Selectivity of the time-dependent M. tuberculosis LeuRS inhibitor ganfeborole is driven by target vulnerability

Selectivity of the time-dependent M. tuberculosis LeuRS inhibitor ganfeborole is driven by target vulnerability | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Selectivity of the time-dependent M. tuberculosis LeuRS inhibitor ganfeborole is driven by target vulnerability Mingqian Wang , YongLe He , Siobhan A. Cohen , Amanda R. Strohm , Gauri Shetye , Scott G. Franzblau , Stephen G. Walker , Dickon Alley , View ORCID Profile Peter J. Tonge doi: https://doi.org/10.1101/2025.07.31.667927 Mingqian Wang a Center for Advanced Study of Drug Action, and Department of Chemistry, Stony Brook University , Stony Brook, NY 11794-3400, United States, Find this author on Google Scholar Find this author on PubMed Search for this author on this site YongLe He a Center for Advanced Study of Drug Action, and Department of Chemistry, Stony Brook University , Stony Brook, NY 11794-3400, United States, Find this author on Google Scholar Find this author on PubMed Search for this author on this site Siobhan A. Cohen a Center for Advanced Study of Drug Action, and Department of Chemistry, Stony Brook University , Stony Brook, NY 11794-3400, United States, Find this author on Google Scholar Find this author on PubMed Search for this author on this site Amanda R. Strohm a Center for Advanced Study of Drug Action, and Department of Chemistry, Stony Brook University , Stony Brook, NY 11794-3400, United States, Find this author on Google Scholar Find this author on PubMed Search for this author on this site Gauri Shetye b Institute for Tuberculosis Research, College of Pharmacy, University of Illinois at Chicago , 833 South Wood Street, Chicago, IL 60612, United States, Find this author on Google Scholar Find this author on PubMed Search for this author on this site Scott G. Franzblau b Institute for Tuberculosis Research, College of Pharmacy, University of Illinois at Chicago , 833 South Wood Street, Chicago, IL 60612, United States, Find this author on Google Scholar Find this author on PubMed Search for this author on this site Stephen G. Walker c Department of Oral Biology and Pathology, Stony Brook University , Stony Brook, NY, 11794, United States, Find this author on Google Scholar Find this author on PubMed Search for this author on this site Dickon Alley d AN2 Therapeutics , Menlo Park, CA 94027, United States Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: peter.tonge{at}stonybrook.edu dalley{at}an2therapeutics.com Peter J. Tonge a Center for Advanced Study of Drug Action, and Department of Chemistry, Stony Brook University , Stony Brook, NY 11794-3400, United States, e Department of Biomedical Genetics, University of Rochester , Rochester, NY 14642, United States Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Peter J. Tonge For correspondence: peter.tonge{at}stonybrook.edu dalley{at}an2therapeutics.com Abstract Full Text Info/History Metrics Preview PDF ABSTRACT Ganfeborole (GSK3036656) inhibits the Mycobacterium tuberculosis leucyl-tRNA-synthetase (mtLeuRS) and is in phase 2a clinical trials for the treatment of tuberculosis. Here we show that ganfeborole is a time-dependent inhibitor of mtLeuRS (IC 50 1 nM) and generates a post-antibiotic effect of 77 h at 50xMIC (MIC 0.058 μM) with M. tuberculosis H37Rv ( Mtb ), indicating that mtLeuRS is a highly vulnerable drug target and supporting the excellent in vivo efficacy of the drug. Ganfeborole is also a potent time-dependent inhibitor of Escherichia coli LeuRS (ecLeuRS, IC 50 2 nM), however no antibacterial activity is observed towards E. coli up to 1 mM ganfeborole despite the observation that less potent ganfeborole analogs have antibacterial activity. To rationalize this observation, we propose that ganfeborole forms a complex with AMP that binds to the ecLeuRS editing site but does not impact aminoacylation. In support, addition of 12.5 μM norvaline generates a ganfeborole MIC of 0.4 μM since ecLeuRS is unable to hydrolyze norvaline-tRNA Leu . Additionally, mutations that reduce the affinity and residence time of ganfeborole-AMP on ecLeuRS result in antibacterial activity. We propose that the activity of ganfeborole towards Mtb is because mtLeuRS is a highly vulnerable target so that only low levels of enzyme need to be inhibited by the ganfeborole-tRNA Leu complex in contrast to ecLeuRS, which we previously demonstrated is a low vulnerability target. New drugs are needed to treat tuberculosis (TB), which is the leading cause of death from a single infectious agent. 1 Drug-sensitive TB is treated by a cocktail of 2-4 drugs for 6-9 months, and either noncompliance and/or deviation from this treatment regime is a common cause of drug resistance. 2 However, only three new drugs, bedaquiline, delamanid, and pretomanid, have been approved in the last decade for the treatment of drug-resistant TB, emphasizing the importance of developing new classes of antibiotics with novel mechanisms of action. 3 , 4 The benzoxaborole ganfeborole (GSK3036656, Figure 1 ) recently entered Phase 2a clinical trials for the treatment of TB infection. 5 Ganfeborole inhibits leucyl-tRNA synthetase (LeuRS) through the oxaborole tRNA trapping (OBORT) mechanism, 6 in which the inhibitor forms a covalent adduct with the ribose diol of the terminal adenosine nucleotide (Ade76) of tRNA Leu , and traps the tRNA in the LeuRS editing site thereby inhibiting esterification of tRNA Leu by Leu ( Figure 1 ). Oxaborole inhibitors have also been discovered for LeuRS enzymes from other pathogens, including the first-in-class antifungal tavaborole (AN2690) 7 , 8 and epetraborole (AN3365), which has potent activity toward Gram-negative bacteria. 9 Ganfeborole was identified through an extensive med chem campaign which demonstrated the importance of the halogen at the 4 position (Cl in the case of ganfeborole) and the 2-hydroxyethoxy group at the 7 position. 10 , 11 This study demonstrated that ganfeborole was highly selective for the M. tuberculosis LeuRS (mtLeuRS) compared to the human homologs, with reported IC 50 values of 0.2 μM, 132 μM and >300 μM for mtLeuRS, human cytoplasmic LeuRS and human mitochondrial LeuRS, respectively. 11 Download figure Open in new tab Figure 1. Benzoxaborole structures and the reaction of ganfeborole with AMP. (A) Structures of ganfeborole, 1 , epetraborole and AN3334. (B) Reaction of ganfeborole with AMP. Benzoxaboroles are time-dependent inhibitors of LeuRS, 9 , 12 and we initially set out to compare and contrast the binding kinetics of ganfeborole and analog 1 , which lacks the 4-Cl group, with the LeuRS enzymes from M. tuberculosis (mtLeuRS) and Escherichia coli (ecLeuRS). In the course of this work, we discovered that ganfeborole and 1 are potent inhibitors of both LeuRS enzymes but that only 1 demonstrates antibacterial activity toward E. coli . We subsequently demonstrate that the addition of 12.5 μM norvaline (Nva) results in a >1000-fold decrease in the MIC of ganfeborole for E. coli, supporting a mechanism in which a complex of ganfeborole with AMP blocks the ecLeuRS editing site without inhibiting aminoacylation. Inhibition of the ecLeuRS editing function only becomes critical in the presence of significant quantities of mischarged tRNA Leu , which cannot be hydrolyzed on the editing site. RESULTS The benzoxaboroles are time-dependent inhibitors of LeuRS. 9 , 12 We first quantified the inhibition of ecLeuRS and mtLeuRS by ganfeborole and compound 1 , an analog lacking the 4-Cl group. E. coli and M. tuberculosis tRNA Leu were prepared by in vitro transcription, and in each case, a decrease in IC 50 value was observed after 1 h preincubation of inhibitor, enzyme, and tRNA Leu consistent with slow-onset inhibition ( Figure 2 , Table 1 ). The final IC 50 values for ganfeborole and 1 with ecLeuRS were 2 and 5 nM, respectively, while those for mtLeuRS were 1 and 2 nM, respectively. Download figure Open in new tab Figure 2. Concentration-response plots for the time-dependent inhibition of LeuRS. (A) ecLeuRS and 1 , (B) ecLeuRS and ganfeborole, (C) mtLeuRS and 1 , and (D) mtLeuRS and ganfeborole. Compound 1 and ganfeborole were preincubated with 800 pM ecLeuRS and 20 μM ectRNA Leu or 800 pM mtLeuRS and 20 μM mttRNA Leu for 2 min, 20 min and 1 h. The reaction was initiated with 10 μM ATP and 20 μM L-Leu, and then quenched with 20 mM EDTA after 5 min. Fluorescence polarization (FP) was converted to [AMP] using an AMP/ATP FP standard curve, and the inhibition% was calculated and normalized using the DMSO-only control. The data was fit to a concentration-response equation using GraphPad Prism in which the Hill slope was constrained to 1.0. Each experiment was performed in at least three independent biological replicates, with the error bars representing the standard deviation from the mean. Each experiment was performed in at least two independent biological replicates and the errors are the standard deviations from the mean. View this table: View inline View popup Table 1. Binding kinetics and microbiological activity of the LeuRS inhibitors The microbiological activity of the compounds against M. tuberculosis H37Rv and E. coli ATCC 25922 was assessed by determining the minimum inhibitory concentration (MIC) and post-antibiotic effect (PAE). The MIC values for 1 and ganfeborole with H37Rv were 0.79 and 0.058 μM, respectively ( Table 2 ). PAE values were then determined by first exposing bacterial cultures to 1x, 10x, 30x, and 50xMIC of each inhibitor for 2.5 h, followed by 10,000-fold dilution into fresh media, after which the rate of bacterial growth was quantified. 14 , 15 The PAE values were concentration-dependent, increasing to 42 and 77 h with 50xMIC exposure for 1 and ganfeborole, respectively ( Figure 3 , Table 2 ). As controls, PAE values were also obtained for isoniazid and rifampicin. In agreement with previous studies, isoniazid generated no detectable PAE at any concentration, whereas exposure to rifampicin resulted in a concentration dependent PAE that increased to 72 h at 50xMIC. 15 The PAE values observed for 1 and ganfeborole support the conclusion that mtLeuRS is a highly vulnerable drug target, 13 , 16 – 19 in agreement with gene titration experiments using CRISPRi. 20 View this table: View inline View popup Download powerpoint Table 2. MIC and PAE values of 1 and ganfeborole with M. tuberculosis H37Rv Download figure Open in new tab Figure 3. PAE of 1, ganfeborole, isoniazid and rifampicin with M. tuberculosis H37Rv. PAE of (A) 1 , (B) ganfeborole, (C) isoniazid and (D) rifampicin at 0, 1xMIC, 10xMIC, 30xMIC and 50xMIC. An autobioluminescent strain of M. tuberculosis, H37Rv_LuxABCDE, was treated with multiples of MICs of compounds for 2.5 h before diluting the culture 10,000-fold. The luminescence of the diluted culture (RLU) was measured for 14 days. The PAE is defined as the difference in time taken by compound treated culture to show 1.5 log increase in RLU compared to control wells (T-C). Dashed lines show the PAE induced by 50xMIC of compound. Error bars represent the standard deviation calculated from the average of three biological replicates. For E. coli , the MIC of 1 was 3.1 μM. However, ganfeborole had no detectable antibacterial activity up to 1 mM ( Table 1 ). This result was surprising given that other close structural analogs of ganfeborole have antibacterial activity against E coli . For instance, AN3334 and epetraborole have MIC values of 3.1 and 1.56 μM ( Table 1 ), and DS86760016 has an MIC of 1 μM. 9 , 21 Ganfeborole also had no antibacterial activity in the E. coli ΔtolC and ΔacrAB strains ( Table 1 ), suggesting that efflux did not account for the lack of activity. We then demonstrated that ganfeborole could effectively antagonize the antibacterial activity of 1 in the wild-type strain, where increasing concentrations of ganfeborole raised the MIC of 1 from 3.1 μM to 6.25 μM at 0.1 μM ganfeborole, and 200 μM at 6.25 μM ganfeborole ( Table 3 ). This indicates that ganfeborole is able to penetrate the bacteria and displace 1 from ecLeuRS; in other words, ganfeborole can bind to ecLeuRS but not inhibit the synthesis of Leu-tRNA Leu . View this table: View inline View popup Download powerpoint Table 3: MIC values of the benzoxaboroles in combination and in the presence of Nva and Leu It had previously been reported that AMP can replace tRNA Leu and that the benzoxaborole-AMP complex is a potent inhibitor of LeuRS. 22 We speculated that the ganfeborole-AMP complex occupies the editing site of ecLeuRS and does not prevent aminoacylation from occurring. To evaluate this hypothesis, we repeated the antibacterial assays under conditions where the editing function of ecLeuRS would become more important. This was accomplished by adding norvaline (Nva) to the media, given that tRNA Leu misloaded with Nva is known to be removed by LeuRS. 23 , 24 In support of the hypothesis, whereas Nva had no effect on bacterial growth up to 200 μM and did not affect the MIC of 1 , the addition of 12.5 μM Nva resulted in a ganfeborole MIC of 0.4 μM, which is a more than a 1000-fold increase in antibacterial activity ( Table 3 ). The synergistic activity of Nva and ganfeborole was confirmed using a checkboard assay which generated a FICI value << 0.5 ( Figure 4 ). In addition, time-kill assays demonstrated that the combination of ganfeborole and Nva resulted in cidality ( Figure 5 ). In agreement with the proposed mechanism, it was subsequently shown that Leu could antagonize the effect of Nva on the antibacterial activity of ganfeborole. For instance, the MIC of Nva with 6.4 μM ganfeborole increased to 25 μM in the presence of 3.1 μM Leu, and to 1.6 mM with 200 μM Leu ( Table 3 , Figure 4 and 5 ). Download figure Open in new tab Figure 4. Checkerboard MIC assay of 1 and ganfeborole with Nva and Leu in E. coli ATCC25922. (A) Ganfeborole and 1 , (B) ganfeborole and Nva, (C) 1 and Nva, and (D) Nva and Leu with 6.4 µM ganfeborole. Two-fold serial dilutions of the two compounds were added to the 96-well plate that contained 5x10 5 CFU/mL E. coli cells/well in M9 media. Visual turbidity in each well was determined after 16 h incubation at 37°C. Each experiment was performed in at least three independent biological replicates. Download figure Open in new tab Figure 5. Time-kill assay of 1 and ganfeborole with Nva and Leu against E. coli ATCC25922. Time-kill experiments were performed with (A) ganfeborole, Nva with 0 μM Leu. (B) 6.4 µM ganfeborole and 200 µM Nva with 0, 25, 50, and 100 µM Leu. Experiments were performed in the M9 medium. Aliquots were taken every hour from the culture to record the growth of E. coli over time. Each experiment was performed in at least three independent biological replicates, with the error bars representing the standard deviation from the mean. The checkerboard and time-kill experiments demonstrate that the activity of ganfeborole is impacted by Nva, which we speculated was due to the inability of the ecLeuRS editing site to correct the misloading of tRNA Leu by Nva. To support this hypothesis, we generated strains of E. coli that were resistant to 1 by exposing E. coli to 10xMIC (31 µM) of 1 . Whole genome sequencing of four strains that had MIC values of >250 μM for 1 revealed mutations at D342E, G333D, D345N, and V335D in the ecLeuRS editing site. In contrast to wild-type E. coli , ganfeborole has MIC values of 1.56 µM – 6.25 µM with the four mutant strains, which indicates that ecLeuRS is the target of ganfeborole and that the inhibitor binds in the editing domain ( Table 4 ). View this table: View inline View popup Download powerpoint Table 4. MIC values of ganfeborole in strains of E. coli that are resistant to 1 To further characterize the binding of ganfeborole and AMP to LeuRS we used surface plasmon resonance (SPR). For both enzymes, ganfeborole bound ∼30-40-fold more potently to LeuRS than compound 1 , with K d values of 7 and 17 nM for mtLeuRS and ecLeuRS, respectively ( Figure 6 and Table 1 ). In addition, in keeping with the slow-onset inhibition observed from the time-dependent shift in IC 50 values, ganfeborole was found to have a long residence time on both enzymes with t R values of 100 and 32 min for ecLeuRS and mtLeuRS, respectively ( Table 1 ). Download figure Open in new tab Figure 6. SPR sensorgrams for the binding of 1 and ganfeborole to LeuRS in the presence of AMP. Single-cycle kinetic binding sensorgrams of (A) ecLeuRS and 1 , (B) ecLeuRS and ganfeborole, (C) mtLeuRS and 1 , and (D) mtLeuRS and ganfeborole. BAP-ecLeuRS or BAP-mtLeuRS was immobilized on the streptavidin sensor chip. Five different concentrations of 1 and ganfeborole were preincubated with AMP and then coinjected onto the SPR. The data was fitted to a 1:1 binding model using the Biacore T200 Evaluation Software to extract all the binding parameters. Each experiment was performed in at least two independent biological replicates. As the D342E mutation showed the greatest MIC shift for ganfeborole, we then analyzed the impact of this mutation on the binding kinetics of ganfeborole and 1 ( Figure 7 and Table 1 ). Whereas ganfeborole had an IC 50 of 2 nM for ecLeuRS following 1 h preincubation, this value increased 10-fold to 20 nM for the D342E mutant. In addition, using SPR, it was shown that ganfeborole-AMP became a rapid reversible inhibitor of D342E ecLeuRS and that the K d increased from 17 nM to 1.7 µM. Download figure Open in new tab Figure 7. Binding of ganfeborole to D342E ecLeuRS. (A) Time-dependent inhibition of ganfeborole to D342E ecLeuRS. Ganfeborole was preincubated with 800 pM D342E ecLeuRS and 20 μM ectRNA Leu for 2 min, 20 min and 1 h. The reaction was initiated with 10 μM ATP and 20 μM L-Leu, and then quenched with 20 mM EDTA after 5 min. Fluorescence polarization was converted to [AMP] using a standard curve, and the %inhibition was calculated and normalized using the DMSO-only control. The data was fit to a concentration-response equation using GraphPad Prism in which the Hill slope was constrained to 1. (B) Single-cycle kinetic binding sensorgrams of D342E ecLeuRS with ganfeborole. BAP-D342E ecLeuRS was immobilized on the streptavidin sensor chip. Five different concentrations of ganfeborole were preincubated with AMP and then coinjected onto the SPR chip. The data was fit to a 1:1 binding model using the Biacore T200 Evaluation Software to extract the binding parameters. DISCUSSION Ganfeborole (GSK3036656) is in clinical trials for the treatment of TB. 5 This compound has potent antibacterial activity toward drug-sensitive and drug-resistant strains of M. tuberculosis and has an MIC of 0.058 μM against M. tuberculosis H37Rv. Initial characterization of ganfeborole demonstrated >500-fold selectivity compared to human LeuRS homologs, with a reported IC 50 of 0.2 μM for mtLeuRS with 20 min preincubation. 11 The benzoxaboroles are time-dependent inhibitors of LeuRS with reported residence times of 1-8 h for AN3334 and 23 h for AN3213 (the racemate of epetraborole, AN3365) with ecLeuRS and tRNA Leu . 9 , 12 However, the time-dependent inhibition of mtLeuRS had not been previously studied. To compare and contrast the binding kinetics of ganfeborole with those of other benzoxaborole LeuRS inhibitors, we have studied the time-dependent activity of ganfeborole with mtLeuRS and the homolog from E. coli . Using an activity assay, we showed that the IC 50 values for inhibition of mtLeuRS by ganfeborole and the structural analog 1 that lacks the 4-Cl substituent decrease by more than 10-fold to 1-2 nM following a 1 h preincubation of enzyme, inhibitor, and mttRNA Leu . We then used SPR to further analyze the binding kinetics of the two compounds with mtLeuRS. Using AMP as a surrogate for tRNA Leu , 22 we showed that ganfeborole binds ∼50-fold more potently to mtLeuRS than 1 and has a residence time on the enzyme of 32 min compared to <1 min for 1 . These data thus confirm that ganfeborole is a slow-onset inhibitor of mtLeuRS, and the previously reported IC 50 of 0.2 μM likely reflects the initial rapid binding of the inhibitor to the enzyme in a two-step binding mechanism. We previously demonstrated that drug-target residence time can correlate with the post-antibiotic effect (PAE). 17 – 19 , 25 , 26 which is the delay in bacterial regrowth following exposure and removal of an antibiotic. 27 The PAE is an important component of antibacterial dosing regimens, 19 , 25 consequently, we determined the PAE generated by ganfeborole and 1 for H37Rv and observed PAE values of 77 h and 42 h, respectively, following 50xMIC exposure. The PAEs are similar to those generated by protein synthesis inhibitors such as rifampicin (68-77 h) and streptomycin (32 h), 28 , 29 and the ClpC1 inhibitor ecumicin (80 h), 15 but considerably longer than those caused by other TB drugs such as moxifloxacin (0-0.3 h), ethambutol (2 h) and isoniazid (0-20 h). 15 , 28 , 29 The PAEs generated by TB drugs become considerably longer when used in combination; for instance, isoniazid and rifampicin have a PAE of 160 h, 28 , 29 and thus, the ability of ganfeborole to elicit a PAE indicates that mtLeuRS is a highly vulnerable target and may prove to be an important aspect of human dosing regimens. Ganfeborole and 1 were found to have similar biochemical activity with ecLeuRS, the LeuRS homolog in E. coli . Both compounds were time-dependent inhibitors with IC 50 values of 2-5 nM following 1 h preincubation and K d values of 17 and 744 nM, respectively, determined by SPR in the presence of AMP. In addition, the ganfeborole-AMP complex had a residence time of 104 min on ecLeuRS compared to 1 min for the complex of AMP with 1 . However, whereas 1 had an MIC of 3.1 μM against a wild-type strain of E. coli , ganfeborole has no antibacterial activity up to 1 mM against either wild-type or pump mutant strains of E. coli . The lack of antibacterial activity was not due to an inability of ganfeborole to penetrate E. coli , since ganfeborole antagonized the activity of 1 . We subsequently showed that addition of Nva resulted in potent ganfeborole antibacterial activity which we speculate is due to increased dependence on the editing function of ecLeuRS due to misloading of ectRNA Leu by Nva. In agreement, addition of Leu antagonized the effect of Nva on the ganfeborole MIC. Oxaboroles inhibit aminoacyl-tRNA synthetases by trapping uncharged tRNA in the editing site through the formation of a complex with the terminal A76 ribose. However, studies by Hoffman et al. revealed that oxaboroles can also bind to LeuRS in the presence of nucleotides such as AMP ( Figure 8 ). 22 In the case of ecLeuRS, the results with ganfeborole demonstrate that the oxaborole inhibition complex formed with AMP does not inhibit the formation of leucyl-tRNA Leu and only leads to antibacterial activity when the LeuRS editing function is needed. In contrast, 1 and other oxaboroles that have antibacterial activity against E. coli in the absence of Nva must preferentially form a complex with tRNA Leu on the enzyme. Given that the concentration of nucleotides such as AMP and ATP is at least 10-fold higher than tRNA Leu (1-5 mM compared to 100-200 μM), 22 , 30 the inhibition complex formed with tRNA must be normally 10-100-fold more potent than that formed with (e.g.) AMP, which is reasonable given that tRNA will form many more interactions with the enzyme. Indeed, comparison of the IC 50 and K d values obtained from activity assays in the presence of tRNA Leu and SPR using AMP, respectively, shows that the K d /IC 50 ratio for ecLeuRS is ≥150-fold for 1 , AN3334 and epetraborole. However, the ratio drops to 8.5 for ganfeborole indicating the 5’ chloro group has preferentially stabilized the enzyme-inhibitor complex form with AMP compared to tRNA Leu . In the D342E editing site mutant the K d /IC 50 ratio for ganfeborole has increased to 85-fold, explaining the antibacterial activity of ganfeborole toward the mutant strain. Download figure Open in new tab Figure 8: Oxaboroles Bind to LeuRS either in complex with tRNA Leu or AMP. (A) The ganfeborole-AMP complex binds to the editing site of LeuRS, inhibiting editing but not aminoacylation. (B) The ganfeborole-tRNA Leu complex inhibits aminoacylation. The relative amounts of each complex depend on the concentrations of LeuRS, ganfeborole, tRNA Leu and nucleotides such as AMP. The ganfeborole-AMP complex is significantly more potent than the complex formed with other oxaboroles, thus the relative ratio of complex A to B is significantly higher for ganfeborole. Since mtLeuRS is more vulnerable than ecLeuRS, the required fractional occupancy of mtLeuRS by ganfeborole-tRNA Leu is smaller than that in ecLeuRS. In contrast to E. coli , ganfeborole has potent activity toward M. tuberculosis despite similar differences in the K d /IC 50 ratios for 1 and ganfeborole (160 and 7-fold, respectively) compared to ecLeuRS. Here we demonstrate that mtLeuRS is a highly vulnerable target in contrast to ecLeuRS which we previously showed was a low vulnerability target. 13 Thus, one possible explanation for the differential activity of ganfeborole in the two organisms is that a smaller fraction of mtLeuRS compared to ecLeuRS has to be occupied by ganfeborole-tRNA Leu to inhibit bacterial growth ( Figure 8 ). 25 In addition, while ganfeborole has a significant residence time on mtLeuRS with AMP, the value of 32 min is short relative to the ∼24 h doubling time of M. tuberculosis , whereas it is long (104 min) on ecLeuRS compared to the ∼20 min doubling time of E. coli . In either case, the high vulnerability of mtLeuRS and ability of ganfeborole to generate a significant post-antibiotic effect in Mtb , support the excellent in vivo efficacy of ganfeborole in the recent successfully completed Phase 2a early bactericidal activity clinical trial. MATERIALS AND METHODS Compounds and Bacterial Strains Ganfeborole, epetraborole, AN3334 and 1 were gifts from AN2 Therapeutics. L-Norvaline and L-leucine were purchased from Fisher Scientific. Adenosine 5’-monophosphate monohydrate was purchased from Sigma-Aldrich. E. coli ATCC 25922 was purchased from ATCC. E. coli ΔacrAB was kindly provided by Prof. Vincent Tam at the University of Houston, and E. coli ΔtolC was kindly provided by Prof. Zgurskaya at the University of Oklahoma. Muller Hinton Broth (Cation-Adjusted) and Muller Hinton Agar were purchased from BD Difco. Cloning, Expression, and Purification of LeuRS The E. coli leucyl tRNA synthetase was amplified from E. coli ATCC 25922 by PCR using primer 1 ATGCAAGAGCAATACCGCCCGGAAGAGATAGAATC and primer 2 TTAGCCAACGACCAGATT GAGGAGTTTACCGGGTAC. The gene insert was gel extracted and cloned into the pEMB54 vector using the Gibson Assembly method, which is an ampicillin-resistant, arabinose-inducible vector with a pMB1 origin of replication and 6XHis-Smt3 under the PBAD (araBp) promoter, including a multiple cloning site containing BamHI and HindIII sites following the Smt3 sequence. Genes cloned into pEMB54 via BamHI/HindIII are fused in-frame with 6XHis-Smt3, leaving a serine linker following the C-terminal double glycine of Smt3. The codon-optimized Leucyl tRNA synthetase from Mycobacterium tuberculosis (mtLeuRS, WP_128882958.1) was sub-cloned into pET28TEV vector via NdeI/BamHI, which is fused in-frame with the N-terminal 6XHis Tag followed by a TEV cleavage site. The constructs utilized for the SPR study were inserted with a C-terminal Biotin Acceptor Peptide (BAP) using primer 1 GCGCAGAAAATTGAATGGCATGAAAAGCTTGGCTGTTTTG and primer 2 TTCAAAAATATCGTTCAGGCCACCCACAACCAGGTTCAGC for ecLeuRS and primer 1 GCAGAAAATTGAATGGCATGAATAAGGATCCGAATTCGAG and primer 2 GCTTCAAAAATATCGTTCAGGCCAATCACCAGGTTAACCAG for mtLeuRS. The amplified products were circulated with the Kinase, Ligase, and DpnI reaction mix (KLD Enzyme Mix, NEB). The final ligation was transformed into chemically competent DH5α cells, and the construct was mini-prepped from a colony, after which the sequence was confirmed by Sanger DNA sequencing. The E. coli Bl21 (DE3) component cells were transformed with the pEMB54 ecLeuRS or pET28TEV mtLeuRS construct by heat shock at 42°C and plated on LB-Agar plate containing 100 μg/mL of ampicillin (ecLeuRS) or 50 μg/mL of kanamycin (mtLeuRS). The overnight culture was prepared by inoculating LB Miller broth, containing appropriate antibiotic, with a single colony and incubating at 37°C in an orbital shaker (250 rpm). After overnight incubation at 37°C, 10 mL of the overnight culture was inoculated into 500 mL of 2XYT media broth with appropriate antibiotic. The cultures were incubated at 37°C in an orbital shaker (250 rpm) until the OD600 ∼0.6 - 0.8 was obtained, and then, the temperature was lowered to 18°C. Once the OD600 was ∼0.8 - 1, 0.1% of arabinose (Sigma-Aldrich) or 1 mM of isopropyl β-D-1-thiogalactopyranoside (IPTG, Gold Biosciences) was added to induce protein expression, and the culture was incubated with shaking for an additional 16 h. Cells from the 1 L culture were harvested by centrifugation at 5000 rpm (4°C) for 20 min, and the cell pellet was stored at −20°C. After thawing, the pellet was resuspended in 35 mL of lysis buffer (25 mM Tris-HCl pH 8, 150 mM NaCl, 2 mM MgCl 2 , and 5 mM imidazole, buffer A) and lysed by sonication. The cell debris was removed by ultracentrifugation at 40,000 rpm for 1 h (4°C) and filtered by a 40 μm constrainer. The filtered supernatant was then loaded into a 5 mL Ni-NTA column (GE) previously equilibrated with buffer A. After all the supernatant was applied to the column, the column was then washed with 10-20 CV of buffer A containing 10-30 mM of Imidazole. A gradient of 30-500 mM of Imidazole elution was performed, and the protein was eluted at 500 mM Imidazole. Fractions containing protein were pooled and concentrated by a 10 kDa cut-off concentrator and desalted using the HiPrep 26/10 desalting column (GE) with buffer A. Fractions containing protein were pooled, and 250 μg of homemade UlpI SUMO protease (ecLeuRS) or TEV protease (mtLeuRS) was added to cleave the SUMO tag/6XHis tag at 4°C overnight. The cleaved protein was loaded onto the Ni-NTA column and washed 8 CV with buffer A. Fraction containing LeuRS was concentrated by a 10 kDa cut-off concentrator and loaded onto a HiLoad 16/600 Superdex-75 size exclusion column previously equilibrated with the store buffer (25 mM Tris-HCl pH 8, 150 mM NaCl, 2 mM DTT, 10% glycerol). For the sample that contains the BAP, biotinylation was performed prior to size exclusion chronography. The BAP-protein was desalted into the biotinylation buffer (50 mM Bicine pH 8, 30 mM NaCl), followed by adding 10 mM ATP, 10 mM magnesium acetate, and 1 mM d-Biotin. ∼300 μg of homemade BirA was added into the sample and incubated at 25°C for 1 to 2 h, and the BirA was separated using size exclusion chromatography. Pure protein fractions were collected, and the purity of the protein was confirmed by SDS-PAGE. The concentration of the protein was determined by Absorbance spectrum using extinction coefficient at 280 nm (ε280 = 169,765 M -1 cm - 1 for ecLeuRS, 189,330 M -1 cm - 1 for mtLeuRS). In Vitro Transcription of tRNA Leu All oligodeoxynucleotides used as templates for enzymatic transcription were obtained from Integrated DNA Technologies. The oligonucleotides used for construction of the E. coli tRNA Leu gene were PO 4 - GGATCC TAATACGACTCACTATA GCGGGAGTGGCGAAATTGGTAGACG CACCAGATTTAG and TGGTGCGGGAGGCGAGACTTGAACTCGCACACCTTGCGGCGCCAGAAC CTAAATCTGGTG . Oligonucleotides were designed such that the sense strand corresponding to the 5’ end of the sequence possessed a 12 bp overlap with the 3’ antisense strand. The underlined portions of the sequence represent the overlapping regions, and the bold text indicates the T7 RNA polymerase promoter. Oligonucleotides were mixed to an equimolar concentration of 4 μM in a reaction solution containing 400 μM dNTPs, 10 mM Tris-HCl, pH 7.5, 10 mM MgSO 4 , 7.5 mM DTT, and 50 U/mL Klenow fragment polymerase (New England Biolabs). 31 The mixture was cycled between 10°C and 37°C at 30 s intervals for eight cycles. The PCR products were extracted from a 3% agarose gel by cutting the band with the correct molecular weight. The gel-extracted gene was then amplified by PCR using the Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific) with primers 5’-GGATCCTAATACGACTCACTATAGCGGGAG and 5’TGGTGCGGGAGGCGA GACTTG. The second PCR amplified product was purified by the PCR clean-up kit (Qiagen). The oligonucleotides used for the construction of the M. tuberculosis tRNA Leu gene were PO 4 -GGATCC TAATACGACTCACTATA GGGCGAGTGGCGGAATGGCAGACGCGCTG GCTTCAGGTGCCAGTGTCCTTCGGGACGTGGGGGTTCAAGTCCCCCTTCGCCCACCA (Synthesized by GenScript). The in vitro transcription was performed using the HiScribe T7 High Yield RNA Synthesis Kit (NEB). Briefly, 7.5 mM of NTP, 10 mM of T7 RNA polymerase mix, 0.75x of reaction buffer, and 300 ng of purified DNA template were used for the in vitro transcription reaction. The reaction mixture was incubated at 37°C for 16 h, followed by the addition of 2 U DNase digest for 15 min at 37°C. Subsequently, 0.1 volume of 3 M sodium acetate was added to the final tRNA Leu product, and the tRNA Leu was precipitated using ethanol. IC 50 Measurements using LeuRS Aminoacylation-Activity Assay The aminoacylation reaction was performed in 50 mM HEPES buffer pH 8, containing 1 mM MgCl 2 and 1 mM DTT. The formation of the AMP product was monitored over time using the Transcreener AMP 2 /GMP 2 FP Assay Kit (BellBrook). ecLeuRS or mtLeuRS (800 pM) was preincubated with 20 µM ectRNA Leu or mttRNA Leu and 2-fold serial dilutions of the ganfeborole or 1 from 2 min to 1 h, after which the reaction was initiated by adding 10 µM ATP and 20 µM L-leucine. After 5 min at 25°C, the reaction was quenched by adding the detection mixture, which included 20 mM EDTA. After 90 min at 25°C, the fluorescence polarization was read on a plate reader (BioTek Synergy Neo2) with 620 nm excitation and 680 nm emission. The enzyme activity was determined by converting the mP value to the AMP concentration using the standard curve. The data were fitted to a nonlinear regression model using GraphPad Prism to determine the IC 50 value for each compound. Residence Time Measurements using Surface Plasmon Resonance The kinetic assay was performed by SPR using a Biacore T200 (Cytiva). BAP-ecLeuRS full length or BAP-mtLeuRS full length was immobilized on the Serie S SA Sensor chip (Cytiva) at ∼3500 response units after the chip surface was rinsed with a mixed solution of 1 M NaCl and 50 mM NaOH, and tested for binding at 25°C. One of the two flow paths was left empty as a reference for nonspecific binding. The running buffer comprises 10 mM HEPES, 150 mM NaCl, and 0.5% (v/v) Surfectant P20, pH 7.4 (HBS-P buffer, Cytiva). The ganfeborole or 1 stock solution was diluted into the running buffer containing 1% DMSO and 1 mM AMP to yield a series of working stocks, which included five different dilution concentrations for single-cycle kinetics, and preincubated at RT for 1 h before injections. The flow rate was 60 µL/min, and the injection time was set to 120 s with a 60 s equilibration time between injections and a 3600 s dissociation time. Data was referenced using a reference flow cell in line with the active flow cell. All data were analyzed using the Biacore T200 Evaluation Software (GE Healthcare). All experiments were done in at least duplicates. Minimum Inhibitory Concentration E. coli ATCC 25922 was grown to mid-log phase (OD600 of 0.5 - 0.7) in M9 minimal media, consisting of M9 salts (6.78 g/L Na 2 HPO 4 , 3 g/L KH 2 PO 4 , 0.5 g/L NaCl, 1 g/L NH 4 Cl), 5 g/L glucose, 1 mM MgSO 4 , 0.1 mM CaCl 2 , 100 μL trace metal solution, 33 μM thiamine at 37°C in an orbital shaker. An inoculum of 10 6 CFU/mL was added to each well, containing 2-fold dilutions of inhibitors in a round-bottom 96-well plate. The MIC is defined as the minimum concentration of the inhibitor at which no visible growth showed after 16 h at 37°C. All experiments were performed in triplicate. Minimum inhibitory concentration against replicating Mtb is determined using a previously described Microplate Alamar Blue Assay (MABA). 14 Briefly, compound stocks were prepared in dimethyl sulfoxide (DMSO) at 100x of the highest desired final concentration. Subsequently, 2 µL of the compound DMSO stock was transferred to the assay plate containing 100 µL of Middlebrook 7H12 media (4.7 g 7H9 broth, containing 1 g casitone (Bacto), 5 g bovine serum albumin (BSA), 4 mg catalase and 5.6 mg palmitic acid for 1 L media). Two-fold serial dilutions of the compounds was performed in triplicates in the assay plate. Plates are then inoculated with Mtb strain H37Rv (ATCC 27294) to achieve a final density of ∼ 1 × 10 5 CFU/mL in each well and incubated for 7 days at 37°C. At the end of 7 days, a resazurin dye/tween 80 mixture (0.6 mM resazurin dye and 12 µL of 20% Tween 80) was added to each well, and the plates were further incubated for an additional 18 to 24 h at 37°C. Fluorescence was measured using a CLARIOstar (BMG LABTECH, Ortenberg, Germany) plate reader on day 8. The MIC is defined as the lowest concentration of compound that resulted in a 90%reduction in fluorescence compared to the controls. Post-antibiotic Effect in Mtb The post-antibiotic effect in Mtb was determined using a previously described method. 15 Briefly, 2 µL of compound stock was transferred to 200 µL of bacterial culture of 1 × 10 6 CFU/mL density in row B of 96-well plates. Each compound was tested at 50X, 30X, 10X, and 1X MIC concentrations. Wells from rows C to G were filled with 180 µL of 7H12 media (4.7 g 7H9 broth), containing 1 g casitone (Bacto), 5 g bovine serum albumin (BSA), 4 mg catalase and 5.6 mg palmitic acid for 1 L media). Plates were incubated in a humidified incubator for 2.5 h at 37°C, after which 20 µL of bacterial culture from row B were serially diluted 10-fold up to row G (10 5 -fold dilution), and the plate was transferred back to the incubator. Following serial dilutions, the luminescence of the plate was read every day up to day 14. Although cultures were serially diluted up to 10 5 , graphs were plotted, and PAE was calculated based on the 10 4 dilution. PAE is defined as the difference in time taken by compound treated culture to show a 1.5 log increase in RLU compared to control wells. Checkerboard MIC Assay and FIC Index E. coli ATCC 25922 was grown to mid-log phase (OD 600 of 0.5 - 0.7) in cation-adjusted Mueller Hinton (CAMH) media at 37°C in an orbital shaker. Then, 100 µL of 10 6 CFU/mL cells were added to each well in a round-bottom 96-well plate containing 2-fold dilutions of two compounds. The MIC was defined as the minimum concentration of the inhibitor at which no visible growth was observed after 16 h at 37°C. All experiments were performed in triplicate. The fractional inhibitory concentration index (FICI) was determined in order to calculate the synergistic effect between the two compounds using Equation 1 . 32 , 33 In Equation 1 , FIC A and FIC B are the FIC values of compounds A and B, respectively, and MIC A is the MIC of compound A, MIC B is the MIC of compound B, MIC AB is the MIC of compound A in the presence of compound B and MIC BA is the MIC of compound B in the presence of compound A. A FICI ≤ 0.5 indicates a synergistic effect, 0.5 < FICI ≤ 1 indicates an additive effect, 1 4 indicates an antagonistic effect. Time-Kill Assays in E. coli ATCC25922 E. coli ATCC 25922 was grown to mid-log phase (OD600 of 0.5 - 0.7) in M9 minimal media, consisting of M9 salts (6.78 g/L Na 2 HPO 4 , 3 g/L KH 2 PO 4 , 0.5 g/L NaCl, 1 g/L NH 4 Cl), 5 g/L glucose, 1 mM MgSO 4 , 0.1 mM CaCl 2 , 100 μL trace metal solution, 33 μM thiamine at 37°C in an orbital shaker. Then, an inoculum of 10 6 CFU/mL was added to the media containing various concentrations of ganfeborole, 1 , L-norvaline, or vehicle (DMSO). Subsequently, 100 μL aliquots were taken at 0, 2 h, 4 h, 6 h, 8 h, and 24 h and plated in serial dilutions on Muller-Hinton agar plates. After incubating at 37°C overnight, CFUs were calculated by counting the colonies on each plate. Generation and Sequencing of E. coli Strains Resistant to 1 E. coli ATCC 25922 was grown in CAMH media to OD600 = 1 at 37°C in an orbital shaker. Subsequnetly,100 µL of E. coli cells were plated on Mueller-Hinton agar containing 31 µM (10xMIC) of 1 . Plates were incubated at 37°C overnight and four colonies were used to inoculate 20 mL CAMH medium containing 31 µM (10xMIC) 1 at 37°C overnight in an orbital shaker. The E. coli cells were pelleted at 37°C for 10 min at 3900 rpm. DNA extraction and Whole Genome Sequencing were performed by Admera Health. AUTHOR INFORMATION Corresponding Author Peter Tonge - Center for Advanced Study of Drug Action, and Departments of Chemistry and Radiology, John S. Toll Drive, Stony Brook University, Stony Brook, NY 11794-3400, United States; Department of Biomedical Genetics, University of Rochester, Rochester, NY 14642, United States; Email: peter.tonge{at}stonybrook.edu M.R.K. Alley – AN2 Therapeutics, Menlo Park, CA 94027, United States; Email: dalley{at}an2therapeutics.com Authors Mingqian Wang - Center for Advanced Study of Drug Action, and Department of Chemistry, John S. Toll Drive, Stony Brook University, Stony Brook, NY 11794-3400, United States; Email: mingqian.wang.1{at}stonybrook.edu Yongle He - Center for Advanced Study of Drug Action, and Department of Chemistry, John S. Toll Drive, Stony Brook University, Stony Brook, NY 11794-3400, United States; Email: yongle.he{at}stonybrook.edu Siobhan Cohen - Center for Advanced Study of Drug Action, and Department of Chemistry, John S. Toll Drive, Stony Brook University, Stony Brook, NY 11794-3400, United States; Email: siobhan.cohen{at}stonybrook.edu Amanda Strohm - Center for Advanced Study of Drug Action, and Department of Chemistry, John S. Toll Drive, Stony Brook University, Stony Brook, NY 11794-3400, United States; Email: amanda.strohm{at}stonybrook.edu Gauri Shetye - Institute for Tuberculosis Research, College of Pharmacy, University of Illinois at Chicago, 833 South Wood Street, Chicago, IL 60612, United States; Email: gauris{at}uic.edu Scott G. Franzblau - Institute for Tuberculosis Research, College of Pharmacy, University of Illinois at Chicago, 833 South Wood Street, Chicago, IL 60612, United States; Email: sgf{at}uic.edu Stephen G. Walker - Department of Oral Biology and Pathology, Stony Brook University, Stony Brook, NY 11794, United States; Email: stephen.walker{at}stonybrookmedicine.edu ABBREVIATIONS LeuRS Leucyl-tRNA-Synthetase PAE Post-antibiotic Effect MIC Minimum Inhibitory Concentration Nva norvaline SPR surface plasmon resonance. For Table of Contents Use Only Download figure Open in new tab ACKNOWLEDGMENTS This study was supported by the National Institutes of Health (GM149297 to P.J.T.). Y.H. was supported by a National Institutes of Health Chemistry-Biology Interface Training Grant (GM136572), and S.A.C. was supported by a National Institutes of Health Training Grant for Scholars in Biomedical Sciences (GM148331). Funder Information Declared National Institutes of Health, https://ror.org/01cwqze88 , GM149297 , GM136572 , GM148331 REFERENCES (1). ↵ Hoelscher , M. ; Barros-Aguirre , D. ; Dara , M. ; Heinrich , N. ; Sun , E. ; Lange , C. ; Tiberi , S. ; Wells , C . Candidate anti-tuberculosis medicines and regimens under clinical evaluation Clin Microbiol Infect , 2024 , 30 , 1131 – 1138 . DOI: 10.1016/j.cmi.2024.06.016 OpenUrl CrossRef PubMed (2). ↵ Dartois , V. ; Dick , T . Therapeutic developments for tuberculosis and nontuberculous mycobacterial lung disease Nat Rev Drug Discov , 2024 , 23 , 381 – 403 . DOI: 10.1038/s41573-024-00897-5 OpenUrl CrossRef PubMed (3). ↵ De Ruysscher , D. ; Pang , L. ; Lenders , S. M. G. ; Cappoen , D. ; Cos , P. ; Rozenski , J. ; Strelkov , S. V. ; Weeks , S. D. ; Van Aerschot , A . Synthesis and structure-activity studies of novel anhydrohexitol-based Leucyl-tRNA synthetase inhibitors Eur J Med Chem , 2021 , 211 , 113021 . DOI: 10.1016/j.ejmech.2020.113021 OpenUrl CrossRef (4). ↵ Cheng , B. ; Cai , Z. ; Luo , Z. ; Luo , S. ; Luo , Z. ; Cheng , Y. ; Yu , Y. ; Guo , J. ; Ju , Y. ; Gu , Q. ; Xu , J. ; Jiang , X. ; Li , G. ; Zhou , H . Structure-Guided Design of Halofuginone Derivatives as ATP- Aided Inhibitors Against Bacterial Prolyl-tRNA Synthetase J Med Chem , 2022 , 65 , 15840 – 15855 . DOI: 10.1021/acs.jmedchem.2c01496 OpenUrl CrossRef PubMed (5). ↵ Diacon , A. H. ; Barry , C. E ., 3rd; Carlton , A. ; Chen , R. Y. ; Davies , M. ; de Jager , V. ; Fletcher , K. ; Koh , G. ; Kontsevaya , I. ; Heyckendorf , J. ; Lange , C. ; Reimann , M. ; Penman , S. L. ; Scott , R. ; Maher-Edwards , G. ; Tiberi , S. ; Vlasakakis , G. ; Upton , C. M. ; Aguirre , D. B . A first-in- class leucyl-tRNA synthetase inhibitor, ganfeborole, for rifampicin-susceptible tuberculosis: a phase 2a open-label, randomized trial Nat Med , 2024 , 30 , 896 – 904 . DOI: 10.1038/s41591-024-02829-7 OpenUrl CrossRef PubMed (6). ↵ Zhang , P. ; Ma , S . Recent development of leucyl-tRNA synthetase inhibitors as antimicrobial agents Med Chem Commun , 2019 , 10 , 1329 – 1341 . DOI: 10.1039/c9md00139e OpenUrl CrossRef PubMed (7). ↵ Sarkar , J. ; Mao , W. ; Lincecum , T. L. , Jr. ; Alley , M. R. ; Martinis , S. A . Characterization of benzoxaborole-based antifungal resistance mutations demonstrates that editing depends on electrostatic stabilization of the leucyl-tRNA synthetase editing cap FEBS Lett , 2011 , 585 , 2986 – 2991 . DOI: 10.1016/j.febslet.2011.08.010 OpenUrl CrossRef PubMed (8). ↵ Rock , F. L. ; Mao , W. ; Yaremchuk , A. ; Tukalo , M. ; Crepin , T. ; Zhou , H. ; Zhang , Y. K. ; Hernandez , V. ; Akama , T. ; Baker , S. J. ; Plattner , J. J. ; Shapiro , L. ; Martinis , S. A. ; Benkovic , S. J. ; Cusack , S. ; Alley , M. R . An antifungal agent inhibits an aminoacyl-tRNA synthetase by trapping tRNA in the editing site Science , 2007 , 316 , 1759 – 1761 . DOI: 10.1126/science.1142189 OpenUrl Abstract / FREE Full Text (9). ↵ Hernandez , V. ; Crepin , T. ; Palencia , A. ; Cusack , S. ; Akama , T. ; Baker , S. J. ; Bu , W. ; Feng , L. ; Freund , Y. R. ; Liu , L. ; Meewan , M. ; Mohan , M. ; Mao , W. ; Rock , F. L. ; Sexton , H. ; Sheoran , A. ; Zhang , Y. ; Zhang , Y. K. ; Zhou , Y. ; Nieman , J. A. ; Anugula , M. R. ; Keramane el , M. ; Savariraj , K. ; Reddy , D. S. ; Sharma , R. ; Subedi , R. ; Singh , R. ; O’Leary , A. ; Simon , N. L. ; De Marsh , P. L. ; Mushtaq , S. ; Warner , M. ; Livermore , D. M. ; Alley , M. R. ; Plattner , J. J . Discovery of a Novel Class of Boron-Based Antibacterials with Activity against Gram- Negative Bacteria Antimicrob Agents Chemother , 2013 , 57 , 1394 – 1403 . DOI: 10.1128/AAC.02058-12 OpenUrl Abstract / FREE Full Text (10). ↵ Palencia , A. ; Li , X. ; Bu , W. ; Choi , W. ; Ding , C. Z. ; Easom , E. E. ; Feng , L. ; Hernandez , V. ; Houston , P. ; Liu , L. ; Meewan , M. ; Mohan , M. ; Rock , F. L. ; Sexton , H. ; Zhang , S. ; Zhou , Y. ; Wan , B. ; Wang , Y. ; Franzblau , S. G. ; Woolhiser , L. ; Gruppo , V. ; Lenaerts , A. J. ; O’Malley , T. ; Parish , T. ; Cooper , C. B. ; Waters , M. G. ; Ma , Z. ; Ioerger , T. R. ; Sacchettini , J. C. ; Rullas , J. ; Angulo-Barturen , I. ; Perez-Herran , E. ; Mendoza , A. ; Barros , D. ; Cusack , S. ; Plattner , J. J. ; Alley , M. R . Discovery of Novel Oral Protein Synthesis Inhibitors of Mycobacterium tuberculosis That Target Leucyl-tRNA Synthetase Antimicrob Agents Chemother , 2016 , 60 , 6271 – 6280 . DOI: 10.1128/AAC.01339-16 OpenUrl Abstract / FREE Full Text (11). ↵ Li , X. ; Hernandez , V. ; Rock , F. L. ; Choi , W. ; Mak , Y. S. L. ; Mohan , M. ; Mao , W. ; Zhou , Y. ; Easom , E. E. ; Plattner , J. J. ; Zou , W. ; Perez-Herran , E. ; Giordano , I. ; Mendoza-Losana , A. ; Alemparte , C. ; Rullas , J. ; Angulo-Barturen , I. ; Crouch , S. ; Ortega , F. ; Barros , D. ; Alley , M. R. K . Discovery of a Potent and Specific M. tuberculosis Leucyl-tRNA Synthetase Inhibitor: (S)-3-(Aminomethyl)-4-chloro-7-(2-hydroxyethoxy)benzo[c][1,2]oxaborol-1(3H)-ol (GSK656) J Med Chem , 2017 , 60 , 8011 – 8026 . DOI: 10.1021/acs.jmedchem.7b00631 OpenUrl CrossRef PubMed (12). ↵ Shapiro , A. B. ; Gao , N. ; Hajec , L. ; McKinney , D. C . Time-dependent, reversible, oxaborole inhibition of Escherichia coli leucyl-tRNA synthetase measured with a continuous fluorescence assay Anal Biochem , 2012 , 431 , 48 – 53 . DOI: 10.1016/j.ab.2012.08.024 OpenUrl CrossRef PubMed (13). ↵ Wang , M. ; He , Y. ; Cohen , S. A. ; Strohm , A. R. ; Haley , J. D. ; Walker , S. G. ; Alley , M. R. K. ; Tonge , P. J . Time-Dependent Inhibition of Leucyl-tRNA-Synthetase (LeuRS): Insight into Target Vulnerability ACS Infect Dis , 2025 , 11 , 977 – 985 . DOI: 10.1021/acsinfecdis.4c01017 OpenUrl CrossRef PubMed (14). ↵ Collins , L. A. ; Franzblau , S. G . Microplate Alamar blue assay versus BACTEC 460 system for high-throughput screening of compounds against Mycobacterium tuberculosis and Mycobacterium avium Antimicrob . Agents. Chemother ., 1997 , 41 , 1004 – 1009 . DOI: OpenUrl Abstract / FREE Full Text (15). ↵ Shetye , G. S. ; Choi , K. B. ; Kim , C. Y. ; Franzblau , S. G. ; Cho , S . In Vitro Profiling of Antitubercular Compounds by Rapid, Efficient, and Nondestructive Assays Using Autoluminescent Mycobacterium tuberculosis Antimicrob Agents Chemother , 2021 , 65 , e0028221 . DOI: 10.1128/AAC.00282-21 OpenUrl CrossRef PubMed (16). ↵ Basak , S. ; Li , Y. ; Tao , S. ; Daryaee , F. ; Merino , J. ; Gu , C. ; Delker , S. L. ; Phan , J. N. ; Edwards , T. E. ; Walker , S. G. ; Tonge , P. J . Structure-Kinetic Relationship Studies for the Development of Long Residence Time LpxC Inhibitors J Med Chem , 2022 , 65 , 11854 – 11875 . DOI: 10.1021/acs.jmedchem.2c00974 OpenUrl CrossRef PubMed (17). ↵ Basu , R. ; Wang , N. ; Basak , S. ; Daryaee , F. ; Babar , M. ; Allen , E. K. ; Walker , S. G. ; Haley , J. D. ; Tonge , P. J . Impact of target turnover on the translation of drug-target residence time to time-dependent antibacterial activity ACS Infect Dis , 2021 , 7 , 2755 – 2763 . DOI: 10.1021/acsinfecdis.1c00317 OpenUrl CrossRef PubMed (18). Davoodi , S. ; Daryaee , F. ; Chang , A. ; Walker , S. G. ; Tonge , P. J . Correlating drug-target residence time and post-antibiotic effect: insight into target vulnerability ACS Infect Dis , 2020 , 6 , 629 – 636 . DOI: 10.1021/acsinfecdis.9b00484 OpenUrl CrossRef PubMed (19). ↵ Basak , S. ; Tonge , P. J . In Med Chem Rev ; Bronson , J. J. , Ed.; Medicinal Chemistry Division of the American Chemical Society : Washington, DC ., 2020 ; Vol. 55 , p 367 – 380 . OpenUrl (20). ↵ Bosch , B. ; DeJesus , M. A. ; Poulton , N. C. ; Zhang , W. ; Engelhart , C. A. ; Zaveri , A. ; Lavalette , S. ; Ruecker , N. ; Trujillo , C. ; Wallach , J. B. ; Li , S. ; Ehrt , S. ; Chait , B. T. ; Schnappinger , D. ; Rock , J. M . Genome-wide gene expression tuning reveals diverse vulnerabilities of M. tuberculosis Cell , 2021 , 184 , 4579 – 4592 e4524. DOI: 10.1016/j.cell.2021.06.033 OpenUrl CrossRef PubMed (21). ↵ Purnapatre , K. P. ; Rao , M. ; Pandya , M. ; Khanna , A. ; Chaira , T. ; Bambal , R. ; Upadhyay , D. J. ; Masuda , N . In Vitro and In Vivo Activities of DS86760016, a Novel Leucyl-tRNA Synthetase Inhibitor for Gram-Negative Pathogens Antimicrob Agents Chemother , 2018 , 62 . DOI: 10.1128/AAC.01987-17 OpenUrl Abstract / FREE Full Text (22). ↵ Hoffmann , G. ; Le Gorrec , M. ; Mestdach , E. ; Cusack , S. ; Salmon , L. ; Jensen , M. R. ; Palencia , A . Adenosine-Dependent Activation Mechanism of Prodrugs Targeting an Aminoacyl-tRNA Synthetase J Am Chem Soc , 2023 , 145 , 800 – 810 . DOI: 10.1021/jacs.2c04808 OpenUrl CrossRef PubMed (23). ↵ Cvetesic , N. ; Palencia , A. ; Halasz , I. ; Cusack , S. ; Gruic-Sovulj , I . The physiological target for LeuRS translational quality control is norvaline EMBO J , 2014 , 33 , 1639 – 1653 . DOI: 10.15252/embj.201488199 OpenUrl Abstract / FREE Full Text (24). ↵ Sullivan , J. R. ; Lupien , A. ; Kalthoff , E. ; Hamela , C. ; Taylor , L. ; Munro , K. A. ; Schmeing , T. M. ; Kremer , L. ; Behr , M. A . Efficacy of epetraborole against Mycobacterium abscessus is increased with norvaline PLoS Pathog , 2021 , 17 , e1009965 . DOI: 10.1371/journal.ppat.1009965 OpenUrl CrossRef PubMed (25). ↵ Tonge , P. J . Drug-target kinetics in drug discovery ACS Chem Neurosci , 2018 , 9 , 29 – 39 . DOI: 10.1021/acschemneuro.7b00185 OpenUrl CrossRef PubMed (26). ↵ Walkup , G. K. ; You , Z. ; Ross , P. L. ; Allen , E. K. ; Daryaee , F. ; Hale , M. R. ; O’Donnell , J. ; Ehmann , D. E. ; Schuck , V. J. ; Buurman , E. T. ; Choy , A. L. ; Hajec , L. ; Murphy-Benenato , K. ; Marone , V. ; Patey , S. A. ; Grosser , L. A. ; Johnstone , M. ; Walker , S. G. ; Tonge , P. J. ; Fisher , S. L . Translating slow-binding inhibition kinetics into cellular and in vivo effects Nat Chem Biol , 2015 , 11 , 416 – 423 . DOI: 10.1038/nchembio.1796 OpenUrl CrossRef PubMed (27). ↵ Bundtzen , R. W. ; Gerber , A. U. ; Cohn , D. L. ; Craig , W. A . Postantibiotic suppression of bacterial growth Rev Infect Dis , 1981 , 3 , 28 – 37 . DOI: 10.1093/clinids/3.1.28 OpenUrl CrossRef (28). ↵ Chan , C. Y. ; Au-Yeang , C. ; Yew , W. W. ; Hui , M. ; Cheng , A. F . Postantibiotic effects of antituberculosis agents alone and in combination Antimicrob Agents Chemother , 2001 , 45 , 3631 – 3634 . DOI: 10.1128/AAC.45.12.3631-3634.2001 OpenUrl Abstract / FREE Full Text (29). ↵ Chan , C. Y. ; Au-Yeang , C. ; Yew , W. W. ; Leung , C. C. ; Cheng , A. F . In vitro postantibiotic effects of rifapentine, isoniazid, and moxifloxacin against Mycobacterium tuberculosis Antimicrob Agents Chemother , 2004 , 48 , 340 – 343 . DOI: 10.1128/AAC.48.1.340-343.2004 OpenUrl Abstract / FREE Full Text (30). ↵ Bennett , B. D. ; Kimball , E. H. ; Gao , M. ; Osterhout , R. ; Van Dien , S. J. ; Rabinowitz , J. D . Absolute metabolite concentrations and implied enzyme active site occupancy in Escherichia coli Nat Chem Biol , 2009 , 5 , 593 – 599 . DOI: 10.1038/nchembio.186 OpenUrl CrossRef PubMed Web of Science (31). ↵ Korencic , D. ; Soll , D. ; Ambrogelly , A . A one-step method for in vitro production of tRNA transcripts Nucleic Acids Res , 2002 , 30 , e105 . DOI: 10.1093/nar/gnf104 OpenUrl CrossRef PubMed (32). ↵ Song , M. ; Liu , Y. ; Li , T. ; Liu , X. ; Hao , Z. ; Ding , S. ; Panichayupakaranant , P. ; Zhu , K. ; Shen , J . Plant Natural Flavonoids Against Multidrug Resistant Pathogens Adv Sci , 2021 , 8 , e2100749 . DOI: 10.1002/advs.202100749 OpenUrl CrossRef (33). ↵ Liu , S. ; She , P. ; Li , Z. ; Li , Y. ; Li , L. ; Yang , Y. ; Zhou , L. ; Wu , Y . Drug synergy discovery of tavaborole and aminoglycosides against Escherichia coli using high throughput screening AMB Express , 2022 , 12 , 151 . DOI: 10.1186/s13568-022-01488-6 OpenUrl CrossRef View the discussion thread. Back to top Previous Next Posted August 03, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Selectivity of the time-dependent M. tuberculosis LeuRS inhibitor ganfeborole is driven by target vulnerability Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Selectivity of the time-dependent M. tuberculosis LeuRS inhibitor ganfeborole is driven by target vulnerability Mingqian Wang , YongLe He , Siobhan A. Cohen , Amanda R. Strohm , Gauri Shetye , Scott G. Franzblau , Stephen G. Walker , Dickon Alley , Peter J. Tonge bioRxiv 2025.07.31.667927; doi: https://doi.org/10.1101/2025.07.31.667927 Share This Article: Copy Citation Tools Selectivity of the time-dependent M. tuberculosis LeuRS inhibitor ganfeborole is driven by target vulnerability Mingqian Wang , YongLe He , Siobhan A. Cohen , Amanda R. Strohm , Gauri Shetye , Scott G. Franzblau , Stephen G. Walker , Dickon Alley , Peter J. Tonge bioRxiv 2025.07.31.667927; doi: https://doi.org/10.1101/2025.07.31.667927 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Biochemistry Subject Areas All Articles Animal Behavior and Cognition (7640) Biochemistry (17706) Bioengineering (13902) Bioinformatics (41978) Biophysics (21465) Cancer Biology (18611) Cell Biology (25528) Clinical Trials (138) Developmental Biology (13387) Ecology (19920) Epidemiology (2067) Evolutionary Biology (24332) Genetics (15615) Genomics (22519) Immunology (17747) Microbiology (40424) Molecular Biology (17194) Neuroscience (88662) Paleontology (667) Pathology (2838) Pharmacology and Toxicology (4827) Physiology (7650) Plant Biology (15160) Scientific Communication and Education (2046) Synthetic Biology (4302) Systems Biology (9826) Zoology (2271)