Epigenetic modifications of inflammation in pancreas cells of rats with alcoholic pancreatitis and the protective effect of cooked rhubarb

Epigenetic modifications of inflammation in pancreas cells of rats with alcoholic pancreatitis and the protective effect of cooked rhubarb | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Epigenetic modifications of inflammation in pancreas cells of rats with alcoholic pancreatitis and the protective effect of cooked rhubarb Xianlin Zhao, Shifeng Zhu, Meihua Wan, Wenfu Tang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4016295/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Alcohol abuse is known to be a precipitating risk factor for pancreatic cell injury in pancreatitis,but the exact mechanism of action is far from clear. In this study, a 2x2 factorial design was used to determine whether chronic alcohol exposure affect epigenetics modifications of inflammatory genes in pancreatic cells and the potential protective effects of cooked rhubarb in rats with alcoholic pancreatitis. First, two intervention pairs (chronic alcohol exposure and/or acute pancreatitis stimulation) will be compared in rats. Further analysis of two other intervention pairs (cooked rhubarb treatment and/or acute pancreatitis stimulation) will be performed in alcohol-exposed rats. We found that the combination of acute pancreatitis and chronic alcohol intake resulted in changes to DNA methylation levels, protein expression of IL-1αand IL-10, and induced pathological alterations in the pancreas(P<0.05). Furthermore, Additionally, alcohol-experienced rats treated with cooked rhubarb displayed some effectiveness in reversing these effects (P<0.05). From these experimental results, it can be justified that chronic ethanol exposure could induce epigenetic changes of inflammatory factors and exacerbate inflammatory damage in pancreatic cells,and cooked rhubarb may prevent the progression of alcoholic pancreatitis in rats. Health sciences/Pathogenesis/Inflammation Health sciences/Diseases/Gastrointestinal diseases/Pancreatic disease epigenetics DNA methylation alcoholic pancreatitis cooked rhubarb factorial design Figures Figure 1 Figure 2 Figure 3 Introduction Alcohol (also known as ethanol) is a widely used recreational substance that has been used in many cultures for centuries. Alcohol abuse is a serious public problem and is known to cause serious damage for drinkers 1,2 . The current study reports that abuse of alcohol can damage pancreatic cells and is associated with acute pancreatitis, chronic pancreatitis and pancreatic cancer 3,4 . However, only a few alcohol abusers develop pancreatic disease, demonstrating that other factors (such as gene–environment interactions) may participate in the occurrence and development of the disease 5 . The epigenetics, including DNA methylation and posttranslational modifications to the histones, affects gene expression without altering the DNA sequence 6,7 . Current research indicates that alcohol exposure promotes the overexpression of inflammatory factors (e.g.NF-κB, TNF–α and IL-6) in alcoholic pancreatitis 3,8,9 . Our previous study also showed that chronic alcohol feeding significantly modifies inflammatory markers (IL-1α and IL-10) in rat pancreatic tissue 10 . In other words, alcohol exposure could regulate both pro-inflammatory factors and anti-inflammatory factors in the pancreas, and disease occurs when the balance between the damaging effects shifts to outweight the potential protective effects 5 . Traditional Chinese medicine (TCM), one of the oldest traditional medicines in the world, has been used to treat various diseases for millennia in clinical practice in China 11 . Although rhubarb is a widely used TCM for treating patients with pancreatitis in China, its targets and specific mechanism of action remain obscure 12,13 . Mounting evidence has shown that there is a close relationship between Chinese medicine and epigenetic modification 14 . Hsieh et al reported that 48,491 chemicals in 3,294 TCM can interact with epigenetic-related proteins, and most (99%) of 200 government-approved TCM formulas are epigenome- and miRNA-interacting 15 , which further support the potential of the epigenomes as a potential drug target for treating pancreatitis. Previous studies have shown that alcohol abuse does not itself induce pancreatitis but sensitizes patients to pancreatitis caused by other harmful stimuli 8,16 . Our previous study showed that cooked rhubarb treatment may reduce alcoholic pancreas injury in rats by modulating the level of DNA methylation and protein expression of IL-1α ( pro-inflammatory cytokine) and IL-10 (anti-inflammatory cytokine) 10 . However , whether cooked rhubarb is able to protect pancreatic cells from alcoholic pancreatitis is still unclear . Therefore, in this study, it was determined via a 2x2 factorial design whether chronic alcohol exposure affect epigenetics memory of inflammatory genes (IL-1α/IL-10) in pancreatic cells and the potential protective effects of cooked rhubarb in rats with pancreatitis. Materials and Methods Ethics and animal statement Adult male Sprague–Dawley (SD) rats (200–250 g), purchased from Dashuo Company (Chengdu, China), were used in the experiments. During the entire experimental period,all animals were housed in controlled environments that regulated temperatures (22–24°C) and humidity (50 + 5%),and they had free access to food and water.To minimize animal suffering, every animal work was conducted according to relevant institutional and national guidelines [National Institutes of Health (NIH) publication number 85Y23, revised 1996]. Additionally, ARRIVE Guidelines for Reporting Animal Research were followed. The study procedure was authorized by the West China Hospital of Sichuan University's Ethics Committee for Animal Experiments(Chengdu, China). Study design and interventions SD rats weighing approximately 200–250 g were allocated to a completely randomized design (2 × 2 factorial design with 4 rats per group): ( 1 ) alcohol exposure (AE) versus no alcohol exposure (no-AE); ( 2 ) acute pancreatitis stimulation (AP) versus no acute pancreatitis stimulation (no-AP); and ( 3 ) cooked rhubarb treatment (CR) versus no cooked rhubarb treatment (no-CR). The specific subgroups are presented in Tables 1 and 2 . The rats in the AE group were fed an alcohol liquid diet containing 6.7% vol/vol ethanol and 36% derived calories for 8 weeks, which was manufactured by Trophic Animal Feed High-tech Co., Ltd., in China 10 . The AP model rats were induced by a standard retrograde infusion of 3% sodium taurocholate (0.1 ml/100g;Sigma) after the 8th week as previously described 10 . The CR groups of rats were administered 3 g/kg body weight cooked rhubarb (Jiangyin Tianjiang Pharmaceutical Co., Ltd.) by gavage for 5 weeks (4th -8th week), once a day as previously described 10 . Last , all experimental rats were anesthetized and sacrificed by sodium pentobarbital(250 mg/kg), and their pancreatic tissue was removed and stored for subsequent processing. The methylation degree of specific inflammatory genes (IL-1α and IL-10), relative protein expression, and severity of pancreatic tissue injury were analysed and compared in all groups. Table 1 Four groups within 2 × 2 factorial randomized controlled in the rats:acute pancreatitis and/or alcohol exposure. acute pancreatitis(AP) alcohol exposure(AE) no-AE AE no-AP no-AP and no-AE group no-AP and AE group AP AP and no-AE group AP and AE group Table 2 Four groups within 2 × 2 factorial randomized controlled in the alcohol-exposed rats:acute pancreatitis and/or cooked rhubarb. acute pancreatitis(AP) cooked rhubarb (CR) no-CR CR no-AP AE with no-AP and no-CR group AE with no-AP and CR group AP AE with AP and no-CR group AE with AP and CR group Techniques and processes for detecting DNA methylation and protein expression of inflammatory cytokine, as well as concomitant histopathological damage. Levels of methylated DNA of target inflammatory factors (IL-1α and IL-10) in the pancreas were assessed using a quantitative pyrosequencing approach at the Shanghai Biotechnology Corporation 10 . Using Qiagen's DNeasy Blood & Tissue Kit(Germany) and the Zymo Research EZ DNA Methylation Kit, genomic DNA was extracted and converted to bisulfite. Each target CpG site area was amplified using specific primers (PyroMark software, Qiagen, Hilden). The PyroQ-CpG program was used to determine the methylation level in the target area (Qiagen, Hilden) 10 . The relevant DNA methylation analysis sequence is described in Tables 3 and 4. Table 3 Primer and sequences of IL-1 and IL-10 gene for DNA methylation analysis Gene Primer Name Primer sequences IL-1α BC14044-IL-1α-Fw AAGTTTTTAGGGTATAGAGGGAGTTA BC14044-IL-1α-Rv-B CTCACTCCAACCCCTACTCT BC14044-IL-1α-s GGTATAGAGGGAGTTAAT IL-10 BC14044-IL-10-Fw TTGTAAATTGAGAGGTTTTGTTGTAT BC14044-IL-10-Rv-B AAAAACAAATCCCTAATATATAAATCTCCT BC14044-IL-10-s GAGAGGTTTTGTTGTATT Table 4. DNA methylation analysis site of IL-1α and IL-10 gene Gene Analysis sequence IL-1α TATTGG Y GTTTGAGT Y GGTAAAGGTATTGTTTTTATTTTATTTGA site 1 2 IL-10 TT Y GGTATAAAAGGGGGATAT Y GGGTAGGAGATTTATATATTAGGGAT site 1 2 The protein expression of IL-1α and IL-10 was detected using the streptavidin biotin-peroxidase complex (SABC) immunocytochemistry technique 10 . Samples of pancreatic tissue were harvested and fixed in 4% formalin solution, incubated in methanol and hydrogen peroxide, blocked in goat serum, and then incubated at 4°C overnight with polyclonal antibodies specific for rabbit (IL-1α and IL-10) (Wuhan Boster, Wuhan, China); Subsequently, the slides were incubated with HRP-conjugated goat anti–mouse secondary antibodies and counterstained with haematoxylin following the manufacturer’s protocol (Wuhan Boster, Wuhan, China) 10 . Finally,the stained sections were dehydrated, transparent and sealed, and microscopy was used to examine them before photos were taken. Hematoxylin and eosin (H&E) staining was performed to assess the severity of pancreatic tissue injury. Pancreatic tissue samples were preserved in formalin before being embedded in paraffin. The Grewal gross scoring standard was used to estimate pathological scores based on the degree of tissue damage after HE staining, and photos were taken 10,17 . Statistical analysis All of the tests were carried out at least three times, and the findings are shown as the mean and the standard deviation (mean ± SD). The statistical program PEMS 3.1 was used to handle and analyse the experimental data (Package for Encyclopaedia of Medical Statistics, Sichuan University). The dependent-samples Student's t test was used to make statistical comparisons between groups. Statistical significance was determined at P < 0.05. Results Acute pancreatitis stimulation , in part interacting with alcohol exposure, caused a change in the levels of methylated DNA and protein expression of IL-1α and IL-10 , and the pathological damage in the pancreas of rats. Figure 1 shows the various degrees of methylated DNA and protein expression of IL-1α, as well as pancreatic pathological damage. The average methylation level of a specific CpG site (site-1) of IL-1α was lower in the AE group than in the no-AE group ( P < 0 .05), but the differences were not significantly different between the AP and no-AP groups [Figure 1 ( 1 ) and ( 2 )]. There were no significant interactions found between acute pancreatitis stimulation and alcohol consumption (P = 0.9469) [Figure 1 ( 1 ) and ( 2 )]. Alcohol significantly enhanced the average expression of the IL-1α protein in acinar cells (P < 0.05), while acute pancreatitis stimulation had no similar impact [Figure 1 ( 3 ) and Fig. 3 (⑦-⑫)]. Acute pancreatitis stimulation, in combination with alcohol exposure, significantly enhanced the expression levels of the IL-1α protein within interstitial cells (P < 0.05)[Figure 1 ( 4 ) ]. The different levels of methylated DNA of IL-10 and related protein expression and pathological damage to the pancreas are depicted in Fig. 1 . Alcohol exposure significantly enhanced the level of methylated DNA of IL-10 (site-1 and site-2) (P < 0.05), while it was reduced in the AP group (P < 0.05), and there was not a significant interaction between alcohol exposure and acute pancreatitis stimulation (P < 0.05) [Figure 1 ( 5 ) and ( 6 )]. Compared to the no-AE group, the AE group exhibited a lower expression level of the IL-10 protein (P < 0.05), but the AP group expressed more IL−10 protein(P < 0.05)[Figure 1 ( 7 ) and Fig. 3 (⑬-⑱)]. Acute pancreatitis stimulation, in combination with alcohol exposure, significantly increased IL-10 protein expression levels within interstitial cells (P < 0.05)[Figure 1 ( 8 )]. The impact of acute pancreatitis stimulation and/or alcohol exposure on pathological damage in the pancreas of rats is shown in Fig. 1 ( 9 ) and Fig. 3 (①-⑥). Acute pancreatitis stimulation statistically augmented pancreatic tissue damage (P < 0.05), but alcohol exposure had no such impact. No significant interaction effect was found between acute pancreatitis stimulation and alcohol exposure. Cooked rhubarb treatment effectively reduced changes in the DNA methylation of IL-1α and IL-10, related protein expression , and pathological damage by acute pancreatitis stimulation and/or alcohol exposure in the pancreas of rats. The effects of acute pancreatitis stimulation and/or cooked rhubarb administration on the levels of IL-1α and IL-10 in methylated DNA, protein expression and pathological damage in the pancreas of alcohol-fed rats are illustrated in Fig. 2 . Acute pancreatitis stimulation had no influence on the DNA methylation levels of IL-1α (site-1 and − 2) in the alcohol-exposed pancreas [ Figure 2 ( 1 ) and ( 2 )]. Acute pancreatitis stimulation dramatically reduced the DNA methylation levels of IL-10 (site-1 and − 2) [Figure 2 ( 5 ) and ( 6 )]. Rhubarb treatment increased the level of methylated DNA of IL-1α (site-1) but inhibited the level of methylated DNA of IL-10 (site-1) in the pancreas of alcohol-exposed rats (P < 0.05) [Figure 2 ( 1 ) and ( 5 )]. Acute pancreatitis stimulation in conjunction with cooked rhubarb treatment dramatically altered the levels of methylated DNA of IL-1α (site-2) and IL-10 (site-1 and − 2) (P < 0.05) [Figure 2 ( 2 ), ( 5 ) and ( 6 )]. After acute pancreatitis stimulation, IL-1α protein expression was significantly increased in interstitial cells , but no significant differences were observed in acinar cells (P < 0.05) [Figure 2 ( 3 ), ( 4 ) and Fig. 3 (⑦-⑫)]. Acute pancreatitis activation had no effect on IL-10 protein expression in interstitial and acinar cells [ Figure 2 ( 7 ), ( 8 ) and Fig. 3 (⑬-⑱)]. Cooked rhubarb treatment increased IL-10 protein expression in interstitial and acinar cells while decreasing the expression of IL-1α protein in acinar cells (P < 0.05) [Figure 2 ( 3 ), ( 7 ), ( 8 ), Fig. 3 (⑦-⑱)]. There was an interaction between acute pancreatitis stimulation and cooked rhubarb treatment on IL-1α protein expression in acinar cells and IL-10 protein expression in the interstitial cells of the pancreas affected by alcohol exposure (P < 0.05) [Figure 2 ( 3 ) and ( 8 )]. Discussion Acute pancreatitis represents one of the most common gastrointestinal conditions, increasingly occurring disease and being a frequent cause of hospitalization 18 . Currently , alcohol abuse represents the most common etiological contributor to acute pancreatitis in humans worldwide 3,8 . Although substantial progress has been made in understanding the processes of alcoholic pancreatitis, the particular mechanisms remain unknown 8,19 . Inflammatory cytokines are involved in the inflammatory response of alcoholic pancreatitis and could be either pro- or anti- inflammatory cytokines depending on their roles 8,19 . Our previous study showed that chronic alcohol feeding can lead to epigenetic changes in the IL-1α and IL-10 genes and tissue injury in the pancreas of rats, with cooked rhubarb acting as a protective factor 10 . The purpose of this study was to determine whether cooked rhubarb may help rats with alcohol-induced acute pancreatitis by modulating the epigenetics of inflammatory cytokine genes and histopathology. Although alcohol abuse or alcoholism are one of the major causes of pancreatic disease, the incidence of clinical pancreatitis in heavy drinkers is low 8,20 . These results indicated that other factors (such as genetic background) might be involved in the pathogenesis of acute pancreatitis 8 . Epigenetic modifications , including DNA methylation and histone modifications, affect gene expression without altering the DNA code 6,7 . Chronic alcohol use causes epigenetic alterations in inflammatory genes in rat pancreatic tissue, according to our prior study 10 . First, the experiments in the study were designed to assess the influence of acute pancreatitis and/or chronic alcohol exposure on the epigenetics of inflammatory genes and pathological damage in the pancreas of rats by a 2×2 factorial design. Our results suggested that alcohol exposure stimulation statistically suppressed the IL-1α methylated DNA levels and increased the IL-10 methylated DNA levels. However, a subsequent study found that acinar cells exposed to alcohol produced significantly more IL-1α, while less IL-10 was produced. Meanwhile, our findings showed that after acute pancreatitis stimulation, DNA methylation of IL-10 was reduced and IL-10 protein production was enhanced, but IL-1α did not change. Furthermore, in acute pancreatitis stimulation and alcohol exposure, a link was discovered between changes in the DNA methylation of IL-10 and the protein expression of IL-1α and IL-10 in interstitial cells. Finally , acute pancreatitis stimulation significantly increased pathological pancreatic injury , but alcohol exposure did not show a similar effect. The findings show that while alcohol exposure alone can modify the epigenetics of inflammatory markers (IL-1α and IL-10), it is insufficient to produce severe pathological damage in the rat pancreas. Other researchers have also observed similar findings. Setiawan VW et al reported that alcohol administration alone dose not initiate pancreatitis but dose sensitize the pancreas to pancreatitis by other insults 21 . As described in these epidemiologic studies 20 , pancreatitis appears to be triggered by repeated acute attacks in combination with alcohol binge drinking and other factors, such as epigenetics. The above results indicate that acute pancreatitis stimulation combined with alcohol exposure, at least in part, modified the DNA methylation of IL-1α and IL-10, related protein expression, and pathological damage in the rat pancreas. While abstinence from alcohol is the most essential first suggestion for these individuals with alcoholic pancreatitis to decrease disease recurrence and progression, no particular therapy is available at this time 3,8 . Rhubarb, an ancient Chinese medicine, has been used as an anti- inflammatory drug for a long time 22 . Rhubarb has been shown to reduce inflammatory reactions and attenuate organ injury in acute pancreatitis in previous studies 12,13 . Therefore,in a second phase of our experiments, we used a 2×2 factorial design to investigate the effects of acute pancreatitis and/or cooked rhubarb therapy on DNA methylation and protein expression of IL-1α and IL-10, and the severity of pathological damage in pancreatic tissues of rats fed with alcohol. We found that cooked rhubarb therapy significantly increased the methylation level of IL-1α DNA while inhibiting the methylation level of IL-10 DNA i n the alcohol-exposed pancreas. Meanwhile, cooked rhubarb treatment increased the IL-10 protein expression in the interstitial tissue and acinar tissues but decreased the IL-1α protein in the acinar tissues. The pathological injury of the pancreas was significantly increased by acute pancreatitis stimulation, whereas the pathological injury of the pancreas was clearly alleviated by cooked rhubarb therapy. In addition, there was an interaction between acute pancreatitis stimulation and alcohol exposure on the alteration of the DNA methylation levels of IL-1α and IL-10, related protein expression, and pathological damage in the pan creas of alcohol-exposed rats, according to subgroup analysis. The above-mentioned findings suggest that cooked rhubarb treatment decreased DNA methylation, protein expression of inflammatory genes and pathological damage in rats with alcoholic pancreatitis. Pancreatic acini and interstitial (stellate and duct) cells make up the exocrine pancreas. Pancreatic acinar cells manufacture and release digestive enzymes, the pancreatic duct transports digestive enzymes to the duodenum, and pancreatic stellate cells are myofibroblast-like cells linked with the pancreatic fibrosis of chronic pancreatitis 19,23 . Pancreatic acinar cells, as well as i nterstitial cells, play a role in the general pathophysiology of pancreatitis 18,19 . Chronic alcohol misuse is linked to pancreatic acinar cell destruction in acute pancreatitis, as well as pancreatic interstitial fibrosis in chronic inflammation, according to recent research 8,19 . Alcohol causes pancreatic stellate cells to boost IL-8 production and connective tissue development, according to previous reports by Masamune et al 24 . Our findings also support this theory. Our findings showed that chronic alcohol exposure combined with acute pancreatitis,at least in part, affects IL-1α and IL-10 protein expression not only in pancreatic acini but also in interstitial cells. In the pancreatic acini and interstitial cells of rats, cooked rhubarb administration successfully reduced alterations in the expression levels of IL-1α and IL-10 protein caused by acute pancreatitis stimulation and/or alcohol exposure. Alcohol and its metabolites have previously been found to activate the MAPK, ERK1/2, JNK, and p38K pathways in pancreatic interstitial cells 8,25–27 . Because of their influence on cytokine production, all of these signals are related to inflammation in alcoholic pancreatitis 27 . Conclusions To summarize, chronic ethanol exposure could induce epigenetic changes of inflammatory factors and exacerbate inflammatory damage in pancreatic cells. At least in part, acute pancreatitis stimulation in combination with chronic alcohol exposure may alter inflammatory gene (IL- 1α and IL-10) expression and DNA methylation levels, as well as pathological damage in the rat pancreas.The combination of chronic alcohol exposure and acute pancreatitis stimulation is fatal for the pancreas, according to our findings, and rhubarb may benefit pancreatic cells of rats with alcoholic pancreatitis. Declarations Authors’ Contributions All authors participated in the design, interpretation of the studies and analysis of the data and review of the manuscript. Xianlin Zhao and Wenfu Tang were the one who developed the idea, devised the experimental strategy, and proofread the entire article. Xianlin Zhao carried out the research and wrote the manuscript, which included figures and tables. Shifeng Zhu conducted the experiments, data interpretation, and paper revision. Meihua Wan helped with the experimental setup, the results monitoring, and paper proofreading. Declaration of Conflicting Interests The authors certify no conflicting financial interests during the research. Funding National Natural Science Foundation of China [grants 81374042,82004227, and 82104711] supported this study. References Sacks, J. J., Gonzales, K. R., Bouchery, E. E., Tomedi, L. E. & Brewer, R. D. 2010 National and State Costs of Excessive Alcohol Consumption. Am J Prev Med 49, e73-e79 (2015). Osna, N. A., Ganesan, M., Seth, D., Wyatt, T. A., Kidambi, S. & Kharbanda, K. K. Second hits exacerbate alcohol-related organ damage: an update. Alcohol Alcohol 56, 8–16 (2021). Pezzilli, R. Alcohol Abuse and Pancreatic Diseases: An Overview. Recent Pat Inflamm Allergy Drug Discov 9, 102–106 (2015). Singh, N., Rashid, S., Rashid, S., Sati, H. C., Gupta, S., Vaswani, M. & Saraya, A. Genetic polymorphisms in phase II metabolizing enzymes in alcoholic and idiopathic chronic pancreatitis: Indian scenario. Indian J Gastroenterol (2023). Lugea, A., Waldron, R. T. & Pandol, S. J. Pancreatic adaptive responses in alcohol abuse: Role of the unfolded protein response. Pancreatology 15, S1-5 (2015). Agarwal, G. et al. Epigenetics and epigenomics: underlying mechanisms, relevance, and implications in crop improvement. Funct Integr Genomics 20, 739–761 (2020). Shu, F. et al. Epigenetic and post-translational modifications in autophagy: biological functions and therapeutic targets. Signal Transduct Target Ther 8, 32 (2023). Żorniak, M., Sirtl, S., Mayerle, J. & Beyer, G. What Do We Currently Know about the Pathophysiology of Alcoholic Pancreatitis: A Brief Review. Visc Med 36, 182–190 (2020). González-Reimers, E., Santolaria-Fernández, F., Martín-González, M. C., Fernández-Rodríguez, C. M. & Quintero-Platt, G. Alcoholism: a systemic proinflammatory condition. World J Gastroenterol 20, 14660–14671 (2014). Zhao, X., Zhu, S., Li, J., Long, D., Wan, M. & Tang, W. Epigenetic changes in inflammatory genes and the protective effect of cooked rhubarb on pancreatic tissue of rats with chronic alcohol exposure. Biomed Pharmacother 146, 112587 (2022). Liu, S., Zhu, J. J. & Li, J. C. The interpretation of human body in traditional Chinese medicine and its influence on the characteristics of TCM theory. Anat Rec (Hoboken) 304, 2559–2565 (2021). Chen, X., Yang, K., Jing, G., Yang, J. & Li, K. Meta-Analysis of Efficacy of Rhubarb Combined With Early Enteral Nutrition for the Treatment of Severe Acute Pancreatitis. JPEN J Parenter Enteral Nutr 44, 1066–1078 (2020). Zhang, W. F. et al. Expression and clinical significance of rhubarb on serum amylase and TNF-alpha of rat model of acute pancreatitis. J Biol Regul Homeost Agents 31, 753–760 (2017). Hu, X. Q. & Su, S. B. An overview of epigenetics in Chinese medicine researches. Chin J Integr Med 23, 714–720 (2017). Hsieh, H. Y., Chiu, P. H. & Wang, S. C. Epigenetics in traditional chinese pharmacy: a bioinformatic study at pharmacopoeia scale. Evid Based Complement Alternat Med 2011, 816714 (2011). Pandol, S. J. et al. Ethanol diet increases the sensitivity of rats to pancreatitis induced by cholecystokinin octapeptide. Gastroenterology 117, 706–716 (1999). Liu, X. et al. Isoliquiritigenin Ameliorates Acute Pancreatitis in Mice via Inhibition of Oxidative Stress and Modulation of the Nrf2/HO-1 Pathway. Oxid Med Cell Longev 2018, 7161592 (2018). Mederos, M. A., Reber, H. A. & Girgis, M. D. Acute Pancreatitis: A Review. JAMA 325, 382–390 (2021). Takahashi, T., Miao, Y., Kang, F., Dolai, S. & Gaisano, H. Y. Susceptibility Factors and Cellular Mechanisms Underlying Alcoholic Pancreatitis. Alcohol Clin Exp Res 44, 777–789 (2020). Yadav, D. & Lowenfels, A. B. The epidemiology of pancreatitis and pancreatic cancer. Gastroenterology 144, 1252–1261 (2013). Setiawan, V. W., Monroe, K., Lugea, A., Yadav, D. & Pandol, S. Uniting Epidemiology and Experimental Disease Models for Alcohol-Related Pancreatic Disease. Alcohol Res 38, 173–182 (2017). Cao, Y. J. et al. Advances in bio-active constituents, pharmacology and clinical applications of rhubarb. Chin Med 12, 36 (2017). Omary, M. B., Lugea, A., Lowe, A. W. & Pandol, S. J. The pancreatic stellate cell: a star on the rise in pancreatic diseases. J Clin Invest 117, 50–59 (2007). Masamune, A. et al. Effects of ethanol and its metabolites on human pancreatic stellate cells. Dig Dis Sci 55, 204–211 (2010). Masamune, A., Satoh, M., Kikuta, K., Sakai, Y., Satoh, A. & Shimosegawa, T. Inhibition of p38 mitogen-activated protein kinase blocks activation of rat pancreatic stellate cells. J Pharmacol Exp Ther 304, 8–14 (2003). McCarroll, J. A., Phillips, P. A., Park, S., Doherty, E., Pirola, R. C., Wilson, J. S. & Apte, M. V. Pancreatic stellate cell activation by ethanol and acetaldehyde: is it mediated by the mitogen-activated protein kinase signaling pathway. Pancreas 27, 150–160 (2003). Apte, M., McCarroll, J., Pirola, R. & Wilson, J. Pancreatic MAP kinase pathways and acetaldehyde. Novartis Found Symp 285, 200–211; discussion 211–216 (2007). Additional Declarations No competing interests reported. Supplementary Files GA.jpg Graphical Abstract Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4016295","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":283464827,"identity":"8d62f091-47c3-4b1c-8112-4619ee7bf69b","order_by":0,"name":"Xianlin Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBElEQVRIiWNgGAWjYDACCRBhwMDAx8zA+ICB4QBElIcYLWzMDMwGJGgBAjYgkiBKi/zs5oePeQrs8tjYeY9V89TcseefkcD44G0bg7w5Di2Mc44ZG84wSC5mY+ZLu81z7FnijBsJzIZz2xgMdzZg18IskWAm8cGAObGNmcfsdm7D4QQDiQQ2ad42hgSDA9i1sEmkf5NIMKgHaykGarEHamH/jU8Lj0QOyJbDYC3MQC2MG4C2MOPTIiGRUwz0y3GQFmPpP8cOJ84487BZcs45CcMNOLTIz0jf+JjnT3ViP/8Zw48zag7b87cnH/zwpsxGHpct2ABjAwMivkbBKBgFo2AUkAMA18xR5FhYsrsAAAAASUVORK5CYII=","orcid":"","institution":"West China Hospital of Sichuan University","correspondingAuthor":true,"prefix":"","firstName":"Xianlin","middleName":"","lastName":"Zhao","suffix":""},{"id":283464830,"identity":"2c049b49-204e-4c4d-8b69-d768dd869f50","order_by":1,"name":"Shifeng Zhu","email":"","orcid":"","institution":"Tongde Hospital of Zhejiang Province","correspondingAuthor":false,"prefix":"","firstName":"Shifeng","middleName":"","lastName":"Zhu","suffix":""},{"id":283464833,"identity":"a00d8a82-b831-4294-b39f-c7e0cf06c60b","order_by":2,"name":"Meihua Wan","email":"","orcid":"","institution":"West China Hospital of Sichuan University","correspondingAuthor":false,"prefix":"","firstName":"Meihua","middleName":"","lastName":"Wan","suffix":""},{"id":283464834,"identity":"c2d339b3-43b2-49b8-afbd-ae34384f79da","order_by":3,"name":"Wenfu Tang","email":"","orcid":"","institution":"West China Hospital of Sichuan University","correspondingAuthor":false,"prefix":"","firstName":"Wenfu","middleName":"","lastName":"Tang","suffix":""}],"badges":[],"createdAt":"2024-03-05 09:44:46","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4016295/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4016295/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53539775,"identity":"d4f866cb-cb87-473f-b7cd-6259d8f2ddfb","added_by":"auto","created_at":"2024-03-27 08:29:26","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":800257,"visible":true,"origin":"","legend":"\u003cp\u003eA 2×2 factorial design examination of the effects of chronic alcohol exposure(AE) and/or acute pancreatitis(AP) stimulation on methylated\u0026nbsp;DNA of IL-1α and IL-10 and related protein expression (immunohistochemistry), as well as pathological damages(H\u0026amp;E)\u0026nbsp;to\u0026nbsp;the rat\u0026nbsp;pancreas. (1), (2), (3) and(4) AP and/or AE on methylated\u0026nbsp;DNA of IL-1α and related protein expression; (5), (6), (7) and (8) AP and/or AE on DNA methylation of IL-10 and related protein expression; (9) AP and/or AE on pancreatic histopathology damage.The data are represented as the means±standard deviation\u0026nbsp;from four independent experiments (n=4; \u003csup\u003e▲\u003c/sup\u003eP\u0026lt;0.05, comparison between the AP and no-AP groups; \u003csup\u003e◆\u003c/sup\u003eP\u0026lt;0.05, comparison between the AE and no-AE groups; ∞P\u0026lt;0.05, interaction between the AP and AE groups; unpaired Student’s t test).\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4016295/v1/e47d8d3bf92addc766f9bfe3.jpg"},{"id":53539773,"identity":"b24701d8-f555-4757-bc1c-d3cfa517c856","added_by":"auto","created_at":"2024-03-27 08:29:25","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":795386,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of acute pancreatitis(AP) stimulation and/or cooked rhubarb(CR) treatment on the level of methylated DNA of IL-1α and IL-10 and related protein expression(immunohistochemistry), as well as pancreatic pathological damages(H\u0026amp;E) of alcohol-fed rats by 2×2 factorial design analysis. (1), (2), (3) and (4) AP and/or CR treatment on methylated DNA of IL-1αand related protein expression; (5), (6), (7) and (8) AP and/or CR treatment on methylated DNA of IL-10 and related protein expression; (9) AP and/or CR treatment on pancreatic histopathology damage. The data are represented as the means±standard deviation from four independent experiments(n=4; ▲P\u0026lt;0.05, comparison between the AP and no-AP groups; ◆P\u0026lt;0.05, comparison between the CR and no-CR groups; ∞P\u0026lt;0.05, interaction between the AP and CR groups; unpaired Student’s t test).\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4016295/v1/01fac6e217499ef826412485.jpg"},{"id":53539774,"identity":"e84de2f5-49d7-4e68-bf1d-ee48d39684a2","added_by":"auto","created_at":"2024-03-27 08:29:25","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":413553,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of acute pancreatitis(AP) stimulation, chronic alcohol exposure(AE) and cooked rhubarb(CR) treatment on pancreatic histopathological changes(H\u0026amp;E, ①-⑥),and the protein expression(immunohistochemistry,⑦-⑱) of IL-1α and IL-10. Scale bar in ①-⑥ , 50μm. Scale bar in ⑦-⑱, 100 μm. Magnification: 40×(histopathologyimages)；400×(IL-1αand IL-10 protein images).\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4016295/v1/3dfd564ccef0a8e174be8764.jpg"},{"id":54807234,"identity":"a6487f76-38d4-464f-b391-35bdc3497344","added_by":"auto","created_at":"2024-04-17 04:55:00","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":622024,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4016295/v1/20b58aef-36b6-4352-a2e6-55afd8bb0b11.pdf"},{"id":53539776,"identity":"746e3a97-aad5-4a6e-b404-394a57c6d456","added_by":"auto","created_at":"2024-03-27 08:29:26","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":708265,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical Abstract\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"GA.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4016295/v1/569c3b325a0785af4f8da794.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Epigenetic modifications of inflammation in pancreas cells of rats with alcoholic pancreatitis and the protective effect of cooked rhubarb","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAlcohol (also known as ethanol) is \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ea\u003c/span\u003e widely used recreational substance that has been used in many cultures for centuries. Alcohol abuse is a serious public problem and is known to cause serious damage for drinkers\u003csup\u003e1,2\u003c/sup\u003e. The current study reports that \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eabuse of\u003c/span\u003e alcohol can damage pancreatic cells and is associated with acute pancreatitis, chronic pancreatitis and pancreatic cancer\u003csup\u003e3,4\u003c/sup\u003e. However, \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eonly a\u003c/span\u003e few alcohol abusers develop pancreatic disease, demonstrating that other factors (such as \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003egene\u0026ndash;environment\u003c/span\u003e interactions) may participate in the occurrence and development of the disease\u003csup\u003e5\u003c/sup\u003e. The epigenetics, including DNA methylation and \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eposttranslational\u003c/span\u003e modifications to the histones, affects gene expression without altering the DNA sequence\u003csup\u003e6,7\u003c/sup\u003e. Current research \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eindicates\u003c/span\u003e that alcohol exposure promotes the overexpression of inflammatory factors (e.g.NF-κB, TNF\u0026ndash;α and IL-6) in alcoholic pancreatitis\u003csup\u003e3,8,9\u003c/sup\u003e. Our previous study also showed that chronic alcohol feeding significantly modifies inflammatory markers (IL-1α and IL-10) in rat pancreatic tissue\u003csup\u003e10\u003c/sup\u003e. In other words, alcohol exposure could regulate both \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003epro-inflammatory\u003c/span\u003e factors and anti-inflammatory factors in \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe\u003c/span\u003e pancreas, and disease occurs when the balance between the damaging effects shifts to \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eoutweight\u003c/span\u003e the potential protective effects\u003csup\u003e5\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eTraditional Chinese medicine (TCM), one of the oldest traditional medicines in the world, has been used to treat various diseases for millennia in clinical practice in China\u003csup\u003e11\u003c/sup\u003e. Although rhubarb is \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ea\u003c/span\u003e widely used TCM for treating patients with pancreatitis in China, its targets and specific mechanism of action remain obscure\u003csup\u003e12,13\u003c/sup\u003e. Mounting evidence has shown that there is a close relationship between Chinese medicine and epigenetic modification\u003csup\u003e14\u003c/sup\u003e. Hsieh et al reported that 48,491 chemicals in 3,294 TCM can interact with epigenetic-related proteins, and most (99%) of 200 government-approved TCM formulas are epigenome- and miRNA-interacting \u003csup\u003e15\u003c/sup\u003e, which further support the potential of the epigenomes as a potential drug target for treating pancreatitis. Previous studies have shown that alcohol abuse does not itself induce pancreatitis but \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003esensitizes patients to\u003c/span\u003e pancreatitis caused by other harmful \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003estimuli\u003c/span\u003e\u003csup\u003e8,16\u003c/sup\u003e. Our previous study showed that cooked rhubarb treatment may reduce alcoholic pancreas injury in rats by modulating the level of DNA methylation and protein expression of IL-1α (\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003epro-inflammatory\u003c/span\u003e cytokine) and IL-10 (anti-inflammatory cytokine) \u003csup\u003e10\u003c/sup\u003e. \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eHowever\u003c/span\u003e, whether cooked rhubarb is able to \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eprotect\u003c/span\u003e pancreatic cells from alcoholic pancreatitis is still \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eunclear\u003c/span\u003e. Therefore, in this study, it was determined via a 2x2 factorial design whether chronic alcohol exposure affect epigenetics memory of inflammatory genes (IL-1α/IL-10) in pancreatic cells and the potential protective effects of cooked rhubarb in rats with pancreatitis.\u003c/p\u003e "},{"header":"Materials and Methods","content":"\u003ch2\u003eEthics and \u003cspan class=\"BoldSmallCaps\"\u003eanimal\u003c/span\u003e statement\u003c/h2\u003e\n\u003cp\u003eAdult male \u003cspan class=\"SmallCaps\"\u003eSprague\u0026ndash;Dawley\u003c/span\u003e (SD) rats (200\u0026ndash;250 g), purchased from Dashuo Company (Chengdu, China), were used in the experiments. During the entire experimental period,all animals were housed in controlled environments that regulated temperatures (22\u0026ndash;24\u0026deg;C) and humidity (50\u0026thinsp;+\u0026thinsp;5%),and they had free access to food and water.To minimize animal suffering, every animal work was conducted according to relevant institutional and national guidelines [National Institutes of Health (NIH) publication number 85Y23, revised 1996]. Additionally, ARRIVE Guidelines for Reporting Animal Research were followed. The study procedure was authorized by the West China Hospital of Sichuan University's Ethics Committee for Animal Experiments(Chengdu, China).\u003c/p\u003e\n\u003ch3\u003eStudy design and interventions\u003c/h3\u003e\n\u003cp\u003eSD rats weighing \u003cspan class=\"SmallCaps\"\u003eapproximately\u003c/span\u003e 200\u0026ndash;250 g were allocated to a completely randomized design (2 \u0026times; 2 factorial design with 4 rats per group): (\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e) alcohol exposure (AE) versus no alcohol exposure (no-AE); (\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e) acute pancreatitis stimulation (AP) versus no acute pancreatitis stimulation (no-AP); and (\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e) cooked rhubarb treatment (CR) versus no cooked rhubarb treatment (no-CR). The specific subgroups are presented in Tables \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. The \u003cspan class=\"SmallCaps\"\u003erats in the\u003c/span\u003e AE \u003cspan class=\"SmallCaps\"\u003egroup\u003c/span\u003e were fed \u003cspan class=\"SmallCaps\"\u003ean\u003c/span\u003e alcohol liquid diet \u003cspan class=\"SmallCaps\"\u003econtaining\u003c/span\u003e 6.7% vol/vol ethanol and 36% derived calories for 8 weeks, which was manufactured by Trophic Animal Feed High-tech Co., Ltd., in China\u003csup\u003e10\u003c/sup\u003e. The AP model rats \u003cspan class=\"SmallCaps\"\u003ewere\u003c/span\u003e induced by a standard retrograde infusion of 3% sodium taurocholate (0.1 ml/100g;Sigma) after the 8th week as previously described\u003csup\u003e10\u003c/sup\u003e. The CR groups \u003cspan class=\"SmallCaps\"\u003eof\u003c/span\u003e rats were administered 3 g/kg body weight cooked rhubarb (Jiangyin Tianjiang Pharmaceutical Co., Ltd.) by gavage for 5 weeks (4th -8th week), once a day as previously described\u003csup\u003e10\u003c/sup\u003e. \u003cspan class=\"SmallCaps\"\u003eLast\u003c/span\u003e, all experimental rats were anesthetized and sacrificed by sodium pentobarbital(250 mg/kg), and their pancreatic tissue \u003cspan class=\"SmallCaps\"\u003ewas\u003c/span\u003e removed and stored for subsequent processing. The methylation degree of specific inflammatory \u003cspan class=\"SmallCaps\"\u003egenes\u003c/span\u003e (IL-1\u0026alpha; and IL-10), relative \u003cspan class=\"SmallCaps\"\u003eprotein\u003c/span\u003e expression, and severity of pancreatic tissue injury were \u003cspan class=\"SmallCaps\"\u003eanalysed\u003c/span\u003e and compared in all groups.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eFour groups within 2 \u0026times; 2 factorial randomized controlled in the rats:acute pancreatitis and/or alcohol exposure.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eacute pancreatitis(AP)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003ealcohol exposure(AE)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eno-AE\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eAE\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eno-AP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eno-AP and no-AE group\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eno-AP and AE group\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAP and no-AE group\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAP and AE group\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eFour groups within 2 \u0026times; 2 factorial randomized controlled in the alcohol-exposed rats:acute pancreatitis and/or cooked rhubarb.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth rowspan=\"2\" align=\"left\"\u003e\n\u003cp\u003eacute pancreatitis(AP)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth colspan=\"2\" align=\"left\"\u003e\n\u003cp\u003ecooked rhubarb (CR)\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eno-CR\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eCR\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eno-AP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAE with no-AP and no-CR group\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAE with no-AP and CR group\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAP\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAE with AP and no-CR group\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAE with AP and CR group\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eTechniques and processes for detecting DNA methylation and protein expression of inflammatory cytokine, as well as concomitant histopathological damage.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLevels of methylated DNA of target inflammatory factors (IL-1\u0026alpha; and IL-10) in \u003cspan class=\"SmallCaps\"\u003ethe\u003c/span\u003e pancreas \u003cspan class=\"SmallCaps\"\u003ewere\u003c/span\u003e assessed using a quantitative pyrosequencing approach at the Shanghai Biotechnology Corporation\u003csup\u003e10\u003c/sup\u003e. Using Qiagen's DNeasy Blood \u0026amp; Tissue Kit(Germany) and the Zymo Research EZ DNA Methylation Kit, genomic DNA was extracted and converted to bisulfite. Each target CpG site area was amplified using specific primers (PyroMark software, Qiagen, Hilden). The PyroQ-CpG program was used to determine the methylation level in the target area (Qiagen, Hilden)\u003csup\u003e10\u003c/sup\u003e. The relevant DNA methylation analysis sequence is described in Tables\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e and 4.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003ePrimer and sequences of IL-1 and IL-10 gene for DNA methylation analysis\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePrimer Name\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePrimer sequences\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eIL-1\u0026alpha;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBC14044-IL-1\u0026alpha;-Fw\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAGTTTTTAGGGTATAGAGGGAGTTA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBC14044-IL-1\u0026alpha;-Rv-B\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCTCACTCCAACCCCTACTCT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBC14044-IL-1\u0026alpha;-s\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGGTATAGAGGGAGTTAAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd rowspan=\"3\" align=\"left\"\u003e\n\u003cp\u003eIL-10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBC14044-IL-10-Fw\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTTGTAAATTGAGAGGTTTTGTTGTAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBC14044-IL-10-Rv-B\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAAAAACAAATCCCTAATATATAAATCTCCT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBC14044-IL-10-s\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGAGAGGTTTTGTTGTATT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003eTable\u0026nbsp;4. DNA methylation analysis site of IL-1\u0026alpha; and IL-10 gene\u0026nbsp;\u003c/div\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Taba\" border=\"1\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eGene\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eAnalysis sequence\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eIL-1\u0026alpha;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTATTGG\u003cspan class=\"BoldUnderline\"\u003eY\u003c/span\u003eGTTTGAGT\u003cspan class=\"BoldUnderline\"\u003eY\u003c/span\u003eGGTAAAGGTATTGTTTTTATTTTATTTGA\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003esite\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1 2\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\nIL-10\u003c/div\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eTT\u003cspan class=\"BoldUnderline\"\u003eY\u003c/span\u003eGGTATAAAAGGGGGATAT\u003cspan class=\"BoldUnderline\"\u003eY\u003c/span\u003eGGGTAGGAGATTTATATATTAGGGAT\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003esite\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1 2\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eThe protein expression of IL-1\u0026alpha; and IL-10 was detected using the streptavidin biotin-peroxidase complex (SABC) immunocytochemistry technique\u003csup\u003e10\u003c/sup\u003e. Samples of pancreatic tissue were harvested and fixed in 4% formalin solution, incubated in methanol and hydrogen peroxide, blocked in goat serum, and then incubated at 4\u0026deg;C overnight with polyclonal antibodies specific for rabbit (IL-1\u0026alpha; and IL-10) (Wuhan Boster, Wuhan, China); Subsequently, the slides were incubated with HRP-conjugated goat anti\u0026ndash;mouse secondary antibodies and counterstained with\u003c/p\u003e\n\u003cp\u003ehaematoxylin following the \u003cspan class=\"SmallCaps\"\u003emanufacturer\u0026rsquo;s\u003c/span\u003e protocol (Wuhan Boster, Wuhan, China)\u003csup\u003e10\u003c/sup\u003e. Finally,the stained sections were dehydrated, transparent and sealed, \u003cspan class=\"SmallCaps\"\u003eand\u003c/span\u003e microscopy was used to examine them before photos were taken.\u003c/p\u003e\n\u003cp\u003eHematoxylin and eosin (H\u0026amp;E) staining was performed to assess the severity of pancreatic tissue injury. Pancreatic tissue samples were preserved in formalin before being embedded in paraffin. The Grewal gross scoring standard was used to estimate pathological scores based on the degree of tissue damage after HE staining, and photos were taken\u003csup\u003e10,17\u003c/sup\u003e.\u003c/p\u003e\n\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eAll of the tests were carried out at least three times, and the findings are shown as \u003cspan class=\"SmallCaps\"\u003ethe\u003c/span\u003e mean and the standard deviation (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD). The statistical program PEMS 3.1 was used to handle and \u003cspan class=\"SmallCaps\"\u003eanalyse\u003c/span\u003e the experimental data (Package for Encyclopaedia of Medical Statistics, Sichuan University). The dependent-samples Student's t test was used to make statistical comparisons between groups. \u003cspan class=\"SmallCaps\"\u003eStatistical significance was determined at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/span\u003e\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eAcute pancreatitis stimulation\u003c/strong\u003e, \u003cspan class=\"BoldSmallCaps\"\u003ein part interacting\u003c/span\u003e \u003cstrong\u003ewith alcohol exposure, caused a change in\u003c/strong\u003e \u003cspan class=\"BoldSmallCaps\"\u003ethe\u003c/span\u003e \u003cstrong\u003elevels of methylated DNA and protein expression of IL-1\u0026alpha; and IL-10\u003c/strong\u003e, \u003cstrong\u003eand the pathological damage in\u003c/strong\u003e \u003cspan class=\"BoldSmallCaps\"\u003ethe\u003c/span\u003e \u003cstrong\u003epancreas of rats.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFigure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e shows the various degrees of methylated DNA and protein expression of IL-1\u0026alpha;, as well as pancreatic pathological damage. The average methylation level of a specific CpG site (site-1) of IL-1\u0026alpha; was lower in the AE group than in the no-AE group (\u003cspan class=\"SmallCaps\"\u003eP\u0026thinsp;\u0026lt;\u0026thinsp;0\u003c/span\u003e.05), but the differences were not \u003cspan class=\"SmallCaps\"\u003esignificantly\u003c/span\u003e different between the AP and no-AP groups [Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e) and (\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e)]. There were no significant interactions found between acute pancreatitis stimulation and alcohol consumption (P\u0026thinsp;=\u0026thinsp;0.9469) [Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e(\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e) and (\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e)]. Alcohol significantly enhanced the average expression of the IL-1\u0026alpha; protein in acinar cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while acute pancreatitis stimulation had no similar impact [Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e(\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e) and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e(⑦-⑫)]. Acute pancreatitis stimulation, in combination with alcohol exposure, significantly \u003cspan class=\"SmallCaps\"\u003eenhanced\u003c/span\u003e the expression levels of the IL-1\u0026alpha; protein within interstitial cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)[Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e(\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e) ].\u003c/p\u003e\n\u003cp\u003eThe different levels of methylated DNA of IL-10 and related protein expression and pathological damage \u003cspan class=\"SmallCaps\"\u003eto the pancreas\u003c/span\u003e are depicted in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. Alcohol exposure \u003cspan class=\"SmallCaps\"\u003esignificantly\u003c/span\u003e enhanced the level of methylated DNA of IL-10 (site-1 and site-2) (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while it was reduced in the AP group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and \u003cspan class=\"SmallCaps\"\u003ethere was\u003c/span\u003e not a significant interaction between alcohol exposure and acute pancreatitis stimulation (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) [Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e) and (\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e)]. Compared to the no-AE group, the AE group exhibited a lower expression level of the IL-10 protein (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but the AP group expressed more \u003cspan class=\"SmallCaps\"\u003eIL\u0026minus;10\u003c/span\u003e protein(P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)[Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e) and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e(⑬-⑱)]. Acute pancreatitis stimulation, in combination with alcohol exposure, \u003cspan class=\"SmallCaps\"\u003esignificantly\u003c/span\u003e increased IL-10 protein expression levels within interstitial cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05)[Figure \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e)].\u003c/p\u003e\n\u003cp\u003eThe impact of acute pancreatitis stimulation and/or alcohol exposure on pathological damage in the pancreas of rats is \u003cspan class=\"SmallCaps\"\u003eshown\u003c/span\u003e in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e) and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e(①-⑥). Acute pancreatitis stimulation statistically augmented pancreatic tissue damage (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), but alcohol exposure \u003cspan class=\"SmallCaps\"\u003ehad\u003c/span\u003e no such impact. No significant interaction effect was found between acute pancreatitis stimulation and alcohol exposure.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCooked rhubarb treatment effectively reduced changes in\u003c/strong\u003e \u003cspan class=\"BoldSmallCaps\"\u003ethe\u003c/span\u003e \u003cstrong\u003eDNA methylation of IL-1\u0026alpha; and IL-10, related protein expression\u003c/strong\u003e, \u003cstrong\u003eand pathological damage by acute pancreatitis stimulation and/or alcohol exposure in\u003c/strong\u003e \u003cspan class=\"BoldSmallCaps\"\u003ethe\u003c/span\u003e \u003cstrong\u003epancreas of rats.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effects of acute pancreatitis stimulation and/or cooked rhubarb administration on the \u003cspan class=\"SmallCaps\"\u003elevels\u003c/span\u003e of IL-1\u0026alpha; and IL-10 in methylated DNA, \u003cspan class=\"SmallCaps\"\u003eprotein\u003c/span\u003e expression and pathological damage in \u003cspan class=\"SmallCaps\"\u003ethe\u003c/span\u003e pancreas of alcohol-fed rats are illustrated in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e. Acute pancreatitis stimulation had no influence on the DNA methylation levels of IL-1\u0026alpha; (site-1 and \u0026minus;\u0026thinsp;2) in \u003cspan class=\"SmallCaps\"\u003ethe\u003c/span\u003e alcohol-exposed \u003cspan class=\"SmallCaps\"\u003epancreas [\u003c/span\u003eFigure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e) and (\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e)]. Acute pancreatitis stimulation dramatically reduced the DNA methylation levels of IL-10 (site-1 and \u0026minus;\u0026thinsp;2) [Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e) and (\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e)]. Rhubarb treatment increased the level of methylated DNA of IL-1\u0026alpha; (site-1) but inhibited the level of methylated DNA of IL-10 (site-1) in \u003cspan class=\"SmallCaps\"\u003ethe\u003c/span\u003e pancreas of alcohol-exposed rats (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) [Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e) and (\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e)]. Acute pancreatitis stimulation in conjunction with cooked rhubarb treatment dramatically altered the levels of methylated DNA of IL-1\u0026alpha; (site-2) and IL-10 (site-1 and \u0026minus;\u0026thinsp;2) (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) [Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e), (\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e) and (\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e)].\u003c/p\u003e\n\u003cp\u003eAfter acute pancreatitis stimulation, IL-1\u0026alpha; protein expression was \u003cspan class=\"SmallCaps\"\u003esignificantly\u003c/span\u003e increased in interstitial \u003cspan class=\"SmallCaps\"\u003ecells\u003c/span\u003e, but no \u003cspan class=\"SmallCaps\"\u003esignificant\u003c/span\u003e differences \u003cspan class=\"SmallCaps\"\u003ewere observed\u003c/span\u003e in acinar cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) [Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e), (\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e) and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e(⑦-⑫)]. Acute pancreatitis activation had no effect on IL-10 protein expression in interstitial and acinar \u003cspan class=\"SmallCaps\"\u003ecells [\u003c/span\u003eFigure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e), (\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e) and Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e(⑬-⑱)]. Cooked rhubarb treatment increased IL-10 protein expression in interstitial and acinar cells while decreasing the expression of IL-1\u0026alpha; protein in acinar cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) [Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e), (\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e), (\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e), Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e(⑦-⑱)]. There was an interaction between acute pancreatitis stimulation and cooked rhubarb treatment on IL-1\u0026alpha; protein expression in acinar cells and IL-10 protein expression in the interstitial cells of \u003cspan class=\"SmallCaps\"\u003ethe\u003c/span\u003e pancreas affected by alcohol exposure (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) [Figure \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e) and (\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e)].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAcute pancreatitis represents one of the most common gastrointestinal conditions, increasingly occurring disease and being a frequent cause of \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ehospitalization\u003c/span\u003e\u003csup\u003e18\u003c/sup\u003e. \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eCurrently\u003c/span\u003e, alcohol abuse represents the most common etiological \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003econtributor to\u003c/span\u003e acute pancreatitis in humans \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eworldwide\u003c/span\u003e\u003csup\u003e3,8\u003c/sup\u003e. Although substantial progress has been made in understanding the processes of alcoholic pancreatitis, the particular mechanisms remain unknown\u003csup\u003e8,19\u003c/sup\u003e. Inflammatory cytokines are involved in the inflammatory response of alcoholic pancreatitis and could be either pro- or anti- inflammatory cytokines depending on their roles\u003csup\u003e8,19\u003c/sup\u003e. Our previous study showed that chronic alcohol feeding can lead to epigenetic changes \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ein the\u003c/span\u003e IL-1α and IL-10 \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003egenes\u003c/span\u003e and tissue injury in the pancreas of rats, with cooked rhubarb acting as a protective factor\u003csup\u003e10\u003c/sup\u003e. The purpose of this study was to \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003edetermine whether\u003c/span\u003e cooked rhubarb may help rats with alcohol-induced acute pancreatitis by modulating the epigenetics of inflammatory \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ecytokine\u003c/span\u003e genes and histopathology.\u003c/p\u003e \u003cp\u003eAlthough alcohol abuse or alcoholism are one of \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe\u003c/span\u003e major \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ecauses\u003c/span\u003e of pancreatic disease, the incidence of clinical pancreatitis in heavy drinkers is low \u003csup\u003e8,20\u003c/sup\u003e. These results indicated that other\u003c/p\u003e \u003cp\u003e \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003efactors (such\u003c/span\u003e as genetic \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ebackground)\u003c/span\u003e might be involved in the pathogenesis of acute pancreatitis\u003csup\u003e8\u003c/sup\u003e. \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eEpigenetic modifications\u003c/span\u003e, including DNA methylation and histone modifications, \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eaffect\u003c/span\u003e gene expression without altering the DNA code\u003csup\u003e6,7\u003c/sup\u003e. Chronic alcohol use causes epigenetic alterations in inflammatory genes in \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003erat\u003c/span\u003e pancreatic tissue, according to our prior study\u003csup\u003e10\u003c/sup\u003e. First, the experiments in the study were designed to assess the influence of acute pancreatitis and/or chronic alcohol exposure on \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe\u003c/span\u003e epigenetics of inflammatory genes and pathological damage in \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe\u003c/span\u003e pancreas of rats by \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ea\u003c/span\u003e 2\u0026times;2 factorial design. Our results suggested that alcohol exposure stimulation statistically suppressed the IL-1α methylated DNA levels and increased \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe\u003c/span\u003e IL-10 methylated DNA levels. However, a subsequent \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003estudy\u003c/span\u003e found that acinar cells exposed to alcohol produced significantly more IL-1α, while less IL-10 was produced. Meanwhile, our findings showed that after acute pancreatitis stimulation, DNA methylation of IL-10 was reduced and IL-10 protein production was enhanced, but IL-1α did not change. Furthermore, in acute pancreatitis stimulation and alcohol exposure, a link was discovered between changes in \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe\u003c/span\u003e DNA methylation of IL-10 and \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe protein\u003c/span\u003e expression of IL-1α and IL-10 in interstitial \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ecells. Finally\u003c/span\u003e, acute pancreatitis stimulation \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003esignificantly increased pathological pancreatic injury\u003c/span\u003e, but alcohol exposure did not show a similar effect. The findings show that while alcohol exposure alone can modify the epigenetics of inflammatory markers (IL-1α and IL-10), it is insufficient to produce severe pathological damage in \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe rat\u003c/span\u003e pancreas. Other researchers \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ehave\u003c/span\u003e also observed similar findings. Setiawan VW et al reported that alcohol administration alone dose not initiate pancreatitis but dose sensitize the pancreas to pancreatitis by other insults\u003csup\u003e21\u003c/sup\u003e. As described in these epidemiologic studies\u003csup\u003e20\u003c/sup\u003e, pancreatitis appears to be triggered by repeated acute attacks in combination with alcohol binge drinking and other factors, such as epigenetics. The above results indicate that acute pancreatitis stimulation combined with alcohol exposure, at least in part, modified \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe\u003c/span\u003e DNA methylation of IL-1α and IL-10, related protein expression, and pathological damage in \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe rat\u003c/span\u003e pancreas.\u003c/p\u003e \u003cp\u003eWhile abstinence from alcohol is the most essential first suggestion for these individuals with alcoholic pancreatitis to decrease disease recurrence and progression, no particular therapy is available at this time\u003csup\u003e3,8\u003c/sup\u003e. Rhubarb, an ancient Chinese medicine, \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ehas been\u003c/span\u003e used as an anti-\u003c/p\u003e \u003cp\u003einflammatory drug for a long time\u003csup\u003e22\u003c/sup\u003e. Rhubarb has been shown to reduce inflammatory reactions and \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eattenuate\u003c/span\u003e organ injury in acute pancreatitis in previous studies\u003csup\u003e12,13\u003c/sup\u003e. Therefore,in a second phase of our experiments, we used a 2\u0026times;2 factorial design to investigate the effects of acute pancreatitis and/or cooked rhubarb therapy on DNA methylation and protein expression of IL-1α and IL-10, and the severity of pathological damage in pancreatic tissues of rats fed with alcohol. We found that cooked rhubarb therapy significantly \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eincreased\u003c/span\u003e the methylation level of IL-1α DNA while inhibiting the methylation level of IL-10 DNA \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ei\u003c/span\u003en \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe\u003c/span\u003e alcohol-exposed pancreas. Meanwhile, cooked rhubarb treatment increased the IL-10 protein expression in the interstitial tissue and acinar tissues but decreased the IL-1α protein in the acinar tissues. The pathological injury of the pancreas \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ewas significantly\u003c/span\u003e increased by acute pancreatitis stimulation, whereas the pathological injury of the pancreas was clearly alleviated by cooked rhubarb therapy. In addition, there was an interaction between acute pancreatitis stimulation and alcohol exposure on the alteration of \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe\u003c/span\u003e DNA methylation \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003elevels\u003c/span\u003e of IL-1α and IL-10, related protein expression, \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eand\u003c/span\u003e pathological damage in \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe pan\u003c/span\u003ecreas of alcohol-exposed rats, according to subgroup analysis. The above-mentioned findings suggest that cooked rhubarb treatment decreased DNA methylation, protein expression of inflammatory genes and pathological damage in rats with alcoholic pancreatitis.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ePancreatic\u003c/span\u003e acini and interstitial (stellate and duct) cells make up the exocrine pancreas. Pancreatic acinar cells manufacture and release digestive enzymes, the pancreatic duct transports digestive enzymes to the duodenum, and pancreatic stellate cells are myofibroblast-like cells linked with the pancreatic fibrosis of chronic pancreatitis\u003csup\u003e19,23\u003c/sup\u003e. Pancreatic acinar cells, as well as i\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003enterstitial\u003c/span\u003e cells, play a role in the general pathophysiology of pancreatitis\u003csup\u003e18,19\u003c/sup\u003e. Chronic alcohol misuse is linked to pancreatic acinar cell destruction in acute pancreatitis, as well as pancreatic interstitial fibrosis in chronic inflammation, according to recent research\u003csup\u003e8,19\u003c/sup\u003e. Alcohol causes pancreatic stellate cells to boost IL-8 production and connective tissue development, according \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003eto\u003c/span\u003e previous reports by Masamune et al\u003csup\u003e24\u003c/sup\u003e. Our findings also \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003esupport\u003c/span\u003e this theory. Our findings showed that chronic alcohol exposure combined with acute pancreatitis,at least in part, affects IL-1α and IL-10 protein expression \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003enot only\u003c/span\u003e in pancreatic acini but also in interstitial cells. In the pancreatic acini and interstitial cells of rats, cooked rhubarb administration successfully reduced alterations \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ein the\u003c/span\u003e expression \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003elevels\u003c/span\u003e of IL-1α and IL-10 protein caused by acute pancreatitis stimulation and/or alcohol exposure. Alcohol and its metabolites have previously been found to activate the MAPK, ERK1/2, JNK, and p38K \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003epathways\u003c/span\u003e in pancreatic interstitial cells\u003csup\u003e8,25\u0026ndash;27\u003c/sup\u003e. Because of their influence on cytokine production, all of these signals are related to inflammation in alcoholic pancreatitis\u003csup\u003e27\u003c/sup\u003e.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eTo summarize, chronic ethanol exposure could induce epigenetic changes of inflammatory factors and exacerbate inflammatory damage in pancreatic cells. At least in part, acute pancreatitis stimulation in combination with chronic alcohol exposure may alter inflammatory gene (IL-\u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003e1α and\u003c/span\u003e IL-10) expression and DNA methylation levels, as well as pathological damage in \u003cspan type=\"SmallCaps\" class=\"SmallCaps\" name=\"Emphasis\"\u003ethe rat\u003c/span\u003e pancreas.The combination of chronic alcohol exposure and acute pancreatitis stimulation is fatal for the pancreas, according to our findings, and rhubarb may benefit pancreatic cells of rats with alcoholic pancreatitis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors participated in the design, interpretation of the studies and analysis of the data and\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ereview of the manuscript. Xianlin Zhao and Wenfu Tang were the one who developed the idea, devised the experimental strategy, and proofread the entire article. Xianlin Zhao carried out the research and wrote the manuscript, which included figures and tables. Shifeng Zhu conducted the experiments, data interpretation, and paper revision. Meihua Wan helped with the experimental setup, the results monitoring, and paper proofreading.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Conflicting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors certify\u0026nbsp;no\u0026nbsp;conflicting financial interests during the research.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNational Natural Science Foundation of China [grants 81374042,82004227, and 82104711] supported this study.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSacks, J. J., Gonzales, K. R., Bouchery, E. E., Tomedi, L. E. \u0026amp; Brewer, R. D. 2010 National and State Costs of Excessive Alcohol Consumption. Am J Prev Med 49, e73-e79 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsna, N. A., Ganesan, M., Seth, D., Wyatt, T. A., Kidambi, S. \u0026amp; Kharbanda, K. K. Second hits exacerbate alcohol-related organ damage: an update. Alcohol Alcohol 56, 8\u0026ndash;16 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePezzilli, R. Alcohol Abuse and Pancreatic Diseases: An Overview. Recent Pat Inflamm Allergy Drug Discov 9, 102\u0026ndash;106 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh, N., Rashid, S., Rashid, S., Sati, H. C., Gupta, S., Vaswani, M. \u0026amp; Saraya, A. Genetic polymorphisms in phase II metabolizing enzymes in alcoholic and idiopathic chronic pancreatitis: Indian scenario. Indian J Gastroenterol (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLugea, A., Waldron, R. T. \u0026amp; Pandol, S. J. Pancreatic adaptive responses in alcohol abuse: Role of the unfolded protein response. Pancreatology 15, S1-5 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAgarwal, G. et al. Epigenetics and epigenomics: underlying mechanisms, relevance, and implications in crop improvement. Funct Integr Genomics 20, 739\u0026ndash;761 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShu, F. et al. Epigenetic and post-translational modifications in autophagy: biological functions and therapeutic targets. Signal Transduct Target Ther 8, 32 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eŻorniak, M., Sirtl, S., Mayerle, J. \u0026amp; Beyer, G. What Do We Currently Know about the Pathophysiology of Alcoholic Pancreatitis: A Brief Review. Visc Med 36, 182\u0026ndash;190 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonz\u0026aacute;lez-Reimers, E., Santolaria-Fern\u0026aacute;ndez, F., Mart\u0026iacute;n-Gonz\u0026aacute;lez, M. C., Fern\u0026aacute;ndez-Rodr\u0026iacute;guez, C. M. \u0026amp; Quintero-Platt, G. Alcoholism: a systemic proinflammatory condition. World J Gastroenterol 20, 14660\u0026ndash;14671 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao, X., Zhu, S., Li, J., Long, D., Wan, M. \u0026amp; Tang, W. Epigenetic changes in inflammatory genes and the protective effect of cooked rhubarb on pancreatic tissue of rats with chronic alcohol exposure. Biomed Pharmacother 146, 112587 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, S., Zhu, J. J. \u0026amp; Li, J. C. The interpretation of human body in traditional Chinese medicine and its influence on the characteristics of TCM theory. Anat Rec (Hoboken) 304, 2559\u0026ndash;2565 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen, X., Yang, K., Jing, G., Yang, J. \u0026amp; Li, K. Meta-Analysis of Efficacy of Rhubarb Combined With Early Enteral Nutrition for the Treatment of Severe Acute Pancreatitis. JPEN J Parenter Enteral Nutr 44, 1066\u0026ndash;1078 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, W. F. et al. Expression and clinical significance of rhubarb on serum amylase and TNF-alpha of rat model of acute pancreatitis. J Biol Regul Homeost Agents 31, 753\u0026ndash;760 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu, X. Q. \u0026amp; Su, S. B. An overview of epigenetics in Chinese medicine researches. Chin J Integr Med 23, 714\u0026ndash;720 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsieh, H. Y., Chiu, P. H. \u0026amp; Wang, S. C. Epigenetics in traditional chinese pharmacy: a bioinformatic study at pharmacopoeia scale. Evid Based Complement Alternat Med 2011, 816714 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandol, S. J. et al. Ethanol diet increases the sensitivity of rats to pancreatitis induced by cholecystokinin octapeptide. Gastroenterology 117, 706\u0026ndash;716 (1999).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, X. et al. Isoliquiritigenin Ameliorates Acute Pancreatitis in Mice via Inhibition of Oxidative Stress and Modulation of the Nrf2/HO-1 Pathway. Oxid Med Cell Longev 2018, 7161592 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMederos, M. A., Reber, H. A. \u0026amp; Girgis, M. D. Acute Pancreatitis: A Review. JAMA 325, 382\u0026ndash;390 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakahashi, T., Miao, Y., Kang, F., Dolai, S. \u0026amp; Gaisano, H. Y. Susceptibility Factors and Cellular Mechanisms Underlying Alcoholic Pancreatitis. Alcohol Clin Exp Res 44, 777\u0026ndash;789 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYadav, D. \u0026amp; Lowenfels, A. B. The epidemiology of pancreatitis and pancreatic cancer. Gastroenterology 144, 1252\u0026ndash;1261 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSetiawan, V. W., Monroe, K., Lugea, A., Yadav, D. \u0026amp; Pandol, S. Uniting Epidemiology and Experimental Disease Models for Alcohol-Related Pancreatic Disease. Alcohol Res 38, 173\u0026ndash;182 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCao, Y. J. et al. Advances in bio-active constituents, pharmacology and clinical applications of rhubarb. Chin Med 12, 36 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOmary, M. B., Lugea, A., Lowe, A. W. \u0026amp; Pandol, S. J. The pancreatic stellate cell: a star on the rise in pancreatic diseases. J Clin Invest 117, 50\u0026ndash;59 (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasamune, A. et al. Effects of ethanol and its metabolites on human pancreatic stellate cells. Dig Dis Sci 55, 204\u0026ndash;211 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasamune, A., Satoh, M., Kikuta, K., Sakai, Y., Satoh, A. \u0026amp; Shimosegawa, T. Inhibition of p38 mitogen-activated protein kinase blocks activation of rat pancreatic stellate cells. J Pharmacol Exp Ther 304, 8\u0026ndash;14 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCarroll, J. A., Phillips, P. A., Park, S., Doherty, E., Pirola, R. C., Wilson, J. S. \u0026amp; Apte, M. V. Pancreatic stellate cell activation by ethanol and acetaldehyde: is it mediated by the mitogen-activated protein kinase signaling pathway. Pancreas 27, 150\u0026ndash;160 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eApte, M., McCarroll, J., Pirola, R. \u0026amp; Wilson, J. Pancreatic MAP kinase pathways and acetaldehyde. Novartis Found Symp 285, 200\u0026ndash;211; discussion 211\u0026ndash;216 (2007).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"epigenetics, DNA methylation, alcoholic pancreatitis, cooked rhubarb, factorial design","lastPublishedDoi":"10.21203/rs.3.rs-4016295/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4016295/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAlcohol abuse is known to be a precipitating risk factor for pancreatic cell injury in pancreatitis,but the exact mechanism of action is far from clear. In this study, a 2x2 factorial design was used to determine whether chronic alcohol exposure affect epigenetics modifications of inflammatory genes in pancreatic cells and the potential protective effects of cooked rhubarb in rats with alcoholic pancreatitis. First, two intervention pairs (chronic alcohol exposure and/or acute pancreatitis stimulation) will be compared in rats. Further analysis of two other intervention pairs (cooked rhubarb treatment and/or acute pancreatitis stimulation) will be performed in alcohol-exposed rats. We found that the combination of acute pancreatitis and chronic alcohol intake resulted in changes to DNA methylation levels, protein expression of IL-1αand IL-10, and induced pathological alterations in the pancreas(P\u0026lt;0.05). Furthermore, Additionally, alcohol-experienced rats treated with cooked rhubarb displayed some effectiveness in reversing these effects (P\u0026lt;0.05). From these experimental results, it can be justified that chronic ethanol exposure could induce epigenetic changes of inflammatory factors and exacerbate inflammatory damage in pancreatic cells,and cooked rhubarb may prevent the progression of alcoholic pancreatitis in rats.\u003c/p\u003e","manuscriptTitle":"Epigenetic modifications of inflammation in pancreas cells of rats with alcoholic pancreatitis and the protective effect of cooked rhubarb","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-27 08:29:21","doi":"10.21203/rs.3.rs-4016295/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"dbba26be-383f-42ae-bab4-8fda3012bb6b","owner":[],"postedDate":"March 27th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":29837802,"name":"Health sciences/Pathogenesis/Inflammation"},{"id":29837803,"name":"Health sciences/Diseases/Gastrointestinal diseases/Pancreatic disease"}],"tags":[],"updatedAt":"2024-04-17T04:46:53+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-27 08:29:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4016295","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4016295","identity":"rs-4016295","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}