene, and SYBR Green qPCR Master Mix (Cat. No.: GK10002) was used for the qPCR amplification reaction. Primers with an amplification efficiency of 90%-110% were selected based on a standard curve made using LightCycler® 96 SW 1.1 software. The specificity of the primer was assessed by analyzing the melting curve, which should be a unimodal curve. The 2 −ΔΔCT method (Livak and Schmittgen., 2001) was used for relative quantification of target genes, following the method described by Zhang et al. ( 2015 ). Log 2 (Fc) analysis was performed on the relative expression ratio of each gene in the two groups. 3. Result 3.1 Transcriptomic data overview A total of 30.0 Gb of clean data was obtained from 8 samples, with Q30 > 92.68%. The main statistical data of the 8 samples are shown in Table 1 . After correlation evaluation, it was found that the 4 samples in each group had strong correlations, so the samples were not removed (Fig. 1 a). 3.2 Functional annotation and analysis of DEGs A total of 11,592 DEGs were screened out from 8 sequencing samples. A total of 11,592 genes with significant expression differences were screened out by PG relative to Ctrl, including 3,243 up-regulated genes and 8,349 down-regulated genes (Fig. 1 b). Hierarchical clustering was performed on these differential gene expression patterns, and the clustering results were presented using heat maps. These genes with similar expression patterns may have common functions or participate in common metabolic pathways and signaling pathways (Fig. 2 ). 3.3 DEGs trends analysis Gene Ontology (GO for short) is an internationally standardized gene function classification system that provides a set of dynamically updated standard vocabulary (controlled vocabulary) for comprehensively describing the attributes of genes and gene products in organisms. GO analysis showed that differentially expressed genes (DEGs) clustered together in molecular functions, biological processes, and cellular components. DEGs are highly representative of biological processes. The main categories of biological processes include cellular components (5399 single genes), metabolic processes (4614 single genes), and biological regulation (2920 single genes). The main category of molecular function is catalytic activity (3781 single genes). The main categories of cellular components are cellular anatomical entity (4511 single genes) and protein-containing complex (1877 single genes). Enrichment and classification of DEGs were performed, and hypergeometric testing was used to identify significantly enriched GO terms among the DEGs compared to the background of the entire genome. The results showed that DEGs were significantly enriched in Protein binding, Organonitrogen compound metabolic process, Biological regulation, and Cellular component organization or biogenesis (Fig. 3 , P < 0.05). KEGG enrichment analysis results show that compared with Ctrl, the DEGs of PG are mainly enriched in pathways such as lipid metabolism, carbohydrate metabolism, and amino acid metabolism (Fig. 4 , P < 0.05). In the lipid metabolism pathway, the expression levels of Diacylglycerol acyltransferase 2 ( DGAT2 ), Alcohol dehydrogenase class 3 ( ADH3 ), Glycerol-3-phosphate dehydrogenase ( G3P ), Fatty acid synthase ( FAS ), and Glycerol-3-phosphate acyltransferase 3 ( GPAT3 ) were increased. The expression levels of Glutathione-S-transferase 3 ( GS3 ), cathepsin L ( CTSL ), and 3-hydroxybutyrate dehydrogenase ( 3-HBDH ) in the lysosomal pathway are increased. The expression of key genes for vitellogenic formation, vitellogenin receptor (VgR), vitellogenin 2 (Vg2), and juvenile hormone acid methyltransferase (JHAMT), is down-regulated (Fig. 5 , P < 0.05). 3.4 qPCR validation Four genes with different expression patterns were randomly selected from the functional enrichment and pathways for qPCR, and Log 2 (Fc) analysis was performed on the relative expression ratio of each gene in the two groups. The results showed that the expression levels of cathepsin L ( CTSL ), Diacylglycerol acyltransferase 2 ( DGAT2 ), Fatty acid synthase ( FAS ) and 3-hydroxybutyrate dehydrogenase ( HBDH ) were up-regulated, and were consistent with the expression pattern in transcriptomics (Fig. 6 ). 4 Discussion Nitrite is one of the most common water pollutants in the aquaculture process. It is difficult to remove from the water and easily accumulates. When the concentration is too high, it can cause strong toxicity to aquatic animals. Therefore, it requires special attention in intensive breeding processes (Gross et al., 2004 ; Svobodova et al., 2005 ; Jørgensen et al., 2009 ; Kouba et al., 2012 ). There are variations in size and sensitivity to nitrite among different crustacean species (Kocour Kroupová et al., 2018 ). While many studies have been conducted on the toxic effects of nitrite on crustaceans, most of them focus on its impact on the immune, antioxidant, and digestive systems (Yu et al., 2019 ; Huang et al., 2020 ; Xie et al., 2022 ), with limited research on its effects on gonadal development. In this study, M. nipponense was exposed to nitrite levels equivalent to LC50 48h . Transcriptome sequencing was performed on ovaries that developed to stage III, and GO annotations of DEG and KEGG pathways were used to explore acute nitrite stress and its impact on the ovary development stages of M. nipponense . GO and KEGG pathway analysis showed that nitrite stress may affect ovarian development by mediating carbohydrate metabolism, lipid metabolism, and lysosome pathways. Ovarian development requires more energy supply (Bo et al., 2021 ). Carbohydrates are the main source of energy for crustaceans (Rosas et al., 2000 ), and their metabolic processes are enhanced (Castille and Lawrence, 1989 ). When crustaceans are exposed to environmental stress, they inevitably increase their energy supply to maintain internal homeostasis (Cuzon et al., 1994 ; Cuzon et al., 2004 ). Studies have demonstrated that nitrite in the environment can enter the body through the respiration of Penaeus monodon and accumulate in the blood (Xian et al., 2012 ). In this study, carbohydrate metabolism processes were found to be enhanced in shrimp ovaries subjected to nitrite stress, which may be due to the need for more energy to resist endogenous nitrite stress on the ovaries. Ovarian development is accompanied by lipid accumulation (Lee and Walker, 1995 ; Wouters et al., 2001 ). Phospholipids, sterols, and glycerol are the main lipids found in shrimp. These lipids serve as raw materials for the synthesis of hormones and steroids (Zandee, 1967 ; Kean et al., 1985 ), and they play an important role in ovarian development (Ravid et al., 1999 ). Therefore, lipid metabolism is a pathway that warrants attention when studying the process of ovarian development. Diacylglycerol acyltransferase 2 ( DGAT2 ) is a member of the diacylglycerol acyltransferase family. In mammals, it is generally considered to be the enzyme that catalyzes the final step in the synthesis of triglycerides from diacylglycerol (Yen et al., 2008 ). The conversion of diacylglycerol and triglyceride in crustaceans has not been reported, but in a study on Chinese mitten crab ( Eriocheir sinensis ), it was found that Diacylglycerol acyltransferase 2 ( DGAT2 ) may also have similar functions to those observed in mammals (Feng et al., 2022 ). Glycerol-3-phosphate dehydrogenase ( G3P ), Glycerol-3-phosphate acyltransferase 3 ( GPAT3 ) and Fatty acid synthase ( FAS ) are enzymes that synthesize triglycerides (Luo et al., 2018 , An et al., 2020 ). Triglyceride is the main lipid energy supply substance during ovarian development (Yao et al., 2008 ), and its synthesis pathway is up-regulated after nitrite exposure, which may also be due to the need for more energy supply. The lysosomal pathway has the function of decomposing various endogenous or exogenous macromolecules during ovarian development and is an important way to regulate ovarian development (Wang et al., 2020 ). Cathepsin L ( CTSL ) and Lysosomal aspartic protease are both cathepsins in the lysosomal pathway and play a role in the hydrolysis of vitellogenin and acidification of vitellogenic balls (Carnevali et al., 2006 , LaFleur Jr et al., 2005 ). The expression levels show different expression patterns at different stages of ovarian development, and the expression level reaches the highest level in the stage III of ovarian development of M. nipponense (Zhang et al., 2021 ). "For crustaceans, JHAMT is a key gene involved in the biosynthesis of methyl farnesoate (MF), which promotes the synthesis and transport of vitellogenin during ovarian development (Homola and Chang., 1997; Bellés et al., 2005 ; Stay and Tobe., 2007; Fast and Lester., 2013; Miyakawa et al., 2014 ; Xie et al., 2016 ). In this study, although nitrite stress promoted the expression of genes related to carbohydrate metabolism, lipid metabolism, lysosomal pathway, and other pathways, the expression of genes such as JHAMT , vitellogenin receptor ( VgR ), and vitellogenin 2 ( Vg2 ), which are associated with vitellogenin synthesis and transport, was downregulated. This indicates that exogenous nitrite stress enhances energy metabolism in the ovary but inhibits substance synthesis and transport, which is an interesting phenomenon. In fact, nitrite in the environment enters the blood circulation of crustaceans through respiration (Xian et al., 2012 ). Nitrite in the body can generate nitric oxide through ion metabolism (Panesar and Chan., 2000). A study on catfish ( Heteropneustes fossilis ) found that serum nitrite levels increased during ovarian development and played an active role in previtellogenesis, but during vitellogenesis, serum nitrite levels dropped dramatically. In other words, serum nitrite levels in H. fossilis change cyclically during ovarian development (Tripathi and Krishna., 2008). Similar regulation exists during mammalian ovarian development (Panesar and Chan., 2000). Currently, there are no studies on the regulation of ovarian development by exogenous nitrite in crustaceans. However, it is possible that M. nipponense also has a pathway similar to that of fish, in which nitrite regulates ovarian development, this hypothesis deserves further exploration. To verify the reliability of transcriptomic sequencing in this study, we randomly selected four genes from the lipid metabolism pathway and lysosomal pathway for qPCR verification. The results showed that the expression patterns of the four genes were consistent with the omics results, confirming the reliability of the sequencing data." 5 Conclusion After 48 hours of nitrite exposure in M. nipponense LC50 48h , DEGs involved in the carbohydrate metabolism pathway, lipid metabolism pathway, lysosomal pathway and vitellogenesis were significantly enriched in the ovary. In order to resist nitrite stress and enhance energy supply, the expression levels of carbohydrate metabolism pathways and triglyceride anabolism pathways were increased. The expression of lysosomal pathway genes related to ovarian development increased, while the expression of genes related to vitellogenesis was down-regulated. This indicates that nitrite stress inhibits the ovary development of M. nipponense and it may have a mechanism similar to fish in regulating ovarian development with nitrite. Declarations Animal Experimentation Welfare and Ethics Statement All experiments involving the handling and treatment of M. nipponense were conducted in strict accordance with the recommendations in the Guide for the Animal Care and Use Committee of the Fishery Institute of the Sichuan Academy of Agricultural Sciences (20220323001A). All animal collection and use protocols were conducted in accordance with the guidelines and regulations for the care and use of laboratory animals at the Fishery Institute of the Sichuan Academy of Agricultural Sciences. Data availability statement All data generated and analyzed during this study are included in this published article. Declarations of interest None. Acknowledgements This work was supported by the Sichuan Science and Technology Planning Project (2021YFYZ0015); Investigation on Fishery Resources and Environment in Key Waters of Northwest China and Agriculture Research System of China (CARS-46); “1 + 9” open competition mechanism to select the best candidates and scientific and technological project of Sichuan Academy of Agricultural Sciences (1+ 9KJGG004); Sichuan Freshwater Fish Innovation Team of the National Modern Agricultural Industrial Technology System; Fish Reso urces and Environment in the Upper Reaches of the Yangtze River Observation and Research Station of Sichuan Province. References An W, He H, Dong X, Tan B, Yang Q, Chi S, Zhang S, Liu H, Yang Y (2020) Regulation of growth, fatty acid profiles, hematological characteristics and hepatopancreatic histology by different dietary n-3 highly unsaturated fatty acids levels in the first stages of juvenile Pacific white shrimp ( Litopenaeus vannamei ). Aquac Rep 17:100321 Bellés X, Martín D, Piulachs M-D (2005) The mevalonate pathway and the synthesis of juvenile hormone in insects. Annu Rev Entomol 50:181–199 Bo Q-K, Lu Y-Z, Ma C, Mi H-J, Jia L, Meng Y-G, Yu Y-G, Geng X-Y (2021) Reproductive biology and biochemical changes in female mantis shrimp Oratosquilla oratoria (Stomatopoda) with ovary development from the Tianjin coastal zone of Bohai Bay. Aquaculture 534:736239 Carballo M, Munoz MJ (1991) Effect of sublethal concentrations of four chemicals on susceptibility of juvenile rainbow trout ( Oncorhynchus mykiss ) to saprolegniosis. Appl Environ Microbiol 57:1813–1816 Carnevali O, Cionna C, Tosti L, Lubzens E, Maradonna F (2006) Role of cathepsins in ovarian follicle growth and maturation. Gen Comp Endocrinol 146:195–203. https://doi.org/https://doi.org/10.1016/j.ygcen.2005.12.007 Castille FL, Lawrence AL (1989) Relationship between maturation and biochemical composition of the gonads and digestive glands of the shrimps Penaeus aztecus Ives and Penaeus setiferus (L) . J Crustac Biol 9:202–211 China Fishery Statistical Yearbook (2023) China Fishery Statistical Yearbook. Agriculture, Beijing, China Chen S, Zhou Y, Chen Y, Gu J (2018) Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34:i884–i890. https://doi.org/10.1093/bioinformatics/bty560 Chen T, Lin T, Li H, Lu T, Li J, Huang W, Sun H, Jiang X, Zhang J, Yan A, Hu C, Luo P, Ren C (2018) Heat Shock Protein 40 (HSP40) in Pacific White Shrimp ( Litopenaeus vannamei ): Molecular Cloning, Tissue Distribution and Ontogeny, Response to Temperature, Acidity/Alkalinity and Salinity Stresses, and Potential Role in Ovarian Development. Front Physiol 9:1–13. https://doi.org/10.3389/fphys.2018.01784 Cui F, Yu Y, Bao F, Wang S, Xiao MS (2018) Genetic diversity analysis of the oriental river prawn ( Macrobrachium nipponense ) in Huaihe River. Mitochondrial DNA Part A DNA Mapping. Seq Anal 29:737–744. https://doi.org/10.1080/24701394.2017.1350953 Cuzon G, Guillaume J, Cahu C (1994) Composition, preparation and utilization of feeds for Crustacea. Aquaculture 124:253–267 Cuzon G, Lawrence A, Gaxiola G, Rosas C, Guillaume J (2004) Nutrition of Litopenaeus vannamei reared in tanks or in ponds. Aquaculture 235:513–551 Fast AW, Lester LJ (2013) Marine shrimp culture: principles and practices. Elsevier Feng Q, Liu M, Cheng Y, Wu X (2022) Comparative transcriptome analysis reveals the process of ovarian development and nutrition metabolism in Chinese mitten crab, Eriocheir sinensis . Front Genet 13:910682 Fu C, Li F, Wang L, Li T (2019) Molecular insights into ovary degeneration induced by environmental factors in female oriental river prawns Macrobrachium nipponense *. Environ Pollut 253:882–888. https://doi.org/10.1016/j.envpol.2019.07.085 Gross A, Shai A, Dina Z (2004) Acute and Chronic Effects of Nitrite on White Shrimp. J World Aquac Soc 35:7 Hanson LA, Grizzle JM (1985) Nitrite-induced predisposition of channel catfish to bacterial diseases. Progress Fish‐Culturist 47:98–101 Homola E, Chang ES (1997) Methyl Farnesoate: Crustacean Juvenile Hormone in Search of Functions. 117:347–356 Huang M, Xie J, Yu Q, Xu C, Zhou L, Qin JG, Chen L, Li E (2020) Toxic effect of chronic nitrite exposure on growth and health in Pacific white shrimp Litopenaeus vannamei . Aquaculture 529:735664. https://doi.org/10.1016/j.aquaculture.2020.735664 Jørgensen TR, Larsen TB, Buchmann K (2009) Parasite infections in recirculated rainbow trout ( Oncorhynchus mykiss ) farms. Aquaculture 289:91–94 Kean JC, Castell JD, Boghen AG, d’Abramo LR, Conklin DE (1985) A re-evaluation of the lecitihin and cholesterol requirements of juvenile lobster ( Homarus americanus ) using crab protein-based diets. Aquaculture 47:143–149 Kim D, Langmead B, Salzberg SL (2015) HISAT: A fast spliced aligner with low memory requirements. Nat Methods 12:357–360. https://doi.org/10.1038/nmeth.3317 Kocour Kroupová H, Valentová O, Svobodová Z, Šauer P, Máchová J (2018) Toxic effects of nitrite on freshwater organisms: a review. Rev Aquac 10:525–542. https://doi.org/10.1111/raq.12184 Kouba A, Niksirat H, Kuklina I, Buřič M, Kozák P (2012) Ultraviolet light and semi-recirculating systems in artificial incubation of noble crayfish ( Astacus astacus ) eggs: opportunities and limitations. Aquac Res 44:67–74 LaFleur Jr GJ, Raldúa D, Fabra M, Carnevali O, Denslow N, Wallace RA, Cerda J (2005) Derivation of major yolk proteins from parental vitellogenins and alternative processing during oocyte maturation in Fundulus heteroclitus. Biol Reprod 73:815–824 Lee RF, Walker A (1995) Lipovitellin and lipid droplet accumulation in oocytes during ovarian maturation in the blue crab, Callinectes sapidus . J Exp Zool 271:401–412 Lin W, Guo H, Li Y, Wang L, Zhang D, Hou J, Wu X, Li L, Li D, Zhang X (2018) Single and combined exposure of microcystin-LR and nitrite results in reproductive endocrine disruption via hypothalamic-pituitary-gonadal-liver axis. Chemosphere 211:1137–1146. https://doi.org/10.1016/j.chemosphere.2018.08.049 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods 25:402–408. https://doi.org/10.1006/meth.2001.1262 Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15:1–21. https://doi.org/10.1186/s13059-014-0550-8 Luo N, Ding Z, Kong Y, Zhang R, Zhang Y, Wu C, Jiang Z, Ye J (2018) An evaluation of increasing linolenic acid level in the diet of Macrobrachium nipponense : Lipid deposition, fatty acid composition and expression of lipid metabolism-related genes. Aquac Nutr 24:758–767 Mevel G, Chamroux S (1981) A study on nitrification in the presence of prawns ( Penaeus japonicus ) in marine closed systems. Aquaculture 23:29–43. https://doi.org/10.1016/0044-8486(81)90005-3 Miyakawa H, Toyota K, Sumiya E, Iguchi T (2014) Comparison of JH signaling in insects and crustaceans. Curr Opin Insect Sci 1:81–87 Panesar NS, Chan KW (2000) Decreased steroid hormone synthesis from inorganic nitrite and nitrate: studies in vitro and in vivo. Toxicol Appl Pharmacol 169:222–230 Qiao H, Fu H, Xiong Y, Jiang S, Zhang W, Sun S, Jin S, Gong Y, Wang Y, Shan D, Li F, Wu Y (2017) Molecular insights into reproduction regulation of female Oriental River prawns Macrobrachium nipponense through comparative transcriptomic analysis. Sci Rep 7:1–11. https://doi.org/10.1038/s41598-017-10439-2 Qiao H, Lv D, Jiang SF, Sun SM, Gong YS, Xiong YW, Jin SB, Fu HT (2013) Genetic diversity analysis of oriental river prawn, Macrobrachium nipponense , in Yellow River using microsatellite marker. Genet Mol Res 12:5694–5703. https://doi.org/10.4238/2013.November.18.18 Ravid T, Tietz A, Khayat M, Boehm E, Michelis R, Lubzens E (1999) Lipid accumulation in the ovaries of a marine shrimp Penaeus semisulcatus (De Haan) . J Exp Biol 202:1819–1829. https://doi.org/10.1242/jeb.202.13.1819 Rosas C, Cuzon G, Gaxiola G, Arena L, Lemaire P, Soyez C, Van Wormhoudt A (2000) Influence of dietary carbohydrate on the metabolism of juvenile Litopenaeus stylirostris . J Exp Mar Bio Ecol 249:181–198 Siikavuopio SI, Dale T, Christiansen JS, Nevermo I (2004) Effects of chronic nitrite exposure on gonad growth in green sea urchin Strongylocentrotus droebachiensis . Aquaculture 242:357–363. https://doi.org/10.1016/j.aquaculture.2004.09.007 Stay B, Tobe SS (2007) The role of allatostatins in juvenile hormone synthesis in insects and crustaceans. Annu Rev Entomol 52:277–299 Svobodova Z, Machova J, Poleszczuk G, Hůda J, Hamáčková J, Kroupova H (2005) Nitrite poisoning of fish in aquaculture facilities with water-recirculating systems. Acta Vet Brno 74:129–137 Tripathi V, Krishna A (2008) Changes in nitric oxide (NO) synthase isoforms and NO in the ovary of Heteropneustes fossilis (Bloch.) during the reproductive cycle. J Endocrinol 199:307–316 Vázquez MG, Ituarte RB, Bas CC, Spivak ED (2013) Effects of temperature and salinity on the ovarian cycle and the embryonic development of the invasive shrimp Palaemon macrodactylus . J Crustac Biol 33:218–223. https://doi.org/10.1163/1937240X-00002128 Wang M, Hu Y, Li M, Xu Q, Zhang X, Wang X, Xue X, Xiao Q, Liu J, Wang H (2020) A proteomics analysis of the ovarian development in females of Haemaphysalis longicornis . Exp Appl Acarol 80:289–309 Wang WN, Wang AL, Zhang YJ, Li ZH, Wang JX, Sun RY (2004) Effects of nitrite on lethal and immune response of Macrobrachium nipponense . Aquaculture 232:679–686. https://doi.org/10.1016/j.aquaculture.2003.08.018 Wen J, Yang H, Liu MZ, Luo KJ, Liu H, Hu Y, Zhang X, Lai RC, Lin T, Wang HY, Fu JH (2014) Gene expression analysis of pretreatment biopsies predicts the pathological response of esophageal squamous cell carcinomas to neo-chemoradiotherapy. Ann Oncol 25:1769–1774. https://doi.org/https://doi.org/10.1093/annonc/mdu201 Wouters R, Molina C, Lavens P, Calderón J (2001) Lipid composition and vitamin content of wild female Litopenaeus vannamei in different stages of sexual maturation. Aquaculture 198:307–323 Wu S, Hu S, Fan W, Zhang X, Wang H, Li C, Deng J (2022) Nitrite exposure may induce infertility in mice. J Toxicol Pathol 35:75–82. https://doi.org/10.1293/tox.2021-0002 Xian J-A, Wang A-L, Hao X-M, Miao Y-T, Li B, Ye C-X, Liao S-A (2012) In vitro toxicity of nitrite on haemocytes of the tiger shrimp, Penaeus monodon , using flow cytometric analysis. Comp Biochem Physiol Part C Toxicol Pharmacol 156:75–79 Xie X, Tao T, Liu M, Zhou Y, Liu Z, Zhu D (2016) The potential role of juvenile hormone acid methyltransferase in methyl farnesoate (MF) biosynthesis in the swimming crab, Portunus trituberculatus * Corresponding author: Dongfa Zhu Xie X-D, Cao M-X, Chen Q, Yu M-L, Liu Q-Y, Zhao Y-Z, Zhang L, Hu T-J (2022) Effect of medical herbs in Tian-Dong-Tang-Gan powder on the oxidative stress induced by ammonia and nitrite in Litopenaeus vannamei . Aquaculture 548:737584 Yao GG, Wu XG, Cheng YX, Yang XZ, Wang CL (2008) The changes of histology and main biochemical composition in the hepatopancreas at the different physiological stages of Portunus trituberculatus in East China Sea. Acta Oceanol Sin 30:122–131 Yen C-LE, Stone SJ, Koliwad S, Harris C, Farese RV (2008) Thematic review series: glycerolipids. DGAT enzymes and triacylglycerol biosynthesis. J Lipid Res 49:2283–2301 Yu J, Ji X, Wang X, Li T, Wang H, Zeng Q (2019) Identification and characterization of differentially expressed genes in hepatopancreas of oriental river prawn Macrobrachium nipponense under nitrite stress. Fish Shellfish Immunol 87:144–154. https://doi.org/10.1016/j.fsi.2018.12.075 Zandee DI (1967) Absence of cholesterol synthesis as contrasted with the presence of fatty acid synthesis in some arthropods. Comp Biochem Physiol 20:811–822 Zhang JD, Ruschhaupt M, Biczok R (2015) ddCt method for qRT – PCR data analysis. Bioconductor 1–8 Zhang Y, Jiang S, Qiao H, Xiong Y, Fu H, Zhang W, Gong Y, Jin S, Wu Y (2021) Transcriptome analysis of five ovarian stages reveals gonad maturation in female Macrobrachium nipponense . BMC Genomics 22:1–12. https://doi.org/10.1186/s12864-021-07737-5 Tables Table 1. Sequencing data overview Sample Raw Datas Clean Data (%) AF Q30(%) Low Quality (%) Ctrl-1 38097342 99.80% 93.79% 0.17% Ctrl-2 50151018 99.78% 93.69% 0.19% Ctrl-3 48554222 99.65% 92.84% 0.30% Ctrl-4 42593312 99.80% 94.01% 0.18% PG-1 39667482 99.77% 94.05% 0.21% PG-2 49129048 99.71% 93.24% 0.27% PG-3 49031588 99.65% 92.98% 0.32% PG-4 48170084 99.72% 93.42% 0.26% Table 2. qPCR primer list Primer Sequence (5′–3′) Product size Accession number β-actin -F β-actin -R GTCTTACGAGCTCCCTGACG TCTCGTGAATGCCGCAAGAT 116 JF288784.1 HBDH - F HBDH - R TGTCATCAACAACGCGGGTA GTGCCAGGCAAGCCTTAGTA 125 XP-045614091.1 CTSL- F CTSL - R GAACACAACCAGCGCTTCAG CGCTGCCTTCCTTACTTGGA 126 XP-042858750.1 FAS- F FAS- R TCCACGTCTGCTGGAAGAAC CTCTCGGGCAGTTGACAGTT 109 QDK64693.1 DGAT2- F DGAT2- R CAGAACACCTTGCAACAGGC TTCTTCACCTGCGGTACGTC 146 XP-045599376.1 Note: HBDH is 3-hydroxybutyrate dehydrogenase , CTSL is Cathepsin L , FAS is Fatty acid synthase , DGAT2 is Diacylglycerol acyltransferase 2 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4229192","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":290290833,"identity":"2521a105-4836-4bc4-8e09-4d87e6444661","order_by":0,"name":"Zhao Li","email":"","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Zhao","middleName":"","lastName":"Li","suffix":""},{"id":290290834,"identity":"8763bb20-15b6-470c-a4ab-d19cac9b980b","order_by":1,"name":"Huadong Li","email":"","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Huadong","middleName":"","lastName":"Li","suffix":""},{"id":290290835,"identity":"33c9e9eb-531c-4d2f-8e23-eb372190421b","order_by":2,"name":"Han Zhao","email":"","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Han","middleName":"","lastName":"Zhao","suffix":""},{"id":290290836,"identity":"a3f735d9-85be-4db3-98c3-7eb8c28f44c8","order_by":3,"name":"Zhongmeng Zhao","email":"","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Zhongmeng","middleName":"","lastName":"Zhao","suffix":""},{"id":290290837,"identity":"4b233568-e0de-4bbb-8eab-7a0e385c1584","order_by":4,"name":"Lu Zhang","email":"","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Zhang","suffix":""},{"id":290290838,"identity":"74170a44-4dfd-4522-b589-3506031230c9","order_by":5,"name":"Chengyan Mou","email":"","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Chengyan","middleName":"","lastName":"Mou","suffix":""},{"id":290290839,"identity":"9142d5f4-8c8e-4e12-9e48-b1536991fc03","order_by":6,"name":"Yuanliang Duan","email":"","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Yuanliang","middleName":"","lastName":"Duan","suffix":""},{"id":290290840,"identity":"37d7481f-1b83-4f9f-9255-1cf8d5e4af8c","order_by":7,"name":"Jian Zhou","email":"","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Zhou","suffix":""},{"id":290290841,"identity":"94ff13e3-3e7c-407c-aa74-9a349ffd902b","order_by":8,"name":"Zhipeng Huang","email":"","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Zhipeng","middleName":"","lastName":"Huang","suffix":""},{"id":290290842,"identity":"fa0173ef-3c01-4376-b8b2-5e38e3349537","order_by":9,"name":"Qiang Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvElEQVRIiWNgGAWjYBACPmYG9h8fKiTk2NibDxCnhY2ZgUFyxhkbYz6eYwlEagFiad62tMR5EjkKRGphZ95gzMN2OL2NIYeB4UfFNmIcxlaQOIfncG4bw9kDjD1nbhOjhcfgwBsJoBbGvgRmxjbitBg28BgcTgfpJVqLMSNPQloCGxvxWtjKGGccsDFs42FLOEiUX/j5D29j+PhPQl5+/uODD35UEKEFCAzgrANEqUfRMgpGwSgYBaMAKwAAERgz6ehN+uIAAAAASUVORK5CYII=","orcid":"","institution":"Sichuan Academy of Agricultural Sciences Fisheries Research Institute","correspondingAuthor":true,"prefix":"","firstName":"Qiang","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-04-07 02:29:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4229192/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4229192/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54783289,"identity":"d2585adc-1f2d-49b4-b783-14c4a4f655c4","added_by":"auto","created_at":"2024-04-16 17:21:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":86361,"visible":true,"origin":"","legend":"\u003cp\u003eSample relationship heat map (a). The abscissa and ordinate in the figure represent each sample respectively, and the color depth indicates the correlation coefficient of the two samples. The closer to red, the greater the correlation, and the closer to yellow, the smaller the correlation. DEGs histogram (b).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4229192/v1/ac3ec94fd70bc2868b43aca1.png"},{"id":54783293,"identity":"5659aa9a-dc98-4bd7-a3c9-ce5873b6ec58","added_by":"auto","created_at":"2024-04-16 17:21:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":205854,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential gene statistics chart. Abscissa: paired comparison samples; ordinate: number of differentially expressed genes; red represents up-regulated DEGs; blue represents down-regulated DEGs.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4229192/v1/f9c17b854d097966d6c62646.png"},{"id":54783290,"identity":"d516625b-5e37-43a4-a636-22951328aeaa","added_by":"auto","created_at":"2024-04-16 17:21:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":482051,"visible":true,"origin":"","legend":"\u003cp\u003eGO enrichment classification histogram. The abscissa is the second-level GO term, and the ordinate is the number of DEGs in the term. Red indicates up-regulation, and blue indicates down-regulation.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4229192/v1/50586334c477ed336406e597.png"},{"id":54783292,"identity":"4f32843a-8f22-461d-811d-753a026afd64","added_by":"auto","created_at":"2024-04-16 17:21:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":476367,"visible":true,"origin":"","legend":"\u003cp\u003eKEGG enrichment bubble plot. Use the top 20 pathways with the smallest Q value to draw the graph. The ordinate is the pathway and the abscissa is the enrichment factor.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4229192/v1/e3134dc3e386d8b1d21de3eb.png"},{"id":54783823,"identity":"d751127f-3182-44ea-a6dc-1317552bf713","added_by":"auto","created_at":"2024-04-16 17:29:44","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":241189,"visible":true,"origin":"","legend":"\u003cp\u003eHeat map of DEGs in lipid metabolism pathways and lysosomal pathways.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4229192/v1/38cf2790bf09b0326f5eee2e.png"},{"id":54783944,"identity":"1723e362-cf07-469b-b124-fe7542f69a14","added_by":"auto","created_at":"2024-04-16 17:37:44","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":32802,"visible":true,"origin":"","legend":"\u003cp\u003eFour genes in the lipid metabolism and lysosomal pathways were subjected to qPCR, and the ratio of the relative expression of each gene in the two groups was analyzed using Log\u003csub\u003e2 \u003c/sub\u003e(Fc). \u003cem\u003eCTSL\u003c/em\u003e is cathepsin L, \u003cem\u003eDGAT2\u003c/em\u003e is Diacylglycerol acyltransferase 2, \u003cem\u003eFAS\u003c/em\u003e is Fatty acid synthase, \u003cem\u003eHBDH\u003c/em\u003e is 3-hydroxybutyrate dehydrogenase.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4229192/v1/9ce804c3a68c3341d579f26d.png"},{"id":54848494,"identity":"a79457ea-fb3e-4e3d-9983-db3740417eac","added_by":"auto","created_at":"2024-04-17 15:38:02","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1058406,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4229192/v1/b79db346-eddb-460a-9984-5a035f5a89b5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Transcriptomic study of acute nitrite stress on ovary development stages of river shrimp (Macrobrachium nipponense)","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cem\u003eM. nipponense\u003c/em\u003e is widely distributed in rivers, lakes, and ditches throughout various regions of China (Qiao et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). As a native shrimp, it is widely cultured in China with an aquaculture production of 226,312 tons in 2022 (Bureau of Fishery et al., 2023). With the development of China's economy, people's consumption of \u003cem\u003eM. nipponense\u003c/em\u003e has increased, which has prompted the scale of \u003cem\u003eM. nipponense\u003c/em\u003e culture to increase year by year (Cui et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), and the corresponding demand for juvenile shrimp will also increase. However, artificial breeding of \u003cem\u003eM. nipponense\u003c/em\u003e is still in its initial stages. Due to the short development cycle of female shrimp ovaries, the development process is easily affected by environmental factors (Qiao et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Fu et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). External environmental factors have an important impact on crustacean ovarian development. For example, lower salinity (5) and temperature (20\u0026deg;C) can hinder the maturation of the ovaries of \u003cem\u003ePalaemon macrodactylus\u003c/em\u003e (V\u0026aacute;zquez et al., \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The temperature, salinity, and acidity/alkalinity of the water body will affect the gene expression of heat stress protein 70 in the pacific white shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e), thereby affecting the development of ovaries (Chen et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). At present, most research on the impact of environmental factors on crustacean ovary development focuses on temperature, salinity, pH, etc. However, nitrite, a common pollutant in the breeding process, needs to be studied.\u003c/p\u003e \u003cp\u003eNitrite is produced due to the imbalance of the proportion of nitrifying bacteria in the water body during the absorption and utilization of ammonia nitrogen (Wang et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Mevel and Chamroux, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e1981\u003c/span\u003e). The toxicity of nitrite to aquatic animals is multifaceted (Kocour Kroupov\u0026aacute; et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). For fish, nitrite will oxidize the divalent iron ions in hemoglobin to ferric ions, reducing the oxygen transport capacity and causing immune damage and oxidative damage (Hanson and Grizzle, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1985\u003c/span\u003e; Carballo and Munoz, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e1991\u003c/span\u003e). Crustaceans are more sensitive to changes in nitrite levels than fish (Kocour Kroupov\u0026aacute; et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Excessive nitrite levels in the environment can cause oxidative damage, immune damage, and other adverse effects on the hepatopancreas of \u003cem\u003eM. nipponense\u003c/em\u003e (Wang et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Yu et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Studies have shown that excessive concentrations of exogenous nitrite can affect the gonadal development process of animals. Excessive nitrite intake can inhibit follicle development in mice (\u003cem\u003eMus musculus\u003c/em\u003e), leading to infertility in mice (\u003cem\u003eM. musculus\u003c/em\u003e) (Wu et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Excessively high nitrite levels in the water environment can cause the gonadal index of zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e) and green sea urchin (\u003cem\u003eStrongylocentrotus droebachiensis\u003c/em\u003e) to decrease, inhibit D. rerio testosterone secretion and cell proliferation, thereby inhibiting testis development (Lin et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Siikavuopio et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). The effects of nitrite on the development of crustacean ovaries need to be studied.\u003c/p\u003e \u003cp\u003eBased on the above background, we selected the appropriate nitrite concentration in the water body (\u0026lt;\u0026thinsp;0.2 mg/L) as the control group (Ctrl), and the experimentally predicted LC50\u003csub\u003e48h\u003c/sub\u003e (10.2 mg/L) of \u003cem\u003eM. nipponense\u003c/em\u003e as the treatment group (PG). Through 48 hours of acute nitrite stress, the effect on ovary development of \u003cem\u003eM. nipponense\u003c/em\u003e was explored to provide theoretical support to solve the adverse effects of nitrite stress on ovary development of \u003cem\u003eM. nipponense\u003c/em\u003e.\u0026middot;\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e2.1 Experimental animals\u003c/h2\u003e\n \u003cp\u003eFemale individuals of \u003cem\u003eM. nipponense\u003c/em\u003e (3.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12 g) were obtained from an aquaculture base in Qianwei County, Sichuan Province, China. Female shrimps of the same size with complete appendages were selected. All shrimps were placed in a tank (2\u0026times;0.5\u0026times;0.8m) containing 400L of water for one week before the experiment. They were fed four times a day (at 7:00, 11:00, 17:00, and 23:00) to acclimate to the environment.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e2.2 LC50\u003csub\u003e48h\u003c/sub\u003e\u003c/h2\u003e\n \u003cp\u003eWater was used as a solvent to prepare a mother liquor with a nitrite concentration of 3g/L. The preliminary experiment was divided into four groups with nitrite concentrations of 6, 9, 12, and 15 mg/L, respectively. Each group had three replicates, and each replicate contained 30 shrimps. The above concentrations were diluted with the mother liquor and prepared. Each water tank was filled with 200L of water. The mortality rate was recorded at 48 hours, and Probit regression analysis was performed on the concentration and mortality rate using SPSS. The LC50\u003csub\u003e48h\u003c/sub\u003e was predicted to be 10.2 mg/L. During the experiment, the nitrite concentration in the water was detected using the kit provided by Shanghai Beibo Biotechnology Co., Ltd (Shanghai, China), and the detection method recommended by the manufacturer was followed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003e2.3 Nitrite stress and sample collection\u003c/h2\u003e\n \u003cp\u003eSelected 180 shrimps and placed them into the control group (Ctrl) with a nitrite concentration of 0 mg/L, and the treatment group (PG) with a nitrite concentration of 10.2 mg/L. Each group had three replicates with 30 shrimps each. After 48 hours, all surviving shrimps were sampled, and the ovaries in stage III of development were selected. They were then placed in RNALater preservation solution (Nanjing Jiancheng Bioengineering Institute Co., Ltd, Nanjing, China) and stored at -20\u0026deg;C.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e2.4 RNA extraction and library preparation\u003c/h2\u003e\n \u003cp\u003eFour ovaries were randomly selected from each group, and total RNA was extracted using TRIzol reagent (HongYe Biotech Co., Ltd, Shanghai, China) according to the method described by Wen et al. (\u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). After enriching eukaryotic mRNA with polyA tail using magnetic beads with Oligo(dT), the mRNA was fragmented with buffer. The first strand of cDNA was synthesized in the M-MuLV reverse transcriptase system, using the fragmented mRNA as a template and random oligonucleotides as primers. RNaseH was then used to degrade the RNA chain, and dNTPs were used as the primer in the DNA polymerase I system to synthesize the second strand of cDNA. The purified double-stranded cDNA was end-repaired, A-tailed, and connected to sequencing adapters. AMPure XP beads were used to screen about 200 bp of cDNA, PCR amplification was performed, and AMPure XP beads were used again to purify the PCR product to finally obtain a library. The quality of the library was analyzed using agarose gel electrophoresis. To ensure data quality, the original data were filtered before information analysis to reduce analysis interference caused by invalid data. First, fastp was used to perform quality control on the raw reads that were downloaded, filter low-quality data, and obtain clean reads (Chen et al., \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). After data filtering, we analyzed the composition and mass distribution of bases to visually demonstrate the data quality. The more balanced the base composition, the higher the quality. After passing the quality inspection, the \u003cem\u003eM. nipponense\u003c/em\u003e genome GigaDB 100843 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://gigadb.org/dataset/view/id/100843\u003c/span\u003e\u003c/span\u003e) was used as the reference genome, and HISAT2 software was used to carry out comparative analysis based on the reference genome (Kim et al., \u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003e2.5 Differential gene analysis\u003c/h2\u003e\n \u003cp\u003eThe read count data obtained from the gene expression level analysis were analyzed using DESeq2 software (Love et al., \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). Hierarchical clustering of differential gene expression patterns was performed, and a heat map was used to present the clustering results. These genes with similar expression patterns may have common functions or participate in common metabolic pathways and signaling pathways. The DEGs were compared with the Gene Ontology (GO) database and the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, respectively. Then, the hypergeometric test was applied to identify significantly enriched GO entries and KEGG pathways among the DEGs compared to the background (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Transcriptome data has been uploaded to NCBI SRA database (PRJNA1098363).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e2.6 Transcriptome validation\u003c/h2\u003e\n \u003cp\u003eEight samples per group were used to extract RNA. Total RNA was extracted using TRIzol reagent (HongYe Biotech Co., Ltd, Shanghai, China) following the method described by Wen et al. (\u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). The total RNA concentration was adjusted to 500 ng/\u0026micro;L using a microvolume spectrophotometer (WI 53711, Thermo Fisher Scientific, USA). Reverse transcription was performed using a reverse transcription kit. Primers for \u0026beta;-Actin, which was used as an internal reference gene, were designed using Primer 5 software (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Three pairs of primers were designed for each gene, and SYBR Green qPCR Master Mix (Cat. No.: GK10002) was used for the qPCR amplification reaction. Primers with an amplification efficiency of 90%-110% were selected based on a standard curve made using LightCycler\u0026reg; 96 SW 1.1 software. The specificity of the primer was assessed by analyzing the melting curve, which should be a unimodal curve. The 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;CT\u003c/sup\u003e method (Livak and Schmittgen., 2001) was used for relative quantification of target genes, following the method described by Zhang et al. (\u003cspan class=\"CitationRef\"\u003e2015\u003c/span\u003e). Log\u003csub\u003e2\u003c/sub\u003e (Fc) analysis was performed on the relative expression ratio of each gene in the two groups.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Result","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1 Transcriptomic data overview\u003c/h2\u003e\n \u003cp\u003eA total of 30.0 Gb of clean data was obtained from 8 samples, with Q30\u0026thinsp;\u0026gt;\u0026thinsp;92.68%. The main statistical data of the 8 samples are shown in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. After correlation evaluation, it was found that the 4 samples in each group had strong correlations, so the samples were not removed (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2 Functional annotation and analysis of DEGs\u003c/h2\u003e\n \u003cp\u003eA total of 11,592 DEGs were screened out from 8 sequencing samples. A total of 11,592 genes with significant expression differences were screened out by PG relative to Ctrl, including 3,243 up-regulated genes and 8,349 down-regulated genes (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb). Hierarchical clustering was performed on these differential gene expression patterns, and the clustering results were presented using heat maps. These genes with similar expression patterns may have common functions or participate in common metabolic pathways and signaling pathways (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3 DEGs trends analysis\u003c/h2\u003e\n \u003cp\u003eGene Ontology (GO for short) is an internationally standardized gene function classification system that provides a set of dynamically updated standard vocabulary (controlled vocabulary) for comprehensively describing the attributes of genes and gene products in organisms. GO analysis showed that differentially expressed genes (DEGs) clustered together in molecular functions, biological processes, and cellular components. DEGs are highly representative of biological processes. The main categories of biological processes include cellular components (5399 single genes), metabolic processes (4614 single genes), and biological regulation (2920 single genes). The main category of molecular function is catalytic activity (3781 single genes). The main categories of cellular components are cellular anatomical entity (4511 single genes) and protein-containing complex (1877 single genes). Enrichment and classification of DEGs were performed, and hypergeometric testing was used to identify significantly enriched GO terms among the DEGs compared to the background of the entire genome. The results showed that DEGs were significantly enriched in Protein binding, Organonitrogen compound metabolic process, Biological regulation, and Cellular component organization or biogenesis (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). KEGG enrichment analysis results show that compared with Ctrl, the DEGs of PG are mainly enriched in pathways such as lipid metabolism, carbohydrate metabolism, and amino acid metabolism (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In the lipid metabolism pathway, the expression levels of Diacylglycerol acyltransferase 2 (\u003cem\u003eDGAT2\u003c/em\u003e), Alcohol dehydrogenase class 3 (\u003cem\u003eADH3\u003c/em\u003e), Glycerol-3-phosphate dehydrogenase (\u003cem\u003eG3P\u003c/em\u003e), Fatty acid synthase (\u003cem\u003eFAS\u003c/em\u003e), and Glycerol-3-phosphate acyltransferase 3 (\u003cem\u003eGPAT3\u003c/em\u003e) were increased. The expression levels of Glutathione-S-transferase 3 (\u003cem\u003eGS3\u003c/em\u003e), cathepsin L (\u003cem\u003eCTSL\u003c/em\u003e), and 3-hydroxybutyrate dehydrogenase (\u003cem\u003e3-HBDH\u003c/em\u003e) in the lysosomal pathway are increased. The expression of key genes for vitellogenic formation, vitellogenin receptor (VgR), vitellogenin 2 (Vg2), and juvenile hormone acid methyltransferase (JHAMT), is down-regulated (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4 qPCR validation\u003c/h2\u003e\n \u003cp\u003eFour genes with different expression patterns were randomly selected from the functional enrichment and pathways for qPCR, and Log\u003csub\u003e2\u003c/sub\u003e (Fc) analysis was performed on the relative expression ratio of each gene in the two groups. The results showed that the expression levels of cathepsin L (\u003cem\u003eCTSL\u003c/em\u003e), Diacylglycerol acyltransferase 2 (\u003cem\u003eDGAT2\u003c/em\u003e), Fatty acid synthase (\u003cem\u003eFAS\u003c/em\u003e) and 3-hydroxybutyrate dehydrogenase (\u003cem\u003eHBDH\u003c/em\u003e) were up-regulated, and were consistent with the expression pattern in transcriptomics (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003e \u003cb\u003e\u003c/b\u003e Nitrite is one of the most common water pollutants in the aquaculture process. It is difficult to remove from the water and easily accumulates. When the concentration is too high, it can cause strong toxicity to aquatic animals. Therefore, it requires special attention in intensive breeding processes (Gross et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Svobodova et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; J\u0026oslash;rgensen et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Kouba et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). There are variations in size and sensitivity to nitrite among different crustacean species (Kocour Kroupov\u0026aacute; et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). While many studies have been conducted on the toxic effects of nitrite on crustaceans, most of them focus on its impact on the immune, antioxidant, and digestive systems (Yu et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Huang et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Xie et al., \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), with limited research on its effects on gonadal development. In this study, \u003cem\u003eM. nipponense\u003c/em\u003e was exposed to nitrite levels equivalent to LC50\u003csub\u003e48h\u003c/sub\u003e. Transcriptome sequencing was performed on ovaries that developed to stage III, and GO annotations of DEG and KEGG pathways were used to explore acute nitrite stress and its impact on the ovary development stages of \u003cem\u003eM. nipponense\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eGO and KEGG pathway analysis showed that nitrite stress may affect ovarian development by mediating carbohydrate metabolism, lipid metabolism, and lysosome pathways. Ovarian development requires more energy supply (Bo et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Carbohydrates are the main source of energy for crustaceans (Rosas et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2000\u003c/span\u003e), and their metabolic processes are enhanced (Castille and Lawrence, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). When crustaceans are exposed to environmental stress, they inevitably increase their energy supply to maintain internal homeostasis (Cuzon et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Cuzon et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Studies have demonstrated that nitrite in the environment can enter the body through the respiration of \u003cem\u003ePenaeus monodon\u003c/em\u003e and accumulate in the blood (Xian et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). In this study, carbohydrate metabolism processes were found to be enhanced in shrimp ovaries subjected to nitrite stress, which may be due to the need for more energy to resist endogenous nitrite stress on the ovaries. Ovarian development is accompanied by lipid accumulation (Lee and Walker, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Wouters et al., \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Phospholipids, sterols, and glycerol are the main lipids found in shrimp. These lipids serve as raw materials for the synthesis of hormones and steroids (Zandee, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e1967\u003c/span\u003e; Kean et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e1985\u003c/span\u003e), and they play an important role in ovarian development (Ravid et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Therefore, lipid metabolism is a pathway that warrants attention when studying the process of ovarian development. Diacylglycerol acyltransferase 2 (\u003cem\u003eDGAT2\u003c/em\u003e) is a member of the diacylglycerol acyltransferase family. In mammals, it is generally considered to be the enzyme that catalyzes the final step in the synthesis of triglycerides from diacylglycerol (Yen et al., \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The conversion of diacylglycerol and triglyceride in crustaceans has not been reported, but in a study on Chinese mitten crab (\u003cem\u003eEriocheir sinensis\u003c/em\u003e), it was found that Diacylglycerol acyltransferase 2 (\u003cem\u003eDGAT2\u003c/em\u003e) may also have similar functions to those observed in mammals (Feng et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Glycerol-3-phosphate dehydrogenase (\u003cem\u003eG3P\u003c/em\u003e), Glycerol-3-phosphate acyltransferase 3 (\u003cem\u003eGPAT3\u003c/em\u003e) and Fatty acid synthase (\u003cem\u003eFAS\u003c/em\u003e) are enzymes that synthesize triglycerides (Luo et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, An et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Triglyceride is the main lipid energy supply substance during ovarian development (Yao et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), and its synthesis pathway is up-regulated after nitrite exposure, which may also be due to the need for more energy supply. The lysosomal pathway has the function of decomposing various endogenous or exogenous macromolecules during ovarian development and is an important way to regulate ovarian development (Wang et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Cathepsin L (\u003cem\u003eCTSL\u003c/em\u003e) and Lysosomal aspartic protease are both cathepsins in the lysosomal pathway and play a role in the hydrolysis of vitellogenin and acidification of vitellogenic balls (Carnevali et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, LaFleur Jr et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). The expression levels show different expression patterns at different stages of ovarian development, and the expression level reaches the highest level in the stage III of ovarian development of \u003cem\u003eM. nipponense\u003c/em\u003e (Zhang et al., \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). \"For crustaceans, \u003cem\u003eJHAMT\u003c/em\u003e is a key gene involved in the biosynthesis of methyl farnesoate (MF), which promotes the synthesis and transport of vitellogenin during ovarian development (Homola and Chang., 1997; Bell\u0026eacute;s et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Stay and Tobe., 2007; Fast and Lester., 2013; Miyakawa et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Xie et al., \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In this study, although nitrite stress promoted the expression of genes related to carbohydrate metabolism, lipid metabolism, lysosomal pathway, and other pathways, the expression of genes such as \u003cem\u003eJHAMT\u003c/em\u003e, vitellogenin receptor (\u003cem\u003eVgR\u003c/em\u003e), and vitellogenin 2 (\u003cem\u003eVg2\u003c/em\u003e), which are associated with vitellogenin synthesis and transport, was downregulated. This indicates that exogenous nitrite stress enhances energy metabolism in the ovary but inhibits substance synthesis and transport, which is an interesting phenomenon. In fact, nitrite in the environment enters the blood circulation of crustaceans through respiration (Xian et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Nitrite in the body can generate nitric oxide through ion metabolism (Panesar and Chan., 2000). A study on catfish (\u003cem\u003eHeteropneustes fossilis\u003c/em\u003e) found that serum nitrite levels increased during ovarian development and played an active role in previtellogenesis, but during vitellogenesis, serum nitrite levels dropped dramatically. In other words, serum nitrite levels in \u003cem\u003eH. fossilis\u003c/em\u003e change cyclically during ovarian development (Tripathi and Krishna., 2008). Similar regulation exists during mammalian ovarian development (Panesar and Chan., 2000). Currently, there are no studies on the regulation of ovarian development by exogenous nitrite in crustaceans. However, it is possible that \u003cem\u003eM. nipponense\u003c/em\u003e also has a pathway similar to that of fish, in which nitrite regulates ovarian development, this hypothesis deserves further exploration. To verify the reliability of transcriptomic sequencing in this study, we randomly selected four genes from the lipid metabolism pathway and lysosomal pathway for qPCR verification. The results showed that the expression patterns of the four genes were consistent with the omics results, confirming the reliability of the sequencing data.\"\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eAfter 48 hours of nitrite exposure in \u003cem\u003eM. nipponense\u003c/em\u003e LC50\u003csub\u003e48h\u003c/sub\u003e, DEGs involved in the carbohydrate metabolism pathway, lipid metabolism pathway, lysosomal pathway and vitellogenesis were significantly enriched in the ovary. In order to resist nitrite stress and enhance energy supply, the expression levels of carbohydrate metabolism pathways and triglyceride anabolism pathways were increased. The expression of lysosomal pathway genes related to ovarian development increased, while the expression of genes related to vitellogenesis was down-regulated. This indicates that nitrite stress inhibits the ovary development of \u003cem\u003eM. nipponense\u003c/em\u003e and it may have a mechanism similar to fish in regulating ovarian development with nitrite.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAnimal Experimentation Welfare and Ethics Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments involving the handling and treatment of \u003cem\u003eM. nipponense\u003c/em\u003e were conducted in strict accordance with the recommendations in the Guide for the Animal Care and Use Committee of the Fishery Institute of the Sichuan Academy of Agricultural Sciences (20220323001A). All animal collection and use protocols were conducted in accordance with the guidelines and regulations for the care and use of laboratory animals at the Fishery Institute of the Sichuan Academy of Agricultural Sciences.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated and analyzed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclarations of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Sichuan Science and Technology Planning Project (2021YFYZ0015); Investigation on Fishery Resources and Environment in Key Waters of Northwest China and Agriculture Research System of China (CARS-46); \u0026ldquo;1 + 9\u0026rdquo; open competition mechanism to select the best candidates and scientific and technological project of Sichuan Academy of Agricultural Sciences (1+ 9KJGG004); Sichuan Freshwater Fish Innovation Team of the National Modern Agricultural Industrial Technology System; Fish Reso urces and Environment in the Upper Reaches of the Yangtze River Observation and Research Station of Sichuan Province. \u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAn W, He H, Dong X, Tan B, Yang Q, Chi S, Zhang S, Liu H, Yang Y (2020) Regulation of growth, fatty acid profiles, hematological characteristics and hepatopancreatic histology by different dietary n-3 highly unsaturated fatty acids levels in the first stages of juvenile Pacific white shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e). Aquac Rep 17:100321\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBell\u0026eacute;s X, Mart\u0026iacute;n D, Piulachs M-D (2005) The mevalonate pathway and the synthesis of juvenile hormone in insects. Annu Rev Entomol 50:181\u0026ndash;199\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBo Q-K, Lu Y-Z, Ma C, Mi H-J, Jia L, Meng Y-G, Yu Y-G, Geng X-Y (2021) Reproductive biology and biochemical changes in female mantis shrimp \u003cem\u003eOratosquilla oratoria\u003c/em\u003e (Stomatopoda) with ovary development from the Tianjin coastal zone of Bohai Bay. Aquaculture 534:736239\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarballo M, Munoz MJ (1991) Effect of sublethal concentrations of four chemicals on susceptibility of juvenile rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) to saprolegniosis. Appl Environ Microbiol 57:1813\u0026ndash;1816\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarnevali O, Cionna C, Tosti L, Lubzens E, Maradonna F (2006) Role of cathepsins in ovarian follicle growth and maturation. Gen Comp Endocrinol 146:195\u0026ndash;203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.ygcen.2005.12.007\u003c/span\u003e\u003cspan address=\"10.1016/j.ygcen.2005.12.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCastille FL, Lawrence AL (1989) Relationship between maturation and biochemical composition of the gonads and digestive glands of the shrimps Penaeus aztecus Ives and \u003cem\u003ePenaeus setiferus (L)\u003c/em\u003e. J Crustac Biol 9:202\u0026ndash;211\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChina Fishery Statistical Yearbook (2023) China Fishery Statistical Yearbook. Agriculture, Beijing, China\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen S, Zhou Y, Chen Y, Gu J (2018) Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34:i884\u0026ndash;i890. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/bty560\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/bty560\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen T, Lin T, Li H, Lu T, Li J, Huang W, Sun H, Jiang X, Zhang J, Yan A, Hu C, Luo P, Ren C (2018) Heat Shock Protein 40 (HSP40) in Pacific White Shrimp (\u003cem\u003eLitopenaeus vannamei\u003c/em\u003e): Molecular Cloning, Tissue Distribution and Ontogeny, Response to Temperature, Acidity/Alkalinity and Salinity Stresses, and Potential Role in Ovarian Development. Front Physiol 9:1\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphys.2018.01784\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2018.01784\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui F, Yu Y, Bao F, Wang S, Xiao MS (2018) Genetic diversity analysis of the oriental river prawn (\u003cem\u003eMacrobrachium nipponense\u003c/em\u003e) in Huaihe River. Mitochondrial DNA Part A DNA Mapping. Seq Anal 29:737\u0026ndash;744. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/24701394.2017.1350953\u003c/span\u003e\u003cspan address=\"10.1080/24701394.2017.1350953\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCuzon G, Guillaume J, Cahu C (1994) Composition, preparation and utilization of feeds for Crustacea. Aquaculture 124:253\u0026ndash;267\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCuzon G, Lawrence A, Gaxiola G, Rosas C, Guillaume J (2004) Nutrition of \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e reared in tanks or in ponds. Aquaculture 235:513\u0026ndash;551\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFast AW, Lester LJ (2013) Marine shrimp culture: principles and practices. Elsevier\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng Q, Liu M, Cheng Y, Wu X (2022) Comparative transcriptome analysis reveals the process of ovarian development and nutrition metabolism in Chinese mitten crab, \u003cem\u003eEriocheir sinensis\u003c/em\u003e. Front Genet 13:910682\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu C, Li F, Wang L, Li T (2019) Molecular insights into ovary degeneration induced by environmental factors in female oriental river prawns \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e *. Environ Pollut 253:882\u0026ndash;888. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.envpol.2019.07.085\u003c/span\u003e\u003cspan address=\"10.1016/j.envpol.2019.07.085\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGross A, Shai A, Dina Z (2004) Acute and Chronic Effects of Nitrite on White Shrimp. J World Aquac Soc 35:7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanson LA, Grizzle JM (1985) Nitrite-induced predisposition of channel catfish to bacterial diseases. Progress Fish‐Culturist 47:98\u0026ndash;101\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHomola E, Chang ES (1997) Methyl Farnesoate: Crustacean Juvenile Hormone in Search of Functions. 117:347\u0026ndash;356\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang M, Xie J, Yu Q, Xu C, Zhou L, Qin JG, Chen L, Li E (2020) Toxic effect of chronic nitrite exposure on growth and health in Pacific white shrimp \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e. Aquaculture 529:735664. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2020.735664\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2020.735664\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJ\u0026oslash;rgensen TR, Larsen TB, Buchmann K (2009) Parasite infections in recirculated rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e) farms. Aquaculture 289:91\u0026ndash;94\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKean JC, Castell JD, Boghen AG, d\u0026rsquo;Abramo LR, Conklin DE (1985) A re-evaluation of the lecitihin and cholesterol requirements of juvenile lobster (\u003cem\u003eHomarus americanus\u003c/em\u003e) using crab protein-based diets. Aquaculture 47:143\u0026ndash;149\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim D, Langmead B, Salzberg SL (2015) HISAT: A fast spliced aligner with low memory requirements. Nat Methods 12:357\u0026ndash;360. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.3317\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.3317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKocour Kroupov\u0026aacute; H, Valentov\u0026aacute; O, Svobodov\u0026aacute; Z, Šauer P, M\u0026aacute;chov\u0026aacute; J (2018) Toxic effects of nitrite on freshwater organisms: a review. Rev Aquac 10:525\u0026ndash;542. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/raq.12184\u003c/span\u003e\u003cspan address=\"10.1111/raq.12184\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKouba A, Niksirat H, Kuklina I, Buřič M, Koz\u0026aacute;k P (2012) Ultraviolet light and semi-recirculating systems in artificial incubation of noble crayfish (\u003cem\u003eAstacus astacus\u003c/em\u003e) eggs: opportunities and limitations. Aquac Res 44:67\u0026ndash;74\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaFleur Jr GJ, Rald\u0026uacute;a D, Fabra M, Carnevali O, Denslow N, Wallace RA, Cerda J (2005) Derivation of major yolk proteins from parental vitellogenins and alternative processing during oocyte maturation in Fundulus heteroclitus. Biol Reprod 73:815\u0026ndash;824\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee RF, Walker A (1995) Lipovitellin and lipid droplet accumulation in oocytes during ovarian maturation in the blue crab, \u003cem\u003eCallinectes sapidus\u003c/em\u003e. J Exp Zool 271:401\u0026ndash;412\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin W, Guo H, Li Y, Wang L, Zhang D, Hou J, Wu X, Li L, Li D, Zhang X (2018) Single and combined exposure of microcystin-LR and nitrite results in reproductive endocrine disruption via hypothalamic-pituitary-gonadal-liver axis. Chemosphere 211:1137\u0026ndash;1146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.chemosphere.2018.08.049\u003c/span\u003e\u003cspan address=\"10.1016/j.chemosphere.2018.08.049\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-∆∆CT method. Methods 25:402\u0026ndash;408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLove MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15:1\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13059-014-0550-8\u003c/span\u003e\u003cspan address=\"10.1186/s13059-014-0550-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo N, Ding Z, Kong Y, Zhang R, Zhang Y, Wu C, Jiang Z, Ye J (2018) An evaluation of increasing linolenic acid level in the diet of \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e: Lipid deposition, fatty acid composition and expression of lipid metabolism-related genes. Aquac Nutr 24:758\u0026ndash;767\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMevel G, Chamroux S (1981) A study on nitrification in the presence of prawns (\u003cem\u003ePenaeus japonicus\u003c/em\u003e) in marine closed systems. Aquaculture 23:29\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0044-8486(81)90005-3\u003c/span\u003e\u003cspan address=\"10.1016/0044-8486(81)90005-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiyakawa H, Toyota K, Sumiya E, Iguchi T (2014) Comparison of JH signaling in insects and crustaceans. Curr Opin Insect Sci 1:81\u0026ndash;87\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePanesar NS, Chan KW (2000) Decreased steroid hormone synthesis from inorganic nitrite and nitrate: studies in vitro and in vivo. Toxicol Appl Pharmacol 169:222\u0026ndash;230\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao H, Fu H, Xiong Y, Jiang S, Zhang W, Sun S, Jin S, Gong Y, Wang Y, Shan D, Li F, Wu Y (2017) Molecular insights into reproduction regulation of female Oriental River prawns \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e through comparative transcriptomic analysis. Sci Rep 7:1\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-017-10439-2\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-10439-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQiao H, Lv D, Jiang SF, Sun SM, Gong YS, Xiong YW, Jin SB, Fu HT (2013) Genetic diversity analysis of oriental river prawn, \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e, in Yellow River using microsatellite marker. Genet Mol Res 12:5694\u0026ndash;5703. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4238/2013.November.18.18\u003c/span\u003e\u003cspan address=\"10.4238/2013.November.18.18\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRavid T, Tietz A, Khayat M, Boehm E, Michelis R, Lubzens E (1999) Lipid accumulation in the ovaries of a marine shrimp \u003cem\u003ePenaeus semisulcatus (De Haan)\u003c/em\u003e. J Exp Biol 202:1819\u0026ndash;1829. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jeb.202.13.1819\u003c/span\u003e\u003cspan address=\"10.1242/jeb.202.13.1819\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosas C, Cuzon G, Gaxiola G, Arena L, Lemaire P, Soyez C, Van Wormhoudt A (2000) Influence of dietary carbohydrate on the metabolism of juvenile \u003cem\u003eLitopenaeus stylirostris\u003c/em\u003e. J Exp Mar Bio Ecol 249:181\u0026ndash;198\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSiikavuopio SI, Dale T, Christiansen JS, Nevermo I (2004) Effects of chronic nitrite exposure on gonad growth in green sea urchin \u003cem\u003eStrongylocentrotus droebachiensis\u003c/em\u003e. Aquaculture 242:357\u0026ndash;363. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2004.09.007\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2004.09.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStay B, Tobe SS (2007) The role of allatostatins in juvenile hormone synthesis in insects and crustaceans. Annu Rev Entomol 52:277\u0026ndash;299\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSvobodova Z, Machova J, Poleszczuk G, Hůda J, Ham\u0026aacute;čkov\u0026aacute; J, Kroupova H (2005) Nitrite poisoning of fish in aquaculture facilities with water-recirculating systems. Acta Vet Brno 74:129\u0026ndash;137\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTripathi V, Krishna A (2008) Changes in nitric oxide (NO) synthase isoforms and NO in the ovary of \u003cem\u003eHeteropneustes fossilis\u003c/em\u003e (Bloch.) during the reproductive cycle. J Endocrinol 199:307\u0026ndash;316\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eV\u0026aacute;zquez MG, Ituarte RB, Bas CC, Spivak ED (2013) Effects of temperature and salinity on the ovarian cycle and the embryonic development of the invasive shrimp \u003cem\u003ePalaemon macrodactylus\u003c/em\u003e. J Crustac Biol 33:218\u0026ndash;223. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1163/1937240X-00002128\u003c/span\u003e\u003cspan address=\"10.1163/1937240X-00002128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang M, Hu Y, Li M, Xu Q, Zhang X, Wang X, Xue X, Xiao Q, Liu J, Wang H (2020) A proteomics analysis of the ovarian development in females of \u003cem\u003eHaemaphysalis longicornis\u003c/em\u003e. Exp Appl Acarol 80:289\u0026ndash;309\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang WN, Wang AL, Zhang YJ, Li ZH, Wang JX, Sun RY (2004) Effects of nitrite on lethal and immune response of \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e. Aquaculture 232:679\u0026ndash;686. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2003.08.018\u003c/span\u003e\u003cspan address=\"10.1016/j.aquaculture.2003.08.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWen J, Yang H, Liu MZ, Luo KJ, Liu H, Hu Y, Zhang X, Lai RC, Lin T, Wang HY, Fu JH (2014) Gene expression analysis of pretreatment biopsies predicts the pathological response of esophageal squamous cell carcinomas to neo-chemoradiotherapy. Ann Oncol 25:1769\u0026ndash;1774. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1093/annonc/mdu201\u003c/span\u003e\u003cspan address=\"10.1093/annonc/mdu201\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWouters R, Molina C, Lavens P, Calder\u0026oacute;n J (2001) Lipid composition and vitamin content of wild female \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e in different stages of sexual maturation. Aquaculture 198:307\u0026ndash;323\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu S, Hu S, Fan W, Zhang X, Wang H, Li C, Deng J (2022) Nitrite exposure may induce infertility in mice. J Toxicol Pathol 35:75\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1293/tox.2021-0002\u003c/span\u003e\u003cspan address=\"10.1293/tox.2021-0002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXian J-A, Wang A-L, Hao X-M, Miao Y-T, Li B, Ye C-X, Liao S-A (2012) In vitro toxicity of nitrite on haemocytes of the tiger shrimp, \u003cem\u003ePenaeus monodon\u003c/em\u003e, using flow cytometric analysis. Comp Biochem Physiol Part C Toxicol Pharmacol 156:75\u0026ndash;79\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie X, Tao T, Liu M, Zhou Y, Liu Z, Zhu D (2016) The potential role of juvenile hormone acid methyltransferase in methyl farnesoate (MF) biosynthesis in the swimming crab, \u003cem\u003ePortunus trituberculatus\u003c/em\u003e * Corresponding author: Dongfa Zhu\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie X-D, Cao M-X, Chen Q, Yu M-L, Liu Q-Y, Zhao Y-Z, Zhang L, Hu T-J (2022) Effect of medical herbs in Tian-Dong-Tang-Gan powder on the oxidative stress induced by ammonia and nitrite in \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e. Aquaculture 548:737584\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao GG, Wu XG, Cheng YX, Yang XZ, Wang CL (2008) The changes of histology and main biochemical composition in the hepatopancreas at the different physiological stages of \u003cem\u003ePortunus trituberculatus\u003c/em\u003e in East China Sea. Acta Oceanol Sin 30:122\u0026ndash;131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYen C-LE, Stone SJ, Koliwad S, Harris C, Farese RV (2008) Thematic review series: glycerolipids. DGAT enzymes and triacylglycerol biosynthesis. J Lipid Res 49:2283\u0026ndash;2301\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu J, Ji X, Wang X, Li T, Wang H, Zeng Q (2019) Identification and characterization of differentially expressed genes in hepatopancreas of oriental river prawn \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e under nitrite stress. Fish Shellfish Immunol 87:144\u0026ndash;154. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2018.12.075\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2018.12.075\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZandee DI (1967) Absence of cholesterol synthesis as contrasted with the presence of fatty acid synthesis in some arthropods. Comp Biochem Physiol 20:811\u0026ndash;822\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang JD, Ruschhaupt M, Biczok R (2015) ddCt method for qRT \u0026ndash; PCR data analysis. Bioconductor 1\u0026ndash;8\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Jiang S, Qiao H, Xiong Y, Fu H, Zhang W, Gong Y, Jin S, Wu Y (2021) Transcriptome analysis of five ovarian stages reveals gonad maturation in female \u003cem\u003eMacrobrachium nipponense\u003c/em\u003e. BMC Genomics 22:1\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12864-021-07737-5\u003c/span\u003e\u003cspan address=\"10.1186/s12864-021-07737-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSequencing data overview\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"607\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.968698517298186%\"\u003e\n \u003cp\u003eSample\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.87644151565074%\"\u003e\n \u003cp\u003eRaw Datas\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.27512355848435%\"\u003e\n \u003cp\u003eClean Data (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.462932454695224%\"\u003e\n \u003cp\u003eAF Q30(%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.4168039538715%\"\u003e\n \u003cp\u003eLow Quality (%)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.968698517298186%\"\u003e\n \u003cp\u003eCtrl-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.87644151565074%\"\u003e\n \u003cp\u003e38097342\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.27512355848435%\"\u003e\n \u003cp\u003e99.80%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.462932454695224%\"\u003e\n \u003cp\u003e93.79%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.4168039538715%\"\u003e\n \u003cp\u003e0.17%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.968698517298186%\"\u003e\n \u003cp\u003eCtrl-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.87644151565074%\"\u003e\n \u003cp\u003e50151018\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.27512355848435%\"\u003e\n \u003cp\u003e99.78%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.462932454695224%\"\u003e\n \u003cp\u003e93.69%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.4168039538715%\"\u003e\n \u003cp\u003e0.19%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.968698517298186%\"\u003e\n \u003cp\u003eCtrl-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.87644151565074%\"\u003e\n \u003cp\u003e48554222\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.27512355848435%\"\u003e\n \u003cp\u003e99.65%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.462932454695224%\"\u003e\n \u003cp\u003e92.84%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.4168039538715%\"\u003e\n \u003cp\u003e0.30%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.968698517298186%\"\u003e\n \u003cp\u003eCtrl-4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.87644151565074%\"\u003e\n \u003cp\u003e42593312\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.27512355848435%\"\u003e\n \u003cp\u003e99.80%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.462932454695224%\"\u003e\n \u003cp\u003e94.01%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.4168039538715%\"\u003e\n \u003cp\u003e0.18%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.968698517298186%\"\u003e\n \u003cp\u003ePG-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.87644151565074%\"\u003e\n \u003cp\u003e39667482\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.27512355848435%\"\u003e\n \u003cp\u003e99.77%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.462932454695224%\"\u003e\n \u003cp\u003e94.05%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.4168039538715%\"\u003e\n \u003cp\u003e0.21%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.968698517298186%\"\u003e\n \u003cp\u003ePG-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.87644151565074%\"\u003e\n \u003cp\u003e49129048\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.27512355848435%\"\u003e\n \u003cp\u003e99.71%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.462932454695224%\"\u003e\n \u003cp\u003e93.24%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.4168039538715%\"\u003e\n \u003cp\u003e0.27%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.968698517298186%\"\u003e\n \u003cp\u003ePG-3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.87644151565074%\"\u003e\n \u003cp\u003e49031588\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.27512355848435%\"\u003e\n \u003cp\u003e99.65%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.462932454695224%\"\u003e\n \u003cp\u003e92.98%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.4168039538715%\"\u003e\n \u003cp\u003e0.32%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.968698517298186%\"\u003e\n \u003cp\u003ePG-4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.87644151565074%\"\u003e\n \u003cp\u003e48170084\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.27512355848435%\"\u003e\n \u003cp\u003e99.72%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"17.462932454695224%\"\u003e\n \u003cp\u003e93.42%\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.4168039538715%\"\u003e\n \u003cp\u003e0.26%\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eqPCR primer list\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"671\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.883755588673623%\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.599105812220564%\"\u003e\n \u003cp\u003eSequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.350223546944859%\" valign=\"top\"\u003e\n \u003cp\u003eProduct size\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.166915052160952%\"\u003e\n \u003cp\u003eAccession number\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.883755588673623%\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e-F\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e-R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.599105812220564%\"\u003e\n \u003cp\u003eGTCTTACGAGCTCCCTGACG\u003c/p\u003e\n \u003cp\u003eTCTCGTGAATGCCGCAAGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.350223546944859%\" valign=\"top\"\u003e\n \u003cp\u003e116\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.166915052160952%\"\u003e\n \u003cp\u003eJF288784.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.883755588673623%\"\u003e\n \u003cp\u003e\u003cem\u003eHBDH\u003c/em\u003e\u003cem\u003e-\u003c/em\u003eF\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eHBDH\u003c/em\u003e\u003cem\u003e-\u003c/em\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.599105812220564%\"\u003e\n \u003cp\u003eTGTCATCAACAACGCGGGTA\u003c/p\u003e\n \u003cp\u003eGTGCCAGGCAAGCCTTAGTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.350223546944859%\" valign=\"top\"\u003e\n \u003cp\u003e125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.166915052160952%\"\u003e\n \u003cp\u003eXP-045614091.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.883755588673623%\"\u003e\n \u003cp\u003e\u003cem\u003eCTSL-\u003c/em\u003eF\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCTSL\u003c/em\u003e\u003cem\u003e-\u003c/em\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.599105812220564%\"\u003e\n \u003cp\u003eGAACACAACCAGCGCTTCAG\u003c/p\u003e\n \u003cp\u003eCGCTGCCTTCCTTACTTGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.350223546944859%\" valign=\"top\"\u003e\n \u003cp\u003e126\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.166915052160952%\"\u003e\n \u003cp\u003eXP-042858750.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.883755588673623%\"\u003e\n \u003cp\u003e\u003cem\u003eFAS-\u003c/em\u003eF\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eFAS-\u003c/em\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.599105812220564%\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;TCCACGTCTGCTGGAAGAAC\u003c/p\u003e\n \u003cp\u003eCTCTCGGGCAGTTGACAGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.350223546944859%\" valign=\"top\"\u003e\n \u003cp\u003e109\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.166915052160952%\"\u003e\n \u003cp\u003eQDK64693.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"17.883755588673623%\"\u003e\n \u003cp\u003e\u003cem\u003eDGAT2-\u003c/em\u003eF\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eDGAT2-\u003c/em\u003eR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"38.599105812220564%\"\u003e\n \u003cp\u003eCAGAACACCTTGCAACAGGC\u003c/p\u003e\n \u003cp\u003eTTCTTCACCTGCGGTACGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.350223546944859%\" valign=\"top\"\u003e\n \u003cp\u003e146\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"28.166915052160952%\"\u003e\n \u003cp\u003eXP-045599376.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003eNote:\u0026nbsp;\u003c/em\u003e\u003cem\u003eHBDH\u0026nbsp;\u003c/em\u003eis\u003cem\u003e\u0026nbsp;3-hydroxybutyrate dehydrogenase\u003c/em\u003e,\u0026nbsp;\u003cem\u003eCTSL\u003c/em\u003e is \u003cem\u003eCathepsin L\u003c/em\u003e, \u003cem\u003eFAS\u0026nbsp;\u003c/em\u003eis \u003cem\u003eFatty acid synthase\u003c/em\u003e, \u003cem\u003eDGAT2\u003c/em\u003e is \u003cem\u003eDiacylglycerol acyltransferase 2\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"M. nipponense, ovary development, nitrite, transcriptome, lipid metabolism","lastPublishedDoi":"10.21203/rs.3.rs-4229192/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4229192/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRiver shrimp (\u003cem\u003eMacrobranchium nipponense\u003c/em\u003e) is a species of shrimp that is widely farmed in China. As the scale of farming expands, the demand for juvenile shrimp will also increase. Their ovarian development time is short, and they are easily affected by environmental factors. Nitrite is a common water pollutant. Excessive exogenous nitrite concentration can affect the gonad development of some animals. However, the effect of nitrite on ovarian development in crustaceans remains to be studied. This experiment conducted a transcriptomic study of ovaries in stage III of development by exposing \u003cem\u003eM. nipponense\u003c/em\u003e (3.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12g) to nitrite in LC50\u003csub\u003e48h\u003c/sub\u003e (10.2 mg/L) for 48 hours. The results showed that the 11,592 differential genes (DEGs) included 3,243 up-regulated genes and 8,349 down-regulated genes. These DEGs are mainly enriched in pathways such as lipid metabolism, carbohydrate metabolism, lysosomal pathway and vitellogenesis. In order to resist nitrite stress, energy supply needs to be enhanced, and the expression levels of carbohydrate metabolism pathways and triglyceride synthesis and metabolism pathways increase. in the lysosomal pathway. The expression levels of Cathepsin L (\u003cem\u003eCTSL\u003c/em\u003e) and Lysosomal aspartic protease were down-regulated. The expression levels of genes related to vitellogenin formation, juvenile hormone acid methyltransferase (\u003cem\u003eJHAMT\u003c/em\u003e), vitellogenin receptor (\u003cem\u003eVgR\u003c/em\u003e), and vitellogenin 2 (\u003cem\u003eVg2\u003c/em\u003e) were down-regulated. This shows that nitrite stress inhibits the ovarian development of \u003cem\u003eM. nipponense\u003c/em\u003e, and there may be a mechanism similar to that of fish in regulating ovarian development by nitrite.\u003c/p\u003e","manuscriptTitle":"Transcriptomic study of acute nitrite stress on ovary development stages of river shrimp (Macrobrachium nipponense)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-16 17:21:39","doi":"10.21203/rs.3.rs-4229192/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"116aca82-544e-4800-9260-b7299db99d22","owner":[],"postedDate":"April 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-17T15:29:54+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-16 17:21:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4229192","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4229192","identity":"rs-4229192","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.