Electroacupuncture Alleviates Neuroinflammation and Memory Dysfunction by Regulating Hippocampal Microglial α7nAChR in LPS-Induced Systemic Inflammation in Mice

Electroacupuncture Alleviates Neuroinflammation and Memory Dysfunction by Regulating Hippocampal Microglial α7nAChR in LPS-Induced Systemic Inflammation in Mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Electroacupuncture Alleviates Neuroinflammation and Memory Dysfunction by Regulating Hippocampal Microglial α7nAChR in LPS-Induced Systemic Inflammation in Mice Xiangmei Yu, Xiaomei Cheng, Yanyan Lan, Qiuling Huang, Honglin Chen, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4480515/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Cognitive impairment induced by systemic inflammatory diseases is associated with hippocampal microglial activation and central neuroinflammation. This paper investigated whether electroacupuncture (EA) stimulation exerts anti-inflammatory effects and improves cognitive impairment through the hippocampal microglial α7 receptor. Methods ES efficacy was evaluated with respect to microglial activation and cognitive dysfunction amelioration following lipopolysaccharide (LPS) intraperitoneal injection in mice. Behavioral testing of “what,” “where,” and “when” memories was used to observe spatial memory. Microglial α7 was knocked out by hybridization of α7nAchR fl/fl and Cx3Cr1 cre transgenic mice. Furthermore, the cholinergic transmission between medium septum (MS) and the hippocampus (HP) was studied using magnetic resonance spectroscopy to investigate the EA effects on the central cholinergic anti-inflammatory properties. Results EA can improve the spatial memory and increase the cholinergic level of the MS and promote the cholinergic transmission of MS–HP. EA also activated the cholinergic neurons of MS, increased the expression of microglial α7nAChR, and decreased the expression of Iba-1. The results of qPCR and enzyme-linked immunosorbent assay detection showed EA could reduce the expression of mRNA related to cytokine (IL-1β, iNOS, IL-10, Arg1, CD206, and TNF-α) in the HP. Hippocampal injection of a7 antagonist or specific knockout of microglia a7 can reverse the EA effects of anti-inflammatory properties and improve cognitive impairment. Conclusion EA treatment ameliorates system inflammation-induced cognitive decline mediated by hippocampal microglial α7 receptor, which displays cholinergic antineuroinflammation properties and improves cognitive function. Microglia α7nAChR Neuroinflammation Cognition Hippocampus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Systemic inflammation is a pathological process that occurs after infection, surgery, or trauma, which can affect the central nervous system, resulting in coma, delirium, and drowsiness ( 1 ). Clinical studies have found that acute and chronic systemic inflammation is associated with cognitive impairment and can aggravate the process of chronic neurodegenerative diseases, such as Alzheimer’s disease, Parkinson’s disease, and vascular cognitive impairment ( 2 – 4 ). Recent studies have reported that systemic inflammation caused by COVID-9 often results in cognitive impairment, which increases the burden of diagnosis and treatment of the disease ( 5 , 6 ). Brain damage induced by acute systemic inflammation is associated with long-term memory impairment. Neuroinflammation is the key pathophysiology of cognitive impairment induced by systemic inflammation, and peripheral inflammatory factors can directly or indirectly activate cerebral glial cells, thus affecting the homeostasis of the central nervous system ( 7 – 8 ). Microglia are the resident macrophages in the central nervous system, which act as the “first line of immune defense” in the brain ( 9 ). Under physiological conditions, microglia can remove damaged cells and toxic substances from the brain, thus maintaining the homeostasis of the environment ( 10 ). However, when microglia are overactivated and induce inflammatory cascades, they would secrete a large amount of inflammatory cytokine, which could cause central nervous system inflammation ( 11 , 12 ). Several studies have found that a large number of hippocampal microglia are activated in the state of systemic inflammation, and the function of learning and memory is seriously impaired ( 13 ). α7 nicotinic acetyl choline receptor (α7nAchR) is one of the main subtypes of the ligand gated ion channel receptor superfamily, which is widely distributed in the hippocampus (HP), and exerts neuroprotection in synaptic plasticity ( 14 – 16 ). α7nAchR is mainly expressed on the surface of immune cells such as microglia, participates in intersynaptic signal transmission and neurotransmitter release, and mediates cholinergic anti-inflammatory effects ( 17 ). Central cholinergic anti-inflammatory pathway refers to cholinergic neurons secreting acetylcholine, acting on microglial cholinergic receptors, changing intracellular signal pathways, and transforming their activated phenotypes, thereby reducing the level of central nervous inflammation ( 18 , 19 ). Hippocampal cholinergic neurons mainly originate from the projections of the medial septal (MS) of the basal forebrain, which refer to the recall of previous experience that contain specific temporal, spatial, and sequential information ( 20 ). Acupuncture is an effective means of traditional Chinese medicine to treat human diseases, which stimulates specific acupoints to regulate the state of the body. Studies have shown that electroacupuncture (EA) has neuroprotective and anti-inflammatory effects, which can improve the cognitive function of AD and VCI ( 21 , 22 ). EA can improve cognitive function by reducing inflammatory factors such as IL-1β, IL-6, and TNF-α in the central nervous system. Moreover, EA can activate the activity of neurons in multiple brain regions and regulate the activity of acetylcholinesterase in the brain (23, 24, 25 ). Previous research showed that targeted cervical vagus nerve stimulation reduced LPS induced cerebral systemic inflammation and improves cognitive responses ( 13 ). Our recent studies also found that 0.5 mA low-intensity electrical stimulation of ST36 acupoints can considerably improve the level of systemic inflammation by activating the dorsal nucleus of the vagus nerve ( 26 ). This paper explores the molecular mechanism of low-intensity EA at ST36 acupoints to improve cognitive function and exhibit anti-inflammatory properties on cognitive impairment induced by LPS, which might be mediated by α7nAChR on the surface of hippocampal microglia and regulated by improving the cholinergic transmission efficiency of MA. Material and methods Animals SPF grade C57BL/6 mice used in this study were provided by the Experimental Animal Center of Fujian University of Traditional Chinese Medicine. SPF grade Cx3Cr1-Cre/ERT2 mice, α7nAchR fl/fl mice, and ChAT-Cre mice were purchased from the Jackson Laboratory in the United States (Stock Numbers: 26965, 21160, and 6410). The mice were bred in the Experimental Animal Center of Fujian University of Traditional Chinese Medicine. They were given free access to water and food, the constant temperature was maintained at 23°C, and the duration of light and darkness followed the normal circadian rhythm. The progeny mice obtained by cross-breeding were subjected to DNA gene identification to obtain the transgenic mice required for this subject. All experimental animals in this study were approved by the Animal Experiment Ethics Committee of Fujian University of Traditional Chinese Medicine (animal ethics number 2020056). Animal experiments were performed in strict accordance with international animal protection laws and guidelines for the use of laboratory animals. Hybridization and gene identification The α7nAchR fl/fl mice were crossed with the Cx3Cr1-Cre/ERT2 mice to obtain the first generation of heterozygous transgenic mice with the genotype of α7nAchR fl/WT Cx3Cr1cre, and then the first generation mice were crossed with α7nAchR fl/fl mice to obtain the second generation of α7nAchR fl/fl Cx3Cr1cre transgenic mice. The ChAT-Cre transgenic mice were crossed with Ai-14 mice to obtain the first generation of ChAT-Cre/Ai-14 transgenic mice. The PCR gene identification operation of transgenic mice is as follows: First, when the mice were about 3 weeks old, the toes of the mice were cut according to the number and placed in the EP tube, and then the DNA extraction solution was added to the EP tube, and the DNA was extracted according to the steps. DNA was then amplified, The α7nAchR gene primer sequences Common, Wild type Reverse and Mutant Reverse are: GTC CCT CTG CTG GTA TTT GC; GAA CAA GTC AGA TAA GAA CCT; GCC CAA TTC CGA TCA TAT TC, the α7nAchR fl/WT heterozygous gene band is 241 bp, 320 bp double band, α7nAchR fl/fl gene band is 320 bp. Amplification procedure see table. Cx3Cr1cre gene primer sequences Common, Wild type Reverse and Mutant Reverse are: AAG ACT CAC GTG GAC CTG CT; CGG TTA AAC TTG CAC CA; AGG ATG TTG ACT TCC GAG TTG, Cx3Cr1-Cre heterozygous gene band is 300 bp, 695 bp double band, Cx3Cr1cre homozygous gene band is 300 bp. Amplification procedure see table. ChATcre gene primer sequences Common, Wild type Reverse and Mutant Reverse are: GCA AAG AGA CCT CAT CTG TGG A; CAG GGT TAG TAG GGG CTG AC; CAA AAG CGC TCT GAA GTT CCT, ChATcre heterozygous gene band It is 148 bp and 200 bp double bands, and the ChATcre homozygous gene band is 148 bp. The amplification procedure is shown in Table. According to the molecular weight, prepare a 1.2% agarose gel, put it in the electrophoresis solution, add samples to each well, and perform electrophoresis. After the electrophoresis, place the agarose gel on a luminescence imager to develop and observe the bands. ChATcre, Cx3Cr1cre and α7nAchR fl/fl gene bands were determined according to the molecular weight of Marker, and the results were recorded. LPS-induced cognitive impairment Establishment of systemic inflammation-induced cognitive impairment model mice The mice were anesthetized by isoflurane inhalation (1.5% isoflurane mixed with oxygen) and intraperitoneal injection of lipopolysaccharide (1 mg/kg) immediately. The remaining nonmodel group mice were intraperitoneally injected with the same volume of normal saline. EA treatment EA bilateral Zusanli (about 0.5 cm below the head of the fibula) and sterile Huatuo brand acupuncture needles (13 mm in length and 0.3 mm in diameter) were inserted into the acupuncture point about 1 mm. By connecting HANS 200E acupoint nerve stimulator (Nanjing Jisheng Medical Technology Co, Ltd.) and giving 10 Hz sparse and dense waves, the stimulation intensity was 0.5 Ma, 30 min/time. EA was implemented before modeling and behavioral testing. Behavioral tests The episodic memory behavior (what–when–where) was used to verify the effects of the EA treatment on HP-related learning and memory functions. The experiments were improved based on references, which were divided into an adaption period and a test period. The mice were placed in a 60 cm × 60 cm × 40 cm screen box. The first two days were the adaptation period before modeling. A formal test was conducted after modeling, the task was divided into three “5-minute” stages, and the interval time of each stage was 50–55 min, as shown in Fig. 1 A. In the first stage, four identical A objects were arranged in a triangle. In the second stage, four identical B objects were arranged in a square. In the final test stage, a new arrangement of objects was used, and the “B” objects (Recent B) was still in the corner. The first “A” object (called Stationary A) was stuck in one corner, while the 2nd A object (called Displaced A) was placed in the other corner. Video was recorded by a camera mounted above the test area, using a three-point dynamic tracking method to record the time of contact with each object. The location preference for the test phase was calculated as the “what” percent time, the “where” percent time, and the “when” percent time as follows: What = ((Stationary A + Displaced A)/2 − (Recent B1 + Recent B2)/2)/(Stationary A + Displaced A + Recent B1 + Recent B2); Where = (Displaced A − Stationary A)/(Displaced A + Stationary A); When = (Stationary A – (Recent B1 + Recent B2)/2)/(Stationary A + Recent B1 + Recent B2). Magnetic Resonance Spectroscopy Magnetic Resonance Spectroscopy (MRS) was used to analyze the choline levels in the MS of the basal forebrain and the HP. The mouse was subjected to rapid air anesthesia and quickly placed in supine position on a scanning bed. The head of the mouse was adjusted, and the tooth bar was tightened. During process, air anesthesia was maintained by administering 1.5% isoflurane mixed with oxygen. The hypothermia state of the mice under anesthesia was maintained through a water circulation heating system, and a physiological characteristic monitoring patch was placed on the abdomen to monitor the physiological state of the mice. A body temperature monitor was placed, the mice were observed to maintain their body temperature at 36°C–37°C, and their breathing rate was 50–60 times/min. The experimental data were collected by Bruker’s 9.4T small animal MRI (Bruker, BioSpec 94/30 T, Etlingen Company, Germany), the mouse head coil imaging was selected, and localization image scanning was performed to determine the mouse head position and image quality. In this study, the MS of the basal forebrain and the HP regions were used as scanning areas, and the ratio of the area under the Cho peak to the area under the Cr peak in the two brain regions (Cho/Cr) was calculated as the representative of the choline level. Stereotactic surgery After the mouse was quickly anesthetized, it was placed on a stereotaxic apparatus, the position of the mouse head was adjusted, the tooth rod and ear rod were fixed and tightened, and then hippocampal area (X: 1.1, Y: −1.8, Z: −1.2) positioning followed. After accurate positioning, a mark was made, and the skull was drilled at the mark. Then, the speed of the buried pipe device was adjusted through a stereotaxic instrument. The tube was slowly inserted into the HP and fixed with resin and glue, and the skin was sewed. After tube embedding was completed, the mice were returned to the cage to recover. Before the behavioral test, the mice were rapidly anesthetized by injection of methyllycaconitine (MLA) on the stereotaxic device through the tube embedding device. Immunohistochemistry The expression of Iba-1 and α7nAchR in the HP, the expression of C-Fos in the MS brain of the ChAT cre/Ai14 mice, and the expression of α7nAchR in the HP of the α7nAchR fl/* /Cx3Cr1cre mice were tested by immunofluorescence staining. After the behavioral test, the rats were anesthetized immediately by intraperitoneal injection of 5% sodium pentobarbital. The saline and paraformaldehyde were precooled in advance, slowly perfused with 30 mL of saline, and then slowly inject with 30 mL of 4% paraformaldehyde. The whole mouse brain was then removed, immersed in 4% paraformaldehyde, fixed at 4°C overnight, replaced with 15% sucrose for dehydration the next day, and replaced with 30% sucrose for secondary dehydration. after sinking to the bottom, the sections were embedded in a cryostat with a thickness of 10 µm, and the cut tissue pieces were attached to the glass slide. When staining, the tissue samples were washed three times with PBST (PBS and Tween 20 prepared as 5% PBST) for 10 min each time, washed once with 0.1 M PBS for 10 min, and placed on a shaking table at 37°C. The water around the tissue was dried (the tissue was kept moist throughout the process), the blocking solution was dropped into trash can, and placed the box in an incubator at 37°C for 1 h. Then, the blocking solution was removed with filter paper, without washing, goat antimouse Iba-1 primary antibody (1:200), goat anti-rabbit α7nAchR primary antibody (1:200), and goat anti-rabbit C-fos primary antibody (1:200) was added, then placed in a wet box at 4°C overnight. The next day, the slides were washed again in the same way, and the water was wiped off. Then, biotin-labeled donkey antigoat secondary antibody (1:500) and donkey antirabbit secondary antibody (1:500) were added dropwise and incubated at 37°C for 1 h. The slides were washed again, the moisture around the tissue was wiped off, and the mounting medium containing DAPI was dropped. The slides were covered, developed with a fluorescence microscope, and recorded. Western blot After the mice were anesthetized, the hippocampal region was quickly removed and placed in liquid nitrogen to prevent the destruction of protein components. First, protein extraction and quantification were carried out. The hippocampal tissue of each group was taken out and weighed 30 ug. Magnetic beads and lysis buffer were added for protein lysis. The quantification and balance were carried out according to the ratio of the kit, and the protein was placed into a metal bath for denaturation. The experimental operation for determining the protein concentration was as follows: The stacking gel and separating gel were prepared according to the molecular weight of the protein. After solidification, the gel plate was placed in an electrophoresis box, and protein was added to the gel hole. Marker is set on both sides, and then electrophoresis was performed. After electrophoresis, protein was transferred to the PVDF membrane. The PVDF membrane was subjected to blocking with 5% milk for 1 h, the band was washed with TBST, the prepared GAPDH (1:8000) was added, and the primary antibody with α7nAchR (1:2000) antibody was incubated and shaken at 4°C overnight. After washing the band in the same way the next day, the secondary antibody (1:5000) was incubated at room temperature for 1 h, and then the band was washed in the same way. Finally, the developer solution was dropped on the strip, and protein band were placed on the protein developer for development. The results were obtained and analyzed. ELISA The changes of α7nAchR, IL-1β, Arg1, CD206, IL-10, and iNOS contents in the HP were tested by using an enzyme-linked immunosorbent assay (ELISA) kit. The operation method was as follows: First, samples were added to the enzyme-labeled wells, and standard and test samples were added to each well. The samples were mixed well and placed at 37°C for 40 min. The reaction plate was cleaned with a washing solution and dried. Distilled water and primary antibody working solution were added to each well, mixing well and placing at 37°C for 20 min. After washing in the same way, antibody working solution was added, washing again and adding substrate working solution, which was placed in the dark at 37°C for 15 min. Finally, the stop solution was added and mixed, and the absorbance value was measured at 450 µm wavelength of the microplate reader within 30 min. The standard curve was drawn, and the corresponding α7nAchR, IL-1β, Arg1, CD206, IL-10, and iNOS contents were calculated according to the sample A value. Isolation of total RNA and quantitative PCR TNF-α mRNA Expression in the HP was detected by PCR. The operation method was as follows: First, 120 ug of hippocampal tissue was placed into a grinding tube containing magnetic beads, and lysate was added to each tube, ground, and pulverized. After high-speed centrifugation, the supernatant was taken into an EP tube, chloroform was added, vigorously shaken, and then centrifuged. The supernatant RNA was taken, an equal volume of isopropanol was added, mixed, and allowed to stand at 4°C for 10 min. The waste liquid was discarded after centrifugation again to obtain a white precipitate. Alcohol was added. The bottom of the tube was flicked to make the precipitate float, it was inverted and mixed several times, and allowed to stand still at room temperature for 3–5 min. After centrifugation again, the supernatant was discarded. The precipitate was dried for 3 min, an appropriate amount of RNase-free water was added, and it was stored at − 80°C in a refrigerator. After mixing the extracted RNA samples and 1× loading buffer, the samples were loaded, and the parameters of the electrophoresis apparatus were set to 200 v for 10 min to perform electrophoresis. According to the mRNA sequence of the TNF-α gene and the GAPDH of the corresponding species as the internal reference gene, the synthetic primer sequences was as follows: TNF-α F: 5GCCCGATGGGTTGTACCTTGT3; TNF-αR: 5TCTTGACGGCAGAGAGGAGG3; GAPDH F: 5TGGAAAGCTGTGGCGTGATG3; GAPDH R: 5TACTTGGCAGGTTTCTCCAGG3. The RNA was subjected to concentration determination and quantification, followed by QPCR amplification to obtain the results. Statistical analysis All experimental data in this study were analyzed using SPSS 23.0 statistical software, and data were expressed as mean ± SEM. MS cholinergic neuron activation fluorescence data and hippocampal α7nAchR knockout protein validation data were used samples in the t-test, one-way analysis of variance was used for the rest of the data, and pairwise comparisons were performed using the LSD method when the variances were equal. Then, Dunnett’s T3 method was used for pairwise comparison when the variances were unequal. Results EA can improve the behavioral impairment of episodic memory induced by LPS, while hippocampal α7nAChR antagonism and microglial receptor α7 knockout can reduce the effect of EA. The “what–when–where” behaviors were used to detect three components of episodic memory (Fig. 1A), “what” was explored, “where” was investigated, and “when” was examined relative to adjacent events (13). Compared to the control group, the time percentages of the what, where, and when of episodic memory decreased substantially in the LPS-treated mice. Compared with the model group, EA treatment could improve the ability of recognizing novel objects and changes in object timing in the “what” and “when” tests but could not affect the recognition ability of its position change (Fig. 1B). Hippocampal stereotaxic injection technology was applied to inject a7 receptor antagonist (MLA) into the HP to observe its effect on EA. Compared with the EA group, the hippocampal injection of MLA greatly reduced the ability to recognize new objects and changes in timing (Fig. 1C). Moreover, α7 receptor was applied on the surface of the microglia gene knockout technology to observe the changes of cognitive behavior after knockout of receptor a7 on the surface of microglia. The episodic memory behavioral results showed the knockout of microglia surface receptor α7 could greatly reduce the effect of EA (Fig. 1D). These results indicated that EA exerted its memory-improving effects mainly through hippocampal microglia a7 receptors. EA can activate the MS cholinergic neurons and promote MS–HP cholinergic anti-neuroinflammation transmission. Based on the episodic memory behavior test results, whether the alterations in episodic memory behavior were correlated with the MS–HP cholinergic anti-neuroinflammation circuit was investigated. The expression levels of C-fos in cholinergic neurons in the MS regions of mice in the EA group and the non EA group were compared. The coexpression of c-fos (green fluorescence) and cholinergic neurons (red fluorescence) in the MS is shown in Fig. 2A. Compared with the non EA group, the number of cholinergic neurons coexpressed with C-fos was considerably increased in the EA group. Compared with the control group, the cholinergic content (Cho/Cr) of the MS and HP detected by MRS scanning decreased after LPS stimulation. In addition, the MRS results showed the cholinergic content (Cho/Cr) of the MS and HP in the mice of EA group substantially increased compared with the model group (Figs. 2B and 2C). These results showed EA can simultaneously increase the MS and hippocampal cholinergic level, which may promote the MS-hippocampus cholinergic transmission. EA increases the expression of surface receptorα7 in hippocampal microglia. Previous studies showed the α7 receptor is one of the important components in the cholinergic system and is closely related to neuroinflammation. Enzyme-linked immunosorbent assay and Western blot were used to observe changes of the α7 receptor in the HP. Both results showed that compared with the control group, the expression of the hippocampal α7 receptor of the model mice was greatly reduced, while EA could increase the expression of the a7 receptor protein in the HP (Figs. 3A and 3B). Immunofluorescence was used to detect the expression of the hippocampal α7 receptor on the surface of microglia and observe the activation number of microglia. The co-expression of α7 receptors (red fluorescence) and microglia (green fluorescence) in the HP by immunofluorescence is shown in Fig. 3C. Compared with the control group, the expression of the hippocampal α7 receptors in the model group was substantially reduced on the surface of microglia, and the activation of microglia was greatly increased. EA can increase hippocampal α7 receptors on the surface of microglia and reduce the activation of microglia. Verification of α7nAchR fl/fl Cx3Cr1cre gene knockout mouse To explore further the related mechanisms of EA in the improvement of the model, α7 receptor was applied on the surface of the microglia gene knockout technology to observe the changes of cognitive behavior and hippocampal neuroinflammation after knockout of receptor a7 on the surface of microglia. First, a mouse knockout of the microglia surface receptor a7 was constructed, the Cx3Cr1cre mouse was crossed with the α7nAchR fl/fl mouse, and our target gene mouse α7nAchR fl/fl Cx3Cr1cre was obtained in the third generation (Fig. 4A). When the target gene mice became adults, intraperitoneal injection of tamoxifen induced a7 receptor conditional knockout. To identify the success of the gene knockout, Western blot and immunofluorescence were carried out to confirm that the a7 receptor protein content in the HP of the knockout mice was greatly reduced, and no a7 receptor expression was on the surface of microglia (Figs. 4B and C). This outcome meant gene knockout was successful. The mice in the control group were tested with negative mice in the same litter. EA can reduce the expression of Iba-1 and reduce neuroinflammation in the HP, which can be blocked by the hippocampal injection of MLA and microglial surface receptor α7 knockout. The behavioral decline of episodic memory induced by LPS is related to hippocampal neuroinflammation. Immunofluorescence and RT-qPCR were used to detect the expression of hippocampal Iba-1 and the mRNA expression of neuroinflammation-related factors. The results showed that compared with the control group, the expression levels of Iba-1, pro-inflammatory factors IL-1β, CD206, and iNOS in the HP brain, while the expression levels of anti-inflammatory factors IL-10 and Arg1 greatly decreased. EA can inhibit the expression of Iba-1, IL-1β, CD206, and iNOS, and promote the expression levels of IL-10 and Arg1 (Figs. 5A and B). EA also could decrease the hippocampal TNF-α mRNA, which would be reversed by the hippocampal injection of α7 antagonist MLA or knockout of microglia surface receptor α7 (Fig. 5C). Discussion Systemic inflammation is accompanied by systemic infection, postoperative trauma, and other pathological processes such as COVID-19 infection ( 27 , 28 ), which seriously affect the cognition of patients ( 29 ). Therefore, finding an effective prevention and treatment of cognitive impairment caused by systemic inflammation is an urgent problem. EA is an effective nondrug therapy in traditional Chinese medicine. EA is a supplement to replace medical technology, which is widely used for treating inflammatory diseases and cognitive impairment ( 30 , 31 ). EA can remarkably improve learning and memory through the central cholinergic anti-inflammatory pathway ( 32 , 33 ). Our previous experimental results showed low-intensity EA at ST36 acupoints can effectively reduce systemic inflammation in mice with sepsis ( 26 ). On this basis, this paper further explored the effects of EA at ST36 acupoints on systemic inflammation inducing cognitive impairment. First, this paper revealed the molecular mechanism of low-intensity EA at bilateral ST36 to improve cognitive impairment induced by LPS, which was related to activating the cholinergic system through hippocampal α7nAChR. The systemic inflammation induced by LPS is widely used in the field of central nervous system research, and LPS can directly activate microglia to release a series of neurotoxic factors, resulting in neuronal death ( 34 , 35 ). Glial toll-like receptor4 (TLR4) is the main receptor of LPS, which can induce activate the NF-κB signal pathway and promote the production of inflammatory factors ( 36 , 37 ). Our study results confirmed the cognitive impairment induced by systemic inflammation is hippocampal dependent, characterized by the behavioral impairment of episodic memory. In the “what–when–where” of the episodic memory behavior test, EA can effectively improve the memory of new objects and sequence in mice with cognitive impairment induced by systemic inflammation. Episodic memory refers to the recall of previous experiences containing specific object, spatial, and sequential information, which requires the coordination of multiple brain regions. Chemical genetic inhibition of the circuit of the MS–HP can destroy episodic memory ( 13 , 20 ). Whether EA improves episodic memory induced by systemic inflammation through affecting the MS–HP cholinergic circuit remains to be explored. Neuroinflammation can lead to neuronal damage and death in the brain, which is one of the key pathogenesis of cognitive disorders ( 38 ). Microglia are the immune cells of the brain, derived from myeloid origin, which are related to the innate immune response of the brain ( 39 ). Overactivation of microglia can cause neuroinflammation, leading to neuronal death and cognitive degradation in several cognitive disorders diseases ( 40 – 44 ). In our experiment, when intraperitoneal injection of LPS induced cognitive impairment, microglia active biomarkers (Iba-1) in the HP were increased substantially, which triggered the release of inflammatory cytokines such as IL-1β and TNF-α ( 45 , 46 ). Consistent with other studies, LPS resulted in hippocampal neuroinflammation. EA could improve the behavior of episodic memory and reduce the activation of microglia and the level mRNA of inflammatory cytokines in the HP. Tracey’s research showed that vagus nerve stimulation can inhibit considerably and rapidly the release of macrophage TNF-α and attenuate systemic inflammatory responses via the classic peripheral and central “cholinergic anti-inflammatory pathway” ( 47 – 48 ). Some studies found that the cholinergic activity of the HP is mainly derived from the MS, which can inhibit hippocampal neuroinflammation ( 49 ). In this experiment, MRS detection showed the cholinergic content was substantially decreased in the HP and MS when suffering cognitive impairment by LPS, which may promote hippocampal neuroinflammation ( 50 ). An effective stimulation method to drive the vagal–adrenal anti-inflammatory axis in systemic inflammatory mice, EA at the hindlimb ST36 acupoint can increase the cholinergic transmission level of the MS–HP and activate cholinergic neurons in the MS, which were beneficial for suppressing neuroinflammation. α7nAChR is expressed in neurons and non-neuronal cells in the brain, among which it is highly expressed in the HP. It is related to various neurological diseases and neurodegenerative diseases ( 51 ). Studies have shown that nicotine or Ach can inhibit LPS-induced TNF-α production and microglial activation by activating α7nAChR ( 52 ). α7nAChR activation protects microglia by alleviating neuroinflammatory response ( 53 ). Therefore, α7nAChR is an important receptor for improving cognitive impairment induced by systemic inflammation. Our results found that the expression of hippocampal α7nAChR was considerably decreased in the LPS-induced cognitive impairment, which played an important role in the regulation of neuroinflammation. Previous studies showed EA can upregulate the expression of α7nAChR and inhibit the inflammatory response when suffering from cerebral ischemia injury or cognitive impairment after an operation ( 54 – 56 ). To explore the anti-inflammatory mechanism of central and hippocampal α7nAChR further, this paper used injection of α7nAChR antagonist into the HP or specific knockout of microglia α7, which could block or weaken the central anti-inflammatory effect of EA. The results showed EA can reduce neuroinflammation and improve cognitive function mainly through the cholinergic receptor α7nAChR on microglia. Conclusion Our findings confirm the 0.5 mA intensity EA at ST36 acupoints, which was verified as an effective stimulation of vagus nerve excitation, may improve the episodic memory impairment and play an anti-inflammatory role by promoting cholinergic nerve fiber transmission between the MS and the HP, increasing the release of the MS acetylcholine, and activating microglial α7nAChR during systemic inflammation. This key research conclusion would provide an important theoretical basis for clinical application of EA to improve cognitive impairment related to systemic inflammation in the future. Abbreviations EA electroacupuncture LPS Lipopolysaccharide MS medium septum HP Hippocampus α7nAchR α7 nicotinic acetyl choline receptor MRS Magnetic Resonance Spectroscopy MLA methyllycaconitine Declarations Ethics approval and consent to participate This study was approved by the Ethical Committee on Animal Experimentation, Fujian University of Traditional Chinese Medicine (FJTCMIACUC 2020056). Competing interests Not applicable. Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. The datasets supporting the conclusions of this article are included within the article and its additional files. Competing interests The authors declare that they have no conflicts of any commercial or fnancial relationships that could be construed as a potential competing interests. All authors gave their consent to the publication of the article. Funding This study was jointly supported by the National Natural Science Foundation of China (82274658), the Natural Science Foundation of Fujian Province (2022J01347), the Medical Innovation Project of Fujian Provincial Health Commission (2022CXA053)., the National Key Research and Development Program of China (2022YFC2009700), and Fujian Province Young and Middle aged Teacher Education Research Project (JAT220116). Authors’ contributions Zhifu Wang carried out the project design, and drafted the part of manuscript. Xiaomei Chen were involved in the animal experiment and analysis the data. Yanyan Lan and Qiuling Huang were participated in some experiments and data analysis. Lina Pang and Honglin Chen were assisted in completing the experiment. Zhifu Wang, weiquan Zeng and Jiehui Fu are the co-corresponding authors and they completed the project design and proofread the manuscript. Xiangmei Yu and Xiaomei Chen made an equal contribution to this research. All authors read and approved the final manuscript. Acknowledgements I would like to express my sincere gratitude to all those who participated in this paper, as well as the National Natural Science Foundation of China and the Science and technology platform construction project of Fujian Science and Technology Department. References Zhao L, Song Y, Zhang Y (2022) HIF-1α/BNIP3L induced cognitive deficits in a mouse model of sepsis-associated encephalopathy. Front Immunol 13:1095427 Beydoun M, Dore G, Canas J (2018) Systemic Inflammation Is Associated With Longitudinal Changes in Cognitive Performance Among Urban Adults. Front Aging Neurosci 10:313 Lai K, Liu C, Rau A (2017) Peripheral inflammatory markers in Alzheimer's disease: a systematic review and meta-analysis of 175 studies. J Neurol Neurosurg Psychiatry 88(10):876–882 Pajares M, Rojo I, Manda A (2020) G. Inflammation in Parkinson's Disease: Mechanisms and Therapeutic Implications. Cells ; 9(7) Ceban F, Ling S, Lui L (2022) Fatigue and cognitive impairment in Post-COVID-19 Syndrome: A systematic review and meta-analysis. Brain Behav Immun 101:93–135 Soung A, Vanderheiden A, Nordvig A (2022) COVID-19 induces CNS cytokine expression and loss of hippocampal neurogenesis. Brain 145(12):4193–4201 Ji M, Lei L, Gao D (2022) Neural network disturbance in the medial prefrontal cortex might contribute to cognitive impairments induced by neuroinflammation. Brain Behav Immun 89:133–144 Skelly D, Griffin É, Murray C (2019) Acute transient cognitive dysfunction and acute brain injury induced by systemic inflammation occur by dissociable IL-1-dependent mechanisms. Mol Psychiatry 24(10):1533–1548 Borst K, Dumas A, Prinz MJI (2021) Microglia: Immune and non-immune functions. Immunity 54(10):2194–2208 Augusto-Oliveira M, Arrifano G, Delage C (2022) Plasticity of microglia. Biol Rev Camb Philos Soc 97(1):217–250 Skaper S, Giusti P, Facci LJFFASEB (2012) Microglia and mast cells: two tracks on the road to neuroinflammation. FASEB J 26(8):3103–3117 Yang X, Xu S, Qian Y (2017) Resveratrol regulates microglia M1/M2 polarization via PGC-1α in conditions of neuroinflammatory injury. Brain Behav Immun 64:162–172 Huffman W, Subramaniyan S, Rodriguiz R (2019) Modulation of neuroinflammation and memory dysfunction using percutaneous vagus nerve stimulation in mice. Brain Stimul 12(1):19–29 Noviello C, Gharpure A, Mukhtasimova N (2021) Structure and gating mechanism of the α7 nicotinic acetylcholine receptor. Cell 184(8):2121–34e13 Kabbani N, Nichols RJT (2018) Beyond the Channel: Metabotropic Signaling by Nicotinic Receptors. Trends Pharmacol Sci 39(4):354–366 Fabian-Fine R, Skehel P, Errington M (2001) Ultrastructural distribution of the alpha7 nicotinic acetylcholine receptor subunit in rat hippocampus. J Neurosci 21(20):7993–8003 Mizrachi T, Vaknin-Dembinsky A, Brenner T (2021) Neuroinflammation Modulation via α7 Nicotinic Acetylcholine Receptor and Its Chaperone, RIC-3. Molecules. ; 26(20) Parada E, Egea J, Buendia I (2013) The microglial α7-acetylcholine nicotinic receptor is a key element in promoting neuroprotection by inducing heme oxygenase-1 via nuclear factor erythroid-2-related factor 2. Antioxid Redox Signal 19(11):1135–1148 Kelly M, Breathnach C, Tracey K (2022) Manipulation of the inflammatory reflex as a therapeutic strategy. Cell Rep Med 3(7):100696 Jin T, Chen R, Shao M (2020) Dorsal hippocampus- and ACC-projecting medial septum neurons differentially contribute to the recollection of episodic-like memory. FASEB J 34(9):11741–11753 Zheng X, Lin W, Jiang Y (2021) Electroacupuncture ameliorates beta-amyloid pathology and cognitive impairment in Alzheimer disease via a novel mechanism involving activation of TFEB (transcription factor EB). Autophagy 17(11):3833–3847 Dai Y, Zhang Y, Yang M (2022) Electroacupuncture Increases the Hippocampal Synaptic Transmission Efficiency and Long-Term Plasticity to Improve Vascular Cognitive Impairment. Mediators Inflamm. :5985143 Feng P, Deng P, Liu L Electroacupuncture Alleviates Postoperative Cognitive Dysfunction in Aged Rats by Inhibiting Hippocampal Neuroinflammation Activated via Microglia/TLRs Pathway. Evid Based Complement Alternat Med. 2017:6421260 Cai M, Lee J, Yang EJJ (2019) Electroacupuncture attenuates cognition impairment via anti-neuroinflammation in an Alzheimer's disease animal model. J Neuroinflammation 16(1):264 Lee B, Sur B, Shim J (2014) Acupuncture stimulation improves scopolamine-induced cognitive impairment via activation of cholinergic system and regulation of BDNF and CREB expressions in rats. 2014. BMC Complement Altern Med 14:338 Liu S, Wang Z, Su Y (2020) Somatotopic Organization and Intensity Dependence in Driving Distinct NPY-Expressing Sympathetic Pathways by Electroacupuncture. Neuron 108(3):436–50e7 George P, Reed A, Desai S (2022) A persistent neutrophil-associated immune signature characterizes post-COVID-19 pulmonary sequelae. Sci Transl Med 14(671):eabo5795 Taquet M, Geddes J, Husain M (2021) 6-month neurological and psychiatric outcomes in 236 379 survivors of COVID-19: a retrospective cohort study using electronic health records. Lancet Psychiatry 8(5):416–427 Gao Q, Hernandes MS (2021) Sepsis-Associated Encephalopathy and Blood-Brain Barrier Dysfunction. Inflammation 44(6):2143–2150 Zhang Z, Man S, Yam L (2020) Electroacupuncture trigeminal nerve stimulation plus body acupuncture for chemotherapy-induced cognitive impairment in breast cancer patients: An assessor-participant blinded, randomized controlled trial. Brain Behav Immun 88:88–96 Zhang Y, Zheng L, Deng H (2022) Electroacupuncture Alleviates LPS-Induced ARDS Through α7 Nicotinic Acetylcholine Receptor-Mediated Inhibition of Ferroptosis. Front Immunol 13:832432 Liu W, Zhuo P, Li L (2017) Activation of brain glucose metabolism ameliorating cognitive impairment in APP/PS1 transgenic mice by electroacupuncture. Free Radic Biol Med 112:174–190 Peng W, Zhao H, Liu Z (2007) Acupuncture for vascular dementia. Cochrane Database Syst Rev. ; (2):CD004987 Noh H, Jeon J, Seo HJN (2014) Systemic injection of LPS induces region-specific neuroinflammation and mitochondrial dysfunction in normal mouse brain. Neurochem Int 69:35–40 Terrando N, Rei Fidalgo A, Vizcaychipi M (2010) The impact of IL-1 modulation on the development of lipopolysaccharide-induced cognitive dysfunction. Crit Care 14(3):R88 Lu Y, Yeh W, Ohashi PJC (2008) LPS/TLR4 signal transduction pathway. Cytokine 42(2):145–151 Gong Q, He L, Wang M (2019) Comparison of the TLR4/NFκB and NLRP3 signalling pathways in major organs of the mouse after intravenous injection of lipopolysaccharide. Pharm Biol 57(1):555–563 Moonen S, Koper M, Van Schoor E (2023) Pyroptosis in Alzheimer's disease: cell type-specific activation in microglia, astrocytes and neurons. Acta Neuropathol 145(2):175–195 Chen X, Holtzman DJI (2022) Emerging roles of innate and adaptive immunity in Alzheimer's disease. Immunity 55(12):2236–2254 Leng F, Hinz R, Gentleman S (2023) Neuroinflammation is independently associated with brain network dysfunction in Alzheimer's disease. Mol Psychiatry 28(3):1303–1311 Wu Z, Nakanishi HJJ (2014) Connection between periodontitis and Alzheimer's disease: possible roles of microglia and leptomeningeal cells. J Pharmacol Sci 126(1):8–13 Lavisse S, Goutal S, Wimberley C (2021) Increased microglial activation in patients with Parkinson disease using [F]-DPA714 TSPO PET imaging. Parkinsonism Relat Disord 82:29–36 Luo G, Wang X, Cui Y, Cao Y, Zhao Z, Zhang J (2021) Metabolic reprogramming mediates hippocampal microglial M1 polarization in response to surgical trauma causing perioperative neurocognitive disorders. J Neuroinflammation. ; 13;18(1):267 Liu Y, Zhang Y, Zheng X et al (2018) Galantamine improves cognition, hippocampal inflammation, and synaptic plasticity impairments induced by lipopolysaccharide in mice. J Neuroinflammation 15(1):112 Wang C, Fan L, Khawaja R (2022) Microglial NF-κB drives tau spreading and toxicity in a mouse model of tauopathy. Nat Commun 13(1):1969 Lopez-Rodriguez A, Hennessy E, Murray C (2021) Acute systemic inflammation exacerbates neuroinflammation in Alzheimer's disease: IL-1β drives amplified responses in primed astrocytes and neuronal network dysfunction. Alzheimers Dement 17(10):1735–1755 Wang H, Yu M, Ochani M (2003) Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator of inflammation. Nature 421(6921):384–388 Piovesana R, Salazar Intriago M, Dini L (2021) Cholinergic Modulation of Neuroinflammation: Focus on α7 Nicotinic Receptor. Int J Mol Sci. ; 22(9) Mineur Y, Mose T, Vanopdenbosch L (2022) Hippocampal acetylcholine modulates stress-related behaviors independent of specific cholinergic inputs. Mol Psychiatry 27(3):1829–1838 Kékesi O, Liang H, Münch G (2019) The differential impact of acute microglia activation on the excitability of cholinergic neurons in the mouse medial septum. Brain Struct Funct 224(7):2297–2309 Letsinger A, Gu Z, Yakel JJT (2022) α7 nicotinic acetylcholine receptors in the hippocampal circuit: taming complexity. Trends Neurosci 45(2):145–157 Xia Y, Wu Q, Mak S (2022) Regulation of acetylcholinesterase during the lipopolysaccharide-induced inflammatory responses in microglial cells. FASEB J 36(3):e22189 Han Y, Qin X, Zhang T (2018) Electroacupuncture prevents cognitive impairment induced by lipopolysaccharide via inhibition of oxidative stress and neuroinflammation. Neurosci Lett 683:190–195 Liu J, Li C, Peng H (2017) Electroacupuncture attenuates learning and memory impairment via activation of α7nAChR-mediated anti-inflammatory activity in focal cerebral ischemia/reperfusion injured rats. Exp Ther Med 14(2):939–946 Liu P, Zhou Y, Zhang Y (2017) Electroacupuncture alleviates surgery-induced cognitive dysfunction by increasing α7-nAChR expression and inhibiting inflammatory pathway in aged rats. Neurosci Lett 659:1–6 Ma Z, Zhang Z, Bai F (2019) Electroacupuncture Pretreatment Alleviates Cerebral Ischemic Injury Through α7 Nicotinic Acetylcholine Receptor-Mediated Phenotypic Conversion of Microglia. Front Cell Neurosci 13:537 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4480515","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":312433653,"identity":"3c7722fe-9bf9-4e51-8774-351e456c0f3e","order_by":0,"name":"Xiangmei Yu","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiangmei","middleName":"","lastName":"Yu","suffix":""},{"id":312433654,"identity":"edd6529c-33e7-4963-88ef-1f1a1787c349","order_by":1,"name":"Xiaomei Cheng","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiaomei","middleName":"","lastName":"Cheng","suffix":""},{"id":312433655,"identity":"f2b77811-c11b-49bb-ba82-094ba750e9e9","order_by":2,"name":"Yanyan Lan","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yanyan","middleName":"","lastName":"Lan","suffix":""},{"id":312433658,"identity":"4c5a4d03-60df-4eb0-9fdd-8b10bd119ce1","order_by":3,"name":"Qiuling Huang","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qiuling","middleName":"","lastName":"Huang","suffix":""},{"id":312433660,"identity":"cade4751-4426-43d2-9544-ceecfae04cdc","order_by":4,"name":"Honglin Chen","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Honglin","middleName":"","lastName":"Chen","suffix":""},{"id":312433661,"identity":"7392871a-142f-4074-9cb0-4afb702e1ab1","order_by":5,"name":"Lina Pang","email":"","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lina","middleName":"","lastName":"Pang","suffix":""},{"id":312433662,"identity":"758816eb-faa0-473c-815f-e68e6bd898fb","order_by":6,"name":"Jiehui Fu","email":"","orcid":"","institution":"Fujian University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jiehui","middleName":"","lastName":"Fu","suffix":""},{"id":312433663,"identity":"e127ffc7-58fe-4ac2-86d2-a5c04a71a721","order_by":7,"name":"Weiquan Zeng","email":"","orcid":"","institution":"Fujian University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Weiquan","middleName":"","lastName":"Zeng","suffix":""},{"id":312433669,"identity":"4ed60f8e-448c-468c-967b-702f2f3f39a6","order_by":8,"name":"Zhifu Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIie3QMUsDMRTA8RcC6fKga0qpfoVXAnYp+lWuFNolBUfHgwO7HJ3Pb3HfwFcC16XQtYODLjcfujiIGq2DU+5GwfyHDOH9CC8AsdgfrC/F+jWh97Neyt8XIm0jg3XGurlmg+w6EtpXyaBoeJaz7EjgaMkgPSxzcdg+H2E6KlnWjyEhCktzpHqVg5NDCwtTsppQiEhtySHJ1T04JS24WcmodIgobceZJ0s8kY92gljNRUEu+SHcTnQvq6ChxdjvYoZ+L3Pn1EWQXDlxC8nb9Bz19unF3lyONrusDpJf77E/vr5Kdpv39dPOo7FYLPbP+gTuKUud7IOUgAAAAABJRU5ErkJggg==","orcid":"","institution":"Fujian University of Traditional Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Zhifu","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-05-26 14:53:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4480515/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4480515/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":58226475,"identity":"f67eacb0-709e-47d5-b727-8fb5fe30289e","added_by":"auto","created_at":"2024-06-12 18:03:22","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":162950,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntagonism of α7nAChR in hippocampal and selective knockout of microglia surface receptor α7nAChR affect the improvement of LPS-induced epidemic memory deficiency by electroacupuncture.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) schematic diagram of episodic memory behavior test. (B)The time percentages of What, Where and When of episodic memory decreased significantly, but electroacupuncture could only improve the time percentage of What and When of episodic memory.（C）Injection of α7nAChR antagonist (MLA) into hippocampal significantly reduced the effect of EA on What and When time percentage in episodic memory.（D）Selective knockout of microglia surface receptor α7nAChR significantly reduced the improvement effect of EA on What and When time percentage of episodic memory behavior. All data are presented as the mean ± S.D. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, n = 8/group.\u003c/p\u003e","description":"","filename":"FIgure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4480515/v1/913ce7f4521270b36340eec8.jpg"},{"id":58226478,"identity":"77513913-91cc-4459-8472-5ddca86d37f5","added_by":"auto","created_at":"2024-06-12 18:03:22","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":156292,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eElectroacupuncture activates cholinergic anti-inflammatory pathway in MS-HP\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e（A）Electroacupuncture activates cholinergic neurons in MS，representative photomicrographs of immunofluorescence co-staining for cholinergic neurons and C-fos in the MS of WT and EA mice. Scale bar, 200 μm. （B）Display of brain localization of HP and MS by MRS scan，Green Square.（C）The 9.4T MRS results showed that EA increased the cholinergic content of MS brain in mice. n = 6/group.（D）The 9.4T MRS results showed that EA increased the cholinergic content of hippocampus in mice. the ratio of the area under the Cho peak to the area under the Cr peak in the two brain regions (Cho/Cr) was calculated as the representative of the choline level. n = 6/group. All data are presented as the mean ± S.D. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"FIgure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4480515/v1/5968305ca5388d8bb2ee65b3.jpg"},{"id":58226860,"identity":"82b0b9bc-2f90-4424-b82d-046bf12d64f2","added_by":"auto","created_at":"2024-06-12 18:11:22","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":157773,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEA increases the expression of cholinergic receptor α7nAChR in hippocampus and reduces the activation of microglia\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e（A）Relative expression of α7nAChR by RT-qPCR, the result showed that EA increases α7nAChR mRNA expression in hippocampus. （B） Western blot analysis of the protein levels, the result showed that EA increases α7nAChR protein expression in hippocampus. Protein levels were normalized to GAPDH. （C）EA increased the expression of receptor α 7 protein on the surface of hippocampal microglia and decreased the number of microglia activated. representative photomicrographs of immunofluorescence co-staining for microglia and α7nAChR in the hippocampus. Scale bar, 200 μm. All data are presented as the mean ± S.D. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001. n = 3/group.\u003c/p\u003e","description":"","filename":"FIgure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4480515/v1/9299c2055287f7752a8de6ac.jpg"},{"id":58226859,"identity":"9f71ac1c-6ee8-48b8-8406-4bf62d700b13","added_by":"auto","created_at":"2024-06-12 18:11:22","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":124766,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVerification of microglia surface receptor α 7 knockout in hippocampal of mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e（A）Schematic diagram of Loxp-Cre gene editing technique（B）Western blot analysis of the protein levels, the result showed that The content of α7nAChR in hippocampus decreased significantly after knockout. The data is presented as the mean ± S.D. ***p \u0026lt; 0.001. n = 3/group.（C）The microglia surface receptor of α7 in hippocampal was significantly lost after α7nAChR specific knockout. resentative photomicrographs of immunofluorescence co-staining for microglia and α7nAChR in the hippocampus. Scale bar, 200 μm.\u003c/p\u003e","description":"","filename":"FIgure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4480515/v1/8e3a231c968605c3f89a30fb.jpg"},{"id":58226479,"identity":"7e723b9d-3ade-43ad-95a7-154329afba8c","added_by":"auto","created_at":"2024-06-12 18:03:22","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":179258,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAntagonism of α7nAChR in hippocampal and selective knockout of microglia surface receptor α7nAChR affect the improvement of LPS-induced hippocampal neuroinflammation by electroacupuncture.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e（A）EA reduces the activation of hippocampal microglia induced by LPS. Scale bar, 200 μm. （B）EA reduces the relative expression of mRNA of pro-inflammatory factor IL-1 β, microglia activation marker CD206 and injury-related factor iNOS, increase anti-inflammatory factors IL-20 and Arg1 by RT-qPCR.（C）Injection of α7nAChR antagonist (MLA) into hippocampal significantly affect EA on improving the expression of pro-inflammatory factor TNF- α mRNA in hippocampus induced by LPS（D）Selective knockout of microglia surface receptor α7nAChR significantly affect EA on improving the expression of pro-inflammatory factor TNF- α mRNA in hippocampus induced by LPS. All data are presented as the mean ± S.D. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001. n = 3/group.\u003c/p\u003e","description":"","filename":"FIgure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4480515/v1/eabfa70a638b47df5269b78f.jpg"},{"id":63479474,"identity":"63442ae9-ff54-4739-a629-46b9a9c8de35","added_by":"auto","created_at":"2024-08-28 14:38:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1419713,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4480515/v1/56f8d200-c593-45f5-be1d-64c499503051.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Electroacupuncture Alleviates Neuroinflammation and Memory Dysfunction by Regulating Hippocampal Microglial α7nAChR in LPS-Induced Systemic Inflammation in Mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSystemic inflammation is a pathological process that occurs after infection, surgery, or trauma, which can affect the central nervous system, resulting in coma, delirium, and drowsiness (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). Clinical studies have found that acute and chronic systemic inflammation is associated with cognitive impairment and can aggravate the process of chronic neurodegenerative diseases, such as Alzheimer\u0026rsquo;s disease, Parkinson\u0026rsquo;s disease, and vascular cognitive impairment (\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Recent studies have reported that systemic inflammation caused by COVID-9 often results in cognitive impairment, which increases the burden of diagnosis and treatment of the disease (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eBrain damage induced by acute systemic inflammation is associated with long-term memory impairment. Neuroinflammation is the key pathophysiology of cognitive impairment induced by systemic inflammation, and peripheral inflammatory factors can directly or indirectly activate cerebral glial cells, thus affecting the homeostasis of the central nervous system (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Microglia are the resident macrophages in the central nervous system, which act as the \u0026ldquo;first line of immune defense\u0026rdquo; in the brain (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Under physiological conditions, microglia can remove damaged cells and toxic substances from the brain, thus maintaining the homeostasis of the environment (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). However, when microglia are overactivated and induce inflammatory cascades, they would secrete a large amount of inflammatory cytokine, which could cause central nervous system inflammation (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Several studies have found that a large number of hippocampal microglia are activated in the state of systemic inflammation, and the function of learning and memory is seriously impaired (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eα7 nicotinic acetyl choline receptor (α7nAchR) is one of the main subtypes of the ligand gated ion channel receptor superfamily, which is widely distributed in the hippocampus (HP), and exerts neuroprotection in synaptic plasticity (\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). α7nAchR is mainly expressed on the surface of immune cells such as microglia, participates in intersynaptic signal transmission and neurotransmitter release, and mediates cholinergic anti-inflammatory effects (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). Central cholinergic anti-inflammatory pathway refers to cholinergic neurons secreting acetylcholine, acting on microglial cholinergic receptors, changing intracellular signal pathways, and transforming their activated phenotypes, thereby reducing the level of central nervous inflammation (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Hippocampal cholinergic neurons mainly originate from the projections of the medial septal (MS) of the basal forebrain, which refer to the recall of previous experience that contain specific temporal, spatial, and sequential information (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAcupuncture is an effective means of traditional Chinese medicine to treat human diseases, which stimulates specific acupoints to regulate the state of the body. Studies have shown that electroacupuncture (EA) has neuroprotective and anti-inflammatory effects, which can improve the cognitive function of AD and VCI (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). EA can improve cognitive function by reducing inflammatory factors such as IL-1β, IL-6, and TNF-α in the central nervous system. Moreover, EA can activate the activity of neurons in multiple brain regions and regulate the activity of acetylcholinesterase in the brain (23, 24, 25 ).\u003c/p\u003e \u003cp\u003ePrevious research showed that targeted cervical vagus nerve stimulation reduced LPS induced cerebral systemic inflammation and improves cognitive responses (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Our recent studies also found that 0.5 mA low-intensity electrical stimulation of ST36 acupoints can considerably improve the level of systemic inflammation by activating the dorsal nucleus of the vagus nerve (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). This paper explores the molecular mechanism of low-intensity EA at ST36 acupoints to improve cognitive function and exhibit anti-inflammatory properties on cognitive impairment induced by LPS, which might be mediated by α7nAChR on the surface of hippocampal microglia and regulated by improving the cholinergic transmission efficiency of MA.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eSPF grade C57BL/6 mice used in this study were provided by the Experimental Animal Center of Fujian University of Traditional Chinese Medicine. SPF grade Cx3Cr1-Cre/ERT2 mice, α7nAchR\u003csup\u003efl/fl\u003c/sup\u003e mice, and ChAT-Cre mice were purchased from the Jackson Laboratory in the United States (Stock Numbers: 26965, 21160, and 6410). The mice were bred in the Experimental Animal Center of Fujian University of Traditional Chinese Medicine. They were given free access to water and food, the constant temperature was maintained at 23\u0026deg;C, and the duration of light and darkness followed the normal circadian rhythm. The progeny mice obtained by cross-breeding were subjected to DNA gene identification to obtain the transgenic mice required for this subject. All experimental animals in this study were approved by the Animal Experiment Ethics Committee of Fujian University of Traditional Chinese Medicine (animal ethics number 2020056). Animal experiments were performed in strict accordance with international animal protection laws and guidelines for the use of laboratory animals.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eHybridization and gene identification\u003c/h2\u003e \u003cp\u003eThe α7nAchR\u003csup\u003efl/fl\u003c/sup\u003e mice were crossed with the Cx3Cr1-Cre/ERT2 mice to obtain the first generation of heterozygous transgenic mice with the genotype of α7nAchR\u003csup\u003efl/WT\u003c/sup\u003eCx3Cr1cre, and then the first generation mice were crossed with α7nAchR\u003csup\u003efl/fl\u003c/sup\u003e mice to obtain the second generation of α7nAchR\u003csup\u003efl/fl\u003c/sup\u003eCx3Cr1cre transgenic mice. The ChAT-Cre transgenic mice were crossed with Ai-14 mice to obtain the first generation of ChAT-Cre/Ai-14 transgenic mice.\u003c/p\u003e \u003cp\u003e The PCR gene identification operation of transgenic mice is as follows: First, when the mice were about 3 weeks old, the toes of the mice were cut according to the number and placed in the EP tube, and then the DNA extraction solution was added to the EP tube, and the DNA was extracted according to the steps. DNA was then amplified, The α7nAchR gene primer sequences Common, Wild type Reverse and Mutant Reverse are: GTC CCT CTG CTG GTA TTT GC; GAA CAA GTC AGA TAA GAA CCT; GCC CAA TTC CGA TCA TAT TC, the α7nAchR\u003csup\u003efl/WT\u003c/sup\u003e heterozygous gene band is 241 bp, 320 bp double band, α7nAchR\u003csup\u003efl/fl\u003c/sup\u003e gene band is 320 bp. Amplification procedure see table. Cx3Cr1cre gene primer sequences Common, Wild type Reverse and Mutant Reverse are: AAG ACT CAC GTG GAC CTG CT; CGG TTA AAC TTG CAC CA; AGG ATG TTG ACT TCC GAG TTG, Cx3Cr1-Cre heterozygous gene band is 300 bp, 695 bp double band, Cx3Cr1cre homozygous gene band is 300 bp. Amplification procedure see table. ChATcre gene primer sequences Common, Wild type Reverse and Mutant Reverse are: GCA AAG AGA CCT CAT CTG TGG A; CAG GGT TAG TAG GGG CTG AC; CAA AAG CGC TCT GAA GTT CCT, ChATcre heterozygous gene band It is 148 bp and 200 bp double bands, and the ChATcre homozygous gene band is 148 bp. The amplification procedure is shown in Table. According to the molecular weight, prepare a 1.2% agarose gel, put it in the electrophoresis solution, add samples to each well, and perform electrophoresis. After the electrophoresis, place the agarose gel on a luminescence imager to develop and observe the bands. ChATcre, Cx3Cr1cre and α7nAchR\u003csup\u003efl/fl\u003c/sup\u003e gene bands were determined according to the molecular weight of Marker, and the results were recorded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eLPS-induced cognitive impairment\u003c/h2\u003e \u003cp\u003eEstablishment of systemic inflammation-induced cognitive impairment model mice\u003c/p\u003e \u003cp\u003eThe mice were anesthetized by isoflurane inhalation (1.5% isoflurane mixed with oxygen) and intraperitoneal injection of lipopolysaccharide (1 mg/kg) immediately. The remaining nonmodel group mice were intraperitoneally injected with the same volume of normal saline.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eEA treatment\u003c/h2\u003e \u003cp\u003eEA bilateral Zusanli (about 0.5 cm below the head of the fibula) and sterile Huatuo brand acupuncture needles (13 mm in length and 0.3 mm in diameter) were inserted into the acupuncture point about 1 mm. By connecting HANS 200E acupoint nerve stimulator (Nanjing Jisheng Medical Technology Co, Ltd.) and giving 10 Hz sparse and dense waves, the stimulation intensity was 0.5 Ma, 30 min/time. EA was implemented before modeling and behavioral testing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eBehavioral tests\u003c/h2\u003e \u003cp\u003eThe episodic memory behavior (what\u0026ndash;when\u0026ndash;where) was used to verify the effects of the EA treatment on HP-related learning and memory functions. The experiments were improved based on references, which were divided into an adaption period and a test period. The mice were placed in a 60 cm \u0026times; 60 cm \u0026times; 40 cm screen box. The first two days were the adaptation period before modeling. A formal test was conducted after modeling, the task was divided into three \u0026ldquo;5-minute\u0026rdquo; stages, and the interval time of each stage was 50\u0026ndash;55 min, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. In the first stage, four identical A objects were arranged in a triangle. In the second stage, four identical B objects were arranged in a square. In the final test stage, a new arrangement of objects was used, and the \u0026ldquo;B\u0026rdquo; objects (Recent B) was still in the corner. The first \u0026ldquo;A\u0026rdquo; object (called Stationary A) was stuck in one corner, while the 2nd A object (called Displaced A) was placed in the other corner. Video was recorded by a camera mounted above the test area, using a three-point dynamic tracking method to record the time of contact with each object. The location preference for the test phase was calculated as the \u0026ldquo;what\u0026rdquo; percent time, the \u0026ldquo;where\u0026rdquo; percent time, and the \u0026ldquo;when\u0026rdquo; percent time as follows: What = ((Stationary A\u0026thinsp;+\u0026thinsp;Displaced A)/2 \u0026minus; (Recent B1\u0026thinsp;+\u0026thinsp;Recent B2)/2)/(Stationary A\u0026thinsp;+\u0026thinsp;Displaced A\u0026thinsp;+\u0026thinsp;Recent B1\u0026thinsp;+\u0026thinsp;Recent B2); Where = (Displaced A\u0026thinsp;\u0026minus;\u0026thinsp;Stationary A)/(Displaced A\u0026thinsp;+\u0026thinsp;Stationary A); When = (Stationary A \u0026ndash; (Recent B1\u0026thinsp;+\u0026thinsp;Recent B2)/2)/(Stationary A\u0026thinsp;+\u0026thinsp;Recent B1\u0026thinsp;+\u0026thinsp;Recent B2).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMagnetic Resonance Spectroscopy\u003c/h2\u003e \u003cp\u003eMagnetic Resonance Spectroscopy (MRS) was used to analyze the choline levels in the MS of the basal forebrain and the HP. The mouse was subjected to rapid air anesthesia and quickly placed in supine position on a scanning bed. The head of the mouse was adjusted, and the tooth bar was tightened. During process, air anesthesia was maintained by administering 1.5% isoflurane mixed with oxygen. The hypothermia state of the mice under anesthesia was maintained through a water circulation heating system, and a physiological characteristic monitoring patch was placed on the abdomen to monitor the physiological state of the mice. A body temperature monitor was placed, the mice were observed to maintain their body temperature at 36\u0026deg;C\u0026ndash;37\u0026deg;C, and their breathing rate was 50\u0026ndash;60 times/min. The experimental data were collected by Bruker\u0026rsquo;s 9.4T small animal MRI (Bruker, BioSpec 94/30 T, Etlingen Company, Germany), the mouse head coil imaging was selected, and localization image scanning was performed to determine the mouse head position and image quality. In this study, the MS of the basal forebrain and the HP regions were used as scanning areas, and the ratio of the area under the Cho peak to the area under the Cr peak in the two brain regions (Cho/Cr) was calculated as the representative of the choline level.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eStereotactic surgery\u003c/h2\u003e \u003cp\u003eAfter the mouse was quickly anesthetized, it was placed on a stereotaxic apparatus, the position of the mouse head was adjusted, the tooth rod and ear rod were fixed and tightened, and then hippocampal area (X: 1.1, Y: \u0026minus;1.8, Z: \u0026minus;1.2) positioning followed. After accurate positioning, a mark was made, and the skull was drilled at the mark. Then, the speed of the buried pipe device was adjusted through a stereotaxic instrument. The tube was slowly inserted into the HP and fixed with resin and glue, and the skin was sewed. After tube embedding was completed, the mice were returned to the cage to recover. Before the behavioral test, the mice were rapidly anesthetized by injection of methyllycaconitine (MLA) on the stereotaxic device through the tube embedding device.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e \u003cp\u003eThe expression of Iba-1 and α7nAchR in the HP, the expression of C-Fos in the MS brain of the ChAT cre/Ai14 mice, and the expression of α7nAchR in the HP of the α7nAchR\u003csup\u003efl/*\u003c/sup\u003e/Cx3Cr1cre mice were tested by immunofluorescence staining. After the behavioral test, the rats were anesthetized immediately by intraperitoneal injection of 5% sodium pentobarbital. The saline and paraformaldehyde were precooled in advance, slowly perfused with 30 mL of saline, and then slowly inject with 30 mL of 4% paraformaldehyde. The whole mouse brain was then removed, immersed in 4% paraformaldehyde, fixed at 4\u0026deg;C overnight, replaced with 15% sucrose for dehydration the next day, and replaced with 30% sucrose for secondary dehydration. after sinking to the bottom, the sections were embedded in a cryostat with a thickness of 10 \u0026micro;m, and the cut tissue pieces were attached to the glass slide. When staining, the tissue samples were washed three times with PBST (PBS and Tween 20 prepared as 5% PBST) for 10 min each time, washed once with 0.1 M PBS for 10 min, and placed on a shaking table at 37\u0026deg;C. The water around the tissue was dried (the tissue was kept moist throughout the process), the blocking solution was dropped into trash can, and placed the box in an incubator at 37\u0026deg;C for 1 h. Then, the blocking solution was removed with filter paper, without washing, goat antimouse Iba-1 primary antibody (1:200), goat anti-rabbit α7nAchR primary antibody (1:200), and goat anti-rabbit C-fos primary antibody (1:200) was added, then placed in a wet box at 4\u0026deg;C overnight. The next day, the slides were washed again in the same way, and the water was wiped off. Then, biotin-labeled donkey antigoat secondary antibody (1:500) and donkey antirabbit secondary antibody (1:500) were added dropwise and incubated at 37\u0026deg;C for 1 h. The slides were washed again, the moisture around the tissue was wiped off, and the mounting medium containing DAPI was dropped. The slides were covered, developed with a fluorescence microscope, and recorded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eAfter the mice were anesthetized, the hippocampal region was quickly removed and placed in liquid nitrogen to prevent the destruction of protein components. First, protein extraction and quantification were carried out. The hippocampal tissue of each group was taken out and weighed 30 ug. Magnetic beads and lysis buffer were added for protein lysis. The quantification and balance were carried out according to the ratio of the kit, and the protein was placed into a metal bath for denaturation. The experimental operation for determining the protein concentration was as follows: The stacking gel and separating gel were prepared according to the molecular weight of the protein. After solidification, the gel plate was placed in an electrophoresis box, and protein was added to the gel hole. Marker is set on both sides, and then electrophoresis was performed. After electrophoresis, protein was transferred to the PVDF membrane. The PVDF membrane was subjected to blocking with 5% milk for 1 h, the band was washed with TBST, the prepared GAPDH (1:8000) was added, and the primary antibody with α7nAchR (1:2000) antibody was incubated and shaken at 4\u0026deg;C overnight. After washing the band in the same way the next day, the secondary antibody (1:5000) was incubated at room temperature for 1 h, and then the band was washed in the same way. Finally, the developer solution was dropped on the strip, and protein band were placed on the protein developer for development. The results were obtained and analyzed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eELISA\u003c/h2\u003e \u003cp\u003eThe changes of α7nAchR, IL-1β, Arg1, CD206, IL-10, and iNOS contents in the HP were tested by using an enzyme-linked immunosorbent assay (ELISA) kit. The operation method was as follows: First, samples were added to the enzyme-labeled wells, and standard and test samples were added to each well. The samples were mixed well and placed at 37\u0026deg;C for 40 min. The reaction plate was cleaned with a washing solution and dried. Distilled water and primary antibody working solution were added to each well, mixing well and placing at 37\u0026deg;C for 20 min. After washing in the same way, antibody working solution was added, washing again and adding substrate working solution, which was placed in the dark at 37\u0026deg;C for 15 min. Finally, the stop solution was added and mixed, and the absorbance value was measured at 450 \u0026micro;m wavelength of the microplate reader within 30 min. The standard curve was drawn, and the corresponding α7nAchR, IL-1β, Arg1, CD206, IL-10, and iNOS contents were calculated according to the sample A value.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eIsolation of total RNA and quantitative PCR\u003c/h2\u003e \u003cp\u003eTNF-α mRNA Expression in the HP was detected by PCR. The operation method was as follows: First, 120 ug of hippocampal tissue was placed into a grinding tube containing magnetic beads, and lysate was added to each tube, ground, and pulverized. After high-speed centrifugation, the supernatant was taken into an EP tube, chloroform was added, vigorously shaken, and then centrifuged. The supernatant RNA was taken, an equal volume of isopropanol was added, mixed, and allowed to stand at 4\u0026deg;C for 10 min. The waste liquid was discarded after centrifugation again to obtain a white precipitate. Alcohol was added. The bottom of the tube was flicked to make the precipitate float, it was inverted and mixed several times, and allowed to stand still at room temperature for 3\u0026ndash;5 min. After centrifugation again, the supernatant was discarded. The precipitate was dried for 3 min, an appropriate amount of RNase-free water was added, and it was stored at \u0026minus;\u0026thinsp;80\u0026deg;C in a refrigerator. After mixing the extracted RNA samples and 1\u0026times; loading buffer, the samples were loaded, and the parameters of the electrophoresis apparatus were set to 200 v for 10 min to perform electrophoresis. According to the mRNA sequence of the TNF-α gene and the GAPDH of the corresponding species as the internal reference gene, the synthetic primer sequences was as follows: TNF-α F: 5GCCCGATGGGTTGTACCTTGT3; TNF-αR: 5TCTTGACGGCAGAGAGGAGG3; GAPDH F: 5TGGAAAGCTGTGGCGTGATG3; GAPDH R: 5TACTTGGCAGGTTTCTCCAGG3. The RNA was subjected to concentration determination and quantification, followed by QPCR amplification to obtain the results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll experimental data in this study were analyzed using SPSS 23.0 statistical software, and data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. MS cholinergic neuron activation fluorescence data and hippocampal α7nAchR knockout protein validation data were used samples in the t-test, one-way analysis of variance was used for the rest of the data, and pairwise comparisons were performed using the LSD method when the variances were equal. Then, Dunnett\u0026rsquo;s T3 method was used for pairwise comparison when the variances were unequal.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003col\u003e\n\u003cli\u003eEA can improve the behavioral impairment of episodic memory induced by LPS, while hippocampal \u0026alpha;7nAChR antagonism and microglial receptor \u0026alpha;7 knockout can reduce the effect of EA.\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eThe \u0026ldquo;what\u0026ndash;when\u0026ndash;where\u0026rdquo; behaviors were used to detect three components of episodic memory (Fig. 1A), \u0026ldquo;what\u0026rdquo; was explored, \u0026ldquo;where\u0026rdquo; was investigated, and \u0026ldquo;when\u0026rdquo; was examined relative to adjacent events (13). Compared to the control group, the time percentages of the what, where, and when of episodic memory decreased substantially in the LPS-treated mice. Compared with the model group, EA treatment could improve the ability of recognizing novel objects and changes in object timing in the \u0026ldquo;what\u0026rdquo; and \u0026ldquo;when\u0026rdquo; tests but could not affect the recognition ability of its position change (Fig. 1B).\u003c/p\u003e\n\u003cp\u003eHippocampal stereotaxic injection technology was applied to inject a7 receptor antagonist (MLA) into the HP to observe its effect on EA. Compared with the EA group, the hippocampal injection of MLA greatly reduced the ability to recognize new objects and changes in timing (Fig. 1C). Moreover, \u0026alpha;7 receptor was applied on the surface of the microglia gene knockout technology to observe the changes of cognitive behavior after knockout of receptor a7 on the surface of microglia. The episodic memory behavioral results showed the knockout of microglia surface receptor \u0026alpha;7 could greatly reduce the effect of EA (Fig. 1D). These results indicated that EA exerted its memory-improving effects mainly through hippocampal microglia a7 receptors.\u003c/p\u003e\n\u003col start=\"2\"\u003e\n\u003cli\u003eEA can activate the MS cholinergic neurons and promote MS\u0026ndash;HP cholinergic anti-neuroinflammation transmission.\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eBased on the episodic memory behavior test results, whether the alterations in episodic memory behavior were correlated with the MS\u0026ndash;HP cholinergic anti-neuroinflammation circuit was investigated. The expression levels of C-fos in cholinergic neurons in the MS regions of mice in the EA group and the non EA group were compared. The coexpression of c-fos (green fluorescence) and cholinergic neurons (red fluorescence) in the MS is shown in Fig. 2A. Compared with the non EA group, the number of cholinergic neurons coexpressed with C-fos was considerably increased in the EA group.\u003c/p\u003e\n\u003cp\u003eCompared with the control group, the cholinergic content (Cho/Cr) of the MS and HP detected by MRS scanning decreased after LPS stimulation. In addition, the MRS results showed the cholinergic content (Cho/Cr) of the MS and HP in the mice of EA group substantially increased compared with the model group (Figs. 2B and 2C). These results showed EA can simultaneously increase the MS and hippocampal cholinergic level, which may promote the MS-hippocampus cholinergic transmission.\u003c/p\u003e\n\u003col start=\"3\"\u003e\n\u003cli\u003eEA increases the expression of surface receptor\u0026alpha;7 in hippocampal microglia.\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003ePrevious studies showed the \u0026alpha;7 receptor is one of the important components in the cholinergic system and is closely related to neuroinflammation. Enzyme-linked immunosorbent assay and Western blot were used to observe changes of the \u0026alpha;7 receptor in the HP. Both results showed that compared with the control group, the expression of the hippocampal \u0026alpha;7 receptor of the model mice was greatly reduced, while EA could increase the expression of the a7 receptor protein in the HP (Figs. 3A and 3B).\u003c/p\u003e\n\u003cp\u003eImmunofluorescence was used to detect the expression of the hippocampal \u0026alpha;7 receptor on the surface of microglia and observe the activation number of microglia. The co-expression of \u0026alpha;7 receptors (red fluorescence) and microglia (green fluorescence) in the HP by immunofluorescence is shown in Fig. 3C. Compared with the control group, the expression of the hippocampal \u0026alpha;7 receptors in the model group was substantially reduced on the surface of microglia, and the activation of microglia was greatly increased. EA can increase hippocampal \u0026alpha;7 receptors on the surface of microglia and reduce the activation of microglia.\u003c/p\u003e\n\u003col start=\"4\"\u003e\n\u003cli\u003eVerification of \u0026alpha;7nAchR\u003csup\u003efl/fl\u003c/sup\u003eCx3Cr1cre gene knockout mouse\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eTo explore further the related mechanisms of EA in the improvement of the model, \u0026alpha;7 receptor was applied on the surface of the microglia gene knockout technology to observe the changes of cognitive behavior and hippocampal neuroinflammation after knockout of receptor a7 on the surface of microglia. First, a mouse knockout of the microglia surface receptor a7 was constructed, the Cx3Cr1cre mouse was crossed with the \u0026alpha;7nAchR\u003csup\u003efl/fl\u003c/sup\u003e mouse, and our target gene mouse \u0026alpha;7nAchR\u003csup\u003efl/fl\u003c/sup\u003eCx3Cr1cre was obtained in the third generation (Fig. 4A). When the target gene mice became adults, intraperitoneal injection of tamoxifen induced a7 receptor conditional knockout. To identify the success of the gene knockout, Western blot and immunofluorescence were carried out to confirm that the a7 receptor protein content in the HP of the knockout mice was greatly reduced, and no a7 receptor expression was on the surface of microglia (Figs. 4B and C). This outcome meant gene knockout was successful. The mice in the control group were tested with negative mice in the same litter.\u003c/p\u003e\n\u003col start=\"5\"\u003e\n\u003cli\u003eEA can reduce the expression of Iba-1 and reduce neuroinflammation in the HP, which can be blocked by the hippocampal injection of MLA and microglial surface receptor \u0026alpha;7 knockout.\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eThe behavioral decline of episodic memory induced by LPS is related to hippocampal neuroinflammation. Immunofluorescence\u0026nbsp;and RT-qPCR were used to detect the expression of hippocampal Iba-1 and the mRNA expression of neuroinflammation-related factors. The results showed that compared with the control group, the expression levels of Iba-1, pro-inflammatory factors IL-1\u0026beta;, CD206, and iNOS in the HP brain, while the expression levels of anti-inflammatory factors IL-10 and Arg1 greatly decreased. EA can inhibit the expression of Iba-1, IL-1\u0026beta;, CD206, and iNOS, and promote the expression levels of IL-10 and Arg1 (Figs. 5A and B). EA also could decrease the hippocampal TNF-\u0026alpha; mRNA, which would be reversed by the hippocampal injection of \u0026alpha;7 antagonist MLA or knockout of microglia surface receptor \u0026alpha;7 (Fig. 5C).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eSystemic inflammation is accompanied by systemic infection, postoperative trauma, and other pathological processes such as COVID-19 infection (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e), which seriously affect the cognition of patients (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e). Therefore, finding an effective prevention and treatment of cognitive impairment caused by systemic inflammation is an urgent problem. EA is an effective nondrug therapy in traditional Chinese medicine. EA is a supplement to replace medical technology, which is widely used for treating inflammatory diseases and cognitive impairment (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). EA can remarkably improve learning and memory through the central cholinergic anti-inflammatory pathway (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOur previous experimental results showed low-intensity EA at ST36 acupoints can effectively reduce systemic inflammation in mice with sepsis (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). On this basis, this paper further explored the effects of EA at ST36 acupoints on systemic inflammation inducing cognitive impairment. First, this paper revealed the molecular mechanism of low-intensity EA at bilateral ST36 to improve cognitive impairment induced by LPS, which was related to activating the cholinergic system through hippocampal α7nAChR.\u003c/p\u003e \u003cp\u003eThe systemic inflammation induced by LPS is widely used in the field of central nervous system research, and LPS can directly activate microglia to release a series of neurotoxic factors, resulting in neuronal death (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Glial toll-like receptor4 (TLR4) is the main receptor of LPS, which can induce activate the NF-κB signal pathway and promote the production of inflammatory factors (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Our study results confirmed the cognitive impairment induced by systemic inflammation is hippocampal dependent, characterized by the behavioral impairment of episodic memory. In the \u0026ldquo;what\u0026ndash;when\u0026ndash;where\u0026rdquo; of the episodic memory behavior test, EA can effectively improve the memory of new objects and sequence in mice with cognitive impairment induced by systemic inflammation. Episodic memory refers to the recall of previous experiences containing specific object, spatial, and sequential information, which requires the coordination of multiple brain regions. Chemical genetic inhibition of the circuit of the MS\u0026ndash;HP can destroy episodic memory (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Whether EA improves episodic memory induced by systemic inflammation through affecting the MS\u0026ndash;HP cholinergic circuit remains to be explored.\u003c/p\u003e \u003cp\u003eNeuroinflammation can lead to neuronal damage and death in the brain, which is one of the key pathogenesis of cognitive disorders (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). Microglia are the immune cells of the brain, derived from myeloid origin, which are related to the innate immune response of the brain (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). Overactivation of microglia can cause neuroinflammation, leading to neuronal death and cognitive degradation in several cognitive disorders diseases (\u003cspan additionalcitationids=\"CR41 CR42 CR43\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn our experiment, when intraperitoneal injection of LPS induced cognitive impairment, microglia active biomarkers (Iba-1) in the HP were increased substantially, which triggered the release of inflammatory cytokines such as IL-1β and TNF-α (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e). Consistent with other studies, LPS resulted in hippocampal neuroinflammation. EA could improve the behavior of episodic memory and reduce the activation of microglia and the level mRNA of inflammatory cytokines in the HP.\u003c/p\u003e \u003cp\u003eTracey\u0026rsquo;s research showed that vagus nerve stimulation can inhibit considerably and rapidly the release of macrophage TNF-α and attenuate systemic inflammatory responses via the classic peripheral and central \u0026ldquo;cholinergic anti-inflammatory pathway\u0026rdquo; (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e). Some studies found that the cholinergic activity of the HP is mainly derived from the MS, which can inhibit hippocampal neuroinflammation (\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e). In this experiment, MRS detection showed the cholinergic content was substantially decreased in the HP and MS when suffering cognitive impairment by LPS, which may promote hippocampal neuroinflammation (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e). An effective stimulation method to drive the vagal\u0026ndash;adrenal anti-inflammatory axis in systemic inflammatory mice, EA at the hindlimb ST36 acupoint can increase the cholinergic transmission level of the MS\u0026ndash;HP and activate cholinergic neurons in the MS, which were beneficial for suppressing neuroinflammation.\u003c/p\u003e \u003cp\u003eα7nAChR is expressed in neurons and non-neuronal cells in the brain, among which it is highly expressed in the HP. It is related to various neurological diseases and neurodegenerative diseases (\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e). Studies have shown that nicotine or Ach can inhibit LPS-induced TNF-α production and microglial activation by activating α7nAChR (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e). α7nAChR activation protects microglia by alleviating neuroinflammatory response (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e). Therefore, α7nAChR is an important receptor for improving cognitive impairment induced by systemic inflammation. Our results found that the expression of hippocampal α7nAChR was considerably decreased in the LPS-induced cognitive impairment, which played an important role in the regulation of neuroinflammation.\u003c/p\u003e \u003cp\u003ePrevious studies showed EA can upregulate the expression of α7nAChR and inhibit the inflammatory response when suffering from cerebral ischemia injury or cognitive impairment after an operation (\u003cspan additionalcitationids=\"CR55\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e). To explore the anti-inflammatory mechanism of central and hippocampal α7nAChR further, this paper used injection of α7nAChR antagonist into the HP or specific knockout of microglia α7, which could block or weaken the central anti-inflammatory effect of EA. The results showed EA can reduce neuroinflammation and improve cognitive function mainly through the cholinergic receptor α7nAChR on microglia.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur findings confirm the 0.5 mA intensity EA at ST36 acupoints, which was verified as an effective stimulation of vagus nerve excitation, may improve the episodic memory impairment and play an anti-inflammatory role by promoting cholinergic nerve fiber transmission between the MS and the HP, increasing the release of the MS acetylcholine, and activating microglial α7nAChR during systemic inflammation. This key research conclusion would provide an important theoretical basis for clinical application of EA to improve cognitive impairment related to systemic inflammation in the future.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eEA \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;electroacupuncture\u003c/p\u003e\n\u003cp\u003eLPS \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;Lipopolysaccharide\u003c/p\u003e\n\u003cp\u003eMS \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; medium septum\u003c/p\u003e\n\u003cp\u003eHP \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; Hippocampus\u003c/p\u003e\n\u003cp\u003e\u0026alpha;7nAchR \u0026nbsp; \u0026nbsp;\u0026alpha;7 nicotinic acetyl choline receptor\u003c/p\u003e\n\u003cp\u003eMRS \u0026nbsp; \u0026nbsp; \u0026nbsp; Magnetic Resonance Spectroscopy\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMLA \u0026nbsp; \u0026nbsp; \u0026nbsp; methyllycaconitine\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Ethical Committee on Animal Experimentation, Fujian University of Traditional Chinese Medicine (FJTCMIACUC 2020056).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. The datasets supporting the conclusions of this article are included within the article and its additional files.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflicts of any commercial or fnancial relationships that could be construed as a potential competing interests. All authors gave their consent to the publication of the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was jointly supported by the National Natural Science Foundation of China (82274658),\u0026nbsp;the Natural Science Foundation of Fujian Province (2022J01347), the Medical Innovation Project of Fujian Provincial Health Commission (2022CXA053)., the National Key Research and Development Program of China (2022YFC2009700), and Fujian Province Young and Middle aged Teacher Education Research Project (JAT220116).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZhifu Wang carried out the project design, and drafted the part of manuscript. Xiaomei Chen were involved in the animal experiment and analysis the data. Yanyan Lan and Qiuling Huang were participated in some experiments and data analysis. Lina Pang and Honglin Chen were assisted in completing the experiment. Zhifu Wang, weiquan Zeng and Jiehui Fu are the co-corresponding authors and they completed the project design and proofread the manuscript. Xiangmei Yu and Xiaomei Chen made an equal contribution to this research. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eI would like to express my sincere gratitude to all those who participated in this paper, as well as the National Natural Science Foundation of China and the Science and technology platform construction project of Fujian Science and Technology Department.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZhao L, Song Y, Zhang Y (2022) HIF-1α/BNIP3L induced cognitive deficits in a mouse model of sepsis-associated encephalopathy. Front Immunol 13:1095427\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeydoun M, Dore G, Canas J (2018) Systemic Inflammation Is Associated With Longitudinal Changes in Cognitive Performance Among Urban Adults. Front Aging Neurosci 10:313\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLai K, Liu C, Rau A (2017) Peripheral inflammatory markers in Alzheimer's disease: a systematic review and meta-analysis of 175 studies. J Neurol Neurosurg Psychiatry 88(10):876\u0026ndash;882\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePajares M, Rojo I, Manda A (2020) G. Inflammation in Parkinson's Disease: Mechanisms and Therapeutic Implications. Cells ; 9(7)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCeban F, Ling S, Lui L (2022) Fatigue and cognitive impairment in Post-COVID-19 Syndrome: A systematic review and meta-analysis. Brain Behav Immun 101:93\u0026ndash;135\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoung A, Vanderheiden A, Nordvig A (2022) COVID-19 induces CNS cytokine expression and loss of hippocampal neurogenesis. Brain 145(12):4193\u0026ndash;4201\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJi M, Lei L, Gao D (2022) Neural network disturbance in the medial prefrontal cortex might contribute to cognitive impairments induced by neuroinflammation. Brain Behav Immun 89:133\u0026ndash;144\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkelly D, Griffin \u0026Eacute;, Murray C (2019) Acute transient cognitive dysfunction and acute brain injury induced by systemic inflammation occur by dissociable IL-1-dependent mechanisms. Mol Psychiatry 24(10):1533\u0026ndash;1548\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBorst K, Dumas A, Prinz MJI (2021) Microglia: Immune and non-immune functions. Immunity 54(10):2194\u0026ndash;2208\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAugusto-Oliveira M, Arrifano G, Delage C (2022) Plasticity of microglia. Biol Rev Camb Philos Soc 97(1):217\u0026ndash;250\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkaper S, Giusti P, Facci LJFFASEB (2012) Microglia and mast cells: two tracks on the road to neuroinflammation. FASEB J 26(8):3103\u0026ndash;3117\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang X, Xu S, Qian Y (2017) Resveratrol regulates microglia M1/M2 polarization via PGC-1α in conditions of neuroinflammatory injury. Brain Behav Immun 64:162\u0026ndash;172\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuffman W, Subramaniyan S, Rodriguiz R (2019) Modulation of neuroinflammation and memory dysfunction using percutaneous vagus nerve stimulation in mice. Brain Stimul 12(1):19\u0026ndash;29\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoviello C, Gharpure A, Mukhtasimova N (2021) Structure and gating mechanism of the α7 nicotinic acetylcholine receptor. Cell 184(8):2121\u0026ndash;34e13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKabbani N, Nichols RJT (2018) Beyond the Channel: Metabotropic Signaling by Nicotinic Receptors. Trends Pharmacol Sci 39(4):354\u0026ndash;366\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFabian-Fine R, Skehel P, Errington M (2001) Ultrastructural distribution of the alpha7 nicotinic acetylcholine receptor subunit in rat hippocampus. J Neurosci 21(20):7993\u0026ndash;8003\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMizrachi T, Vaknin-Dembinsky A, Brenner T (2021) Neuroinflammation Modulation via α7 Nicotinic Acetylcholine Receptor and Its Chaperone, RIC-3. Molecules. ; 26(20)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParada E, Egea J, Buendia I (2013) The microglial α7-acetylcholine nicotinic receptor is a key element in promoting neuroprotection by inducing heme oxygenase-1 via nuclear factor erythroid-2-related factor 2. Antioxid Redox Signal 19(11):1135\u0026ndash;1148\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKelly M, Breathnach C, Tracey K (2022) Manipulation of the inflammatory reflex as a therapeutic strategy. Cell Rep Med 3(7):100696\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin T, Chen R, Shao M (2020) Dorsal hippocampus- and ACC-projecting medial septum neurons differentially contribute to the recollection of episodic-like memory. FASEB J 34(9):11741\u0026ndash;11753\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng X, Lin W, Jiang Y (2021) Electroacupuncture ameliorates beta-amyloid pathology and cognitive impairment in Alzheimer disease via a novel mechanism involving activation of TFEB (transcription factor EB). Autophagy 17(11):3833\u0026ndash;3847\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai Y, Zhang Y, Yang M (2022) Electroacupuncture Increases the Hippocampal Synaptic Transmission Efficiency and Long-Term Plasticity to Improve Vascular Cognitive Impairment. Mediators Inflamm. :5985143\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng P, Deng P, Liu L Electroacupuncture Alleviates Postoperative Cognitive Dysfunction in Aged Rats by Inhibiting Hippocampal Neuroinflammation Activated via Microglia/TLRs Pathway. Evid Based Complement Alternat Med. 2017:6421260\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai M, Lee J, Yang EJJ (2019) Electroacupuncture attenuates cognition impairment via anti-neuroinflammation in an Alzheimer's disease animal model. J Neuroinflammation 16(1):264\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee B, Sur B, Shim J (2014) Acupuncture stimulation improves scopolamine-induced cognitive impairment via activation of cholinergic system and regulation of BDNF and CREB expressions in rats. 2014. BMC Complement Altern Med 14:338\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu S, Wang Z, Su Y (2020) Somatotopic Organization and Intensity Dependence in Driving Distinct NPY-Expressing Sympathetic Pathways by Electroacupuncture. Neuron 108(3):436\u0026ndash;50e7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeorge P, Reed A, Desai S (2022) A persistent neutrophil-associated immune signature characterizes post-COVID-19 pulmonary sequelae. Sci Transl Med 14(671):eabo5795\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaquet M, Geddes J, Husain M (2021) 6-month neurological and psychiatric outcomes in 236 379 survivors of COVID-19: a retrospective cohort study using electronic health records. Lancet Psychiatry 8(5):416\u0026ndash;427\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao Q, Hernandes MS (2021) Sepsis-Associated Encephalopathy and Blood-Brain Barrier Dysfunction. Inflammation 44(6):2143\u0026ndash;2150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Z, Man S, Yam L (2020) Electroacupuncture trigeminal nerve stimulation plus body acupuncture for chemotherapy-induced cognitive impairment in breast cancer patients: An assessor-participant blinded, randomized controlled trial. Brain Behav Immun 88:88\u0026ndash;96\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Zheng L, Deng H (2022) Electroacupuncture Alleviates LPS-Induced ARDS Through α7 Nicotinic Acetylcholine Receptor-Mediated Inhibition of Ferroptosis. Front Immunol 13:832432\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu W, Zhuo P, Li L (2017) Activation of brain glucose metabolism ameliorating cognitive impairment in APP/PS1 transgenic mice by electroacupuncture. Free Radic Biol Med 112:174\u0026ndash;190\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng W, Zhao H, Liu Z (2007) Acupuncture for vascular dementia. Cochrane Database Syst Rev. ; (2):CD004987\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoh H, Jeon J, Seo HJN (2014) Systemic injection of LPS induces region-specific neuroinflammation and mitochondrial dysfunction in normal mouse brain. Neurochem Int 69:35\u0026ndash;40\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTerrando N, Rei Fidalgo A, Vizcaychipi M (2010) The impact of IL-1 modulation on the development of lipopolysaccharide-induced cognitive dysfunction. Crit Care 14(3):R88\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu Y, Yeh W, Ohashi PJC (2008) LPS/TLR4 signal transduction pathway. Cytokine 42(2):145\u0026ndash;151\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGong Q, He L, Wang M (2019) Comparison of the TLR4/NFκB and NLRP3 signalling pathways in major organs of the mouse after intravenous injection of lipopolysaccharide. Pharm Biol 57(1):555\u0026ndash;563\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoonen S, Koper M, Van Schoor E (2023) Pyroptosis in Alzheimer's disease: cell type-specific activation in microglia, astrocytes and neurons. Acta Neuropathol 145(2):175\u0026ndash;195\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Holtzman DJI (2022) Emerging roles of innate and adaptive immunity in Alzheimer's disease. Immunity 55(12):2236\u0026ndash;2254\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeng F, Hinz R, Gentleman S (2023) Neuroinflammation is independently associated with brain network dysfunction in Alzheimer's disease. Mol Psychiatry 28(3):1303\u0026ndash;1311\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Z, Nakanishi HJJ (2014) Connection between periodontitis and Alzheimer's disease: possible roles of microglia and leptomeningeal cells. J Pharmacol Sci 126(1):8\u0026ndash;13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLavisse S, Goutal S, Wimberley C (2021) Increased microglial activation in patients with Parkinson disease using [F]-DPA714 TSPO PET imaging. Parkinsonism Relat Disord 82:29\u0026ndash;36\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo G, Wang X, Cui Y, Cao Y, Zhao Z, Zhang J (2021) Metabolic reprogramming mediates hippocampal microglial M1 polarization in response to surgical trauma causing perioperative neurocognitive disorders. J Neuroinflammation. ; 13;18(1):267\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Zhang Y, Zheng X et al (2018) Galantamine improves cognition, hippocampal inflammation, and synaptic plasticity impairments induced by lipopolysaccharide in mice. J Neuroinflammation 15(1):112\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Fan L, Khawaja R (2022) Microglial NF-κB drives tau spreading and toxicity in a mouse model of tauopathy. Nat Commun 13(1):1969\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez-Rodriguez A, Hennessy E, Murray C (2021) Acute systemic inflammation exacerbates neuroinflammation in Alzheimer's disease: IL-1β drives amplified responses in primed astrocytes and neuronal network dysfunction. Alzheimers Dement 17(10):1735\u0026ndash;1755\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Yu M, Ochani M (2003) Nicotinic acetylcholine receptor alpha7 subunit is an essential regulator of inflammation. Nature 421(6921):384\u0026ndash;388\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiovesana R, Salazar Intriago M, Dini L (2021) Cholinergic Modulation of Neuroinflammation: Focus on α7 Nicotinic Receptor. Int J Mol Sci. ; 22(9)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMineur Y, Mose T, Vanopdenbosch L (2022) Hippocampal acetylcholine modulates stress-related behaviors independent of specific cholinergic inputs. Mol Psychiatry 27(3):1829\u0026ndash;1838\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026eacute;kesi O, Liang H, M\u0026uuml;nch G (2019) The differential impact of acute microglia activation on the excitability of cholinergic neurons in the mouse medial septum. Brain Struct Funct 224(7):2297\u0026ndash;2309\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLetsinger A, Gu Z, Yakel JJT (2022) α7 nicotinic acetylcholine receptors in the hippocampal circuit: taming complexity. Trends Neurosci 45(2):145\u0026ndash;157\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXia Y, Wu Q, Mak S (2022) Regulation of acetylcholinesterase during the lipopolysaccharide-induced inflammatory responses in microglial cells. FASEB J 36(3):e22189\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan Y, Qin X, Zhang T (2018) Electroacupuncture prevents cognitive impairment induced by lipopolysaccharide via inhibition of oxidative stress and neuroinflammation. Neurosci Lett 683:190\u0026ndash;195\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Li C, Peng H (2017) Electroacupuncture attenuates learning and memory impairment via activation of α7nAChR-mediated anti-inflammatory activity in focal cerebral ischemia/reperfusion injured rats. Exp Ther Med 14(2):939\u0026ndash;946\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu P, Zhou Y, Zhang Y (2017) Electroacupuncture alleviates surgery-induced cognitive dysfunction by increasing α7-nAChR expression and inhibiting inflammatory pathway in aged rats. Neurosci Lett 659:1\u0026ndash;6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa Z, Zhang Z, Bai F (2019) Electroacupuncture Pretreatment Alleviates Cerebral Ischemic Injury Through α7 Nicotinic Acetylcholine Receptor-Mediated Phenotypic Conversion of Microglia. Front Cell Neurosci 13:537\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Microglia, α7nAChR, Neuroinflammation, Cognition, Hippocampus","lastPublishedDoi":"10.21203/rs.3.rs-4480515/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4480515/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eCognitive impairment induced by systemic inflammatory diseases is associated with hippocampal microglial activation and central neuroinflammation. This paper investigated whether electroacupuncture (EA) stimulation exerts anti-inflammatory effects and improves cognitive impairment through the hippocampal microglial α7 receptor.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eES efficacy was evaluated with respect to microglial activation and cognitive dysfunction amelioration following lipopolysaccharide (LPS) intraperitoneal injection in mice. Behavioral testing of \u0026ldquo;what,\u0026rdquo; \u0026ldquo;where,\u0026rdquo; and \u0026ldquo;when\u0026rdquo; memories was used to observe spatial memory. Microglial α7 was knocked out by hybridization of α7nAchR\u003csup\u003efl/fl\u003c/sup\u003e and Cx3Cr1\u003csup\u003ecre\u003c/sup\u003e transgenic mice. Furthermore, the cholinergic transmission between medium septum (MS) and the hippocampus (HP) was studied using magnetic resonance spectroscopy to investigate the EA effects on the central cholinergic anti-inflammatory properties.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eEA can improve the spatial memory and increase the cholinergic level of the MS and promote the cholinergic transmission of MS\u0026ndash;HP. EA also activated the cholinergic neurons of MS, increased the expression of microglial α7nAChR, and decreased the expression of Iba-1. The results of qPCR and enzyme-linked immunosorbent assay detection showed EA could reduce the expression of mRNA related to cytokine (IL-1β, iNOS, IL-10, Arg1, CD206, and TNF-α) in the HP. Hippocampal injection of a7 antagonist or specific knockout of microglia a7 can reverse the EA effects of anti-inflammatory properties and improve cognitive impairment.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eEA treatment ameliorates system inflammation-induced cognitive decline mediated by hippocampal microglial α7 receptor, which displays cholinergic antineuroinflammation properties and improves cognitive function.\u003c/p\u003e","manuscriptTitle":"Electroacupuncture Alleviates Neuroinflammation and Memory Dysfunction by Regulating Hippocampal Microglial α7nAChR in LPS-Induced Systemic Inflammation in Mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-12 18:03:18","doi":"10.21203/rs.3.rs-4480515/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"febe367e-8096-40d0-9430-6acd04c5342e","owner":[],"postedDate":"June 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-28T14:38:28+00:00","versionOfRecord":[],"versionCreatedAt":"2024-06-12 18:03:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4480515","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4480515","identity":"rs-4480515","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}