Role of Hakai in m6A modification pathway in Drosophila

Role of Hakai in m6A modification pathway in Drosophila | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Role of Hakai in m 6 A modification pathway in Drosophila Yanhua Wang, Lifeng Zhang, Hang Ren, Jian Guo, Decai Mao, Dong Yan This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-47812/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 12 Apr, 2021 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Abstract N6-methyladenosine (m 6 A), the most abundant internal modification in eukaryotic mRNA, is deposited by a multi-component writer complex. Hakai is an E3 ubiquitin ligase that interacts with several m 6 A writer subunits in proteomic studies, however, its role in m 6 A methylation in animals has not been systematically characterized. Here we show that Hakai colocalizes and interacts with other m 6 A writer components in Drosophila , and Hakai mutants exhibit typic m 6 A pathway phenotypes, such as lowered m 6 A levels in mRNA, aberrant Sxl alternative splicing, wing and behavior defects, common reduced m 6 A peaks and mis-regulated genes with Mettl3 and Mettl14 mutants. These results demonstrate that Hakai is a core component of the m 6 A writer complex comprised of seven conserved subunits. Interestingly, our stringent meRIP-seq experiments indicate that the effective m 6 A modification, which depends on the writer complex, is mostly distributed in 5’ UTR and near start codon in Drosophila , in contrast to the mammalian system. We define a set of high-confident m 6 A methylation sites in 5’ UTR in adult flies and it is unlikely the main function of m 6 A modification in Drosophila is through RNA degradation. Furthermore, we find that Hakai is required for the protein levels of other m 6 A writer components Fl(2)d and Flacc, but not Nito. Finally, Hakai does not mediate the stability of E-cadherin in wing discs, suggesting its major role as a nuclear protein. Epigenetics & Genomics Hakai m6A modification m6A writer complex E-cadherin Drosophila Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction There are a variety of chemical modifications on biological macromolecules, such as proteins, nucleic acids, and glycolipids. Like DNA methylation and histone modification, RNA modification represents a new layer of epigenetic regulatory mechanism 1 , 2 . More than 150 chemical modifications in RNA have been discovered, and their biological functions are only starting to be revealed 3 . Chemical modifications of RNA exist in all organisms, including those in tRNA, rRNA, mRNA and long non-coding RNA. Common RNA modifications include N6-methyladenosine (m 6 A), N6,2’-O-dimethyladenosine (m 6 A m ), N1-methyladenosine (m 1 A), 5-methylcytosine (m 5 C), N4-acetylcytidine (ac 4 C), 7-methylguanosine (m 7 G), pseudouridine (Ψ), et al 4 , 5 . Among them, m 6 A is the most abundant internal modification of mRNA in eukaryotes. Although m 6 A in mRNA was found more than 40 years ago 6 , 7 , it was only recently that the field has made extensive progress owing to technological and experimental breakthroughs. By combining m 6 A-specific antibody and high-throughput sequencing, MeRIP-Seq or m 6 A-Seq allows the m 6 A mapping at the whole transcriptome level, thereby providing the possibility to correlate RNA modifications with their biological functions 8 , 9 . These and subsequent studies revealed that m 6 A sites contain a consensus motif RRACH (R=G/A; H=U/A/C), and m 6 A peaks are enriched in 3’ untranslated region (UTR) and near stop codon in yeast and mammals 8 , 9 , 10 . In Arabidopsis , m 6 A is enriched not only in 3’UTR and near stop codon, but also in 5’UTR and around start codon 11 . In mammalian cells, m 6 A also accumulates in 5’UTR region in response to stress conditions such as heat shock 12 , 13 . The distribution of m 6 A is important since it implies the mechanism by which m 6 A modification regulates its mRNA. Another major breakthrough is the gradual elucidation of the m 6 A modification pathway by biochemical and genetic studies. The m 6 A is deposited by a multicomponent methyltransferase complex (“writers”) 14 , 15 , 16 , mainly recognized by YTH domain-containing “readers” 17 , and can be removed by FTO and ALKBH5 “erasers” 18 , 19 , although FTO was also indicated as a m 6 A m demethylase 20 . The key catalytic component of the m 6 A writer complex, Mettl3, was purified and cloned in 1990s 21 , 22 . Since then, studies from yeast, Arabidopsis , Drosophila and mammalian cells have identified several core components of the writer complex 23 , 24 , including Mettl14 25 , 26 , WTAP (Fl(2)d) 27 , 28 , 29 , Virma (Virilizer) 30 , 31 , Rbm15/15B (Spenito) 32 , 33 , ZC3H13 (Flacc or Xio) 34 , 35 , 36 and Hakai 37 . Interestingly, Fl(2)d 38 , Virilizer (Vir) 39 , Spenito (Nito) 40 and Xio 36 were first identified from Drosophila sex determination screens and later realized as part of the writer complex. They regulate Drosophila sex determination by controlling the alternative splicing of the master regulatory gene Sex-lethal ( Sxl ) 41 , 42 , 43 , 44 , 45 , 46 . Recently, Mettl3, Mettl14, as well as the reader YTHDC1, were shown also involved in this process by the same mechanism 33 , 47 , 48 . Thus, Drosophila provides a unique system to screen novel components in m 6 A pathway and pinpoints a critical role for m 6 A in regulating splicing. Other than Sxl splicing, Drosophila m 6 A genes are highly expressed in the nervous system and exhibit similar wing and behavior defects when mutated 33 , 36 , 47 . Mutants of several fly m 6 A factors are viable and thus provide an ideal model to study other processes, such as metabolism and immunity, in the future. Hakai, also known as CBLL1, was found as an interacting protein with several m 6 A writer components in proteomic studies 23 , 31 , 49 . It encodes a RING finger type E3 ubiquitin ligase and was originally identified as an E-cadherin binding protein in human cell lines 50 . It was proposed that Hakai ubiquitinates E-cadherin at the plasma membrane and induces its endocytosis, thus playing a negative role post-translationally. Due to the key role of E-cadherin in tumor metastasis, especially epithelial-mesenchymal transition, Hakai has been extensively studied mainly using cell culture and overexpression system 51 , but a previous study using Drosophila model did not observe an increase of E-cadherin in Hakai mutants 52 . In Arabidopsis , Hakai mutants show partial reduced m 6 A levels and the mutant phenotypes are weaker than other writer components 37 . Importantly, the in vivo role of Hakai as a core m 6 A writer component has not been demonstrated in any animal species. Here we analyzed the role of Hakai in the Drosophila m 6 A modification pathway. Our results demonstrate that Hakai is a bona fide member of the m 6 A writer complex, with its mutants showing reduced global m 6 A levels, typical m 6 A mutant phenotypes and commonly-regulated gene sets. We also obtained a high-quality fly m 6 A methylome using stringent meRIP-seq, characterized the mechanism of Hakai in m 6 A modification, and finally revisited the function of Hakai in E-cadherin regulation. Results Hakai interacts and co-localizes with known m 6 A writer complex subunits Since Hakai was found as an interaction protein with other m 6 A writer components in mammalian proteomic study 23 , we searched the large-scale Drosophila Protein interaction Map (DPiM) database 53 . Hakai as a bait can pull down Fl(2)d, Vir, and Nito in affinity purification and mass spectrometry experiments; on the other hand, Flacc as a bait can pull down Hakai (Supplemental Fig. 1B). Similarly, our own previous mass-spec study using Fl(2)d or Nito as a bait can reciprocally pull down Hakai (Supplemental Fig. 1A) 36 . To confirm these interactions, we performed both co-localization and co-immunoprecipitation (Co-IP) experiments. GFP-Hakai localized to nucleus in live S2 cells and co-localized well with mRFP-Mettl3, mRFP-Mettl14, mRFP-Fl(2)d, mRFP-Nito, and mRFP-Flacc (Fig. 1A-E). Next, we transfected GFP-Hakai and different HA-tagged constructs in S2 cells, and used myc-GFP as a control. In Co-IP experiments, GFP-Hakai, but not myc-GFP, was able to pull down HA-Mettl3, HA-Mettl14, HA-Fl(2)d, HA-Nito, and HA-Flacc (Fig. 1F-J). Interestingly, the pull-down between Hakai and Fl(2)d is particularly strong compared to other factors, suggesting that Hakai may directly interact with Fl(2)d (Fig. 1H). Together, these data suggest that Hakai is a conserved core component of the m 6 A writer complex. Hakai is required for m 6 A methylation in Drosophila Hakai is located on the second chromosome and its transcript is alternatively spliced, producing long and short protein isoforms, both of which containing the RING finger domain (Fig. 2A). Hakai transcript shows a similar expression pattern to those of other m 6 A writers and readers 36 , with high expression in CNS, ovary, fat body and imaginal discs (Supplemental Fig. 2; modENCODE developmental and tissue expression database 54 ). During development, its expression is high in early embryos, decreases during larval stages and rises again at pupal stages (Supplemental Fig. 2), which coincides with the reported m 6 A levels 33 . To monitor endogenous protein expression, we raised an antibody against Hakai (Fig. 2A) and found that it is a ubiquitously-expressed nuclear protein that strongly co-localizes with Fl(2)d (Fig. 2C-C”). To study Hakai function, we generated a sgRNA and constructed or obtained three non-overlapping shRNA lines (Fig. 2A) 55 , 56 . By crossing the U6:3-Hakai sgRNA with nanos-Cas9 57 , we generated a series of Hakai mutants with various small deletions and/or insertions. We chose two alleles, Hakai SH2 and Hakai SH4 for further analysis, since they represent different early frameshift mutations that are expected to disrupt translation (Fig. 2B). Indeed, only background level of Hakai antibody staining remained in Hakai homozygous mutant wing discs compared to wildtype (Fig. 2D, E, compared to 2C), suggesting these are null or strong loss-of-function alleles. Hakai homozygous mutants are semi-lethal and only produce viable adult flies in non-crowded conditions, which have delayed developmental time, smaller size, and reduced lifespan (data not shown). We then measured N6-methyladenosine levels in Hakai mutant adults by quantitative liquid chromatography–mass spectrometry (LC-MS) and used yw and w 1118 as wild-type controls. We used an external calibration curve prepared with A and m 6 A standards to determine the absolute quantities of each ribonucleoside (Supplemental Fig. 3). After two rounds of polyA selection, m 6 A levels drop to around 30% in Mettl3 or Mettl14 mutant flies, while m 6 A levels reduce more than half in Hakai SH2 or Hakai SH4 mutants (Fig. 2F). These results clearly indicated a critical role of Hakai in m 6 A methylation. Hakai controls Sxl alternative splicing and adult fly phenotypes In Drosophila , Sxl pre-mRNA is the best characterized example of m 6 A modified transcripts. Sxl transcripts are alternatively spliced. While male form includes exon 3 that contains a stop codon and leads to early termination of Sxl protein, the female form skips exon 3 and thus produces a functional Sxl protein (Fig. 3A) 58 . Previously multiple m 6 A sites have been mapped in introns on both sides of exon 3 and these modifications are proposed to facilitate the alternative splicing of Sxl in female flies 48 . Indeed, the switch from female form to male form of Sxl splicing occurs in all m 6 A mutants, including Mettl3, Mettl14, Ythdc1, Fl(2)d, Vir, Nito, Flacc, thus representing a gold standard to validate new components in this pathway 33 , 34 , 36 , 38 , 41 , 43 , 47 , 48 . To monitor Sxl splicing pattern, we used a pair of primers flanking exon 3 that detects the small female and large male spliced Sxl products in RT-PCR (Fig. 3A, B, lane1, 2) 59 . As positive controls, Sxl splicing is partially shifted from the female form to the male form in Mettl3 or Mettl14 mutant females (Fig. 3B, lane 3-6). In Hakai SH2 or Hakai SH4 female flies, a large band corresponding to the male-specific spliced form was clearly detected (Fig. 3B, last 4 lanes), similar to Mettl3 or Mettl14 mutants. Disruption of several m 6 A components Fl(2)d, Vir, Nito or Flacc leads to not only aberrant Sxl splicing, but also strongly reduced Sxl protein levels, thus generating a striking female-to-male transformation phenotype in adult flies 34 , 36 , 38 , 41 , 43 , 60 . Mutation of other factors Mettl3, Mettl14 or Ythdc1 alone does not affect Sxl protein levels and does not exhibit the transformation phenotype 33 , 47 , 48 . We found that Sxl protein is not reduced in Hakai SH2 or Hakai SH4 female discs (Supplemental Fig. 4A-D). Furthermore, we expressed three Hakai RNAi using dome-Gal4 and did not observe any transformation phenotype in females, as evidenced before (data not shown) 36 , 41 . Other than Sxl splicing, m 6 A writer and reader mutants show characteristic adult defects. The most prominent ones are the held-out wings and flightless phenotypes in Mettl3 , Mettl14 , Ythdc1 , or Flacc mutants 36 , 61 , 62 , likely due to m 6 A functions in the nervous system 63 . Wild-type flies normally keep their wings in a folded position (Fig. 3C, G), however, majority of Mettl3 mutant flies cannot fold their wings correctly and exhibit held-out wings (Fig. 3D, G), and 100% Mettl3 mutant flies cannot fly (Fig. 3H). Interestingly, Hakai SH2 and Hakai SH4 mutants phenocopy Mettl3 adult defects in terms of strong held-out wing (Fig. 3E-G) and 100% flightless phenotypes (Fig. 3H). Together, these data suggest that Hakai plays an essential role in m 6 A modification pathway in vivo. Effective m 6 A modification occurs in 5’UTR and around start codon in Drosophila Previously, only two studies were reported to map global m 6 A methylation pattern in Drosophila , one MeRIP-seq in S2R+ cells and another miCLIP in embryos 33 , 47 . They found m 6 A enrichment in CDS 33 , in 5’UTR and around start codon 47 , as well as in 3’UTR and around stop codon 47 , but these experiments were not controlled against m 6 A writer mutants. To obtain a high-stringent m 6 A methylome in adult flies, we performed methylated RNA immunoprecipitation sequencing (MeRIP-seq) in yw control, Mettl3 , Mettl14 and Hakai mutants (Supplemental Data 1). In wild-type flies, m 6 A is mostly enriched in 3’UTR and near stop codon, and to a lesser extend enriched in 5’ UTR and near start codon (Fig. 4A, B). De novo motif analysis using HOMER identified the consensus sequence RRACH (Fig. 4C), consistent with those in mammalian system 8 , 9 . There are fewer m 6 A peaks in Mettl3 , Mettl14 or Hakai mutant compared to wild-type (Fig. 4D), and more peaks are reduced in 5’ UTR than 3’ UTR region (Fig. 4A, B). We then filtered differential peaks with more stringency (p<0.05 and fold change ≥2 or ≤0.5) (Supplemental Data 2). Interestingly, many more m 6 A peaks are reduced ( Mettl3 , 2745; Mettl14 , 2615; Hakai , 2036) than increased ( Mettl3 , 330; Mettl14 , 260; Hakai , 278) in these mutants, validating their role as m 6 A writers (Fig. 4E, F). Only in reduced m 6 A peaks, a significant overlap between the three mutants was found (1345 common peaks), suggesting that Hakai plays a similar role to Mettl3 and Mettl14 in m 6 A methylation. In addition, the common reduced peaks in three writer mutants likely represent a high-confident m 6 A modification sites in Drosophila . Next we focused on reduced m 6 A peaks for further analysis. Surprisingly, around 90% of these peaks are located in 5’ UTR and near start codon, and only very small portion occurs in 3’ UTR (Fig. 4G, Supplemental Fig. 5A-C). A few examples of loss of m 6 A peaks in the three mutants are shown in Fig. 4H and Supplemental Fig. 6, which almost always happen in 5’ UTR, while m 6 A peaks in 3’ UTR are generally not changed. These results indicate that although most m 6 A sites map to 3’ UTR in Drosophila , the peaks responding to the loss of m 6 A writers, and thus the effective ones, are distributed in 5’ UTR and this is very different from the mammalian system. Majority peaks in 3’ UTR may be mediated by another methyltransferase or come from non-specific background. To demonstrate the categories of genes modified by m 6 A, we performed GO and KEGG enrichment for genes with reduced m 6 A peaks. GO analysis revealed important regulatory mechanisms such as signal transduction, kinase activity, transcription factor activity, as well as biological processes such as nervous system development and open tracheal system development (Fig. 4I, Supplemental Fig. 5D, F, H). KEGG analysis found most key signaling pathways, including mTOR, FoxO, Wnt, Hedgehog, TGF-b, Hippo, MAPK, Notch, Toll and Imd, Autophagy, et al (Fig. 4J, Supplemental Fig. 5E, G, I). Since so many signaling pathways are enriched for m 6 A targets, it is not surprising that this modification is involved in numerous biological processes. m 6 A modification does not reduce mRNA levels in Drosophila We further analyzed gene expression regulated by m 6 A writer components by RNA-seq (Supplemental Data 3). In Mettl3 , Mettl14 and Hakai mutant adult flies, 987, 954 and 886 genes were differentially expressed (p<0.05 and fold change ≥2 or ≤0.5), respectively (Fig. 5A) (Supplemental Data 4). These genes substantially overlap with each other (Fig. 5B) and common differentially expressed genes generally change in the same direction in the three mutants (Fig. 5C), arguing they act in the same pathway. Interestingly, differentially expressed genes were strongly enriched for immune response genes, as well as chitin binding genes in GO analysis (Fig. 5D, Supplemental Fig. 7). KEGG analysis revealed enrichment for metabolic pathways, including carbohydrate, amino acid and lipid metabolism, possibly reflecting an indirect regulation by m 6 A pathway (Fig. 5E, Supplemental Fig. 7). By exhibiting MeRIP-seq together with RNA-seq data, we observed the reduction of m 6 A peaks in Mettl3 , Mettl14 or Hakai mutant, and no obvious trend for change of mRNA expression correlated with differential m 6 A peaks (Fig. 5F-H, Supplemental Data 5). We further divided genes into m 6 A targets or non-targets, and cumulative plot show that there is no obvious difference between m 6 A targets and non-targets in Hakai or Mettl3 mutant flies (Fig. 5I, J), while there is a slight positive effect of m 6 A on mRNA levels in Mettl14 mutant (Fig. 5K), similar to a previous report 33 . These findings are consistent with the notion that effective m 6 A modifications are located in 5’ UTR in Drosophila , and thus do not mediate mRNA degradation as in mammalian system. Hakai modulates the stability of other m 6 A writer components We aim to look further the mechanisms of Hakai in m 6 A methylation. Since Hakai is a potential E3 ubiquitin ligase, we examined the protein distribution of other m 6 A writer factors in the absence of Hakai using available antibodies. In wild-type wing discs, Fl(2)d, Nito and Flacc are ubiquitous nuclear proteins that co-localizes with each other (Fig. 6A-B). Expression of Hakai RNAi in the dorsal half of the wing disc using ap-Gal4 leads to no effect on Nito protein level (Fig. 6C’), but a strong reduction of Fl(2)d and Flacc levels (Fig. 6C, D). In addition, we crossed actin-Cas9 with U6-Hakai-sgRNA flies to generate random Hakai loss-of-function clones. These clones are marked by the loss of Hakai staining and Fl(2)d level is reduced in these clones as well (Fig. 6E-E’). Overall, Hakai is required for the protein levels of Fl(2)d and Flacc in the m 6 A pathway. Hakai does not mediate E-cadherin levels in wing discs Hakai was first demonstrated as an E-cadherin interaction protein and its role in E-cadherin endocytosis and down-regulation was extensively studied in cell culture 50 , 51 . However, a previous study in Drosophila failed to observe a major role for Hakai in E-cadherin regulation 52 . Thus, we addressed this question using our new genetic toolset. In wild-type wing disc epithelia, E-cadherin shows a membrane distribution and accumulates in the adherens junction (Fig. 7A, A’). First, we used ap-Gal4 to drive the expression of Hakai RNAi in the dorsal half of the wing disc. Although Hakai level is effectively knocked down (Fig. 7C’), E-cadherin level does not change in either the apical or the lateral section (Fig. 7C, C”). Second, in Hakai mutant clones generated by crossing actin-Cas9 with U6-Hakai-sgRNA , E-cadherin level is not affected as well (Fig. 7D-D”). Finally, we examined the localization of E-cadherin and Hakai in detail using the large tracheal cells. As shown in Fig. 7B-B”, most E-cadherin is in the cell membrane, while most Hakai is in the nucleus, and we did not observe co-localization between these two proteins. In conclusion, Hakai is not important for E-cadherin levels in Drosophila and its major function likely happens in the nucleus. Discussion m 6 A modification has been known for more than 40 years 6 but recently gained great attention due to emergence of technologies to map m 6 A methylome 8 , 9 , 64 , as well as the identification of the writers, readers and erasers in this pathway 4 , 14 , 15 , 16 . Since the initial purification of the key methyltransferase Mettl3 21 , other components of the writer complex were gradually identified through biochemical experiments and genetic screens. We now know that m 6 A writer complex is comprised of multiple components including Mettl3, Mettl14, WTAP, Virma, Rbm15/15B, ZC3H13. Hakai was first indicated as a WTAP interaction protein 23 and was shown later required for full m 6 A methylation in Arabidopsis 37 , however, its role in m 6 A pathway in animals has not been studied. Here, we show that Hakai interacts with other m 6 A writer subunits, and Hakai mutants exhibit characteristic m 6 A pathway phenotypes, such as lowered m 6 A levels in mRNA, aberrant Sxl alternative splicing in females, held-out wings and flightless flies, as well as reduced m 6 A peaks shared with Mettl3 and Mettl14 mutants in MeRIP-seq. Altogether, these data unambiguously argue that Hakai is the seventh, and likely last core component of the conserved m 6 A writer complex (Fig. 6F). Each component in the m 6 A writer complex is essential for m 6 A methylation in mRNA but the exact roles of them are not fully understood. Mettl3 is the only subunit that has the methyltransferase enzymatic activity, while Mettl14 contains an RNA-binding site and allosterically activates the catalytic activity of Mettl3 65 , 66 , 67 . WTAP is a key adaptor to interact with Mettl3 and Mettl14 25 , 27 , 29 and is required for their nuclear speckle localization 28 , 68 . Virma preferentially mediates m 6 A methylation in 3’ UTR and near stop codon in human cells and recruits polyadenylation cleavage factor CPSF5 and CPSF6 to regulate alternative polyadenylation 31 . Rbm15 and Rbm15B contain three RRM domains and bind positions adjacent to m 6 A sites, thus may provide specificity for the m 6 A writer complex 32 . ZC3H13 is important for the nuclear localization of several writer components, and has also been proposed to link Rbm15/Nito to WTAP/Fl(2)d 34 . Here, we show that Hakai is required for the stability of Fl(2)d and Flacc, but not Nito, in Drosophila tissues. Overall, more mechanistic studies including super-resolution imaging, biochemical analysis and crystal structures of the complete writer complex will be required to fully elucidate the activity of the m 6 A writer complex. Recent emerging studies suggest that m 6 A is involved in numerous developmental processes and human diseases 16 , 69 , 70 , mainly by controlling mRNA stability, translation or splicing. Drosophila has all seven writer complex components, one homolog of YTHDC1 and one homolog of YTHDF, representing a simple and genetically tractable model system, since mammals have three YTHDF readers with specific or redundant functions 17 . Pioneer work from three labs have established the framework for m 6 A pathway in Drosophila 33 , 47 , 48 . However, only published Drosophila m 6 A methylome was performed in S2R+ cells or embryos 33 , 47 . It is not clear which genomic regions are enriched for effective m 6 A modification since these experiments were not done against writer mutants. Other than Sxl , few m 6 A target loci have been firmly mapped. By performing MeRIP-seq in wild-type adult flies, as well as Mettl3 , Mettl14 and Hakai mutants, we demonstrated that although m 6 A peaks are distributed mostly in 3’ UTR region, the functional peaks responding to the loss of m 6 A writers are almost all located in 5’ UTR region and near start codon. This finding indicates a major difference between Drosophila and mammalian m 6 A methylome, which mainly occurs in 3’ UTR, and is in agreement with a recently submitted manuscript using miCLIP 71 . In zebrafish, more m 6 A peaks were decreased in 5’ UTR than 3’ UTR region in Mettl3 morpholino knockdown 72 . Since m 6 A modification in 3’ UTR usually causes mRNA instability and m 6 A in 5’ UTR is linked to translation enhancement, our results imply that the major role of m 6 A modification in Drosophila is not mRNA degradation, but likely translation upregulation. Indeed, we did not observe an increase in the mRNA expression of m 6 A targets in Mettl3 , Mettl14 or Hakai mutants compared to wild-type flies. By screening for m 6 A peaks commonly reduced in Mettl3 , Mettl14 and Hakai mutants, we identified a set of high-confident m 6 A modification genes and peaks in Drosophila adults. Interestingly, these genes are enriched for most key signaling pathways, thus explaining the involvement of m 6 A modification in numerous developmental and physiological processes. RNA-seq analysis revealed strong enrichment in immune response genes, as well as various metabolic pathways. The involvement of m 6 A modification in fly immune response has not been reported before, and is likely mediated by direct regulation since Toll and Imd signaling are also enriched in meRIP-seq. The involvement in metabolism might be a combined effect caused by signaling such as mTOR, FoxO, autophagy, et al, as indicated by meRIP-seq. We have observed several developmental and metabolic defects associated with m 6 A mutants, and are currently working on the underlying mechanisms. Hakai was initially identified as an E-cadherin binding protein to downgrade its levels post-translationally 50 and the role of Hakai in cell proliferation and tumor progression have been extensively studied in cell culture 51 . However, our in vivo analysis using various genetic tools did not find a requirement of Hakai in E-cadherin regulation. In addition, we found that Hakai is a ubiquitous nuclear protein showing little co-localization with E-cadherin in the membrane. Consistently, Hakai was shown to interact with PTB-associated splicing factor (PSF), a nuclear protein, and to affect its RNA-binding ability 73 . Together, we think that the major function of Hakai occurs in the nucleus and its role in E-cadherin regulation needs to be further investigated using knockout mouse model. Methods Fly strains and genetics Flies were grown on standard cornmeal food and experiments were performed at 25°C. The following stocks were used: w 1118 (used as wild-type, WT), yw , Mettl3 SK2 , Mettl14 SK1 61 , Df(3R)Exel6197 ( Mettl3 deficiency, Bloomington 7676), ap-Gal4 , Hakai shRNA (VDRC 330548), actin-Cas9 (Bloomington 54590) 55 , nanos-Cas9 (Bloomington 78782) 57 . To generate U6-Hakai-sgRNA , target sequence “ACGTCCGCGCCCGCGAGCCC” was picked by DRSC Find CRISPRs 57 and cloned into pCFD3 vector 55 (Addgene 49410). The construct was inserted at attP40 site by standard PhiC31-mediated transformation to make transgenic flies in UniHuaii. U6-Hakai-sgRNA was crossed with nanos-Cas9 flies to generate a series of indel mutations and Hakai SH2 and Hakai SH4 were chosen for further analysis. Two additional Hakai shRNAs were made based on the new pNP vector by Tsinghua Fly Center 56 . TH14422.S with target sequence “GAGCTCGACAAGGACGGCGAA” was inserted at attP2 site and TH14423.S with target sequence “CGGCCGCATGATACCCTGCAA” was inserted at attP40 site. The three Hakai shRNAs show similar knockdown efficiency as examined by Hakai antibody staining. TH14422.S was used in Fig. 6C-C’, TH14423.S was used in Fig. 6D, and VDRC330548 was used in Fig. 7C-C”. To test adult flight ability, cohorts of 10 male flies were tapped down into a petri dish and the number of flies that flew away within 2 minutes was recorded. Immunostaining Larval wing discs were stained as previously described 40 . Briefly, tissues were dissected in PBS and fixed in 4% formaldehyde (Sigma) in PBST (PBS + 0.1% Triton X-100). After blocking in 1% normal donkey serum (Jackson Immuno) in PBST for 1 hour, the samples were incubated with the primary antibody in the same solution at 4°C overnight. After three washes in PBST, samples were incubated with the secondary antibody for 2 hours at room temperature, washed in PBST three times, and subsequently mounted in Antifade Mounting Medium (Beyotime). All images were taken on a Zeiss LSM 880 microscope. The following antibodies were used: mouse anti-Fl(2)d (1:10) (9G2, DSHB), rat anti-Ecad (1:5) (DCAD2, DSHB), mouse anti-Sxl (1:10) (M18, DSHB), rabbit anti-Flacc (1:200) 36 , rabbit anti-Hakai (1:200); Alexa 488- (1:1000) (ThermoFisher) or Cy3- (1:400) (Jackson Immuno) conjugated secondary antibodies and DAPI (1:1000) (Beyotime). Hakai antibody was generated in rabbits against a recombinant protein containing amino acids 1-120 and affinity-purified at ABclonal. Molecular cloning and co-immunoprecipitation To generate the GFP-, mRFP- or HA-tagged plasmids, full-length cDNAs for Hakai (the long isoform amplified from a cDNA library), Flacc (GH14795), Nito (GH11110), Fl(2)d (LD21616), METTL3 (AT20169), and METTL14 (LD06016) were cloned into the pENTR vector (Invitrogen), and transferred into the Drosophila Gateway vector pAGW, pARW and pAHW. GFP was cloned into pAWM as a control. Drosophila S2 cells were maintained in Schneider’s medium (Gibco) supplemented with 10% FBS (Gibco) at 25°C. 2 μg of total DNA was transfected into S2 cells in a 60 mm dish with Effectene (QIAGEN). After 48 hours, cells were lysed in IP lysis buffer (Beyotime, 50mM Tris (pH7.4), 150mM NaCl, 1% NP-40, 1 x protease inhibitor) on ice for 30 mins, and cleared at 20000g for 10 mins at 4 °C. Supernatants were incubated with anti-GFP nanobody agarose beads (Allele Biotechnology) for 2 hours at 4 °C. The beads were washed 3-4 times with 1 ml lysis buffer and resuspended in 2 x SDS sample buffer. Eluted proteins were detected by Western blotting using rabbit anti-GFP (1:1000, A6455, Molecular Probes) or rat anti-HA (1:1000, 3F10, Roche) primary antibodies, and HRP-conjugated secondary antibodies (1:3000, Santa Cruz Biotech). For co-localization, S2 cells were grown on Lab-Tek chamber slides and imaged in live conditions 2 days after transfection. RT-PCR Total RNAs were extracted using TRIzol (Invitrogen) and cDNAs were generated from 0.5 μg of RNA using Hifair II 1st Strand cDNA Synthesis Kit with gDNA digester plus (Yeason). 2xHieff PCR Master Mix (Yeasen) was used for regular PCR. Sxl primers used in Fig. 3B are GTGGTTATCCCCCATATGGC and GATGGCAGAGAATGGGAC, and PCR conditions were described in 59 . Analyzing m 6 A levels by LC-MS Total RNAs were extracted from yw , w 1118 , Mettl3 SK2 /Df , Mettl14 SK1 , Hakai SH2 and Hakai SH4 male adult flies about 1-2 days old using TRIzol (Invitrogen), and then subjected to two rounds of poly(A) selection using the GenElute mRNA Miniprep kit (Sigma). Before LC-MS analysis, all RNA samples were hydrolysed enzymatically to ribonucleosides. Briefly, 600ng RNA of each sample was digested by nuclease P1 (Sigma) and snake venom phosphodiesterase (Sigma) at 37°C for 2 hours, and followed by digestion with fast alkaline phosphatase (Thermo Fisher) for another 1 hour. Then, the digested samples were used for the following LC-MS analysis. Quantitative LC-MS analyses of m 6 A and adenosine were achieved using a Waters UPLC coupled to Thermo Q Exactive mass spectrometer in positive ion mode using dynamic multiple reaction monitoring. The ribonucleosides in the hydrolysed RNA samples were resolved on an acquity UPLC HSS T3 column (1.8 µm particle size, 100Å pore size, 2.1 mm X 100 mm, 30℃) at 300 µl min -1 using a solvent system of 0.1% formic acid in H 2 O (A) and acetonitrile (B). The elution profile was 2% B for 2min, 2-11% B over 4 min, then to 11-80% B over 4min, followed by a column washing at 80% B and column equilibration. The quantification of a ribonucleoside can be achieved using m/z of the parent ribonucleoside ion and m/z of the deglycosylated ion product. Nucleosides were quantified based on the transition of the parent ribonucleoside to the deglycosylated base ion: m/z 282.1-150.1 for m 6 A and m/z 268.1-136.1 for A. Absolute quantities of each ribonucleoside were determined using an external calibration curve prepared with A standards (Sigma) and m 6 A standards (Selleck). meRIP-seq MeRIP-seq was performed as described in 74 , 75 . Total RNA was isolated from yw , Mettl3 SK2 /Df , Mettl14 SK1 , and Hakai SH4 male adult flies about 1-2 days old using TRIzol (Invitrogen). The RNA amount of each sample was quantified using NanoDrop ND-1000 and the RNA integrity was assessed by Bioanalyzer 2100 (Agilent) with RIN number >7.0, and confirmed by electrophoresis with denaturing agarose gel. Poly(A) RNA was purified from 50μg total RNA using Dynabeads Oligo (dT)25 (Thermo Fisher) by two rounds of purification and then was fragmented into small pieces using Magnesium RNA Fragmentation Module (NEB) under 86℃ for 7 minites. The cleaved RNA fragments were incubated for 2 hours at 4℃ with Dynabeads (Dynabeads Antibody Coupling Kit, Thermo Fisher) coupled with m 6 A-specific antibody (202003, Synaptic Systems) in IP buffer (50 mM Tris-HCl, 750 mM NaCl and 0.5% Igepal CA-630). Then the IP RNA fragments and untreated input control fragments are converted to final cDNA library in accordance with a strand-specific library preparation by dUTP method. The average insert size for the final cDNA library was 200±50 bp. At last, we performed the 2×150bp paired-end sequencing (PE150) on an illumina Novaseq 6000 (LC-Bio Technology) following the vendor's recommended protocol. Bioinformatic analysis fastp software was used to remove the reads that contained adaptor contamination, low quality bases and undetermined bases with default parameters. Then sequence quality of IP and Input samples were also verified using fastp. We used HISAT2 76 to map reads to the genome of Drosophila_melanogaster (Version: v96) with default parameters. Mapped reads of IP and input libraries were provided for R package exomePeak 77 , which identifies m 6 A peaks with bed or bigwig format that can be adapted for visualization on the IGV software. HOMER 78 was used for de novo and known motif finding followed by localization of the motif with respect to peak summit. Called peaks were annotated by intersection with gene architecture using R package ChIPseeker 79 . A common peak was picked if the peaks from different groups overlap in the genome> 50% of the smallest of the peaks. StringTie 80 was used to perform expression level for all mRNAs from input libraries by calculating FPKM. The differentially expressed mRNAs were selected with log2 (fold change) >1 or log2 (fold change) <-1 and p value < 0.05 by R package edgeR 81 Declarations Acknowledgements We thank Eric Lai, Bloomington Drosophila Stock Center, TsingHua Fly Center and Vienna Drosophila Resource Center for fly stocks; Developmental Studies Hybridoma Bank for antibodies; the mass-spec and imaging core facility of Institute of Plant Physiology and Ecology for technical support. This work is supported by the National Natural Science Foundation of China (31970786, 91857114, 31771586) and National Key R&D Program of China (2018YFA0800100, 2018YFA0800102) to D.Y.. References Zhao BS, Roundtree IA, He C. Post-transcriptional gene regulation by mRNA modifications. Nat Rev Mol Cell Biol 18, 31–42 (2017). Gilbert WV, Bell TA, Schaening C. Messenger RNA modifications: Form, distribution, and function. Science 352, 1408–1412 (2016). Boccaletto P, et al. MODOMICS: a database of RNA modification pathways. 2017 update. Nucleic Acids Res 46, D303-D307 (2018). Zaccara S, Ries RJ, Jaffrey SR. Reading, writing and erasing mRNA methylation. Nat Rev Mol Cell Biol 20, 608–624 (2019). Roundtree IA, Evans ME, Pan T, He C. Dynamic RNA Modifications in Gene Expression Regulation. Cell 169, 1187–1200 (2017). Desrosiers R, Friderici K, Rottman F. Identification of methylated nucleosides in messenger RNA from Novikoff hepatoma cells. Proc Natl Acad Sci U S A 71, 3971–3975 (1974). Perry R, Kelley DE. Existence of methylated messenger RNA in mouse L cells. Cell 1, 37–42 (1974). Meyer KD, Saletore Y, Zumbo P, Elemento O, Mason CE, Jaffrey SR. Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. Cell 149, 1635–1646 (2012). Dominissini D, et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-sEq. Nature 485, 201–206 (2012). Schwartz S, et al. High-resolution mapping reveals a conserved, widespread, dynamic mRNA methylation program in yeast meiosis. Cell 155, 1409–1421 (2013). Luo GZ, et al. Unique features of the m6A methylome in Arabidopsis thaliana. Nat Commun 5, 5630 (2014). Zhou J, Wan J, Gao X, Zhang X, Jaffrey SR, Qian SB. Dynamic m(6)A mRNA methylation directs translational control of heat shock response. Nature 526, 591–594 (2015). Meyer KD, et al. 5' UTR m(6)A Promotes Cap-Independent Translation. Cell 163, 999–1010 (2015). Meyer KD, Jaffrey SR. Rethinking m(6)A Readers, Writers, and Erasers. Annu Rev Cell Dev Biol 33, 319–342 (2017). Shi H, Wei J, He C. Where, When, and How: Context-Dependent Functions of RNA Methylation Writers, Readers, and Erasers. Mol Cell 74, 640–650 (2019). Yang Y, Hsu PJ, Chen YS, Yang YG. Dynamic transcriptomic m(6)A decoration: writers, erasers, readers and functions in RNA metabolism. Cell Res 28, 616–624 (2018). Patil DP, Pickering BF, Jaffrey SR. Reading m(6)A in the Transcriptome: m(6)A-Binding Proteins. Trends Cell Biol 28, 113–127 (2018). Jia G, et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol 7, 885–887 (2011). Zheng G, et al. ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol Cell 49, 18–29 (2013). Mauer J, et al. Reversible methylation of m(6)Am in the 5' cap controls mRNA stability. Nature 541, 371–375 (2017). Bokar JA, Rath-Shambaugh ME, Ludwiczak R, Narayan P, Rottman F. Characterization and partial purification of mRNA N6-adenosine methyltransferase from HeLa cell nuclei. Internal mRNA methylation requires a multisubunit complex. J Biol Chem 269, 17697–17704 (1994). Bokar JA, Shambaugh ME, Polayes D, Matera AG, Rottman FM. Purification and cDNA cloning of the AdoMet-binding subunit of the human mRNA (N6-adenosine)-methyltransferase. RNA 3, 1233–1247 (1997). Horiuchi K, et al. Identification of Wilms' tumor 1-associating protein complex and its role in alternative splicing and the cell cycle. J Biol Chem 288, 33292–33302 (2013). Hongay CF, Orr-Weaver TL. Drosophila Inducer of MEiosis 4 (IME4) is required for Notch signaling during oogenesis. Proc Natl Acad Sci U S A 108, 14855–14860 (2011). Liu J, et al. A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nat Chem Biol 10, 93–95 (2014). Wang Y, Li Y, Toth JI, Petroski MD, Zhang Z, Zhao JC. N6-methyladenosine modification destabilizes developmental regulators in embryonic stem cells. Nat Cell Biol 16, 191–198 (2014). Zhong S, et al. MTA is an Arabidopsis messenger RNA adenosine methylase and interacts with a homolog of a sex-specific splicing factor. Plant Cell 20, 1278–1288 (2008). Ping XL, et al. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Res 24, 177–189 (2014). Agarwala SD, Blitzblau HG, Hochwagen A, Fink GR. RNA methylation by the MIS complex regulates a cell fate decision in yeast. PLoS Genet 8, e1002732 (2012). Schwartz S, et al. Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. Cell Rep 8, 284–296 (2014). Yue Y, et al. VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. Cell Discov 4, 10 (2018). Patil DP, et al. m(6)A RNA methylation promotes XIST-mediated transcriptional repression. Nature 537, 369–373 (2016). Lence T, et al. m(6)A modulates neuronal functions and sex determination in Drosophila. Nature 540, 242–247 (2016). Knuckles P, et al. Zc3h13/Flacc is required for adenosine methylation by bridging the mRNA-binding factor Rbm15/Spenito to the m(6)A machinery component Wtap/Fl(2)d. Genes Dev 32, 415–429 (2018). Wen J, et al. Zc3h13 Regulates Nuclear RNA m(6)A Methylation and Mouse Embryonic Stem Cell Self-Renewal. Mol Cell 69, 1028–1038 e1026 (2018). Guo J, Tang HW, Li J, Perrimon N, Yan D. Xio is a component of the Drosophila sex determination pathway and RNA N(6)-methyladenosine methyltransferase complex. Proc Natl Acad Sci U S A 115, 3674–3679 (2018). Ruzicka K, et al. Identification of factors required for m(6) A mRNA methylation in Arabidopsis reveals a role for the conserved E3 ubiquitin ligase HAKAI. New Phytol 215, 157–172 (2017). Granadino B, Campuzano S, Sanchez L. The Drosophila melanogaster fl(2)d gene is needed for the female-specific splicing of Sex-lethal RNA. EMBO J 9, 2597–2602 (1990). Hilfiker A, Nothiger R. The temperature-sensitive mutation vir (ts)(virilizer) identifies a new gene involved in sex determination of Drosophila. Roux Arch Dev Biol 200, 240–248 (1991). Yan D, et al. A regulatory network of Drosophila germline stem cell self-renewal. Dev Cell 28, 459–473 (2014). Yan D, Perrimon N. spenito is required for sex determination in Drosophila melanogaster. Proc Natl Acad Sci U S A 112, 11606–11611 (2015). Penn JK, et al. Functioning of the Drosophila Wilms'-tumor-1-associated protein homolog, Fl(2)d, in Sex-lethal-dependent alternative splicing. Genetics 178, 737–748 (2008). Hilfiker A, Amrein H, Dubendorfer A, Schneiter R, Nothiger R. The gene virilizer is required for female-specific splicing controlled by Sxl, the master gene for sexual development in Drosophila. Development 121, 4017–4026 (1995). Penalva LO, et al. The Drosophila fl(2)d gene, required for female-specific splicing of Sxl and tra pre-mRNAs, encodes a novel nuclear protein with a HQ-rich domain. Genetics 155, 129–139 (2000). Niessen M, Schneiter R, Nothiger R. Molecular identification of virilizer, a gene required for the expression of the sex-determining gene Sex-lethal in Drosophila melanogaster. Genetics 157, 679–688 (2001). Ortega A, et al. Biochemical function of female-lethal (2)D/Wilms' tumor suppressor-1-associated proteins in alternative pre-mRNA splicing. J Biol Chem 278, 3040–3047 (2003). Kan L, et al. The m(6)A pathway facilitates sex determination in Drosophila. Nat Commun 8, 15737 (2017). Haussmann IU, et al. m(6)A potentiates Sxl alternative pre-mRNA splicing for robust Drosophila sex determination. Nature 540, 301–304 (2016). Wan C, et al. Panorama of ancient metazoan macromolecular complexes. Nature 525, 339–344 (2015). Fujita Y, et al. Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. Nat Cell Biol 4, 222–231 (2002). Aparicio LA, Valladares M, Blanco M, Alonso G, Figueroa A. Biological influence of Hakai in cancer: a 10-year review. Cancer Metastasis Rev 31, 375–386 (2012). Kaido M, Wada H, Shindo M, Hayashi S. Essential requirement for RING finger E3 ubiquitin ligase Hakai in early embryonic development of Drosophila. Genes Cells 14, 1067–1077 (2009). Guruharsha KG, et al. A protein complex network of Drosophila melanogaster. Cell 147, 690–703 (2011). Graveley BR, et al. The developmental transcriptome of Drosophila melanogaster. Nature 471, 473–479 (2011). Port F, Chen HM, Lee T, Bullock SL. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A 111, E2967-2976 (2014). Qiao HH, et al. An efficient and multiple target transgenic RNAi technique with low toxicity in Drosophila. Nat Commun 9, 4160 (2018). Ren X, et al. Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9. Proc Natl Acad Sci U S A 110, 19012–19017 (2013). Bell LR, Horabin JI, Schedl P, Cline TW. Positive autoregulation of sex-lethal by alternative splicing maintains the female determined state in Drosophila. Cell 65, 229–239 (1991). Johnson ML, Nagengast AA, Salz HK. PPS, a large multidomain protein, functions with sex-lethal to regulate alternative splicing in Drosophila. PLoS Genet 6, e1000872 (2010). SchuLtt C, Hilfiker A, Nothiger R. virilizer regulates Sex-lethal in the germline of Drosophila melanogaster. Development 125, 1501–1507 (1998). Kan L, et al. The m6A pathway facilitates sex determination in Drosophila. Nature communications 8, 15737 (2017). Haussmann IU, et al. m6A potentiates Sxl alternative pre-mRNA splicing for robust Drosophila sex determination. Nature 540, 301–304 (2016). Lence T, et al. m6A modulates neuronal functions and sex determination in Drosophila. Nature 540, 242–247 (2016). Linder B, Grozhik AV, Olarerin-George AO, Meydan C, Mason CE, Jaffrey SR. Single-nucleotide-resolution mapping of m6A and m6Am throughout the transcriptome. Nat Methods 12, 767–772 (2015). Sledz P, Jinek M. Structural insights into the molecular mechanism of the m(6)A writer complex. Elife 5, (2016). Wang P, Doxtader KA, Nam Y. Structural Basis for Cooperative Function of Mettl3 and Mettl14 Methyltransferases. Mol Cell 63, 306–317 (2016). Wang X, et al. Structural basis of N(6)-adenosine methylation by the METTL3-METTL14 complex. Nature 534, 575–578 (2016). Scholler E, et al. Interactions, localization, and phosphorylation of the m(6)A generating METTL3-METTL14-WTAP complex. RNA 24, 499–512 (2018). Hsu PJ, Shi H, He C. Epitranscriptomic influences on development and disease. Genome Biol 18, 197 (2017). Frye M, Harada BT, Behm M, He C. RNA modifications modulate gene expression during development. Science 361, 1346–1349 (2018). 10.1101/2020.1103.1107.982090 Kan L, et al. A neural m6A/YTHDF pathway is required for learning and memory in Drosophila. bioRxiv doi, 10.1101/2020.1103.1107.982090 (2020). Zhang C, et al. m(6)A modulates haematopoietic stem and progenitor cell specification. Nature 549, 273–276 (2017). Figueroa A, et al. Novel roles of hakai in cell proliferation and oncogenesis. Mol Biol Cell 20, 3533–3542 (2009). Dominissini D, Moshitch-Moshkovitz S, Amariglio N, Rechavi G. Transcriptome-Wide Mapping of N(6)-Methyladenosine by m(6)A-SEq. Methods Enzymol 560, 131–147 (2015). Molinie B, Giallourakis CC. Genome-Wide Location Analyses of N6-Methyladenosine Modifications (m(6)A-Seq). Methods Mol Biol 1562, 45–53 (2017). Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods 12, 357–360 (2015). Meng J, et al. A protocol for RNA methylation differential analysis with MeRIP-Seq data and exomePeak R/Bioconductor package. Methods 69, 274–281 (2014). Heinz S, et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell 38, 576–589 (2010). Yu G, Wang LG, He QY. ChIPseeker: an R/Bioconductor package for ChIP peak annotation, comparison and visualization. Bioinformatics 31, 2382–2383 (2015). Pertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol 33, 290–295 (2015). Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139–140 (2010). Additional Declarations There is NO Competing Interest. Supplementary Files SupplementalInformation.docx Supplemental Figures Cite Share Download PDF Status: Published Journal Publication published 12 Apr, 2021 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-47812","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":992091,"identity":"2c51a933-8d9c-4b07-9480-e447324f953b","order_by":0,"name":"Yanhua Wang","email":"","orcid":"","institution":"Chinese Academy of Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yanhua","middleName":"","lastName":"Wang","suffix":""},{"id":992092,"identity":"c0467ab2-95b2-4705-8528-c5ed00147239","order_by":1,"name":"Lifeng Zhang","email":"","orcid":"","institution":"Chinese Academy of Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Lifeng","middleName":"","lastName":"Zhang","suffix":""},{"id":992093,"identity":"9160b8e4-5ce8-4bcf-a3ed-e09a11a311ff","order_by":2,"name":"Hang Ren","email":"","orcid":"","institution":"Chinese Academy of Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hang","middleName":"","lastName":"Ren","suffix":""},{"id":992094,"identity":"91daecc7-2feb-49e8-a7d2-65c47e5d9358","order_by":3,"name":"Jian Guo","email":"","orcid":"","institution":"Chinese Academy of Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Guo","suffix":""},{"id":992095,"identity":"ef9debd2-b06e-4932-be48-eaa872951ce9","order_by":4,"name":"Decai Mao","email":"","orcid":"","institution":"Gene Regulatory Lab, School of Medicine, Tsinghua University, Beijing 100084","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Decai","middleName":"","lastName":"Mao","suffix":""},{"id":992096,"identity":"638e86ba-9cce-42bb-b693-01ea80807767","order_by":5,"name":"Dong Yan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYJACCSCWI12LMelaEhuIVm5w/OzBGx931Kb3t3enPfzBYCfPwH72AH4tZ/KSLWeeOZ4748zZ7cY8DMmGDTx5Cfi1HMgxk+ZtO5a7QSJ3mzQDA3MCgwSPAX4t59+AtaQbyL/dJvmDoZ4ILTfAttQkGEjwbpPgYThMWIvkjTfGljPbDhjOOJML9IvBccM2nhz8WvjO5xje+NhWJ8/ffnbbwx8V1fL87Gfwa1E4AKYOgwg2oDvBJH4g3wCm6qBaRsEoGAWjYBRgAQAe4UIadYOpPwAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-3786-5708","institution":"Chinese Academy of Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Dong","middleName":"","lastName":"Yan","suffix":""}],"badges":[],"createdAt":"2020-07-23 08:46:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-47812/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-47812/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41467-021-22424-5","type":"published","date":"2021-04-12T21:05:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":1777921,"identity":"a93ab6e4-8b17-4032-af99-b9f501cf3423","added_by":"auto","created_at":"2020-08-04 16:22:20","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":294353,"visible":true,"origin":"","legend":"Hakai co-localizes and interacts with other m6A writer components\n(A-E) GFP-Hakai and mRFP-Mettl3, mRFP-Mettl14, mRFP-Fl(2)d, mRFP-Nito or mRFP-Flacc were co-transfected into S2 cells and their subcellular localization examined in live conditions. All the proteins are predominantly nuclear and GFP-Hakai shows strong co-localization with other factors. Scale bars: 5 μm. (F-J) GFP-Hakai or myc-GFP and HA-Mettl3, HA-Mettl14, HA-Fl(2)d, HA-Nito, HA-Flacc were co-transfected into S2 cells. Cell lysates were immunoprecipitated using GFP nanobody and analyzed by Western blot. myc-GFP is used as a control. GFP-Hakai can pull down HA-Mettl3, HA-Mettl14, HA-Fl(2)d, HA-Nito and HA-Flacc. Note that much more HA-Fl(2)d was co-IPed than other factors.","description":"","filename":"Onlinefloatimage1.Png","url":"https://assets-eu.researchsquare.com/files/rs-47812/v1/Onlinefloatimage1.Png"},{"id":1777922,"identity":"0db892fc-ffd3-4366-b74c-cd3dc61cb19b","added_by":"auto","created_at":"2020-08-04 16:22:20","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":599191,"visible":true,"origin":"","legend":"Hakai is required for m6A levels in mRNA\n(A) Flybase JBrowse view of the Hakai gene locus. Hakai has four transcripts due to alternative splicing that generate two long and two short protein isoforms. The positions of three independent shRNAs, Hakai sgRNA, and the protein region used to generate a Hakai antibody are indicated. (B) Sequencing results showing frameshift indels in HakaiSH2 and HakaiSH4 flies generated by CRISPR/Cas9 mediated mutagenesis. The targeted genomic DNA sequence is underlined and the NGG PAM sequence is in bold type. (C-C”) Hakai and Fl(2)d antibody staining in WT wing discs showing a high degree of co-localization. Hakai antibody staining is strongly reduced in HakaiSH2 (D) or HakaiSH4 (E) homozygous mutant wing discs. (F) Quantifications of m6A relative to A in mRNA extracted from male adult flies. Compared to yw and w1118 controls, m6A levels drop to about 30% in Mettl3 or Mettl14 mutants and to less than 50% in HakaiSH2 or HakaiSH4 mutants. Error barrs represent standard deviation.","description":"","filename":"Onlinefloatimage2.Png","url":"https://assets-eu.researchsquare.com/files/rs-47812/v1/Onlinefloatimage2.Png"},{"id":1777923,"identity":"b80cba3c-1f6b-4262-9db3-d0f49d1194ca","added_by":"auto","created_at":"2020-08-04 16:22:20","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":271894,"visible":true,"origin":"","legend":"Xio regulates Sxl alternative splicing and adult fly behavior\n(A) Diagram showing the alternative splicing event that produces male- or female-specific Sxl transcripts. The arrows indicate primers used for RT-PCR. (B) Sxl splicing was analyzed by RT-PCR using RNA extracted from adult flies of indicated genotypes. Note the appearance of male-specific bands in Mettl3SK2/Df, Mettl14SK1, HakaiSH2, HakaiSH4 females. Male-specific bands: 2-3-4. Female-specific bands: 2-4. (C) yw flies have their wings properly folded. (D) Mettl3SK2/Df, (E) HakaiSH2, (F) HakaiSH4 flies cannot fold their wings and exhibit a held-out wing phenotype (marked by the double arrows). The frequency of flies showing held-out wings were quantified in (G); error barrs represent standard deviation. (H) Flies of the indicated genotypes were tested for their flight abilities and the number of flightless flies were quantified; error barrs represent standard deviation. All flies used from (C) to (H) are males.","description":"","filename":"Onlinefloatimage3.Png","url":"https://assets-eu.researchsquare.com/files/rs-47812/v1/Onlinefloatimage3.Png"},{"id":1777924,"identity":"737c46d0-4d10-4c99-ae4c-9a887ff9c7dc","added_by":"auto","created_at":"2020-08-04 16:22:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":240762,"visible":true,"origin":"","legend":"Effective m6A modification in Drosophila is distributed in 5’ UTR and around start codon\n(A) MeRIP-seq experiments show the normalized density of m6A peaks across 5’ UTR, CDS, and 3’ UTR of mRNA in yw, Mettl3, Mettl14, and Hakai mutant male adult flies. (B) Pie charts depicting m6A peak distribution in different transcript segments in yw, Mettl3, Mettl14, and Hakai flies. (C) Sequence motif identified from m6A peaks in yw flies by HOMER program. (D) Cumulative distribution function of log2 peak density of m6A sites in yw, Mettl3, Mettl14, and Hakai flies. (E) Venn diagram showing overlap of reduced m6A peaks (p\u003c0.05 and fold change ≤0.5) between Mettl3, Mettl14, and Hakai flies versus yw control. (F) Venn diagram showing overlap of increased m6A peaks (p\u003c0.05 and fold change ≥2) between Mettl3, Mettl14, and Hakai flies versus yw control. (G) Pie chart depicting the distribution of 1345 common reduced m6A peaks in different transcript segments. (H) Integrative Genomics Viewer (IGV) tracks displaying MeRIP-seq (lower panels, IP) and RNA-seq (upper panels, input) reads along S6k mRNA in yw, Mettl3, Mettl14, and Hakai flies. Two replicates are shown. Note the reduced peak in 5’ UTR (shaded in yellow) and peaks in 3’ UTR (shaded in purple) are not changed. (I) GO term and (J) KEGG pathway analysis of genes with common reduced m6A peaks. The top 20 terms are displayed.","description":"","filename":"Onlinefloatimage4.Png","url":"https://assets-eu.researchsquare.com/files/rs-47812/v1/Onlinefloatimage4.Png"},{"id":1777925,"identity":"97d91ae6-4994-4c25-be1d-526ec7dd0e07","added_by":"auto","created_at":"2020-08-04 16:22:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":352398,"visible":true,"origin":"","legend":"Hakai regulates common transcripts with Mettl3 and Mettl14\n(A) Numbers of differentially expressed genes (p\u003c0.05 and fold change ≥2 or ≤0.5) in Mettl3, Mettl14, and Hakai mutant male adult flies versus yw control. (B) Venn diagram showing common differentially expressed genes between them. (C) Heat map showing the relative expression of 250 common differentially expressed genes in Mettl3, Mettl14, Hakai and yw flies. (D) GO term and (E) KEGG pathway analysis of 250 common differentially expressed genes between Mettl3, Mettl14, and Hakai. The top 20 terms are displayed. (F-H) Four quadrant plots showing differential m6A peaks together with differential mRNA expression in Mettl3 (G), Mettl14 (H), and Hakai (F) mutants versus yw. Hyper- or Hypo- means increased or decreased m6A peaks; Up or down means increased or decreased mRNA expression levels. (I-K) Cumulative distribution function of fold changes (log2) of RNA expression in Mettl3 (J), Mettl14 (K), and Hakai (I) mutants over yw control separated between m6A targets and non-targets. ","description":"","filename":"Onlinefloatimage5.Png","url":"https://assets-eu.researchsquare.com/files/rs-47812/v1/Onlinefloatimage5.Png"},{"id":1777926,"identity":"57249f85-6749-4acb-96eb-8c55ff96fc7f","added_by":"auto","created_at":"2020-08-04 16:22:21","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":786549,"visible":true,"origin":"","legend":"Hakai controls the protein levels of other m6A writer components \nIn wild-type wing discs, Fl(2)d (A), Nito (A’), and Flacc (B) show ubiquitous nuclear staining pattern. (C-D) Expressing Hakai RNAi in the dorsal half of the disc (below the dashed line) using ap-Gal4 results in strong reduction of Fl(2)d (C) and Flacc (D) levels, but not Nito staining (C’). (E-E’) Fl(2)d staining is similarly reduced in Hakai mutant clones generated by actin-Cas9/U6-Hakai-sgRNA (E), which are marked by the loss of Hakai staining (E’). (F) A model of the m6A writer complex comprised of seven core components.","description":"","filename":"Onlinefloatimage6.Png","url":"https://assets-eu.researchsquare.com/files/rs-47812/v1/Onlinefloatimage6.Png"},{"id":1777927,"identity":"bf847474-ed98-4f4b-a9a4-b5efb1146e64","added_by":"auto","created_at":"2020-08-04 16:22:21","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":894887,"visible":true,"origin":"","legend":"Hakai does not mediate E-cadherin levels in wing discs\n(A-A’) Lateral (A) and apical (A’) section of E-cadherin staining in wild-type wing disc epithelia. (B-B”) E-cadherin is mainly localized in cell membrane (B), while Hakai is mostly in the nucleus (B’) in the large tracheal cells. (C-C”) Expression of Hakai RNAi in the dorsal half of the disc (below the dashed line) using ap-Gal4 leads to strong reduction of Hakai (C’), but E-cadherin staining is not affected either laterally (C) or apically (C”). (D-D”) Lateral (D) and apical (D”) E-cadherin distribution is not changed in Hakai mutant clones marked by the absence of Hakai staining (D’), when crossing actin-Cas9 with U6-Hakai-sgRNA.","description":"","filename":"Onlinefloatimage7.Png","url":"https://assets-eu.researchsquare.com/files/rs-47812/v1/Onlinefloatimage7.Png"},{"id":15668012,"identity":"17f8ccda-b38b-496a-b6ce-8b72847276d7","added_by":"auto","created_at":"2021-11-18 13:46:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4523653,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-47812/v1/b93dcfd2-8a93-4eec-bda9-92c6751e580a.pdf"},{"id":1777929,"identity":"e47723bf-0d5d-46a6-ac41-a76f1bfa1115","added_by":"auto","created_at":"2020-08-04 16:22:22","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":7247206,"visible":true,"origin":"","legend":"Supplemental Figures","description":"","filename":"SupplementalInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-47812/v1/SupplementalInformation.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Role of Hakai in m\u003csup\u003e6\u003c/sup\u003eA modification pathway in \u003ci\u003eDrosophila\u003c/i\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThere are a variety of chemical modifications on biological macromolecules, such as proteins, nucleic acids, and glycolipids. Like DNA methylation and histone modification, RNA modification represents a new layer of epigenetic regulatory mechanism\u003csup\u003e1\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e2\u003c/sup\u003e. More than 150 chemical modifications in RNA have been discovered, and their biological functions are only starting to be revealed\u003csup\u003e3\u003c/sup\u003e. Chemical modifications of RNA exist in all organisms, including those in tRNA, rRNA, mRNA and long non-coding RNA. Common RNA modifications include N6-methyladenosine (m\u003csup\u003e6\u003c/sup\u003eA), N6,2\u0026rsquo;-O-dimethyladenosine (m\u003csup\u003e6\u003c/sup\u003eA\u003csub\u003em\u003c/sub\u003e), N1-methyladenosine (m\u003csup\u003e1\u003c/sup\u003eA), 5-methylcytosine (m\u003csup\u003e5\u003c/sup\u003eC), N4-acetylcytidine (ac\u003csup\u003e4\u003c/sup\u003eC), 7-methylguanosine (m\u003csup\u003e7\u003c/sup\u003eG), pseudouridine (\u0026Psi;), et al\u003csup\u003e4\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e5\u003c/sup\u003e. Among them, m\u003csup\u003e6\u003c/sup\u003eA is the most abundant internal modification of mRNA in eukaryotes. Although m\u003csup\u003e6\u003c/sup\u003eA in mRNA was found more than 40 years ago\u003csup\u003e6\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e7\u003c/sup\u003e, it was only recently that the field has made extensive progress owing to technological and experimental breakthroughs. By combining m\u003csup\u003e6\u003c/sup\u003eA-specific antibody and high-throughput sequencing, MeRIP-Seq or m\u003csup\u003e6\u003c/sup\u003eA-Seq allows the m\u003csup\u003e6\u003c/sup\u003eA mapping at the whole transcriptome level, thereby providing the possibility to correlate RNA modifications with their biological functions\u003csup\u003e8\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e. These and subsequent studies revealed that m\u003csup\u003e6\u003c/sup\u003eA sites contain a consensus motif RRACH (R=G/A; H=U/A/C), and m\u003csup\u003e6\u003c/sup\u003eA peaks are enriched in 3\u0026rsquo; untranslated region (UTR) and near stop codon in yeast and mammals\u003csup\u003e8\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e10\u003c/sup\u003e. In \u003cem\u003eArabidopsis\u003c/em\u003e, m\u003csup\u003e6\u003c/sup\u003eA is enriched not only in 3\u0026rsquo;UTR and near stop codon, but also in 5\u0026rsquo;UTR and around start codon\u003csup\u003e11\u003c/sup\u003e. In mammalian cells, m\u003csup\u003e6\u003c/sup\u003eA also accumulates in 5\u0026rsquo;UTR region in response to stress conditions such as heat shock\u003csup\u003e12\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e13\u003c/sup\u003e. The distribution of m\u003csup\u003e6\u003c/sup\u003eA is important since it implies the mechanism by which m\u003csup\u003e6\u003c/sup\u003eA modification regulates its mRNA.\u003c/p\u003e\n\u003cp\u003eAnother major breakthrough is the gradual elucidation of the m\u003csup\u003e6\u003c/sup\u003eA modification pathway by biochemical and genetic studies. The m\u003csup\u003e6\u003c/sup\u003eA is deposited by a multicomponent methyltransferase complex (\u0026ldquo;writers\u0026rdquo;)\u003csup\u003e14\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e15\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e16\u003c/sup\u003e, mainly recognized by YTH domain-containing \u0026ldquo;readers\u0026rdquo;\u003csup\u003e17\u003c/sup\u003e, and can be removed by FTO and ALKBH5 \u0026ldquo;erasers\u0026rdquo;\u003csup\u003e18\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e19\u003c/sup\u003e, although FTO was also indicated as a m\u003csup\u003e6\u003c/sup\u003eA\u003csub\u003em\u003c/sub\u003e demethylase\u003csup\u003e20\u003c/sup\u003e. The key catalytic component of the m\u003csup\u003e6\u003c/sup\u003eA writer complex, Mettl3, was purified and cloned in 1990s\u003csup\u003e21\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e22\u003c/sup\u003e. Since then, studies from yeast, \u003cem\u003eArabidopsis\u003c/em\u003e, \u003cem\u003eDrosophila\u003c/em\u003e and mammalian cells have identified several core components of the writer complex\u003csup\u003e23\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e24\u003c/sup\u003e, including Mettl14\u003csup\u003e25\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e26\u003c/sup\u003e, WTAP (Fl(2)d)\u003csup\u003e27\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e28\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e29\u003c/sup\u003e, Virma (Virilizer)\u003csup\u003e30\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e31\u003c/sup\u003e, Rbm15/15B (Spenito)\u003csup\u003e32\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e33\u003c/sup\u003e, ZC3H13 (Flacc or Xio)\u003csup\u003e34\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e35\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e36\u003c/sup\u003e and Hakai\u003csup\u003e37\u003c/sup\u003e. Interestingly, Fl(2)d\u003csup\u003e38\u003c/sup\u003e, Virilizer (Vir)\u003csup\u003e39\u003c/sup\u003e, Spenito (Nito)\u003csup\u003e40\u003c/sup\u003e and Xio\u003csup\u003e36\u003c/sup\u003e were first identified from \u003cem\u003eDrosophila\u003c/em\u003e sex determination screens and later realized as part of the writer complex. They regulate \u003cem\u003eDrosophila\u003c/em\u003e sex determination by controlling the alternative splicing of the master regulatory gene \u003cem\u003eSex-lethal \u003c/em\u003e(\u003cem\u003eSxl\u003c/em\u003e)\u003csup\u003e41\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e42\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e43\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e44\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e45\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e46\u003c/sup\u003e. Recently, Mettl3, Mettl14, as well as the reader YTHDC1, were shown also involved in this process by the same mechanism\u003csup\u003e33\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e47\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e48\u003c/sup\u003e. Thus, \u003cem\u003eDrosophila\u003c/em\u003e provides a unique system to screen novel components in m\u003csup\u003e6\u003c/sup\u003eA pathway and pinpoints a critical role for m\u003csup\u003e6\u003c/sup\u003eA in regulating splicing. Other than \u003cem\u003eSxl \u003c/em\u003esplicing, \u003cem\u003eDrosophila \u003c/em\u003em\u003csup\u003e6\u003c/sup\u003eA genes are highly expressed in the nervous system and exhibit similar wing and behavior defects when mutated\u003csup\u003e33\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e36\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e47\u003c/sup\u003e. Mutants of several fly m\u003csup\u003e6\u003c/sup\u003eA factors are viable and thus provide an ideal model to study other processes, such as metabolism and immunity, in the future.\u003c/p\u003e\n\u003cp\u003eHakai, also known as CBLL1, was found as an interacting protein with several m\u003csup\u003e6\u003c/sup\u003eA writer components in proteomic studies\u003csup\u003e23\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e31\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e49\u003c/sup\u003e. It encodes a RING finger type E3 ubiquitin ligase and was originally identified as an E-cadherin binding protein in human cell lines\u003csup\u003e50\u003c/sup\u003e. It was proposed that Hakai ubiquitinates E-cadherin at the plasma membrane and induces its endocytosis, thus playing a negative role post-translationally. Due to the key role of E-cadherin in tumor metastasis, especially epithelial-mesenchymal transition, Hakai has been extensively studied mainly using cell culture and overexpression system\u003csup\u003e51\u003c/sup\u003e, but a previous study using \u003cem\u003eDrosophila\u003c/em\u003e model did not observe an increase of E-cadherin in \u003cem\u003eHakai \u003c/em\u003emutants\u003csup\u003e52\u003c/sup\u003e. In \u003cem\u003eArabidopsis\u003c/em\u003e, \u003cem\u003eHakai\u003c/em\u003e mutants show partial reduced m\u003csup\u003e6\u003c/sup\u003eA levels and the mutant phenotypes are weaker than other writer components\u003csup\u003e37\u003c/sup\u003e. Importantly, the in vivo role of Hakai as a core m\u003csup\u003e6\u003c/sup\u003eA writer component has not been demonstrated in any animal species. Here we analyzed the role of Hakai in the \u003cem\u003eDrosophila\u003c/em\u003e m\u003csup\u003e6\u003c/sup\u003eA modification pathway. Our results demonstrate that Hakai is a bona fide member of the m\u003csup\u003e6\u003c/sup\u003eA writer complex, with its mutants showing reduced global m\u003csup\u003e6\u003c/sup\u003eA levels, typical m\u003csup\u003e6\u003c/sup\u003eA mutant phenotypes and commonly-regulated gene sets. We also obtained a high-quality fly m\u003csup\u003e6\u003c/sup\u003eA methylome using stringent meRIP-seq, characterized the mechanism of Hakai in m\u003csup\u003e6\u003c/sup\u003eA modification, and finally revisited the function of Hakai in E-cadherin regulation.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eHakai interacts and co-localizes with known m\u003csup\u003e6\u003c/sup\u003eA writer complex subunits\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSince Hakai was found as an interaction protein with other m\u003csup\u003e6\u003c/sup\u003eA writer components in mammalian proteomic study\u003csup\u003e23\u003c/sup\u003e, we searched the large-scale \u003cem\u003eDrosophila\u003c/em\u003e Protein interaction Map (DPiM) database\u003csup\u003e53\u003c/sup\u003e.\u0026nbsp; Hakai as a bait can pull down Fl(2)d, Vir, and Nito in affinity purification and mass spectrometry experiments; on the other hand, Flacc as a bait can pull down Hakai (Supplemental Fig. 1B). Similarly, our own previous mass-spec study using Fl(2)d or Nito as a bait can reciprocally pull down Hakai (Supplemental Fig. 1A)\u003csup\u003e36\u003c/sup\u003e. To confirm these interactions, we performed both co-localization and co-immunoprecipitation (Co-IP) experiments. GFP-Hakai localized to nucleus in live S2 cells and co-localized well with mRFP-Mettl3, mRFP-Mettl14, mRFP-Fl(2)d, mRFP-Nito, and mRFP-Flacc (Fig. 1A-E). Next, we transfected GFP-Hakai and different HA-tagged constructs in S2 cells, and used myc-GFP as a control. In Co-IP experiments, GFP-Hakai, but not myc-GFP, was able to pull down HA-Mettl3, HA-Mettl14, HA-Fl(2)d, HA-Nito, and HA-Flacc (Fig. 1F-J). Interestingly, the pull-down between Hakai and Fl(2)d is particularly strong compared to other factors, suggesting that Hakai may directly interact with Fl(2)d (Fig. 1H). Together, these data suggest that Hakai is a conserved core component of the m\u003csup\u003e6\u003c/sup\u003eA writer complex.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHakai is required for m\u003csup\u003e6\u003c/sup\u003eA methylation in \u003cem\u003eDrosophila\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eHakai\u003c/em\u003e is located on the second chromosome and its transcript is alternatively spliced, producing long and short protein isoforms, both of which containing the RING finger domain (Fig. 2A). \u003cem\u003eHakai\u003c/em\u003e transcript shows a similar expression pattern to those of other m\u003csup\u003e6\u003c/sup\u003eA writers and readers\u003csup\u003e36\u003c/sup\u003e, with high expression in CNS, ovary, fat body and imaginal discs (Supplemental Fig. 2; modENCODE developmental and tissue expression database\u003csup\u003e54\u003c/sup\u003e). During development, its expression is high in early embryos, decreases during larval stages and rises again at pupal stages (Supplemental Fig. 2), which coincides with the reported m\u003csup\u003e6\u003c/sup\u003eA levels\u003csup\u003e33\u003c/sup\u003e. To monitor endogenous protein expression, we raised an antibody against Hakai (Fig. 2A) and found that it is a ubiquitously-expressed nuclear protein that strongly co-localizes with Fl(2)d (Fig. 2C-C\u0026rdquo;).\u003c/p\u003e\n\u003cp\u003eTo study Hakai function, we generated a sgRNA and constructed or obtained three non-overlapping shRNA lines (Fig. 2A)\u003csup\u003e55\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e56\u003c/sup\u003e. By crossing the \u003cem\u003eU6:3-Hakai sgRNA\u003c/em\u003e with \u003cem\u003enanos-Cas9\u003c/em\u003e\u003csup\u003e57\u003c/sup\u003e, we generated a series of \u003cem\u003eHakai\u003c/em\u003e mutants with various small deletions and/or insertions. We chose two alleles, \u003cem\u003eHakai\u003csup\u003eSH2\u003c/sup\u003e\u003c/em\u003e and \u003cem\u003eHakai\u003csup\u003eSH4\u003c/sup\u003e\u003c/em\u003e for further analysis, since they represent different early frameshift mutations that are expected to disrupt translation (Fig. 2B). Indeed, only background level of Hakai antibody staining remained in \u003cem\u003eHakai \u003c/em\u003ehomozygous mutant wing discs compared to wildtype (Fig. 2D, E, compared to 2C), suggesting these are null or strong loss-of-function alleles. \u003cem\u003eHakai\u003c/em\u003e homozygous mutants are semi-lethal and only produce viable adult flies in non-crowded conditions, which have delayed developmental time, smaller size, and reduced lifespan (data not shown).\u003c/p\u003e\n\u003cp\u003eWe then measured N6-methyladenosine levels in \u003cem\u003eHakai\u003c/em\u003e mutant adults by quantitative liquid chromatography\u0026ndash;mass spectrometry (LC-MS) and used \u003cem\u003eyw\u003c/em\u003e and \u003cem\u003ew\u003csup\u003e1118\u003c/sup\u003e\u003c/em\u003e as wild-type controls. We used an external calibration curve prepared with A and m\u003csup\u003e6\u003c/sup\u003eA standards to determine the absolute quantities of each ribonucleoside (Supplemental Fig. 3). After two rounds of polyA selection, m\u003csup\u003e6\u003c/sup\u003eA levels drop to around 30% in \u003cem\u003eMettl3\u003c/em\u003e or \u003cem\u003eMettl14\u003c/em\u003e mutant flies, while m\u003csup\u003e6\u003c/sup\u003eA levels reduce more than half in \u003cem\u003eHakai\u003csup\u003eSH2\u003c/sup\u003e\u003c/em\u003e or \u003cem\u003eHakai\u003csup\u003eSH4\u003c/sup\u003e\u003c/em\u003e mutants (Fig. 2F). These results clearly indicated a critical role of Hakai in m\u003csup\u003e6\u003c/sup\u003eA methylation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHakai controls \u003cem\u003eSxl\u003c/em\u003e alternative splicing and adult fly phenotypes\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn \u003cem\u003eDrosophila\u003c/em\u003e, \u003cem\u003eSxl\u003c/em\u003e pre-mRNA is the best characterized example of m\u003csup\u003e6\u003c/sup\u003eA modified transcripts. \u003cem\u003eSxl\u003c/em\u003e transcripts are alternatively spliced. While male form includes exon 3 that contains a stop codon and leads to early termination of Sxl protein, the female form skips exon 3 and thus produces a functional Sxl protein (Fig. 3A)\u003csup\u003e58\u003c/sup\u003e. Previously multiple m\u003csup\u003e6\u003c/sup\u003eA sites have been mapped in introns on both sides of exon 3 and these modifications are proposed to facilitate the alternative splicing of \u003cem\u003eSxl\u003c/em\u003e in female flies\u003csup\u003e48\u003c/sup\u003e. Indeed, the switch from female form to male form of \u003cem\u003eSxl\u003c/em\u003e splicing occurs in all m\u003csup\u003e6\u003c/sup\u003eA mutants, including Mettl3, Mettl14, Ythdc1, Fl(2)d, Vir, Nito, Flacc, thus representing a gold standard to validate new components in this pathway\u003csup\u003e33\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e34\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e36\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e38\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e41\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e43\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e47\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e48\u003c/sup\u003e. To monitor \u003cem\u003eSxl\u003c/em\u003e splicing pattern, we used a pair of primers flanking exon 3 that detects the small female and large male spliced \u003cem\u003eSxl\u003c/em\u003e products in RT-PCR (Fig. 3A, B, lane1, 2)\u003csup\u003e59\u003c/sup\u003e. As positive controls, \u003cem\u003eSxl\u003c/em\u003e splicing is partially shifted from the female form to the male form in \u003cem\u003eMettl3\u003c/em\u003e or \u003cem\u003eMettl14\u003c/em\u003e mutant females (Fig. 3B, lane 3-6). In \u003cem\u003eHakai\u003csup\u003eSH2\u003c/sup\u003e\u003c/em\u003e or \u003cem\u003eHakai\u003csup\u003eSH4\u003c/sup\u003e\u003c/em\u003e female flies, a large band corresponding to the male-specific spliced form was clearly detected (Fig. 3B, last 4 lanes), similar to \u003cem\u003eMettl3\u003c/em\u003e or \u003cem\u003eMettl14\u003c/em\u003e mutants.\u003c/p\u003e\n\u003cp\u003eDisruption of several m\u003csup\u003e6\u003c/sup\u003eA components Fl(2)d, Vir, Nito or Flacc leads to not only aberrant \u003cem\u003eSxl\u003c/em\u003e splicing, but also strongly reduced Sxl protein levels, thus generating a striking female-to-male transformation phenotype in adult flies\u003csup\u003e34\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e36\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e38\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e41\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e43\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e60\u003c/sup\u003e. Mutation of other factors Mettl3, Mettl14 or Ythdc1 alone does not affect Sxl protein levels and does not exhibit the transformation phenotype\u003csup\u003e33\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e47\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e48\u003c/sup\u003e. We found that Sxl protein is not reduced in \u003cem\u003eHakai\u003csup\u003eSH2\u003c/sup\u003e\u003c/em\u003e or \u003cem\u003eHakai\u003csup\u003eSH4\u003c/sup\u003e\u003c/em\u003e female discs (Supplemental Fig. 4A-D). Furthermore, we expressed three \u003cem\u003eHakai\u003c/em\u003e RNAi using \u003cem\u003edome-Gal4\u003c/em\u003e and did not observe any transformation phenotype in females, as evidenced before (data not shown)\u003csup\u003e36\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e41\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eOther than \u003cem\u003eSxl\u003c/em\u003e splicing, m\u003csup\u003e6\u003c/sup\u003eA writer and reader mutants show characteristic adult defects. The most prominent ones are the held-out wings and flightless phenotypes in \u003cem\u003eMettl3\u003c/em\u003e, \u003cem\u003eMettl14\u003c/em\u003e, \u003cem\u003eYthdc1\u003c/em\u003e, or \u003cem\u003eFlacc\u003c/em\u003e mutants\u003csup\u003e36\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e61\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e62\u003c/sup\u003e, likely due to m\u003csup\u003e6\u003c/sup\u003eA functions in the nervous system\u003csup\u003e63\u003c/sup\u003e. Wild-type flies normally keep their wings in a folded position (Fig. 3C, G), however, majority of \u003cem\u003eMettl3\u003c/em\u003e mutant flies cannot fold their wings correctly and exhibit held-out wings (Fig. 3D, G), and 100% \u003cem\u003eMettl3\u003c/em\u003e mutant flies cannot fly (Fig. 3H). Interestingly, \u003cem\u003eHakai\u003csup\u003eSH2\u003c/sup\u003e\u003c/em\u003e and \u003cem\u003eHakai\u003csup\u003eSH4\u003c/sup\u003e\u003c/em\u003e mutants phenocopy \u003cem\u003eMettl3\u003c/em\u003e adult defects in terms of strong held-out wing (Fig. 3E-G) and 100% flightless phenotypes (Fig. 3H). Together, these data suggest that Hakai plays an essential role in m\u003csup\u003e6\u003c/sup\u003eA modification pathway in vivo.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEffective m\u003csup\u003e6\u003c/sup\u003eA modification occurs in 5\u0026rsquo;UTR and around start codon in \u003cem\u003eDrosophila\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePreviously, only two studies were reported to map global m\u003csup\u003e6\u003c/sup\u003eA methylation pattern in \u003cem\u003eDrosophila\u003c/em\u003e, one MeRIP-seq in S2R+ cells and another miCLIP in embryos\u003cem\u003e\u003csup\u003e33\u003c/sup\u003e\u003c/em\u003e\u003cem\u003e\u003csup\u003e, \u003c/sup\u003e\u003c/em\u003e\u003cem\u003e\u003csup\u003e47\u003c/sup\u003e\u003c/em\u003e. They found m\u003csup\u003e6\u003c/sup\u003eA enrichment in CDS\u003csup\u003e33\u003c/sup\u003e, in 5\u0026rsquo;UTR and around start codon\u003csup\u003e47\u003c/sup\u003e, as well as in 3\u0026rsquo;UTR and around stop codon\u003csup\u003e47\u003c/sup\u003e, but these experiments were not controlled against m\u003csup\u003e6\u003c/sup\u003eA writer mutants. To obtain a high-stringent m\u003csup\u003e6\u003c/sup\u003eA methylome in adult flies, we performed methylated RNA immunoprecipitation sequencing (MeRIP-seq) in \u003cem\u003eyw\u003c/em\u003e control, \u003cem\u003eMettl3\u003c/em\u003e, \u003cem\u003eMettl14\u003c/em\u003e and \u003cem\u003eHakai\u003c/em\u003e mutants (Supplemental Data 1). In wild-type flies, m\u003csup\u003e6\u003c/sup\u003eA is mostly enriched in 3\u0026rsquo;UTR and near stop codon, and to a lesser extend enriched in 5\u0026rsquo; UTR and near start codon (Fig. 4A, B). \u003cem\u003eDe novo\u003c/em\u003e motif analysis using HOMER identified the consensus sequence RRACH (Fig. 4C), consistent with those in mammalian system\u003csup\u003e8\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e. There are fewer m\u003csup\u003e6\u003c/sup\u003eA peaks in \u003cem\u003eMettl3\u003c/em\u003e, \u003cem\u003eMettl14\u003c/em\u003e or \u003cem\u003eHakai\u003c/em\u003e mutant compared to wild-type (Fig. 4D), and more peaks are reduced in 5\u0026rsquo; UTR than 3\u0026rsquo; UTR region (Fig. 4A, B). We then filtered differential peaks with more stringency (p\u0026lt;0.05 and fold change \u0026ge;2 or \u0026le;0.5) (Supplemental Data 2). Interestingly, many more m\u003csup\u003e6\u003c/sup\u003eA peaks are reduced (\u003cem\u003eMettl3\u003c/em\u003e, 2745; \u003cem\u003eMettl14\u003c/em\u003e, 2615; \u003cem\u003eHakai\u003c/em\u003e, 2036) than increased (\u003cem\u003eMettl3\u003c/em\u003e, 330; \u003cem\u003eMettl14\u003c/em\u003e, 260; \u003cem\u003eHakai\u003c/em\u003e, 278) in these mutants, validating their role as m\u003csup\u003e6\u003c/sup\u003eA writers (Fig. 4E, F). Only in reduced m\u003csup\u003e6\u003c/sup\u003eA peaks, a significant overlap between the three mutants was found (1345 common peaks), suggesting that Hakai plays a similar role to Mettl3 and Mettl14 in m\u003csup\u003e6\u003c/sup\u003eA methylation. In addition, the common reduced peaks in three writer mutants likely represent a high-confident m\u003csup\u003e6\u003c/sup\u003eA modification sites in \u003cem\u003eDrosophila\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eNext we focused on reduced m\u003csup\u003e6\u003c/sup\u003eA peaks for further analysis. Surprisingly, around 90% of these peaks are located in 5\u0026rsquo; UTR and near start codon, and only very small portion occurs in 3\u0026rsquo; UTR (Fig. 4G, Supplemental Fig. 5A-C). A few examples of loss of m\u003csup\u003e6\u003c/sup\u003eA peaks in the three mutants are shown in Fig. 4H and Supplemental Fig. 6, which almost always happen in 5\u0026rsquo; UTR, while m\u003csup\u003e6\u003c/sup\u003eA peaks in 3\u0026rsquo; UTR are generally not changed. These results indicate that although most m\u003csup\u003e6\u003c/sup\u003eA sites map to 3\u0026rsquo; UTR in \u003cem\u003eDrosophila\u003c/em\u003e, the peaks responding to the loss of m\u003csup\u003e6\u003c/sup\u003eA writers, and thus the effective ones, are distributed in 5\u0026rsquo; UTR and this is very different from the mammalian system. Majority peaks in 3\u0026rsquo; UTR may be mediated by another methyltransferase or come from non-specific background. To demonstrate the categories of genes modified by m\u003csup\u003e6\u003c/sup\u003eA, we performed GO and KEGG enrichment for genes with reduced m\u003csup\u003e6\u003c/sup\u003eA peaks. GO analysis revealed important regulatory mechanisms such as signal transduction, kinase activity, transcription factor activity, as well as biological processes such as nervous system development and open tracheal system development (Fig. 4I, Supplemental Fig. 5D, F, H). KEGG analysis found most key signaling pathways, including mTOR, FoxO, Wnt, Hedgehog, TGF-b, Hippo, MAPK, Notch, Toll and Imd, Autophagy, et al (Fig. 4J, Supplemental Fig. 5E, G, I). Since so many signaling pathways are enriched for m\u003csup\u003e6\u003c/sup\u003eA targets, it is not surprising that this modification is involved in numerous biological processes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003em\u003csup\u003e6\u003c/sup\u003eA modification does not reduce mRNA levels in \u003cem\u003eDrosophila\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe further analyzed gene expression regulated by m\u003csup\u003e6\u003c/sup\u003eA writer components by RNA-seq (Supplemental Data 3). In \u003cem\u003eMettl3\u003c/em\u003e, \u003cem\u003eMettl14\u003c/em\u003e and \u003cem\u003eHakai\u003c/em\u003e mutant adult flies, 987, 954 and 886 genes were differentially expressed (p\u0026lt;0.05 and fold change \u0026ge;2 or \u0026le;0.5), respectively (Fig. 5A) (Supplemental Data 4). These genes substantially overlap with each other (Fig. 5B) and common differentially expressed genes generally change in the same direction in the three mutants (Fig. 5C), arguing they act in the same pathway. Interestingly, differentially expressed genes were strongly enriched for immune response genes, as well as chitin binding genes in GO analysis (Fig. 5D, Supplemental Fig. 7). KEGG analysis revealed enrichment for metabolic pathways, including carbohydrate, amino acid and lipid metabolism, possibly reflecting an indirect regulation by m\u003csup\u003e6\u003c/sup\u003eA pathway (Fig. 5E, Supplemental Fig. 7). By exhibiting MeRIP-seq together with RNA-seq data, we observed the reduction of m\u003csup\u003e6\u003c/sup\u003eA peaks in \u003cem\u003eMettl3\u003c/em\u003e, \u003cem\u003eMettl14\u003c/em\u003e or \u003cem\u003eHakai\u003c/em\u003e mutant, and no obvious trend for change of mRNA expression correlated with differential m\u003csup\u003e6\u003c/sup\u003eA peaks (Fig. 5F-H, Supplemental Data 5). We further divided genes into m\u003csup\u003e6\u003c/sup\u003eA targets or non-targets, and cumulative plot show that there is no obvious difference between m\u003csup\u003e6\u003c/sup\u003eA targets and non-targets in \u003cem\u003eHakai\u003c/em\u003e or \u003cem\u003eMettl3\u003c/em\u003e mutant flies (Fig. 5I, J), while there is a slight positive effect of m\u003csup\u003e6\u003c/sup\u003eA on mRNA levels in \u003cem\u003eMettl14\u003c/em\u003e mutant (Fig. 5K), similar to a previous report\u003csup\u003e33\u003c/sup\u003e. These findings are consistent with the notion that effective m\u003csup\u003e6\u003c/sup\u003eA modifications are located in 5\u0026rsquo; UTR in \u003cem\u003eDrosophila\u003c/em\u003e, and thus do not mediate mRNA degradation as in mammalian system.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHakai modulates the stability of other m\u003csup\u003e6\u003c/sup\u003eA writer components\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe aim to look further the mechanisms of Hakai in m\u003csup\u003e6\u003c/sup\u003eA methylation. Since Hakai is a potential E3 ubiquitin ligase, we examined the protein distribution of other m\u003csup\u003e6\u003c/sup\u003eA writer factors in the absence of \u003cem\u003eHakai\u003c/em\u003e using available antibodies. In wild-type wing discs, Fl(2)d, Nito and Flacc are ubiquitous nuclear proteins that co-localizes with each other (Fig. 6A-B). Expression of \u003cem\u003eHakai\u003c/em\u003e RNAi in the dorsal half of the wing disc using \u003cem\u003eap-Gal4\u003c/em\u003e leads to no effect on Nito protein level (Fig. 6C\u0026rsquo;), but a strong reduction of Fl(2)d and Flacc levels (Fig. 6C, D). In addition, we crossed \u003cem\u003eactin-Cas9\u003c/em\u003e with \u003cem\u003eU6-Hakai-sgRNA\u003c/em\u003e flies to generate random \u003cem\u003eHakai\u003c/em\u003e loss-of-function clones. These clones are marked by the loss of Hakai staining and Fl(2)d level is reduced in these clones as well (Fig. 6E-E\u0026rsquo;). Overall, Hakai is required for the protein levels of Fl(2)d and Flacc in the m\u003csup\u003e6\u003c/sup\u003eA pathway.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eHakai does not mediate E-cadherin levels in wing discs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHakai was first demonstrated as an E-cadherin interaction protein and its role in E-cadherin endocytosis and down-regulation was extensively studied in cell culture\u003csup\u003e50\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e51\u003c/sup\u003e. However, a previous study in \u003cem\u003eDrosophila\u003c/em\u003e failed to observe a major role for Hakai in E-cadherin regulation\u003csup\u003e52\u003c/sup\u003e. Thus, we addressed this question using our new genetic toolset. In wild-type wing disc epithelia, E-cadherin shows a membrane distribution and accumulates in the adherens junction (Fig. 7A, A\u0026rsquo;). First, we used \u003cem\u003eap-Gal4\u003c/em\u003e to drive the expression of \u003cem\u003eHakai\u003c/em\u003e RNAi in the dorsal half of the wing disc. Although Hakai level is effectively knocked down (Fig. 7C\u0026rsquo;), E-cadherin level does not change in either the apical or the lateral section (Fig. 7C, C\u0026rdquo;). Second, in \u003cem\u003eHakai \u003c/em\u003emutant clones generated by crossing \u003cem\u003eactin-Cas9\u003c/em\u003e with \u003cem\u003eU6-Hakai-sgRNA\u003c/em\u003e, E-cadherin level is not affected as well (Fig. 7D-D\u0026rdquo;). Finally, we examined the localization of E-cadherin and Hakai in detail using the large tracheal cells. As shown in Fig. 7B-B\u0026rdquo;, most E-cadherin is in the cell membrane, while most Hakai is in the nucleus, and we did not observe co-localization between these two proteins. In conclusion, Hakai is not important for E-cadherin levels in \u003cem\u003eDrosophila\u003c/em\u003e and its major function likely happens in the nucleus.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003em\u003csup\u003e6\u003c/sup\u003eA modification has been known for more than 40 years\u003csup\u003e6\u003c/sup\u003e but recently gained great attention due to emergence of technologies to map m\u003csup\u003e6\u003c/sup\u003eA methylome\u003csup\u003e8\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e9\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e64\u003c/sup\u003e, as well as the identification of the writers, readers and erasers in this pathway\u003csup\u003e4\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e14\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e15\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e16\u003c/sup\u003e. Since the initial purification of the key methyltransferase Mettl3\u003csup\u003e21\u003c/sup\u003e, other components of the writer complex were gradually identified through biochemical experiments and genetic screens. We now know that m\u003csup\u003e6\u003c/sup\u003eA writer complex is comprised of multiple components including Mettl3, Mettl14, WTAP, Virma, Rbm15/15B, ZC3H13. Hakai was first indicated as a WTAP interaction protein\u003csup\u003e23\u003c/sup\u003e and was shown later required for full m\u003csup\u003e6\u003c/sup\u003eA methylation in \u003cem\u003eArabidopsis\u003c/em\u003e\u003csup\u003e37\u003c/sup\u003e, however, its role in m\u003csup\u003e6\u003c/sup\u003eA pathway in animals has not been studied. Here, we show that Hakai interacts with other m\u003csup\u003e6\u003c/sup\u003eA writer subunits, and \u003cem\u003eHakai \u003c/em\u003emutants exhibit characteristic m\u003csup\u003e6\u003c/sup\u003eA pathway phenotypes, such as lowered m\u003csup\u003e6\u003c/sup\u003eA levels in mRNA, aberrant \u003cem\u003eSxl\u003c/em\u003e alternative splicing in females, held-out wings and flightless flies, as well as reduced m\u003csup\u003e6\u003c/sup\u003eA peaks shared with \u003cem\u003eMettl3\u003c/em\u003e and \u003cem\u003eMettl14\u003c/em\u003e mutants in MeRIP-seq. Altogether, these data unambiguously argue that Hakai is the seventh, and likely last core component of the conserved m\u003csup\u003e6\u003c/sup\u003eA writer complex (Fig. 6F).\u003c/p\u003e\n\u003cp\u003eEach component in the m\u003csup\u003e6\u003c/sup\u003eA writer complex is essential for m\u003csup\u003e6\u003c/sup\u003eA methylation in mRNA but the exact roles of them are not fully understood. Mettl3 is the only subunit that has the methyltransferase enzymatic activity, while Mettl14 contains an RNA-binding site and allosterically activates the catalytic activity of Mettl3\u003csup\u003e65\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e66\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e67\u003c/sup\u003e. WTAP is a key adaptor to interact with Mettl3 and Mettl14\u003csup\u003e25\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e27\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e29\u003c/sup\u003e and is required for their nuclear speckle localization\u003csup\u003e28\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e68\u003c/sup\u003e. Virma preferentially mediates m\u003csup\u003e6\u003c/sup\u003eA methylation in 3\u0026rsquo; UTR and near stop codon in human cells and recruits polyadenylation cleavage factor CPSF5 and CPSF6 to regulate alternative polyadenylation\u003csup\u003e31\u003c/sup\u003e. Rbm15 and Rbm15B contain three RRM domains and bind positions adjacent to m\u003csup\u003e6\u003c/sup\u003eA sites, thus may provide specificity for the m\u003csup\u003e6\u003c/sup\u003eA writer complex\u003csup\u003e32\u003c/sup\u003e. ZC3H13 is important for the nuclear localization of several writer components, and has also been proposed to link Rbm15/Nito to WTAP/Fl(2)d\u003csup\u003e34\u003c/sup\u003e. Here, we show that Hakai is required for the stability of Fl(2)d and Flacc, but not Nito, in \u003cem\u003eDrosophila\u003c/em\u003e tissues. Overall, more mechanistic studies including super-resolution imaging, biochemical analysis and crystal structures of the complete writer complex will be required to fully elucidate the activity of the m\u003csup\u003e6\u003c/sup\u003eA writer complex.\u003c/p\u003e\n\u003cp\u003eRecent emerging studies suggest that m\u003csup\u003e6\u003c/sup\u003eA is involved in numerous developmental processes and human diseases\u003csup\u003e16\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e69\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e70\u003c/sup\u003e, mainly by controlling mRNA stability, translation or splicing. \u003cem\u003eDrosophila\u003c/em\u003e has all seven writer complex components, one homolog of YTHDC1 and one homolog of YTHDF, representing a simple and genetically tractable model system, since mammals have three YTHDF readers with specific or redundant functions\u003csup\u003e17\u003c/sup\u003e. Pioneer work from three labs have established the framework for m\u003csup\u003e6\u003c/sup\u003eA pathway in \u003cem\u003eDrosophila\u003c/em\u003e\u003csup\u003e33\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e47\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e48\u003c/sup\u003e. However, only published \u003cem\u003eDrosophila\u003c/em\u003e m\u003csup\u003e6\u003c/sup\u003eA methylome was performed in S2R+ cells or embryos\u003csup\u003e33\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e47\u003c/sup\u003e. It is not clear which genomic regions are enriched for effective m\u003csup\u003e6\u003c/sup\u003eA modification since these experiments were not done against writer mutants. Other than \u003cem\u003eSxl\u003c/em\u003e, few m\u003csup\u003e6\u003c/sup\u003eA target loci have been firmly mapped. By performing MeRIP-seq in wild-type adult flies, as well as \u003cem\u003eMettl3\u003c/em\u003e, \u003cem\u003eMettl14\u003c/em\u003e and \u003cem\u003eHakai\u003c/em\u003e mutants, we demonstrated that although m\u003csup\u003e6\u003c/sup\u003eA peaks are distributed mostly in 3\u0026rsquo; UTR region, the functional peaks responding to the loss of m\u003csup\u003e6\u003c/sup\u003eA writers are almost all located in 5\u0026rsquo; UTR region and near start codon. This finding indicates a major difference between \u003cem\u003eDrosophila\u003c/em\u003e and mammalian m\u003csup\u003e6\u003c/sup\u003eA methylome, which mainly occurs in 3\u0026rsquo; UTR, and is in agreement with a recently submitted manuscript using miCLIP\u003csup\u003e71\u003c/sup\u003e. In zebrafish, more m\u003csup\u003e6\u003c/sup\u003eA peaks were decreased in 5\u0026rsquo; UTR than 3\u0026rsquo; UTR region in \u003cem\u003eMettl3\u003c/em\u003e morpholino knockdown\u003csup\u003e72\u003c/sup\u003e. Since m\u003csup\u003e6\u003c/sup\u003eA modification in 3\u0026rsquo; UTR usually causes mRNA instability and m\u003csup\u003e6\u003c/sup\u003eA in 5\u0026rsquo; UTR is linked to translation enhancement, our results imply that the major role of m\u003csup\u003e6\u003c/sup\u003eA modification in \u003cem\u003eDrosophila\u003c/em\u003e is not mRNA degradation, but likely translation upregulation. Indeed, we did not observe an increase in the mRNA expression of m\u003csup\u003e6\u003c/sup\u003eA targets in \u003cem\u003eMettl3\u003c/em\u003e, \u003cem\u003eMettl14\u003c/em\u003e or \u003cem\u003eHakai\u003c/em\u003e mutants compared to wild-type flies.\u003c/p\u003e\n\u003cp\u003eBy screening for m\u003csup\u003e6\u003c/sup\u003eA peaks commonly reduced in \u003cem\u003eMettl3\u003c/em\u003e, \u003cem\u003eMettl14\u003c/em\u003e and \u003cem\u003eHakai\u003c/em\u003e mutants, we identified a set of high-confident m\u003csup\u003e6\u003c/sup\u003eA modification genes and peaks in \u003cem\u003eDrosophila\u003c/em\u003e adults. Interestingly, these genes are enriched for most key signaling pathways, thus explaining the involvement of m\u003csup\u003e6\u003c/sup\u003eA modification in numerous developmental and physiological processes. RNA-seq analysis revealed strong enrichment in immune response genes, as well as various metabolic pathways. The involvement of m\u003csup\u003e6\u003c/sup\u003eA modification in fly immune response has not been reported before, and is likely mediated by direct regulation since Toll and Imd signaling are also enriched in meRIP-seq. The involvement in metabolism might be a combined effect caused by signaling such as mTOR, FoxO, autophagy, et al, as indicated by meRIP-seq. We have observed several developmental and metabolic defects associated with m\u003csup\u003e6\u003c/sup\u003eA mutants, and are currently working on the underlying mechanisms.\u003c/p\u003e\n\u003cp\u003eHakai was initially identified as an E-cadherin binding protein to downgrade its levels post-translationally\u003csup\u003e50\u003c/sup\u003e and the role of Hakai in cell proliferation and tumor progression have been extensively studied in cell culture\u003csup\u003e51\u003c/sup\u003e. However, our in vivo analysis using various genetic tools did not find a requirement of Hakai in E-cadherin regulation. In addition, we found that Hakai is a ubiquitous nuclear protein showing little co-localization with E-cadherin in the membrane. Consistently, Hakai was shown to interact with PTB-associated splicing factor (PSF), a nuclear protein, and to affect its RNA-binding ability\u003csup\u003e73\u003c/sup\u003e. Together, we think that the major function of Hakai occurs in the nucleus and its role in E-cadherin regulation needs to be further investigated using knockout mouse model.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eFly strains and genetics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFlies were grown on standard cornmeal food and experiments were performed at 25\u0026deg;C. The following stocks were used: \u003cem\u003ew\u003csup\u003e1118\u003c/sup\u003e\u003c/em\u003e (used as wild-type, WT), \u003cem\u003eyw\u003c/em\u003e, \u003cem\u003eMettl3\u003csup\u003eSK2\u003c/sup\u003e\u003c/em\u003e, \u003cem\u003eMettl14\u003csup\u003eSK1\u003c/sup\u003e\u003c/em\u003e \u003csup\u003e61\u003c/sup\u003e, \u003cem\u003eDf(3R)Exel6197\u003c/em\u003e (\u003cem\u003eMettl3\u003c/em\u003e deficiency, Bloomington 7676), \u003cem\u003eap-Gal4\u003c/em\u003e, \u003cem\u003eHakai\u003c/em\u003e shRNA (VDRC 330548), \u003cem\u003eactin-Cas9\u003c/em\u003e (Bloomington 54590)\u003csup\u003e55\u003c/sup\u003e, \u003cem\u003enanos-Cas9\u003c/em\u003e (Bloomington 78782)\u003csup\u003e57\u003c/sup\u003e. To generate \u003cem\u003eU6-Hakai-sgRNA\u003c/em\u003e, target sequence \u0026ldquo;ACGTCCGCGCCCGCGAGCCC\u0026rdquo; was picked by DRSC Find CRISPRs\u003csup\u003e57\u003c/sup\u003e and cloned into pCFD3 vector\u003csup\u003e55\u003c/sup\u003e (Addgene 49410). The construct was inserted at attP40 site by standard PhiC31-mediated transformation to make transgenic flies in UniHuaii. \u003cem\u003eU6-Hakai-sgRNA\u003c/em\u003e was crossed with \u003cem\u003enanos-Cas9\u003c/em\u003e flies to generate a series of indel mutations and \u003cem\u003eHakai\u003csup\u003eSH2\u003c/sup\u003e\u003c/em\u003e and \u003cem\u003eHakai\u003csup\u003eSH4\u003c/sup\u003e\u003c/em\u003e were chosen for further analysis. Two additional Hakai shRNAs were made based on the new pNP vector by Tsinghua Fly Center\u003csup\u003e56\u003c/sup\u003e. TH14422.S with target sequence \u0026ldquo;GAGCTCGACAAGGACGGCGAA\u0026rdquo; was inserted at attP2 site and TH14423.S with target sequence \u0026ldquo;CGGCCGCATGATACCCTGCAA\u0026rdquo; was inserted at attP40 site. The three \u003cem\u003eHakai\u003c/em\u003e shRNAs show similar knockdown efficiency as examined by Hakai antibody staining. TH14422.S was used in Fig. 6C-C\u0026rsquo;, TH14423.S was used in Fig. 6D, and VDRC330548 was used in Fig. 7C-C\u0026rdquo;. To test adult flight ability, cohorts of 10 male flies were tapped down into a petri dish and the number of flies that flew away within 2 minutes was recorded.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunostaining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLarval wing discs were stained as previously described\u003csup\u003e40\u003c/sup\u003e. Briefly, tissues were dissected in PBS and fixed in 4% formaldehyde (Sigma) in PBST (PBS + 0.1% Triton X-100). After blocking in 1% normal donkey serum (Jackson Immuno) in PBST for 1 hour, the samples were incubated with the primary antibody in the same solution at 4\u0026deg;C overnight. After three washes in PBST, samples were incubated with the secondary antibody for 2 hours at room temperature, washed in PBST three times, and subsequently mounted in Antifade Mounting Medium (Beyotime). All images were taken on a Zeiss LSM 880 microscope.\u003c/p\u003e\n\u003cp\u003eThe following antibodies were used: mouse anti-Fl(2)d (1:10) (9G2, DSHB), rat anti-Ecad (1:5) (DCAD2, DSHB), mouse anti-Sxl (1:10) (M18, DSHB), rabbit anti-Flacc (1:200)\u003csup\u003e36\u003c/sup\u003e, rabbit anti-Hakai (1:200); Alexa 488- (1:1000) (ThermoFisher) or Cy3- (1:400) (Jackson Immuno) conjugated secondary antibodies and DAPI (1:1000) (Beyotime). Hakai antibody was generated in rabbits against a recombinant protein containing amino acids 1-120 and affinity-purified at ABclonal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular cloning and co-immunoprecipitation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo generate the GFP-, mRFP- or HA-tagged plasmids, full-length cDNAs for Hakai (the long isoform amplified from a cDNA library), Flacc (GH14795), Nito (GH11110), Fl(2)d (LD21616), METTL3 (AT20169), and METTL14 (LD06016) were cloned into the pENTR vector (Invitrogen), and transferred into the \u003cem\u003eDrosophila\u003c/em\u003e Gateway vector pAGW, pARW and pAHW. GFP was cloned into pAWM as a control.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDrosophila\u003c/em\u003e S2 cells were maintained in Schneider\u0026rsquo;s medium (Gibco) supplemented with 10% FBS (Gibco) at 25\u0026deg;C. 2 \u0026mu;g of total DNA was transfected into S2 cells in a 60 mm dish with Effectene (QIAGEN). After 48 hours, cells were lysed in IP lysis buffer (Beyotime, 50mM Tris (pH7.4), 150mM NaCl, 1% NP-40, 1 x protease inhibitor) on ice for 30 mins, and cleared at 20000g for 10 mins at 4 \u0026deg;C. Supernatants were incubated with anti-GFP nanobody agarose beads (Allele Biotechnology) for 2 hours at 4 \u0026deg;C. The beads were washed 3-4 times with 1 ml lysis buffer and resuspended in 2 x SDS sample buffer. Eluted proteins were detected by Western blotting using rabbit anti-GFP (1:1000, A6455, Molecular Probes) or rat anti-HA (1:1000, 3F10, Roche) primary antibodies, and HRP-conjugated secondary antibodies (1:3000, Santa Cruz Biotech). For co-localization, S2 cells were grown on Lab-Tek chamber slides and imaged in live conditions 2 days after transfection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRT-PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNAs were extracted using TRIzol (Invitrogen) and cDNAs were generated from 0.5 \u0026mu;g of RNA using Hifair II 1st Strand cDNA Synthesis Kit with gDNA digester plus (Yeason). 2xHieff PCR Master Mix (Yeasen) was used for regular PCR. \u003cem\u003eSxl\u003c/em\u003e primers used in Fig. 3B are GTGGTTATCCCCCATATGGC and GATGGCAGAGAATGGGAC, and PCR conditions were described in \u003csup\u003e59\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnalyzing m\u003csup\u003e6\u003c/sup\u003eA levels by LC-MS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNAs were extracted from \u003cem\u003eyw\u003c/em\u003e, \u003cem\u003ew\u003csup\u003e1118\u003c/sup\u003e\u003c/em\u003e, \u003cem\u003eMettl3\u003csup\u003eSK2\u003c/sup\u003e/Df\u003c/em\u003e, \u003cem\u003eMettl14\u003csup\u003eSK1\u003c/sup\u003e\u003c/em\u003e, \u003cem\u003eHakai\u003csup\u003eSH2\u003c/sup\u003e\u003c/em\u003e and \u003cem\u003eHakai\u003csup\u003eSH4\u003c/sup\u003e\u003c/em\u003e male adult flies about 1-2 days old using TRIzol (Invitrogen), and then subjected to two rounds of poly(A) selection using the GenElute mRNA Miniprep kit (Sigma). Before LC-MS analysis, all RNA samples were hydrolysed enzymatically to ribonucleosides. Briefly, 600ng RNA of each sample was digested by nuclease P1 (Sigma) and snake venom phosphodiesterase (Sigma) at 37\u0026deg;C for 2 hours, and followed by digestion with fast alkaline phosphatase (Thermo Fisher) for another 1 hour. Then, the digested samples were used for the following LC-MS analysis.\u003c/p\u003e\n\u003cp\u003eQuantitative LC-MS analyses of m\u003csup\u003e6\u003c/sup\u003eA and adenosine were achieved using a Waters UPLC coupled to Thermo Q Exactive mass spectrometer in positive ion mode using dynamic multiple reaction monitoring. The ribonucleosides in the hydrolysed RNA samples were resolved on an acquity UPLC HSS T3 column (1.8 \u0026micro;m particle size, 100\u0026Aring; pore size, 2.1 mm X 100 mm, 30℃) at 300 \u0026micro;l min\u003csup\u003e-1\u003c/sup\u003e using a solvent system of 0.1% formic acid in H\u003csub\u003e2\u003c/sub\u003eO (A) and acetonitrile (B). The elution profile was 2% B for 2min, 2-11% B over 4 min, then to 11-80% B over 4min, followed by a column washing at 80% B and column equilibration. The quantification of a ribonucleoside can be achieved using m/z of the parent ribonucleoside ion and m/z of the deglycosylated ion product. Nucleosides were quantified based on the transition of the parent ribonucleoside to the deglycosylated base ion: m/z 282.1-150.1 for m\u003csup\u003e6\u003c/sup\u003eA and m/z 268.1-136.1 for A. Absolute quantities of each ribonucleoside were determined using an external calibration curve prepared with A standards (Sigma) and m\u003csup\u003e6\u003c/sup\u003eA standards (Selleck).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emeRIP-seq\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMeRIP-seq was performed as described in \u003csup\u003e74\u003c/sup\u003e\u003csup\u003e, \u003c/sup\u003e\u003csup\u003e75\u003c/sup\u003e. Total RNA was isolated from \u003cem\u003eyw\u003c/em\u003e, \u003cem\u003eMettl3\u003csup\u003eSK2\u003c/sup\u003e/Df\u003c/em\u003e, \u003cem\u003eMettl14\u003csup\u003eSK1\u003c/sup\u003e\u003c/em\u003e, and \u003cem\u003eHakai\u003csup\u003eSH4\u003c/sup\u003e\u003c/em\u003e male adult flies about 1-2 days old using TRIzol (Invitrogen). The RNA amount of each sample was quantified using NanoDrop ND-1000 and the RNA integrity was assessed by Bioanalyzer 2100 (Agilent) with RIN number \u0026gt;7.0, and confirmed by electrophoresis with denaturing agarose gel. Poly(A) RNA was purified from 50\u0026mu;g total RNA using Dynabeads Oligo (dT)25 (Thermo Fisher) by two rounds of purification and then was fragmented into small pieces using Magnesium RNA Fragmentation Module (NEB) under 86℃ for 7 minites. The cleaved RNA fragments were incubated for 2 hours at 4℃ with Dynabeads (Dynabeads Antibody Coupling Kit, Thermo Fisher) coupled with m\u003csup\u003e6\u003c/sup\u003eA-specific antibody (202003, Synaptic Systems) in IP buffer (50 mM Tris-HCl, 750 mM NaCl and 0.5% Igepal CA-630). Then the IP RNA fragments and untreated input control fragments are converted to final cDNA library in accordance with a strand-specific library preparation by dUTP method. The average insert size for the final cDNA library was 200\u0026plusmn;50 bp. At last, we performed the 2\u0026times;150bp paired-end sequencing (PE150) on an illumina Novaseq 6000 (LC-Bio Technology) following the vendor's recommended protocol.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioinformatic analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003efastp software was used to remove the reads that contained adaptor contamination, low quality bases and undetermined bases with default parameters. Then sequence quality of IP and Input samples were also verified using fastp. We used HISAT2\u003csup\u003e76\u003c/sup\u003e to map reads to the genome of \u003cem\u003eDrosophila_melanogaster\u003c/em\u003e (Version: v96) with default parameters. Mapped reads of IP and input libraries were provided for R package exomePeak\u003csup\u003e77\u003c/sup\u003e, which identifies m\u003csup\u003e6\u003c/sup\u003eA peaks with bed or bigwig format that can be adapted for visualization on the IGV software. HOMER\u003csup\u003e78\u003c/sup\u003e was used for de novo and known motif finding followed by localization of the motif with respect to peak summit. Called peaks were annotated by intersection with gene architecture using R package ChIPseeker\u003csup\u003e79\u003c/sup\u003e. A common peak was picked if the peaks from different groups overlap in the genome\u0026gt; 50% of the smallest of the peaks. StringTie\u003csup\u003e80\u003c/sup\u003e was used to perform expression level for all mRNAs from input libraries by calculating FPKM. The differentially expressed mRNAs were selected with log2 (fold change) \u0026gt;1 or log2 (fold change) \u0026lt;-1 and p value \u0026lt; 0.05 by R package edgeR\u003csup\u003e81\u003c/sup\u003e\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Eric Lai, Bloomington Drosophila Stock Center, TsingHua Fly Center and Vienna Drosophila Resource Center for fly stocks; Developmental Studies Hybridoma Bank for antibodies; the mass-spec and imaging core facility of Institute of Plant Physiology and Ecology for technical support. This work is supported by the National Natural Science Foundation of China (31970786, 91857114, 31771586) and National Key R\u0026amp;D Program of China (2018YFA0800100, 2018YFA0800102) to D.Y..\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZhao BS, Roundtree IA, He C. Post-transcriptional gene regulation by mRNA modifications. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e 18, 31\u0026ndash;42 (2017).\u003c/li\u003e\n\u003cli\u003eGilbert WV, Bell TA, Schaening C. Messenger RNA modifications: Form, distribution, and function. \u003cem\u003eScience\u003c/em\u003e 352, 1408\u0026ndash;1412 (2016).\u003c/li\u003e\n\u003cli\u003eBoccaletto P, \u003cem\u003eet al.\u003c/em\u003e MODOMICS: a database of RNA modification pathways. 2017 update. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 46, D303-D307 (2018).\u003c/li\u003e\n\u003cli\u003eZaccara S, Ries RJ, Jaffrey SR. Reading, writing and erasing mRNA methylation. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e 20, 608\u0026ndash;624 (2019).\u003c/li\u003e\n\u003cli\u003eRoundtree IA, Evans ME, Pan T, He C. Dynamic RNA Modifications in Gene Expression Regulation. \u003cem\u003eCell\u003c/em\u003e 169, 1187\u0026ndash;1200 (2017).\u003c/li\u003e\n\u003cli\u003eDesrosiers R, Friderici K, Rottman F. Identification of methylated nucleosides in messenger RNA from Novikoff hepatoma cells. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 71, 3971\u0026ndash;3975 (1974).\u003c/li\u003e\n\u003cli\u003ePerry R, Kelley DE. Existence of methylated messenger RNA in mouse L cells. \u003cem\u003eCell\u003c/em\u003e 1, 37\u0026ndash;42 (1974).\u003c/li\u003e\n\u003cli\u003eMeyer KD, Saletore Y, Zumbo P, Elemento O, Mason CE, Jaffrey SR. Comprehensive analysis of mRNA methylation reveals enrichment in 3' UTRs and near stop codons. \u003cem\u003eCell\u003c/em\u003e 149, 1635\u0026ndash;1646 (2012).\u003c/li\u003e\n\u003cli\u003eDominissini D, \u003cem\u003eet al.\u003c/em\u003e Topology of the human and mouse m6A RNA methylomes revealed by m6A-sEq. \u003cem\u003eNature\u003c/em\u003e 485, 201\u0026ndash;206 (2012).\u003c/li\u003e\n\u003cli\u003eSchwartz S, \u003cem\u003eet al.\u003c/em\u003e High-resolution mapping reveals a conserved, widespread, dynamic mRNA methylation program in yeast meiosis. \u003cem\u003eCell\u003c/em\u003e 155, 1409\u0026ndash;1421 (2013).\u003c/li\u003e\n\u003cli\u003eLuo GZ, \u003cem\u003eet al.\u003c/em\u003e Unique features of the m6A methylome in Arabidopsis thaliana. \u003cem\u003eNat Commun\u003c/em\u003e 5, 5630 (2014).\u003c/li\u003e\n\u003cli\u003eZhou J, Wan J, Gao X, Zhang X, Jaffrey SR, Qian SB. Dynamic m(6)A mRNA methylation directs translational control of heat shock response. \u003cem\u003eNature\u003c/em\u003e 526, 591\u0026ndash;594 (2015).\u003c/li\u003e\n\u003cli\u003eMeyer KD, \u003cem\u003eet al.\u003c/em\u003e 5' UTR m(6)A Promotes Cap-Independent Translation. \u003cem\u003eCell\u003c/em\u003e 163, 999\u0026ndash;1010 (2015).\u003c/li\u003e\n\u003cli\u003eMeyer KD, Jaffrey SR. Rethinking m(6)A Readers, Writers, and Erasers. \u003cem\u003eAnnu Rev Cell Dev Biol\u003c/em\u003e 33, 319\u0026ndash;342 (2017).\u003c/li\u003e\n\u003cli\u003eShi H, Wei J, He C. Where, When, and How: Context-Dependent Functions of RNA Methylation Writers, Readers, and Erasers. \u003cem\u003eMol Cell\u003c/em\u003e 74, 640\u0026ndash;650 (2019).\u003c/li\u003e\n\u003cli\u003eYang Y, Hsu PJ, Chen YS, Yang YG. Dynamic transcriptomic m(6)A decoration: writers, erasers, readers and functions in RNA metabolism. \u003cem\u003eCell Res\u003c/em\u003e 28, 616\u0026ndash;624 (2018).\u003c/li\u003e\n\u003cli\u003ePatil DP, Pickering BF, Jaffrey SR. Reading m(6)A in the Transcriptome: m(6)A-Binding Proteins. \u003cem\u003eTrends Cell Biol\u003c/em\u003e 28, 113\u0026ndash;127 (2018).\u003c/li\u003e\n\u003cli\u003eJia G, \u003cem\u003eet al.\u003c/em\u003e N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. \u003cem\u003eNat Chem Biol\u003c/em\u003e 7, 885\u0026ndash;887 (2011).\u003c/li\u003e\n\u003cli\u003eZheng G, \u003cem\u003eet al.\u003c/em\u003e ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. \u003cem\u003eMol Cell\u003c/em\u003e 49, 18\u0026ndash;29 (2013).\u003c/li\u003e\n\u003cli\u003eMauer J, \u003cem\u003eet al.\u003c/em\u003e Reversible methylation of m(6)Am in the 5' cap controls mRNA stability. \u003cem\u003eNature\u003c/em\u003e 541, 371\u0026ndash;375 (2017).\u003c/li\u003e\n\u003cli\u003eBokar JA, Rath-Shambaugh ME, Ludwiczak R, Narayan P, Rottman F. Characterization and partial purification of mRNA N6-adenosine methyltransferase from HeLa cell nuclei. Internal mRNA methylation requires a multisubunit complex. \u003cem\u003eJ Biol Chem\u003c/em\u003e 269, 17697\u0026ndash;17704 (1994).\u003c/li\u003e\n\u003cli\u003eBokar JA, Shambaugh ME, Polayes D, Matera AG, Rottman FM. Purification and cDNA cloning of the AdoMet-binding subunit of the human mRNA (N6-adenosine)-methyltransferase. \u003cem\u003eRNA\u003c/em\u003e 3, 1233\u0026ndash;1247 (1997).\u003c/li\u003e\n\u003cli\u003eHoriuchi K, \u003cem\u003eet al.\u003c/em\u003e Identification of Wilms' tumor 1-associating protein complex and its role in alternative splicing and the cell cycle. \u003cem\u003eJ Biol Chem\u003c/em\u003e 288, 33292\u0026ndash;33302 (2013).\u003c/li\u003e\n\u003cli\u003eHongay CF, Orr-Weaver TL. Drosophila Inducer of MEiosis 4 (IME4) is required for Notch signaling during oogenesis. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 108, 14855\u0026ndash;14860 (2011).\u003c/li\u003e\n\u003cli\u003eLiu J, \u003cem\u003eet al.\u003c/em\u003e A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. \u003cem\u003eNat Chem Biol\u003c/em\u003e 10, 93\u0026ndash;95 (2014).\u003c/li\u003e\n\u003cli\u003eWang Y, Li Y, Toth JI, Petroski MD, Zhang Z, Zhao JC. N6-methyladenosine modification destabilizes developmental regulators in embryonic stem cells. \u003cem\u003eNat Cell Biol\u003c/em\u003e 16, 191\u0026ndash;198 (2014).\u003c/li\u003e\n\u003cli\u003eZhong S, \u003cem\u003eet al.\u003c/em\u003e MTA is an Arabidopsis messenger RNA adenosine methylase and interacts with a homolog of a sex-specific splicing factor. \u003cem\u003ePlant Cell\u003c/em\u003e 20, 1278\u0026ndash;1288 (2008).\u003c/li\u003e\n\u003cli\u003ePing XL, \u003cem\u003eet al.\u003c/em\u003e Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. \u003cem\u003eCell Res\u003c/em\u003e 24, 177\u0026ndash;189 (2014).\u003c/li\u003e\n\u003cli\u003eAgarwala SD, Blitzblau HG, Hochwagen A, Fink GR. RNA methylation by the MIS complex regulates a cell fate decision in yeast. \u003cem\u003ePLoS Genet\u003c/em\u003e 8, e1002732 (2012).\u003c/li\u003e\n\u003cli\u003eSchwartz S, \u003cem\u003eet al.\u003c/em\u003e Perturbation of m6A writers reveals two distinct classes of mRNA methylation at internal and 5' sites. \u003cem\u003eCell Rep\u003c/em\u003e 8, 284\u0026ndash;296 (2014).\u003c/li\u003e\n\u003cli\u003eYue Y, \u003cem\u003eet al.\u003c/em\u003e VIRMA mediates preferential m(6)A mRNA methylation in 3'UTR and near stop codon and associates with alternative polyadenylation. \u003cem\u003eCell Discov\u003c/em\u003e 4, 10 (2018).\u003c/li\u003e\n\u003cli\u003ePatil DP, \u003cem\u003eet al.\u003c/em\u003e m(6)A RNA methylation promotes XIST-mediated transcriptional repression. \u003cem\u003eNature\u003c/em\u003e 537, 369\u0026ndash;373 (2016).\u003c/li\u003e\n\u003cli\u003eLence T, \u003cem\u003eet al.\u003c/em\u003e m(6)A modulates neuronal functions and sex determination in Drosophila. \u003cem\u003eNature\u003c/em\u003e 540, 242\u0026ndash;247 (2016).\u003c/li\u003e\n\u003cli\u003eKnuckles P, \u003cem\u003eet al.\u003c/em\u003e Zc3h13/Flacc is required for adenosine methylation by bridging the mRNA-binding factor Rbm15/Spenito to the m(6)A machinery component Wtap/Fl(2)d. \u003cem\u003eGenes Dev\u003c/em\u003e 32, 415\u0026ndash;429 (2018).\u003c/li\u003e\n\u003cli\u003eWen J, \u003cem\u003eet al.\u003c/em\u003e Zc3h13 Regulates Nuclear RNA m(6)A Methylation and Mouse Embryonic Stem Cell Self-Renewal. \u003cem\u003eMol Cell\u003c/em\u003e 69, 1028\u0026ndash;1038 e1026 (2018).\u003c/li\u003e\n\u003cli\u003eGuo J, Tang HW, Li J, Perrimon N, Yan D. Xio is a component of the Drosophila sex determination pathway and RNA N(6)-methyladenosine methyltransferase complex. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 115, 3674\u0026ndash;3679 (2018).\u003c/li\u003e\n\u003cli\u003eRuzicka K, \u003cem\u003eet al.\u003c/em\u003e Identification of factors required for m(6) A mRNA methylation in Arabidopsis reveals a role for the conserved E3 ubiquitin ligase HAKAI. \u003cem\u003eNew Phytol\u003c/em\u003e 215, 157\u0026ndash;172 (2017).\u003c/li\u003e\n\u003cli\u003eGranadino B, Campuzano S, Sanchez L. The Drosophila melanogaster fl(2)d gene is needed for the female-specific splicing of Sex-lethal RNA. \u003cem\u003eEMBO J\u003c/em\u003e 9, 2597\u0026ndash;2602 (1990).\u003c/li\u003e\n\u003cli\u003eHilfiker A, Nothiger R. The temperature-sensitive mutation vir (ts)(virilizer) identifies a new gene involved in sex determination of Drosophila. \u003cem\u003eRoux Arch Dev Biol\u003c/em\u003e 200, 240\u0026ndash;248 (1991).\u003c/li\u003e\n\u003cli\u003eYan D, \u003cem\u003eet al.\u003c/em\u003e A regulatory network of Drosophila germline stem cell self-renewal. \u003cem\u003eDev Cell\u003c/em\u003e 28, 459\u0026ndash;473 (2014).\u003c/li\u003e\n\u003cli\u003eYan D, Perrimon N. spenito is required for sex determination in Drosophila melanogaster. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 112, 11606\u0026ndash;11611 (2015).\u003c/li\u003e\n\u003cli\u003ePenn JK, \u003cem\u003eet al.\u003c/em\u003e Functioning of the Drosophila Wilms'-tumor-1-associated protein homolog, Fl(2)d, in Sex-lethal-dependent alternative splicing. \u003cem\u003eGenetics\u003c/em\u003e 178, 737\u0026ndash;748 (2008).\u003c/li\u003e\n\u003cli\u003eHilfiker A, Amrein H, Dubendorfer A, Schneiter R, Nothiger R. The gene virilizer is required for female-specific splicing controlled by Sxl, the master gene for sexual development in Drosophila. \u003cem\u003eDevelopment\u003c/em\u003e 121, 4017\u0026ndash;4026 (1995).\u003c/li\u003e\n\u003cli\u003ePenalva LO, \u003cem\u003eet al.\u003c/em\u003e The Drosophila fl(2)d gene, required for female-specific splicing of Sxl and tra pre-mRNAs, encodes a novel nuclear protein with a HQ-rich domain. \u003cem\u003eGenetics\u003c/em\u003e 155, 129\u0026ndash;139 (2000).\u003c/li\u003e\n\u003cli\u003eNiessen M, Schneiter R, Nothiger R. Molecular identification of virilizer, a gene required for the expression of the sex-determining gene Sex-lethal in Drosophila melanogaster. \u003cem\u003eGenetics\u003c/em\u003e 157, 679\u0026ndash;688 (2001).\u003c/li\u003e\n\u003cli\u003eOrtega A, \u003cem\u003eet al.\u003c/em\u003e Biochemical function of female-lethal (2)D/Wilms' tumor suppressor-1-associated proteins in alternative pre-mRNA splicing. \u003cem\u003eJ Biol Chem\u003c/em\u003e 278, 3040\u0026ndash;3047 (2003).\u003c/li\u003e\n\u003cli\u003eKan L, \u003cem\u003eet al.\u003c/em\u003e The m(6)A pathway facilitates sex determination in Drosophila. \u003cem\u003eNat Commun\u003c/em\u003e 8, 15737 (2017).\u003c/li\u003e\n\u003cli\u003eHaussmann IU, \u003cem\u003eet al.\u003c/em\u003e m(6)A potentiates Sxl alternative pre-mRNA splicing for robust Drosophila sex determination. \u003cem\u003eNature\u003c/em\u003e 540, 301\u0026ndash;304 (2016).\u003c/li\u003e\n\u003cli\u003eWan C, \u003cem\u003eet al.\u003c/em\u003e Panorama of ancient metazoan macromolecular complexes. \u003cem\u003eNature\u003c/em\u003e 525, 339\u0026ndash;344 (2015).\u003c/li\u003e\n\u003cli\u003eFujita Y, \u003cem\u003eet al.\u003c/em\u003e Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. \u003cem\u003eNat Cell Biol\u003c/em\u003e 4, 222\u0026ndash;231 (2002).\u003c/li\u003e\n\u003cli\u003eAparicio LA, Valladares M, Blanco M, Alonso G, Figueroa A. Biological influence of Hakai in cancer: a 10-year review. \u003cem\u003eCancer Metastasis Rev\u003c/em\u003e 31, 375\u0026ndash;386 (2012).\u003c/li\u003e\n\u003cli\u003eKaido M, Wada H, Shindo M, Hayashi S. Essential requirement for RING finger E3 ubiquitin ligase Hakai in early embryonic development of Drosophila. \u003cem\u003eGenes Cells\u003c/em\u003e 14, 1067\u0026ndash;1077 (2009).\u003c/li\u003e\n\u003cli\u003eGuruharsha KG, \u003cem\u003eet al.\u003c/em\u003e A protein complex network of Drosophila melanogaster. \u003cem\u003eCell\u003c/em\u003e 147, 690\u0026ndash;703 (2011).\u003c/li\u003e\n\u003cli\u003eGraveley BR, \u003cem\u003eet al.\u003c/em\u003e The developmental transcriptome of Drosophila melanogaster. \u003cem\u003eNature\u003c/em\u003e 471, 473\u0026ndash;479 (2011).\u003c/li\u003e\n\u003cli\u003ePort F, Chen HM, Lee T, Bullock SL. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 111, E2967-2976 (2014).\u003c/li\u003e\n\u003cli\u003eQiao HH, \u003cem\u003eet al.\u003c/em\u003e An efficient and multiple target transgenic RNAi technique with low toxicity in Drosophila. \u003cem\u003eNat Commun\u003c/em\u003e 9, 4160 (2018).\u003c/li\u003e\n\u003cli\u003eRen X, \u003cem\u003eet al.\u003c/em\u003e Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 110, 19012\u0026ndash;19017 (2013).\u003c/li\u003e\n\u003cli\u003eBell LR, Horabin JI, Schedl P, Cline TW. Positive autoregulation of sex-lethal by alternative splicing maintains the female determined state in Drosophila. \u003cem\u003eCell\u003c/em\u003e 65, 229\u0026ndash;239 (1991).\u003c/li\u003e\n\u003cli\u003eJohnson ML, Nagengast AA, Salz HK. PPS, a large multidomain protein, functions with sex-lethal to regulate alternative splicing in Drosophila. \u003cem\u003ePLoS Genet\u003c/em\u003e 6, e1000872 (2010).\u003c/li\u003e\n\u003cli\u003eSchuLtt C, Hilfiker A, Nothiger R. virilizer regulates Sex-lethal in the germline of Drosophila melanogaster. \u003cem\u003eDevelopment\u003c/em\u003e 125, 1501\u0026ndash;1507 (1998).\u003c/li\u003e\n\u003cli\u003eKan L, \u003cem\u003eet al.\u003c/em\u003e The m6A pathway facilitates sex determination in Drosophila. \u003cem\u003eNature communications\u003c/em\u003e 8, 15737 (2017).\u003c/li\u003e\n\u003cli\u003eHaussmann IU, \u003cem\u003eet al.\u003c/em\u003e m6A potentiates Sxl alternative pre-mRNA splicing for robust Drosophila sex determination. \u003cem\u003eNature\u003c/em\u003e 540, 301\u0026ndash;304 (2016).\u003c/li\u003e\n\u003cli\u003eLence T, \u003cem\u003eet al.\u003c/em\u003e m6A modulates neuronal functions and sex determination in Drosophila. \u003cem\u003eNature\u003c/em\u003e 540, 242\u0026ndash;247 (2016).\u003c/li\u003e\n\u003cli\u003eLinder B, Grozhik AV, Olarerin-George AO, Meydan C, Mason CE, Jaffrey SR. Single-nucleotide-resolution mapping of m6A and m6Am throughout the transcriptome. \u003cem\u003eNat Methods\u003c/em\u003e 12, 767\u0026ndash;772 (2015).\u003c/li\u003e\n\u003cli\u003eSledz P, Jinek M. Structural insights into the molecular mechanism of the m(6)A writer complex. \u003cem\u003eElife\u003c/em\u003e 5, (2016).\u003c/li\u003e\n\u003cli\u003eWang P, Doxtader KA, Nam Y. Structural Basis for Cooperative Function of Mettl3 and Mettl14 Methyltransferases. \u003cem\u003eMol Cell\u003c/em\u003e 63, 306\u0026ndash;317 (2016).\u003c/li\u003e\n\u003cli\u003eWang X, \u003cem\u003eet al.\u003c/em\u003e Structural basis of N(6)-adenosine methylation by the METTL3-METTL14 complex. \u003cem\u003eNature\u003c/em\u003e 534, 575\u0026ndash;578 (2016).\u003c/li\u003e\n\u003cli\u003eScholler E, \u003cem\u003eet al.\u003c/em\u003e Interactions, localization, and phosphorylation of the m(6)A generating METTL3-METTL14-WTAP complex. \u003cem\u003eRNA\u003c/em\u003e 24, 499\u0026ndash;512 (2018).\u003c/li\u003e\n\u003cli\u003eHsu PJ, Shi H, He C. Epitranscriptomic influences on development and disease. \u003cem\u003eGenome Biol\u003c/em\u003e 18, 197 (2017).\u003c/li\u003e\n\u003cli\u003eFrye M, Harada BT, Behm M, He C. RNA modifications modulate gene expression during development. \u003cem\u003eScience\u003c/em\u003e 361, 1346\u0026ndash;1349 (2018).\u003c/li\u003e\n\u003cli\u003e\n\u003cdiv class=\"BibBookDOI\"\u003e10.1101/2020.1103.1107.982090\u003c/div\u003e\nKan L, et al. A neural m6A/YTHDF pathway is required for learning and memory in Drosophila. \u003cem\u003ebioRxiv\u003c/em\u003e doi, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/2020.1103.1107.982090\u003c/span\u003e\u003c/span\u003e (2020).\u003c/li\u003e\n\u003cli\u003eZhang C, \u003cem\u003eet al.\u003c/em\u003e m(6)A modulates haematopoietic stem and progenitor cell specification. \u003cem\u003eNature\u003c/em\u003e 549, 273\u0026ndash;276 (2017).\u003c/li\u003e\n\u003cli\u003eFigueroa A, \u003cem\u003eet al.\u003c/em\u003e Novel roles of hakai in cell proliferation and oncogenesis. \u003cem\u003eMol Biol Cell\u003c/em\u003e 20, 3533\u0026ndash;3542 (2009).\u003c/li\u003e\n\u003cli\u003eDominissini D, Moshitch-Moshkovitz S, Amariglio N, Rechavi G. Transcriptome-Wide Mapping of N(6)-Methyladenosine by m(6)A-SEq. \u003cem\u003eMethods Enzymol\u003c/em\u003e 560, 131\u0026ndash;147 (2015).\u003c/li\u003e\n\u003cli\u003eMolinie B, Giallourakis CC. Genome-Wide Location Analyses of N6-Methyladenosine Modifications (m(6)A-Seq). \u003cem\u003eMethods Mol Biol\u003c/em\u003e 1562, 45\u0026ndash;53 (2017).\u003c/li\u003e\n\u003cli\u003eKim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. \u003cem\u003eNat Methods\u003c/em\u003e 12, 357\u0026ndash;360 (2015).\u003c/li\u003e\n\u003cli\u003eMeng J, \u003cem\u003eet al.\u003c/em\u003e A protocol for RNA methylation differential analysis with MeRIP-Seq data and exomePeak R/Bioconductor package. \u003cem\u003eMethods\u003c/em\u003e 69, 274\u0026ndash;281 (2014).\u003c/li\u003e\n\u003cli\u003eHeinz S, \u003cem\u003eet al.\u003c/em\u003e Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. \u003cem\u003eMol Cell\u003c/em\u003e 38, 576\u0026ndash;589 (2010).\u003c/li\u003e\n\u003cli\u003eYu G, Wang LG, He QY. ChIPseeker: an R/Bioconductor package for ChIP peak annotation, comparison and visualization. \u003cem\u003eBioinformatics\u003c/em\u003e 31, 2382\u0026ndash;2383 (2015).\u003c/li\u003e\n\u003cli\u003ePertea M, Pertea GM, Antonescu CM, Chang TC, Mendell JT, Salzberg SL. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. \u003cem\u003eNat Biotechnol\u003c/em\u003e 33, 290\u0026ndash;295 (2015).\u003c/li\u003e\n\u003cli\u003eRobinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. \u003cem\u003eBioinformatics\u003c/em\u003e 26, 139\u0026ndash;140 (2010).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Hakai, m6A modification, m6A writer complex, E-cadherin, Drosophila","lastPublishedDoi":"10.21203/rs.3.rs-47812/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-47812/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"N6-methyladenosine (m\u003csup\u003e6\u003c/sup\u003eA), the most abundant internal modification in eukaryotic mRNA, is deposited by a multi-component writer complex. Hakai is an E3 ubiquitin ligase that interacts with several m\u003csup\u003e6\u003c/sup\u003eA writer subunits in proteomic studies, however, its role in m\u003csup\u003e6\u003c/sup\u003eA methylation in animals has not been systematically characterized. Here we show that Hakai colocalizes and interacts with other m\u003csup\u003e6\u003c/sup\u003eA writer components in \u003ci\u003eDrosophila\u003c/i\u003e, and \u003ci\u003eHakai\u003c/i\u003e mutants exhibit typic m\u003csup\u003e6\u003c/sup\u003eA pathway phenotypes, such as lowered m\u003csup\u003e6\u003c/sup\u003eA levels in mRNA, aberrant \u003ci\u003eSxl\u003c/i\u003e alternative splicing, wing and behavior defects, common reduced m\u003csup\u003e6\u003c/sup\u003eA peaks and mis-regulated genes with \u003ci\u003eMettl3\u003c/i\u003e and \u003ci\u003eMettl14\u003c/i\u003e mutants. These results demonstrate that Hakai is a core component of the m\u003csup\u003e6\u003c/sup\u003eA writer complex comprised of seven conserved subunits. Interestingly, our stringent meRIP-seq experiments indicate that the effective m\u003csup\u003e6\u003c/sup\u003eA modification, which depends on the writer complex, is mostly distributed in 5’ UTR and near start codon in \u003ci\u003eDrosophila\u003c/i\u003e, in contrast to the mammalian system. We define a set of high-confident m\u003csup\u003e6\u003c/sup\u003eA methylation sites in 5’ UTR in adult flies and it is unlikely the main function of m\u003csup\u003e6\u003c/sup\u003eA modification in \u003ci\u003eDrosophila\u003c/i\u003e is through RNA degradation. Furthermore, we find that Hakai is required for the protein levels of other m\u003csup\u003e6\u003c/sup\u003eA writer components Fl(2)d and Flacc, but not Nito. Finally, Hakai does not mediate the stability of E-cadherin in wing discs, suggesting its major role as a nuclear protein.","manuscriptTitle":"Role of Hakai in m6A modification pathway in Drosophila","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-08-04 16:22:19","doi":"10.21203/rs.3.rs-47812/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8bc6f411-8ba7-418a-a014-2d20784798ac","owner":[],"postedDate":"August 4th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":240056,"name":"Epigenetics \u0026 Genomics"}],"tags":[],"updatedAt":"2021-07-27T21:05:50+00:00","versionOfRecord":{"articleIdentity":"rs-47812","link":"https://doi.org/10.1038/s41467-021-22424-5","journal":{"identity":"nature-communications","isVorOnly":false,"title":"Nature Communications"},"publishedOn":"2021-04-12 21:05:50","publishedOnDateReadable":"April 12th, 2021"},"versionCreatedAt":"2020-08-04 16:22:19","video":"","vorDoi":"10.1038/s41467-021-22424-5","vorDoiUrl":"https://doi.org/10.1038/s41467-021-22424-5","workflowStages":[]},"version":"v1","identity":"rs-47812","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-47812","identity":"rs-47812","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}