Effect of melatonin supplementation on gonadotropins, Vitellogenin gene expression, antioxidant status, ovarian histology and reproductive performance in female Clarias magur

Effect of melatonin supplementation on gonadotropins, Vitellogenin gene expression, antioxidant status, ovarian histology and reproductive performance in female Clarias magur | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effect of melatonin supplementation on gonadotropins, Vitellogenin gene expression, antioxidant status, ovarian histology and reproductive performance in female Clarias magur Gyandeep Gupta, Prem Prakash Srivastava, Munish Kumar, Tincy Varghese, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6279678/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract This study investigates the effects of melatonin supplementation on gonadotropin gene expression, vitellogenin (Vtg) gene expression, antioxidant status, ovarian histology, and reproductive performance in female Clarias magur . Four experimental diets were formulated: control (0 mg/kg melatonin), T1 (100 mg/kg melatonin), T2 (200 mg/kg melatonin), and T3 (300 mg/kg melatonin). Results showed no significant difference in weight gain between the control and T1 groups, while weight gain decreased notably in T2 and T3. Gonadosomatic index (GSI) and fecundity were monitored over a 60-day feeding trial. The T1 group exhibited significantly higher GSI and fecundity compared to the control, whereas T2 and T3 groups showed significant reductions in both parameters. Histological evaluation revealed more atretic eggs in T3, while T1 contained mature and primary/secondary yolk stage (PYS/SYS) oocytes. Gonadotropin and vitellogenin gene expression in Clarias magur was evaluated from April to June, with samples collected at three time points: April (I sampling, before the start of the feeding trial), May (II sampling, after one month of the feeding trial), and June (III sampling, at the end of the feeding trial).Gonadotropin gene expression (FSH and LH) was significantly affected by melatonin. FSH gene expression peaked at the II sampling in the T1 group, while it was lowest in T3. LH gene expression peaked at the III sampling in the T1 group, showing a marked reduction in higher melatonin doses (T2 and T3 group). Vtg gene expression increased in the T1, reaching the highest levels at the II sampling, while it was inhibited in the T3 group. Antioxidant enzymes (SOD, CAT, GPX, GST) varied significantly with melatonin doses. Lower melatonin doses (T1) reduced antioxidant enzyme activity, while higher doses (T3) enhanced it. Induced breeding outcomes demonstrated that melatonin at 100 mg/kg significantly improved fertilization, hatching, larval survival, and fry survival, outperforming the control group. Our findings indicate that melatonin supplementation at 100 mg/kg enhances reproductive performance in Clarias magur by modulating ovarian development, gonadotropin gene expression, oxidative stress, and improving survival rates in the early life stages. Melatonin Gonadotropins Vitellogenin Antioxidant status Ovarian histology Reproductive performance Clarias magur Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction In India, the fisheries and aquaculture sector provides livelihoods to over 14.5 million people. The country achieved a record fish production of 17.545 million tonnes in the fiscal year 2022–2023, solidifying its position as the third-largest fish-producing nation globally, with an 8% share in worldwide production (Ministry of Fisheries, Animal Husbandry & Dairying 2023). These advancements underscore the growing significance of aquaculture in meeting global fish consumption demands and its vital role in supporting livelihoods, particularly in countries like India. Indian aquaculture is mainly based on carp fishes and contributes around 85% of the total aquaculture production of the country. However, there are more than 20 species in the queue to be commercialized and adopted in the intensified aquaculture system. Therefore, the developmental strategies in terms of culture techniques, species diversification, and nutritional intervention are the major areas to increase the production and productivity of available resources per unit area. Among the different catfishes such as magur, singhi, and pangasius, Clarias magur is an important candidate species in the intensified aquaculture system such as ponds, re-circulatory-aquaculture systems and biofloc-based aquaculture systems. C. magur is commonly known as walking catfish. It is a medium-sized, air-breathing catfish which can tolerate hypoxia as well as utilize aerial oxygen. it has a 3–4 times high market price (approx. ₹ 400/kg) due to presence of higher amount of protein, iron and low fat in their tissues (15.0,protein, 710 iron, 1.0 fat mg/100g tissues (Hossain et al.2006). It has been reported that the magur is prescribed prophylactically to anaemic and malnourished individuals as well as for convalescent individuals due to its nutritional superiority. Its excellent nutritional profile makes Clarias a suitable candidate species for intensification of aquaculture systems. However, the major constraint for the widespread intensified aquaculture of this species is the non-availability of seed/ quality seed, both from hatcheries and the wild. The availability of wild seeds is also scarce due to the depletion of natural stocks or breeding grounds (Srivastava et al.2012) Nowadays, intensified aquaculture will not be depending on natural seed resources because of the inconsistent availability of natural resources. In hatchery-produced seed, low survival was observed during its early larval stage, especially during spawn to fry. The reasons for low survival could be poor broodstock management, lack of knowledge of stocking density and nutrients requirement at various culture periods of C. magur (Sahoo et al. 2004 ). The commercial production of this species hampered seriously due to the insufficient seed availability and low survival during the early larval rearing and this might be the major constraint for large-scale production of C. magur (Mir et al.2020). Another major constraint for this species is poor response to synthetic hormones for gonadal maturation and spawning (Sahoo et al. 2008 ). To consider the major problem of reproductive performance and larval survival in the mind, melatonin as a dietary supplementation was selected to improve the reproductive performance and larval survival of C. magur in an early stage to commercialize the production of magur in an intensified aquaculture system. Melatonin rhythm is the most studied circadian clock in vertebrates. Melatonin concentration is highest at night and lowest during the daytime. Tryptophan amino acid is the precursor of melatonin, which is taken up by the pineal cells of pineal gland. Aralkylamine–acetyltransferase (and) is the key gene of melatonin synthesis, which convert tryptophan into N-acetyl serotonin, from tryptophan (Lima-Cabello et al. 2014 ). It has been reported, during the rupture of the ovarian follicle and ovulatory process produced an immense amount of ROS (Agarwal et al, 2006 ) which has various deterioration effects on lipids of cell membrane, disturbed DNA structure and promotes apoptosis (Kowaltowski and Vercesi 1999 ). Reiter et al. ( 2005 ) described that melatonin have potent free radical scavenging capacity and display a broad spectrum antioxidant activity; it protects the ovary from free radical damage and enhances the oocytes quality. In female teleosts, melatonin can stimulate the production of a maturation-inducing hormone (MIH), maturation of oocyte and normal development of embryo (Chattoraj et al. 2005 : Danilova et al. 2004 ). Danilova et al.(2004) concluded that melatonin exert their function by specific melatonin receptor and enhances the cell proliferation in the embryo of zebrafish. During oocyte maturation and ovulation large amount of free radicals generated which elevated oxidative stress that causes the impairment of oocytes, accelerated oocyte ageing and ultimately deteriorates oocyte quality (Tamura, et al. 2013 ). Several studies reported, melatonin and its metabolites also play an important role in free radical scavenging and prevent the ovary from free radical damage ultimately improving the quality of oocytes (Reiter et al. 2013 ). In ovarian follicle melatonin indirectly reduce oxidative stress by activating antioxidant enzymes like superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) (Reiter et al. 2009 ). Popek ( 1991 ) reported that the pineal gland and melatonin play a role in promoting the final phases of sexual maturation by synchronization of fully grown oocytes with optimum spawning period and it also induces vitellogenesis in in the post-spawning period in carp. Thus, considering the importance of melatonin in reproduction, the present study aimed to optimize the use of melatonin in the diet of C. magur brooders. The response to the supplementation of melatonin was evaluated by assessing the gene expression, growth, reproductive performance and ovarian histology. 2. Materials and methods 2.1. Experimental site and animal The healthy brooders of C. magur (female) with an average wt. 140 ± 5 g were collected from brood stock pond of the freshwater farm of Central Institute of Fisheries Education, Balbhadrapuram, Andhra Pradesh, India. The experiment was conducted in the cement tanks at the same site for a period of 60 days. Fish were acclimatized in cemented tank for a period of 15 days. During acclimatization period, fish were fed with the control diet with 3% body weight and the ration was split into two portions at morning and evening at 7 am and 6 pm respectively. 2.2. Feed preparation and proximate composition The basal diet was prepared with the help of locally available ingredients viz, groundnut oil cake (GNOC), fish meal, soybean meal, soybean oil and fish oil. Four isonitrogenous and isocaloric diets were prepared with different inclusion viz.,Control (0 mg/kg melatonin), T1 (100 mg/kg melatonin), T2 (200 mg/kg melatonin), and T3 (300 mg/kg melatonin). All the ingredients grinded and sieved for removal of impurity and uniform powder of different ingredient obtained. All the ingredients were accurately weighed according to formulation and mixed properly. Dough was prepared by adding water and cooked in pressure cooker for 30 min. After cooking, all the vitamin mineral premix and oil along with graded level of Melatonin was added in respective diets. The vitamin mineral premix was added, when dough was cooled. After adding all the ingredients, mixed well and pellets were formed with the help of hand pelletizer. Pellets were dried in shadow and after drying all the respective diets were kept in air tight polythene bags and stored at 4 0 C. Feed formulation used in experiment shown in Table 1 . The feeds' proximate composition underwent analysis following the AOAC's standard methods (AOAC., 1995). To determine the moisture content of the experimental diets, samples were dried to a constant weight at 100 ± 2°C in a hot air oven. Crude protein content (expressed as TN% × 6.25) was assessed using the micro-Kjeldahl method (Kelplus, PELICAN), while ether extract was determined via the soxhlet extraction method (SOCS plus, SAS-AS 08, PELICAN). Ash content was measured by incinerating samples in a muffle furnace at 550°C for 6 hours, and fiber estimation was conducted using Fiber tech equipment (Tulin equipment) (Table 1 ). Table 1: Feed formulation and proximate analysis Ingredients (%) C T1 T2 T3 Fish meal a 22.00 22.00 22.00 22.00 Soybean a 22.00 22.00 22.00 22.00 GNOC a 20.00 20.00 20.00 20.00 DORB a 15.00 15.00 15.00 15.00 Wheat flour a 13.84 13.74 13.64 13.54 Fish oil a 2.00 2.00 2.00 2.00 Veg. oil a 2.00 2.00 2.00 2.00 Vitamin premix* b (vitamin D free) 1.00 1.00 1.00 1.00 Mineral premix b 1.00 1.00 1.00 1.00 CMC b 1.00 1.00 1.00 1.00 Vitamin C b 0.10 0.10 0.10 0.10 BHT b 0.02 0.02 0.02 0.02 Choline chloride b 0.04 0.04 0.04 0.04 Melatonin(mg/kg) 0.00 100 200 300 Proximate composition (% dry matter) Dry matter 90.56 ±0.21 90.56 ± 0.21 90.56 ± 0.21 90.56 ± 0.21 Crude protein 35.19 ± 0.16 35.25 ± 0.22 35.40 ± 0.18 35.17 ± 0.12 Crude fat 8.26 ± 0.28 8.30 ± 0.42 8.18 ± 0.034 8.41 ± 0.18 Crude fiber 8.05 ± 0.16 8.18 ± 0.32 8.06 ± 0.26 8.21 ± 0.31 Ash 9.05 ± 0.19 9.14 ± 0.49 9.07 ± 0.37 9.08 ± 0.16 Nitrogen free extract 39.45 ±0.51 39.45 ± 0.51 39.45 ± 0.51 39.45 ± 0.51 Digestible energy (Kcal/ 100 g) 372.90±1.73 372.90±1.73 372.90±1.73 372.90±1.73 Data are expressed as Mean ± SE, n = 3 C, (0 mg/kg melatonin), T1 (100 mg/kg melatonin), T2 (200 mg/kg melatonin), and T3 (300 mg/kg melatonin). CMC, Carboxymethyl cellulose; 4BHT, Butylatedhydroxyltoluene; 5Digestible energy = (%CP × 4) + (% EE × 9) + (%NFE × 4), Halver (1976) a Practical ingredients procured from local market . b Procured from Himedia Mineral premix (g/100g mixture): NaCl, 4.33; MgSO 4 .7 H 2 O, 13.63; NaH 2 PO 4 . 2H 2 O, 8.67; KH 2 PO 4 , 23.86; Ca(H 2 P O 4 ) 2 . H 2 O, 13.51; Fe-Citrate, 2.95; Ca-Lactate, 32.53; AlCl 3 , 0.015; KI, 0.015; CuCl, 0.010; MnSO 4 , 0.080; CoCl 2 , 0.100; cellulose used as carrier. Vitamin premix (mg/ 100g mixture): Thiamin-HCl, 5; riboflavin, 20; pyridoxin-HCl,5; choline chloride, 500; nicotinic acid, 75; calcium pantothenate, 50; inositol, 200; folic acid, 1.5; cyanocobalamine, 0.01; menadione, 4; α-tocopherol, 40; retinyl acetate, 2000; Cholecalciferol 1000 IU, cellulose used as carrier. 2.3. Experimental design In present study one hundred and eighty female C. magur (average weight 145 ± 5.0 g) were allocated to twelve cemented tanks with dimensions of 4.5 × 2 × 1 m for a period of 60 days. Fish were distributed in four groups with three replicates following the completely randomized design. Fifteen fish kept in each cemented tank. The first group treated as control (C) fed with basal diet without melatonin; remaining groups were fed with basal diet having 100, 200 and 300 mg/kg melatonin and treated as T1, T2 and T3 respectively. To maintain the adequate oxygen level aeration was provided in each tank. Fish of each treatment group fed with respective diets upto satiation. Ration was divided in two equal half and given twice a day (morning and evening). To maintain the optimum water quality parameters, water was exchanged fortnightly by opening the valves of tanks. The physiochemical parameters of viz. water temperature, dissolved oxygen and pH were 27–29 o C, 6.2–7.4 and 7.5–8.2 respectively throughout the experimental period. 2.4. Total RNA isolation and cDNA synthesis Before sacrificing, fish were subjected to anaesthesia, by using clove oil (50 µl/L). RNAlater™ solution (Qiagen, Netherlands) was used to store samples (liver, n = 3) were. For gene expression study, three replicates samples for each treatment were prepared by pooling the liver tissue. About 50 mg liver sample was added in 1 ml of TRIzol (Invitrogen) reagent and total RNA was isolated by following manufacturer's protocol. NanoDrop spectrophotometer (Thermo Scientific) was used to check the purity and concentration of isolated RNA. Isolated RNA was subjected to DNAse treatment, to avoid the contamination of genomic DNA. DNAse treatment was carried out as per the protocol of manufacturer (Thermo scientific). After DNAse treatment of RNA, it was used as templates for Complementary DNA (cDNA) synthesis (first-strand cDNA synthesis kit (Thermo Scientific). cDNA stored at − 20°C for further use or immediately use for q RT PCR analysis. 2.5. Relative quantification of mRNA expression The gene expression study was performed in Real time PCR Light Cycler® 480 detection system (Roche, Switzerland). Gene runner software (Version 3.05).was used to design the primer. For the quantification of gene expression, a reaction mixture was prepared by adding following components 10 µl containing 5 µl of 2× Maxima™ SYBR Green qPCR Master Mix (Thermo Scientific), 1 µl of (5 pmol) gene-specific primer 1 µl of cDNA and remaining nuclease-free water. All the reaction were performed in duplicate. At the end of each PCR reaction the CT (threshold cycle) and melting curve analysis was done, to quantify the fold change of StAR mRNA. The relative StAR mRNA (KJ662668.1) was analysed by using CT value method described by Livak and Schmittgen ( 2001 ) and comparison was made between StAR gene and β-actin (Acc No.-EU527190.2), which was selected as reference gene. The primer sequence is shown in the Table 2 . Table 2 List of primer sequence used for gene expression study Primer Sequence Accession number β-Actin FP GAAGGTTATGCCCTGCCCCATGCC EU527190.2 β-Actin RP TCCCTCTCGGCTGTGGTGGTGAAG FSH- β FP FTACCCTGTGGCTCTGAGCTGTGAG MF373411.1 FSH- β FP GGCTGTTGGCTGAGCTGATGTGAC LH- β FP CAGCGGACACTGCTTCACCAAGGA KM258876.1 LH- β RP GGCAGGCGAATGGTTTCATAGCGG Vitellogenin FP CAAAGACCTGAACAACTGCCA KJ845350.1 Vitellogenin RP ACCTTTGTCAGTGGGCTTCAT Δct = target gene ct value − reference gene ct value ΔΔct value = Δct value of treatment group − Δct value of control group. 2.6. Growth parameters The growth of fish was measured by weighing the initial and final weight of fish, and the various growth parameters like percentage weight gain (WG %), specific growth rate (SGR), feed conversion ratio (FCR) and protein efficiency ratio (PER) were analysed at the end of the experiment by using the following formulae: WG% = (final wt.-initial wt.) × 100/ initial wt. SGR = (Loge final weight - Loge initial weight) × 100 /Number of days PER = Weight gain (g)/protein intake (g) FCR = Feed given dry/ weight gain 2.7. Gonado-somatic index and fecundity The Gonadosomatic index and fecundity are two key parameters to analyse the reproductive capacity of fish. The ovaries were removed by dissecting the fish and weighed. A small batch of egg separated, weighed and the number of eggs were counted. GSI (%) = Ovary Weight × 100/Body Weight Fecundity = Number of eggs in 1g of ovary × total ovary weight (g) 2.8. Histological analysis The ovary samples was collected from each treatment groups and fixed in 10% neutral buffer formalin (NBF) for 24 h, dehydrated in 90% alcohol for 1 h and three times in absolute alcohol for 45 min each, separately. The samples were then cleared two times in xylene for 30 min each and embedded in paraffin for 45 min. The samples were then blocked, allowed to cool, cut on a rotary microtome at 5 µm and mounted section were de-waxed in xylene and dehydrated serially in alcohol and then the slides were washed in tap water for 1 min, stained in haematoxylin for 12 min, washed with tap water, dipped in 2% acid alcohol and again washed in tap water. The sections were dehydrated through 50%, 70% and 90% alcohol for 2 min each and stained in eosin for 4 min and dipped in absolute alcohol for 1 min. Finally, the stained sections were cleared in xylene for 5 min and mounted with DPX. Histological sections were observed under an Olympus FSX-100 phase contrast microscope equipped with a canon EOS 500D digital camera and photographs taken. 2.9. Induced breeding Artificial breeding was carried out from each treatment for evaluating the reproductive performance of C. magur. Male and female were selected based on the breeding specific morphological charter for this species as described by Sahoo et al. (2005). Ovatide (Hemmo Pharma, Mumbai, India) was used for induced breeding, the male and female were injected with dose of 0.4 ml and 0.2 ml respectably. 2.10. Reproductive performance After optimum latency period, which is 14–17 hr as reported by Sahoo et al (2020). Sperm suspension was prepared by dissecting male and removes the testis and cut into small pieces, squeezed and mixed with physiological saline solution (0.9%). Simultaneously, the stripping of females was carried out and stripped eggs were collected in small clean dry plastic trays. Spermatozoa were activated by adding distilled water and sperm suspension were poured over the stripped eggs and mixed gently by disinfected feather. After mixing eggs were washed with distilled water in order to remove small pieces of testis and ovarian tissue. Eichhornia roots were used for collection of fertilized eggs and shifted to rectangular FRP troughs (1.25’ x 0.5’ x0.2’m 3 having a fixed water level of 8 cm). Flow through system with water flow 2 lit/hr and aeration were provided in each rectangular FRP troughs. For further analysis of breeding performance a batch of small quantity of eggs were collected to a pre-weighed Petriplate and weighed in an electronic balance. Weight of the fish was taken before and after stripping for estimation of stripped egg weight and spawning fecundity. Spawning fecundity (Total number of stripped out eggs) of each treatment was calculated as per the method described by Hossain and Islam ( 1990 ). 2.10.1. Fertilization rate The number of fertilized eggs and fertilization rate was calculated by counting the number of white eggs (unfertilized) and brown eggs (Fertilized). The fertilization rate was calculated by using method given by Dhara and Das ( 2018 ). The fertilization rate was calculated by using the following formula: Fertilization rate = (Fertilized Eggs x 100)/Total no. of eggs in the collected egg mass. 2.10.2. Hatching rate The eggs attached with the root of Eichhornia were hatched out within 24–28 hrs. The number of hatchling and hatching rate was calculated by the method described by Dhara and Das ( 2018 ). Hatching rate = (Total number of hatchlings x 100)/Total no. of eggs released in a tray 2.10.3. Larval and fry rearing Hatchling was reared in inflow-through system upto 4 day. Larvae were fed with mixed zooplankton (dominated by Moina sp.) @ 20 ml per trough (500 No./ml ) after yolk absorption to till 10 days of post hatch. The larval survival was evaluated as per method described by Srivastava et al ( 2012 ). Fry rearing was carried out at Magur fry rearing unit of a freshwater farm of ICAR-CIFE, Kakinada Centre, Balbhadrapuram. Rearing of 15 days old larvae were carried out in eight rectangular FRP tanks with dimension 6’ x 2’ x1.5’, the 15 days dhp were distributed in eight rectangular FRP tanks in duplicates @ 4 No./lit. Fry were fed with mixed zooplankton (dominated by Moina sp.) and artemia flakes (7%). Fry survival was estimated as per the method given by Sahoo et al ( 2004 ). 2.11. Statistical analysis All the data after analysing the normality and homogeneity of the variance were statistically analysed by one-way analysis of variance (ANOVA). The results were expressed as mean ± SE. In one-way ANOVA, the post hoc analysis was performed using Duncan's multiple range test (DMRT) to determine the level of significance among means. The significance level of means was observed at 5% probability level (p < 0.05). 3. Results 3.1. Growth Performance In present study, growth performance parameters such as percentage weight gain (WG %), specific growth rate (SGR), feed conversion ratio (FCR) were calculated at the end of experimental trial and growth performance data depicted in Table 3 . There was no significant difference in weight gain between control and T1 group while, it was decreased significantly (P < 0.05) in medium (T2) and higher melatonin (T3) supplemented groups. Similarly, the SGR also decreased with increasing melatonin level in the diet of C. magur , when compared to the control group. The FCR was lowest in control group and there was no significant difference between control and T1 group, however it was highest in T3 group followed by T2 group. Table 3 Growth performance of C. magur broodstock fed with different levels of melatonin Parameters C T1 T2 T3 P value Initial weight 140 ± 4.5 141.26 ± 4.1 140.72 ± 3.8 141.37 ± 3.72 0.7 WG% 47.06 a ± 0.11 48.13 a ± 0.61 41.32 b ± 2.86 37.50 c ± 0.91 0.01 FCR 3.07 c ± 0.06 3.28 c ± 0.04055 3.86 b ± 0.06 4.68 a ± 0.09 0.001 SGR 0.59 a ± 0.04 0.74 a ± 0.06 0.45 b ± 0.03 0.33 c ± 0.07 0.002 PER 0.93 a ± 0.03 0.98 a ± 0.05 0.79 b ± 0.03 0.50 c ± 0.02 0.001 Values are presented as mean ± SE, Main effect means followed by the different superscript letters in the same row are significantly different (p < 0.05). WG: Weight gain (gram), FCR: Food conversion ratio SGR: Specific growth rate; PER: Protein efficiency ratio. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg). 3.2. Gonadosomatic Index and Fecundity In the present study, GSI and fecundity were calculated at one month interval. During the initial sampling (I sampling, before starting the feeding trial) the GSI and fecundity was lowest and there was no significant (P > 0.05) difference in all treatment groups. At II sampling (May, after one month feeding trial), there was a significant difference (P < 0.05) in both GSI and fecundity between control and treatment groups. In T1 group, both GSI and fecundity were significantly higher as compared to the control group, while in T2 and T3 groups, GSI and fecundity decreased significantly (P < 0.05) when compared to the control group. However, there was no significant difference between T2 and T3 groups in term of GSI and fecundity at II sampling. At the last sampling (III sampling, June, before breeding) the highest GSI and fecundity was reported in T1 group followed by control group while lowest GSI and fecundity were reported in T3 group followed by T2 group. At the III sampling, there was a significant difference (P < 0.05) in both GSI and fecundity between T2 and T3 groups. The GSI and fecundity is depicted in Table 4 . Table 4 Monthly changes in GSI and fecundity of C. magur female broodstock fed with different levels of dietary melatonin GSI I sampling II sampling III sampling C 3.48 ± 0.36 13.34 b ± 0.29 14.29 b ± 0.49 T1 3.52 ± 0.36 14.92 a ± 0.79 17.06 a ± 0.68 T2 3.40 ± 0.36 11.95 c ± 0.60 14.07 b ± 0.45 T3 3.60 ± 0.36 11.19 c ± 0.41 12.59 c ± 0.31 P value 0.17 0.001 0.001 Fecundity C 2205.23 ± 107.13 9986.11 b ± 352.12 12252.01 b ± 281.25 T1 2316.00 ± 107.13 11107.71 a ± 476.61 14035.65 a ± 611.94 T2 2155.23 ± 107.13 8370.16 c ± 265.93 10098.46 c ± 435.00 T3 2035.23 ± 107.13 8299.43 cd ± 352.12 8191.31 d ± 281.25 P value 0.10 0.001 0.001 Values are presented as mean ± SE, Main effect means followed by the different superscript letters in the same column vary significantly different (p < 0.05). C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg) 3.4. Hepato-Somatic Index (HSI) The HSI, of different experimental group was calculated at the end of experiment (Fig. 1 ). There was decreasing trend observed in HSI with increase in the concentration of melatonin in the diet of C. magur. The highest HSI was reported in T1 group and there was no significant difference (P > 0.05) observed in control and T1 group. The lowest HSI was recorded in T3 group compared to the control group. 3.5. Gonadotropin Gene Expression The gonadotropin gene expression was checked in pituitary gland of C. magur female broodstock fed with different levels of melatonin. Three sampling were carried out to see the effect melatonin on gonadotropin gene expression in C. magur . At the beginning of experiment (I sampling, April), there was no significant difference (P > 0.05) in both FSH and LH mRNA expression. At I sampling, the expression of gonadotropins gene was at lowest level. After one month of feeding trial II sampling (May) was carried out. At II sampling, there was increasing trend observed in FSH m RNA expression and it was significantly higher (P < 0.05) in T1 group followed by control group while, in T2 and T3 group expression levels decreased as compared to the control group The last sampling i.e III sampling (June) was carried out before the breeding of C. magur and it was reported that FSH decreased in all the treatment groups. The lowest FSH expression level was observed in T2 and T3 groups compared to the control group. At I sampling, the LH m RNA expression did not vary significantly in all groups, However, it was increased at the II and reached to peak value at III sampling, when fish approached the breeding season. The highest LH m RNA expression was recorded at III sampling (June). At III sampling, the LH mRNA expression was significantly (P < 0.05) higher in T1 group followed by control group. On the other hand, LH expression decreased in both T2 and T3 groups as compared to the control group. The mRNA expression levels of both gonadotropins are shown in Figs. 2 and 3 respectively. 3.6. Vitellogenin Gene Expression The Vtg m RNA was checked in liver of C. magur fed with graded levels of melatonin. The vitellogenin m RNA expression profile was shown Fig. 4 . There was no significant difference in Vtg mRNA expression at I sampling in all treatment groups and it was lowest at I sampling (April). After one month of feeding trial (II sampling), Vtg m RNA increased in all treatment groups, and it was highest in T1 group as compared to the control group. At II sampling the Vtg m RNA expression was decreased significantly (P > 0.05) in both T2 and T3 groups and lowest expression was reported in T3 group compared to the control group The last sampling was carried out before breeding (III), Vtg m RNA expression decreased in all groups but the lowest expression was found in T2 and T3 groups compared to the control group. 3.7. Antioxidant Enzymes 3.7.1. Superoxide Dismutase Enzyme Activity In the present study, SOD activity was measured in liver, muscle, ovary and ovulated eggs of C. magur fed with graded levels of melatonin (Table 5 ). The significant higher (P < 0.05) SOD activity was reported in liver and ovary of T3 group followed by T2 group. However, the lowest SOD activity was reported in liver and ovary of T1 group as compared to the control group. There was no significant difference (P > 0.05) observed in muscle SOD activity of all treatment groups. The ovulated eggs of T1 group showed the lowest SOD activity compared to the control group. Table 5 Effect of melatonin on SOD enzymes activity in C. magur fed with different levels of melatonin Parameters C T1 T2 T3 P Value SOD (Muscle) 3.30 ± 0.37 2.92 ± 0.23 3.41 ± 0.06 3.61 ± 0.22 0.19 SOD (liver) 3.93 c ± 0.62 2.54 d ± 0.34 7.31 b ± 0.87 11.94 a ± 1.86 0.001 SOD (Ovary) 1.65 d ± 0.10 0.58 c ± 0.041 2.57 b ± 0.12 5.43 a ± 0.059 0.001 SOD (ovulated eggs) 6.41 c ± 0.10 2.61 d ± 0.13 8.59 b ± 0.27 10.13 a ± 0.43 0.001 Values are presented as mean ± SE. Main effect means followed by the different superscript letter in same row are significantly different (p < 0.05). SOD activity is expressed as 50% inhibition of epinephrine auto oxidation/mg protein/min. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg). 3.7.2. Catalase Activity Enzyme Activity The catalase activity was measured in liver, muscle, ovary and ovulated eggs of C. magur fed with different levels of melatonin. The catalase activity in liver and ovary followed similar trend as SOD activity. There was a significant (P > 0.05) higher catalase activity observed in T2 and T3 group in ovulated eggs The lowest catalase activity was reported in T1 group compared to the control group The catalase activity in liver, muscle, ovary and ovulated eggs are shown in Table 6 . Table 6 Effect of melatonin on catalase enzymes activity in C. magur fed with different levels of melatonin Parameters C T1 T2 T3 P Value Catalase (Muscle) 4.54 ± 0.39 4.46 ± 0.48 4.66 ± 0.41 4.94 ± 0.17 0.13 Catalase (liver) 5.52 cd ± 0.41 5.13 c ± 0.55 9.39 b ± 0.35 12.40 a ± 0.84 0.001 Catalase (ovary) 2.60 c ± 0.07 1.49 d ± 0.40 4.43 b ± 0.06 7.57 a ± 0.28 0.001 Catalase Ovulated egg 7.56 c ± 0.19 3.65 d ± 0.10 9.59 b ± 0.25 12.55 a ± 0.32 0.001 Values are presented as mean ± SE. Main effect means followed by the different superscript letter in the same row are significantly different (p < 0.05). Catalase activity expressed as Nano moles H2O2 decomposed/min/mg protein. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg) 3.7.3. Glutathione Peroxidase Enzyme Activity In the present study, Gpx activity was measured in the liver, muscle, and ovary and ovulated egg of C. magur fed with melatonin (Table 7 ). The Gpx activity was increased in liver, ovary and ovulated egg with increasing the melatonin concentration in the diet of C. magur , while in muscle, there was no significant difference observed inT2 and T3 groups. The highest Gpx activity was reported in the liver and ovary of T3 group followed by T2 group. In ovulated eggs, the lowest Gpx activity was found in T1 group compared to the control group. Table 7 Gpx activity of C. magur female broodstock fed with different levels of melatonin Parameters C T1 T2 T3 P value GpX (muscle) 5.53 ± 0.15 5.23 ± 0.19 5.59 ± 0.31 5.93 ± 0.27 0.290 GpX (liver) 6.17 c ± 0.20 5.05 d ± 0.25 6.96 b ± 0.20 8.37 a ± 0.60 0.001 GPX (Ovary) 3.26 c ± 0.17 2.17 d ± 0.11 4.52 b ± 0.28 8.22 a ± 0.53 0.000 GpX (ovulated eggs) 2.40 c ± 0.17 1.68 d ± 0.20 3.63 b ± 0.22 5.55 a ± 0.36 0.000 Values are presented as mean ± SE. Main effect means followed by the different superscript letter in the same column are significantly different (p < 0.05). Glutathione peroxidase activity expressed as unit/mg protein/min (unit-decrease in Log GSH by 0.001/min/mg protein). C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg) 3.7.4. Glutathione- S-transferase Enzyme Activity In the present study, GST activity also measured in liver and ovary of C. magur (Figs. 5 and 6 ). The GST activity was highest in the liver and ovary of T3 group followed by T2 group, while there was no significant difference in GST activity of T1 and control groups. In ovary, the lowest GST activity was found in T1 group while there was no significant difference in T2 and T3 group compared to the control group. 3.8. Histology of Ovary The histological study of C. magur showed that number of atretic oocytes increases in higher melatonin (T3) supplemented group however at lower dose (T1) ovary is dominated by mature oocyte and few oocytes were at Primary yolk stage (PYS), Secondary yolk stage (SYS) at III sampling. In present study, ovarian histological section of lower dose melatonin (T1 group) showed the oocytes at dominancy of Primary yolk stage (PYS), Secondary yolk stage (SYS) and few oocytes were at Tertiary yolk stage (TYS) at II sampling while at III sampling number of mature oocytes increased significantly, few oocytes were in Secondary yolk stage (SYS). The medium dose of melatonin (T2) inhibited the development of oocytes, ovary of medium group (T2) group showed the oocytes at Secondary yolk stage (SYS) and atretic oocytes also reported, no mature oocyte were reported at II sampling, while at III sampling number of mature oocytes increased along with Perinucleolar stage follicles (PNS). In T3 group (high melatonin supplemented group) showed the maximum oocytes Secondary yolk stage (SYS) with few mature oocyte, the number of atretic oocytes were also reported at II sampling, however at III sampling number mature oocytes along with Secondary yolk stage (SYS) increased while number of atretic oocytes also increased significantly (Plate 1–9). 3.9. Reproductive Performance of C. magur At the end of feeding trial, induced breeding trial was conducted to evaluate the effect of different levels of melatonin on reproductive performance of C. magur. Reproductive performance was evaluated by fertilization rate, hatching rate, larval survival and fry survival in different experimental diets of melatonin in C. magur . 3.9.1. Fertilization Rate In the present study, fertilization rate decreased with increasing melatonin supplementation. The fertilization rate was significantly (P < 0.05) higher in T1 group compared to other groups. While it was reduced in both T2 and T3 groups (Table 8 ) Table 8 Reproductive performance of C. magur fed with different dose of melatonin Parameters C T1 T2 T3 P Value Spawning fecundity 8042.08 b ± 516.55 12427.54 a ± 626.48 7176.33 c ± 425.55 6150.19 d ± 318.82 0.001 Fertilized eggs 5860.10 b ± 152.56 10685.19 a ± 376.48 4443.85 c ± 274.92 3001.92 d ± 376.46 0.001 No of hatchlings 3955.00 b . ± 143.21 8908.56 a ± 381.68 2157.97c ± 155.82 719.81 d ± 61.12 0.001 Total no. of fry 1528.00 b ± 54.35 4512.33 b ± 159.52 523.58 c ± 24.75 13.31 d ± 2.20 0.001 Fertilization rate 72.86 b ± 3.61 85.98 a ± 8.32 61.92 c ± 5.68 48.81 d ± 3.12 0.001 Hatching rate 67.48 b ± 2.92 83.35 a ± 4.65 48.53 c ± 3.83 23.95 d ± 2.51 0.001 Larval survival 61.87 b ± 3.47 78.12 a ± 4.18 55.75 c ± 2.95 28.54 d ± 1.41 0.001 Fry survival 67.46 b ± 2.86 83.06 a ± 3.17 55.20 c ± 1.84 14.86 d ± 1.92 0.001 Values are presented as mean ± SE, Main effect means followed by the different superscript letters in the same row are significantly different (p < 0.05). C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg) 3.9. 2. Hatching Rate In the present study, it was found that there was significant difference in hatching rate of C. magur fed with different levels of melatonin (Table 8 ). The highest hatching rate was reported in T1 group and lowest hatching rate was reported in higher melatonin supplemented group (T3). 3.9. 3. Larval and Fry Survival In present experiment, it was found that larva and fry survival increased significantly (P < 0.05) in the T1 group compared to the control group (Table 8 ). The larval and fry survival decreased with the increase in the dietary melatonin supplementation. Larval and fry survival were decreased significantly (P < 0.05) in T2 and T3 groups compared to the control group. 4. Discussion 4.1. Growth Performance of C. magur Fed with Melatonin In the present study, it was found that continuous supplementation of melatonin in the diet of C. magur brooder leads to decreased growth performance. The low dose (T1) showed similar percentage weight gain and SGR with control while, in medium and high dose, the growth performance decreased. Similarly, Singh et al. ( 2012 ) reported that melatonin supplementation decreased SGR compared to control; however, Aripin et al. (2015 a) reported that there was no significant difference in weight gain in control and melatonin treated Clarias Macrocephalus Broodstock. The reduction of weight gain in melatonin treatment groups might be due to the decrease in feeding intake. The finding of the present study is supported by the earlier reports of Lopez et al. (2006) and De Pedro et al. ( 2008 ), who concluded that reduction of body weight of gold fish was due to the reduction of food intake. In most of the vertebrates, melatonin was reported in the gastrointestinal tissues and it perform various functions such as metabolite secretion and regulation, protection of mucosa and digestive motility Bubenik ( 2002 ). Bubenik et al. ( 2000 ) reported that during fasting and feeding GIT melatonin increases and it play an important role in feeding regulation. In present study it was reported that lower dose of melatonin having positive effects on growth performance in C. magur . The current study corroborated with previous finding of Aarseth et al ( 2010 ), who concluded that melatonin affects the body mass and condition factor of Arctic charr, Salvelinus alpines . Intra-peritoneal injection of melatonin under short photoperiod in gold fish resulted in increased growth and weight gain (De Vlaming 1980 ). In Atlantic salmon ( Salmo salar ), implantation of melatonin increased growth (Porter et al.1998), while, reduced weight gain in trout Oncorhynchus mykiss (Taylor et al. 2005 ). 4.2. Gonadosomatic Index and Fecundity In the current experiment, GSI and fecundity increased in the group fed with low dose of melatonin while increasing the concentration of melatonin in the diet of C. magur female brooder resulted in decreased GSI and fecundity. The present study is supported by Aripin et al. (2015 a) they reported that melatonin treatment increased GSI and fecundity of C. macrocephalus at optimal dose. Similar results have been documented in rat, salmon, Channa punctatus, zebrafish and Japanese medaka. Amano et al.(2000) reported a positive effect of melatonin and found that GSI of Male Masu Salmon was increased after melatonin treatment. In the present study, low dose of melatonin increased GSI and fecundity of C. magur. Similarly, Carnevali et al. ( 2011 ) reported that melatonin significantly affected fecundity of zebra fish and it increases the number of ovulated eggs and they also suggested the possible reason of that might be due to change in Cox2A gene expression. Renuka and Joshi (2005) reported that continuous exposure of melatonin increased GSI of Channa punctatus concomitant with an increase in vitellogenic follicle in ovary. In the present study, higher supplementation of melatonin reduced GSI in C. magur . Similarly, Ghosh and Nath (2000) reported the inhibitory role of melatonin on GSI of C. batrachus . Ghosh and Nath ( 2005 ) reported that melatonin exert the variable effect (inhibitory and/or no effect) on GSI of C. batrachus. The effect of melatonin is dependent upon method of administration, dose, time and duration of treatment (Zachmann et al. 1992 ). 4.3. Hepatosomatic Index (HSI) In the present study, HSI was measured at the end of experiment. The HSI was decreased with increasing melatonin concentration in the diet of C. magur. This result is supported by Alvarado et al. ( 2015 ), who found that melatonin supplementation decreased HSI in male sea bass during spermatogenesis. Previous study suggested that melatonin has a role in energy homeostasis of fish (Pinillos et.al.2001:. Amano et al.2004) Melatonin also exhibited anorexic action in sea bass as suggested by Alvarado et al. ( 2015 ). In the present study, melatonin at higher concentration inhibited the growth of C. magur compared to the control group In fact, it was reported by several researchers that melatonin reduced food intake and digestive process in fish (Amano et al. 2004 : Taylor et al. 2005 ; López-Olmeda et al. 2006 ; De Pedro et al. 2008 ; Singh et al. 2012 ; Handeland et al. 2013 ). Hence, the decreased HSI might be the result of decreased food intake and subsequent reduction of hepatic energy stores. 4.4. Gonadotropin Gene Expression Pineal gland in fish secretes melatonin under darkness. Pineal gland secretes melatonin hormone to the blood and it act over the hypothalamo–hypophyseal–gonadal axis and regulate the development of oocytes (Maitra and Hasan 2016 ). In the present study, effect of melatonin in C. magur on gonadotropin gene expression was evaluated and it was found that melatonin supplementation inhibited the gonadotropin gene expression in pituitary gland at medium and higher (T2 and T3 groups) concentration of melatonin. Kim et al.2018 reported that melatonin inhibit the GnRH and GTH expression through increasing the GnIH, when injecting melatonin intra-peritonial in tilapia, they concluded that melatonin suppress the hypothalamus-pituitary-gonad (HPG) through the GnIH. In various vertebrates, the relationship between melatonin and GnRH is well documented. The melatonin administration led to inhibit the expression of GnRH-1, GnRH-3 and GnRH receptors in European sea bass ( Dicentrachus labrax ) (Servili et al. 2010 ). Similarly in male masu salmon, melatonin inhibited the gonadal development by suppressing GnRH and GTH (Amano et al. 2004 ). In the present study, there was a dose dependent effect observed on FSH and LH gene expression, by increasing the concentration of melatonin, both FSH and LH decreased significantly. In a recent study conducted by Carnevali et al. ( 2011 ), zebrafish was exposed to different doses of melatonin and observed a dose dependent effect on kiss1, kiss2 and gnrh3 gene expression in the brain and of LH β in the pituitary. In contrast, implantation of melatonin decreased both FSH and LH m RNA expression without affecting the GnRH gene expression in European eel (Sébert et al. 2008 ). Exogenous treatment of melatonin in cultured 4.5. Vitellogenin Gene Expression Vitellogenin (glycolipophosphoprotein) is chief egg yolk precursor protein synthesized by the liver in the influence of estradiol and it is prerequisite process of oocyte growth and it takes place during the oogenesis (Wallace and Selman 1981 ; Sawaguchi, et al. 2006 ). The synthesis of vitellogenin depends upon estradiol level which depends on gonadotropin (FSH). In present study, the highest Vtg mRNA expression was reported in T1 group followed by control group, while in T2 and T3 group Vtg mRNA expression decreased as compared to the control group at II sampling. It might be due to increased FSH level and it was highest at II sampling (May) suggesting that vitellogenesis peaks during this stage. This was also confirmed by the Vtg m RNA expression at II sampling. Similarly, the lowest dose melatonin supplemented group showed highest FSH concomitant with highest Vtg m RNA expression. Also, higher dose of melatonin inhibited gonadotropin expression and inhibited Vtg m RNA expression in C. magur. Our results are in agreement with Carnevali et al. ( 2011 ) who also reported that melatonin treatment resulted to increase in the gene and protein of vitellogenin and estradiol receptor in the liver of zebrafish. Similarly, Renuka and Joshi ( 2010 ) found higher proportion of vitellogenic follicles after melatonin treatment (via water for 24hr) in Channa punctatus . Mondal et al. ( 2019 ) reviewed the possible role of melatonin on vitellogenesis; melatonin may directly act on liver and regulate vitellogenesis, after that it stored into to mature follicle. The higher dose of melatonin in both sexes of Gasterosteus aculeatus led to an antigonadal effect while low dose induced progonadal effect under long photoperiod (Borg and Ekström 1981 ). 4.6. Antioxidant Enzymes Activities It is well documented that melatonin not only act as hormone but also as a potent free radical scavenger and antioxidant (Reiter 1996 ). Due lipophilic nature, melatonin easily crosses cell membrane and work as antioxidant by scavenging free radicals. In the present study, antioxidant enzymes such as SOD, Catalase, GpX and GST were measured after supplementation of graded levels of melatonin in the diet of C. magur. It is reported that melatonin has antioxidant, anti-inflammatory and anti-apoptotic property that is beneficial for treating reproductive abnormalities (Chowdhury, and Haldar 2022 ). SOD is class of important enzyme which is involved in breakdown of superoxide free radical into H2O2 (Gupta et al. 2020 ; Gupta et al. 2021 ). In the present study, SOD activity was highest in liver, muscle and ovary of highest melatonin supplemented group. In ovulated eggs, SOD activity was highest in control group while lowest activity was reported in the low dose melatonin group. The highest SOD activity in control group might be due to generation of high quantity of ROS. During the steroidogenesis, the developing oocytes produce huge quantity of free radicals mainly nitrogen species (RNS) and reactive oxygen species (ROS) (Agarwal et al. 2006 ). Agarwal et al.(2012) reported that during meiotic maturation of oocyte plenty of free radicals are generated and accumulated which produce oxidative stress in developing oocytes and prevent cell division. Melatonin level in oocytes increased during the follicular growth and ovulation (Nakamura et al. 2003 ; Tamura et al.2013). Tamura et al. ( 2013 ) reported that melatonin plays an important role in protecting oocytes from the harmful effect of ROS. Similarly, Reiter et al. ( 2000 ) reported that melatonin in ovarian follicle activate major antioxidant defence enzymes such as superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) and reduce oxidative stress in vivo condition.. The direct and indirect action of melatonin on free radical scavenging activity might have reduced the SOD activity in all tissues of the group fed with low dose of melatonin; this might be possible reason of decreased antioxidant enzymes activities in at lower dose of melatonin. Tan et al. ( 2002 ) found that due to the amphiphilic nature of melatonin it can cross the cellular barrier and directly scavenger of free radicals as well as promotes indirectly to the oxidative stress enzyme. Melatonin prevent ovary from damage by minimizing free radical and improve the oocytes quality (Reiter et al 2013 0). In the present study, SOD activity increased with increasing melatonin. Similar result was reported in human model by Şirinyıldız et al.(2021) they reported that both SOD and catalase enzyme activities increases with increasing melatonin administration. In the current experiment, Catalase and Gpx activity were also measured in liver, muscle and ovary. Catalase and Gpx followed same trend as SOD. In the present study, catalase activity was highest in liver, muscle and ovary of groups fed with melatonin. High catalase activity in control group might be due to generation of more ROS than the other groups. High ROS production might have resulted in the production of H2O2 by the SOD hence catalase activity increased significantly to prevent cell damage by ROS. GpX activity follow similar trend as catalase activity. Melatonin reduces the oxidative stress during the growth, development and maturation of oocytes (Hasan et al. 2014 ). Melatonin reduces oxidative stress by two process i.e it act as direct scavenger of free radical as well as antioxidant (Reiter et al. 2000 ). The decrease in SOD, catalase and GPx activity might be due to melatonin, as it is reported that melatonin inhibited free redical (•OH radicals) and converts H2O2 in to singlet oxygen (İkbal et al.2009). Similarly, Gonenc et al. ( 2005 ) also reported increased GPx activity after administration of melatonin. In the present study, SOD, Catalase and Gpx activity reduced in group fed with low dose group melatonin. However, with increasing concentration of melatonin in the diet, all antioxidant enzyme activities increased significantly. Hence, it is clearly indicated that lower dose of melatonin exhibited beneficial role in C. magur . Similarly, Subramanian et al.(2007) reported that melatonin at pharmacological amount reduced oxidative stress in brain and liver of rat. Reiter et al. (1996) concluded that melatonin act as a powerful antioxidant and it is superior to glutathione in term of neutralizing free radical. It also protects cell membrane from oxidative damage more effectively than vitamin E. In the present study, GST activity also measured in liver and ovary of C. magur. GST activity was highest in the liver and ovary of higher dose melatonin supplementation. The present finding was supported by Świderska-Kołacz et al. ( 2006 ) who reported that melatonin increased GST activity in the liver of mouse. In Catla, melatonin supplementation increased GST activity (Bhattacharya et al.2007). 4.7. Ovarian Histology Melatonin (MT) not only regulate the body’s seasonal and circadian rhythms; but also delay ovarian senescence, regulate ovarian biological rhythm, promote follicles formation, and improve oocyte quality and fertilization rate (Guo et al.2021). In present study, ovarian histological section of lower dose melatonin (T1 group) showed the oocytes at dominancy of Primary yolk stage (PYS), Secondary yolk stage (SYS) and few oocytes were at Tertiary yolk stage (TYS) at II sampling while at III sampling number of mature oocytes increased significantly, few oocytes were in Secondary yolk stage (SYS). The present study is supported by the result of Renuka and Joshi ( 2010 ) they reported that number of vitellogenic oocytes increased when Channa punctatus continuously exposed to melatonin and reduced the number of atretic oocyte in the ovary Maitra et al. ( 2005 ) reported that the dose (50-100mg/100 g body weight) induced maturation of oocytes in Catla at preparatory phase, while no effect at pre-spawning and spawning phase. Carnevali et al. ( 2011 ) reported that melatonin increases the germinal vesicle break down (GVBD) stage in zebrafish. In present study it was reported that medium dose (T2) and higher dose (T3) inhibited the Tertiary yolk stage oocyte and promote the atresia in the oocytes. Similarly Imamura et al ( 2022 ) reported the inhibitory effect of melatonin Sapphire Devil fish; they found the atresia and arrest of recruitment in vitellogenic oocytes in melatonin treat fish. Singh et al.(2012) also reported the inhibitory effect to melatonin in Tilapia, the number of perinucleolus stage oocytes were dominant in melatonin treated fish as compared to control group. In present study dose dependent effect of melatonin was reported on oocytes development in C. magur. The present finding is supported by Panchal and Rani.(2019) they reported that atretic oocytes increased with increasing the melatonin administration in Heteropneustes fossilis. 4.8. Reproductive Performance of C. magur Fed with Melatonin In the present experiment, reproductive performance was evaluated at the end of experiment (July). Reproductive performance was evaluated by fertilization rate, hatching rate, larval survival and fry survival in different experiment of melatonin in C. magur. In the present study, fertilization rate decreased with increasing melatonin supplementation. The highest fertilization rate was reported in lowest melatonin supplemented group. The present work is supported by previous findings that melatonin has positive role on oocytes quality and fertilization rate (Nakamura et al. 2003 ; Nakamura et al. 2003 ). Tamura et al. ( 2013 ) reported that melatonin improved quality of oocytes as well as fertilization rate. It might be due to the antioxidant property of melatonin, which protects oocytes from oxidative stress and aging as well (Reiter 1996 ). Melatonin is also present in ovarian follicular fluid and provide beneficial role in oocyte maturation, fertilization, and embryo development (Tamura et al. 2020 ). Aprin et al. (2015 a) reported there was no significant difference in fertilization rate after supplementation of melatonin in C. macrocephalus . The present findings demonstrated that lower dose of melatonin stimulated fertilization rate in C. magur by ROS scavenging action. Similarly, Ishizuka et al. ( 2020 ) reported that fertilization rate and early development of embryo is supported by ROS scavenging action of melatonin. Nishihara et al. ( 2014 ) reported that oral supplementation of melatonin in women support fertilization as well the quality of embryo. In the present study, it was found that there was a significant difference in hatching rate of C. magur fed with different levels of melatonin. The highest hatching rate was reported in the group fed with lowest levels of melatonin. Danilova et al.(2004) reported that hatching of zebra fish embryo depends on the concentration of melatonin. Tamura et al. ( 2020 ) found that melatonin was present inside the follicular fluid and oocytes; the role of this stored melatonin is to protect the cells during the oxidative stress and support oocyte maturation, fertilization and development of growing embryo. Similarly, the intra-ovarian melatonin reduced the oxidative stress and enhances the ovarian function during spawning of carp (Hasan et al 2014 ). In the present experiment, it was found that larva and fry survival increased significantly in the group fed with lowest levels of melatonin. Larval and fry survival was decreased by increasing the melatonin supplementation in the diet of C. magur. Low dose of melatonin enhanced survival of larval and fry of C. magur , which might be due to the decreasing oxidative stress by maternal melatonin, which enhances the embryo development. Tamura et al. ( 2013 ) reported that melatonin improved the quality of oocytes. Melatonin increased larval survival in Clarias macrocephalus (Aripin et al. 2015a ). Melatonin enhanced the cell proliferation and development of embryonic tissues in dose dependent manner in one day old larvae of zebra fish, hence accelerating their development Danilova et al. ( 2004 ). Melatonin induced cell proliferation and differentiation process in zebra fish, when growth hormone and prolactin supply is not sufficient Danilova et al. ( 2004 ). During spawning season, the intra-ovarian melatonin concentration is five times more than that measured during post spawning in carp ovary (Hasan et al. 2014 ). The increase in larval and fry survival might be due to the increase the quality of oocyte in term of GSI, fecundity and other reproductive genes, which are vital factors for successful bloodstock maturation. The exogenous supplementation of melatonin influence larval growth and weight and the effect depends on the dose of exogenous melatonin (Mhalhel et al. 2020 ). On the other hand, caudal fin complex abnormalities in gilthead seabream were reported by exogenous supplementation and these abnormalities are dose dependent with exogenous melatonin (Mhalhel et al. 2020 ). Supplementation of melatonin @ 100 mg/kg diet in C .magur significantly improved reproductive performance in term of fry and larval survival. Declarations Ethics Statement The research undertaken complies with the current animal welfare laws in India, and the use of animals in this study was in accordance with the guidelines of the CPCSEA (Committee for the Purpose of Control and Supervision of Experiments on Animals), Ministry of Environment & Forests (Animal Welfare Division), Govt. of India on care and use of animals in scientific research. The study was undertaken with the approval of statutory authorities of the Central Institute of Fisheries Education, Mumbai, India (University under Sec.3 of University Grants Commission Act and ISO 9001:2008 certified). Conflicts of Interest There is no conflict of interest for the publication of this manuscript, among the Authors Author Contribution Prem Prakash Srivastva designed and conceptualization of research work, checked the results, interpreted them and manuscript correction.Gyandeep Gupta experimental setup, sample collection, data analysis and preparation of manuscript.Munish Kumar helped in sample collection and statistical analysis. Tincy Varghese helped in manuscript writing and correction Thongam Ibemcha Chanu checked and revised the manuscript. Subodh Gupta helped in analysis. Muralidhar P. Ande checked and revised the manuscript and helped in conducting experiment at ICAR-CIFE, Kakinda, Andhra Pradesh, India. All of the authors read and approved the final manuscript Acknowledgement The Authors are grateful to the Director, ICAR-Central Institute of Fisheries Education (Deemed University), Mumbai, for providing necessary facilities and funding for carrying out the research work. References Aarseth JJ, Frøiland E, Jørgensen EH (2010) Melatonin implantation during spring and summer does not affect the seasonal rhythm of feeding in anadromous Arctic charr ( Salvelinus alpinus ). Polar Biol. , 33: 379-388. Agarwal A, Aponte-Mellado A, Premkumar BJ, Shaman A, Gupta S (2012) The effects of oxidative stress on female reproduction: a review. Reprod. biol. endocrinol. 10 : 1-31. Agarwal A, Gupta S, Sikka S (2006) The role of free radicals and antioxidants in reproduction. Curr Opin Obstet Gynecol , 18 no.: 325-332. Alvarado MV, Carrillo M, Felip A (2015) Melatonin-induced changes in kiss/gnrh gene expression patterns in the brain of male sea bass during spermatogenesis. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 185: 69-79. Amano M, Iigo M, Ikuta K, Kitamura, S, Okuzawa K, Yamada H (2004) and Yamamori, K., Disturbance of plasma melatonin profile by high dose melatonin administration inhibits testicular maturation of precocious male masu salmon. Zool. Sci , 21 no. 1: 79-85. Amano M, Iigo M, Ikuta K, Kitamura S, Yamada H, Yamamori K (2000) Roles of melatonin in gonadal maturation of underyearling precocious male masu salmon. Gen. Comp. Endocrinol, 120(2): 190-197. AOAC., (1995). Association of Official Analytical Chemists. Official Methods of Analysis of the Association Official Analytical Chemists, 16th ed. AOAC, Inc., Arlington, Virginia, USA. Aripin SA, Jintasataporn O, Yoonpundh R (2015a) Effects of melatonin on Clarias macrocephalus female broodstock performance. Int. J. Appl. Sci., 21 no 1: 129-137. Bhattacharya S, Chattoraj A Maitra SK (2007) Melatonin in the regulation of annual testicular events in carp Catla catla : evidence from the studies on the effects of exogenous melatonin, continuous light, and continuous darkness. Chronobiol. Int. , 24 no. 4: 629-650. Borg B, Ekström P (1981). Gonadal effects of melatonin in the three-spined stickleback, Gasterosteus aculeatus L., during different seasons and photoperiods. Reprod. Nutr. Dev. , 21 no. 6A: 919-927. Bubenik GA (2002) Gastrointestinal melatonin: localization, function, and clinical relevance. Dig. Dis. Sci , 47: 2336-2348. Bubenik GA, Pang SF, Cockshut JR, Smith PS, Grovum L W (2000) Friendship, R. M. and Hacker, R. R., Circadian variation of portal, arterial and venous blood levels of melatonin in pigs and its relationship to food intake and sleep, J. Pineal Res 28 no 1: 9-15. Carnevali O, Gioacchini G, Maradonna F, Olivotto I, Migliarini B (2011) Melatonin induces follicle maturation in Danio rerio . PLoS One , 6 no 5: e19978. Chattoraj A, Bhattacharyya S, Basu D, Bhattacharya S, Bhattacharya S, Maitra SK (2005) Melatonin accelerates maturation inducing hormone (MIH): induced oocyte maturation in carps. Gen. Comp. Endocrinol , 140 no. 3: 145-155. Chowdhury JP, Haldar C (2022) Stress associated ovarian dysfunctions in a seasonal breeder Funambulus pennanti : Role of glucocorticoids and possible amelioration by melatonin. Gen. Comp. Endocrinol , 316: 113962. Danilova N, Krupnik VE, Sugden D Zhdanova IV (2004) Melatonin stimulates cell proliferation in zebrafish embryo and accelerates its development. The FASEB Journal, 18 no. 6: 751-753. De Pedro N, Martínez‐Álvarez RM, Delgado MJ (2008) Melatonin reduces body weight in goldfish ( Carassius auratus ): effects on metabolic resources and some feeding regulators. J. Pineal Res. , 45 no. 1: 32-39. De Vlaming, V., (1980). Effects of pinealectomy and melatonin treatment on growth in the goldfish, Carassius auratus . Gen. Comp. Endocrinol. , 40 no 2: 245-250. Dhara K, Das UN (2018) Breeding performance of the walking catfish Clarias batrachus (Linnaeus, 1758) using synthetic inducing agent, Alpa-FH with special reference to the occurrence of morphological deformities in their early stage of life. J. Entomol. Zool. Stud. , 6 : 957–963. Ghosh, J, Nath P (2005) Reported the seasonal effects of Melatonin on ovary and plasma gonadotropin and vitellogenin levels in intact and pinealectomized catfish, Clarias batrachus (L.). Indian J. Exp. Biol , 43: 224 -232. Gonenc S, Uysal N, Acikgoz O, Kayatekin BM, Sonmez A, Kiray M, Aksu I, Gulecer B, Topcu A, Semin I (2005) Effects of melatonin on oxidative stress and spatial memory impairment induced by acute ethanol treatment in rats. Physiol. Res., 54: 341-348. Guo YM, Sun TC, Wang HP, Chen X (2021) Research progress of melatonin (MT) in improving ovarian function: a review of the current status. Aging (Albany NY), 13 no. 13: 17930. Gupta G, Chatterjee A, Kumar M, Sardar P, Varghese T, Srivastava PP, Gupta S (2020) Efficacy of single and multiple doses of fenbendazole against gill parasites ( Dactylogyrus sp.) of Labeo rohita (Hamilton, 1822) and its physio‐metabolic effects on the fish. Aquac. Res. 51 no. 3 : 1190-1199. Gupta G, Srivastava PP, Kumar M, Varghese T, Chanu TI, Gupta S, Ande MP Jana P (2021) The modulation effects of dietary zinc on reproductive performance and gonadotropins’(FSH and LH) expression in threatened Asian catfish, Clarias magur (Hamilton, 1822) broodfish. Aquac. Res. ; 00: 1–12. Handeland SO, Imsland AK, Björnsson BT, Stefansson SO,Porter M (2013) Physiology during smoltification in Atlantic salmon: effect of melatonin implants. Fish Physiol. Biochem 39:1079-1088. Hasan KN, Moniruzzaman M, Maitra SK (2014) Melatonin concentrations in relation to oxidative status and oocyte dynamics in the ovary during different reproductive phases of an annual cycle in carp Catla catla . Theriogenology , 82 no. 2: 1173-1185. Hossain MA, Islam MS (1990) The fecundity and sex ratio of the common punti, Puntius stigma (Cuvier and Valenciennes) (Cypriniformes: Cyprinidae) from the river Padma near Rajshahi (in Bangladesh ). Univ. j. zool., Rajshahi Univ. , 9 : 69–74. Hossain Q, Hossain MA, Parween S (2006) Artificial breeding and nursery practices of Clarias batrachus (Linnaeus, 1758). Scientific World , 4,no 4: 32-37. İkbal AGAH, Zafer EREN, Gürkanli İ (2009) Effect of melatonin on the antioxidant enzyme status in the liver of Swiss albino laboratory mice in single circadian rhythm. J. Appl. Biol. Sci 3 no. 1: 1-5. Imamura S, Hur, SP, Takeuchi Y, Badruzzaman M, Mahardini A, Rizky D, Takemura A (2022) Effect of short-and long-term melatonin treatments on the reproductive activity of the tropical damselfish Chrysiptera cyanea . Fish Physiol. Biochem 48 no. 1:253-262. Ishizuka B, Kuribayashi Y, Murai K, Amemiya A, Itoh MT (2020) The effect of melatonin on in vitro fertilization and embryo development in mice. . Pineal Res, 28 no. 1:48-51. Kim JH, Park JW, Jin YH, Kim DJ, Kwon JY (2018) Effect of melatonin on GnIH precursor gene expression in Nile tilapia, Oreochromis niloticus. Biol. Rhythm Res., 49 no. 2: 303-313. Kołacz Swiderska- G, Klusek J, Kołataj A (2006) The effect of melatonin on glutathione and glutathione transferase and glutathione peroxidase activities in the mouse liver and kidney in vivo. Neuroendocrinol. Lett , 27 no.3. Kowaltowski A, J, Vercesi AE (1999) Mitochondrial damage induced by conditions of oxidative stress. Free Radic. Biol. Med. , 26 no. 3-4: 463-471. Lima‐Cabello E, Díaz‐Casado ME, Guerrero JA, Otalora BB, Escames G, López L C, Reiter RJ. Acuña‐Castroviejo D (2014) A review of the melatonin functions in zebrafish physiology. J. Pineal Res , 57 no 1: 1-9. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods, 25 no 4: 402–408. López-Olmeda, JF, Madrid JA, Sánchez-Vázquez FJ (2006) Melatonin effects on food intake and activity rhythms in two fish species with different activity patterns: Diurnal (goldfish) and nocturnal (tench). Comp. Biochem. Physiol. A Mol. Integr. Physiol. , 144 no. 2: 180-187 Maitra SK Hasan KN (2016) The role of melatonin as a hormone and an antioxidant in the control of fish reproduction. Front. Endocrinol , 7: 38. Maitra SK, Chattoraj A, Bhattacharyya S (2005) Implication of melatonin in oocyte maturation in Indian major carp Catla catla Fish Physiol. Biochem, 31: 201-207. Mhalhel K, Germanà A, Abbate F, Guerrera MC (2020) Levanti, M., Laurà, R. and Montalbano, G., 2020. The Effect of Orally Supplemented Melatonin on Larval Performance and Skeletal Deformities in Farmed Gilthead Seabream ( Sparus aurata Int. J. Mol. Sci., 21 no. 24: 9597. Ministry of Fisheries, Animal Husbandry & Dairying 2023 Mir IN, Srivastava PP, Bhat IA, Jaffar YD, Sushila N, Sardar P, Kumar S, Muralidhar A P, Jain K K (2020) Optimal dietary lipid and protein level for growth and survival of catfish Clarias magur larvae. Aquaculture , 520 : 734678. Mondal P, Hira SK, Saha NC (2019) The functional role of melatonin and kisspeptin in fish reproduction. Innovare Journal of Sciences , 7 no. 3 (2019): 1-7 Nakamura Y, Tamura H, Takayama H, Kato H (2003) Increased endogenous level of melatonin in preovulatory human follicles does not directly influence progesterone production. Fertil Steril , 80 no. 4: 1012-1016. Nishihara T, Hashimoto S, Ito K, Nakaoka Y, Matsumoto K, Hosoi Y, Morimoto Y (2014) Oral melatonin supplementation improves oocyte and embryo quality in women undergoing in vitro fertilization-embryo transfer. Gynecol. Endocrinol , 30 no. 5:359-362. Panchal R, Rani S (2019) Effect of melatonin and pinealectomy on gonadal activity during prespawning period of catfish ( Heteropneustes fossilis ). J. Environ. Biol., 40 no. 4: 698-704. Pinillos ML, De Pedro N, Alonso-Gómez A L, Alonso-Bedate M, Delgado M J (2001) Food intake inhibition by melatonin in goldfish ( Carassius auratus ). Physiol. Behav. 72 no. 5: 629-634. Popek, W. "Role of pineal gland in development and gonad maturation in common carp ( Cyprinus carpio L) Ph. D." PhD diss., Thesis, 1991.. Porter MJR, Randall CF, Bromage NR, Thorpe JE (1998) The role of melatonin and the pineal gland on development and smoltification of Atlantic salmon ( Salmo salar ) parr. Aquaculture , 168 no 1-4 :139-155. Reiter RJ (1996) Antioxidant actions of melatonin. Adv. Pharmacol , 38 :103-117. Reiter RJ, Rosales-Corral SA, Manchester LC, Tan D X (2013) Peripheral reproductive organ health and melatonin: ready for prime time. Int. J. Mol. Sci. , 14 no.4: 7231-7272. Reiter RJ, Tan DX, Maldonado MD (2005) Melatonin as an antioxidant: physiology versus pharmacology. J. Pineal Res , 39 no. 2: 215-216. Reiter RJ, Tan D X, Manchester LC, Paredes SD, Mayo JC, Sainz RM (2009) Melatonin and reproduction revisited. Biol. Reprod. 81 no. 3: 445-456. Reiter R J, Tan DX, Osuna C, Gitto E (2000) Actions of melatonin in the reduction of oxidative stress: a review. J. Biomed. Sci. , 7 no 6: 444-458 Renuka K, Joshi B. N (2010) Melatonin-induced changes in ovarian function in the freshwater fish Channa punctatus (Bloch) held in long days and continuous light. Gen. Comp. Endocrinol 165: 42–46. Sahoo SK, Giri SS, Sahu AK (2004) Effect of stocking density on growth and survival of Clarias batrachus (Linn.) larvae and fry during hatchery rearing. J. Appl. Ichthyol, 20: 302– 305. Sahoo SK, Giri SS, Sahu AK (20050 Induced spawning of Asian catfish, Clarias batrachus (Linn.): effect of various latency periods and SGnRHa and domperidone doses on spawning performance and egg quality. Aquac. Res. , 36 no. 13: 1273-1278 Sahoo SK, Giri SS, Chandra S, Mohapatra BC (2008) Evaluation of breeding performance of Asian catfish Clarias batrachus at different dose of HCG and latency period combinations. Turkish Journal of Fisheries and Aquatic Sciences , 8 no. 2. Sawaguchi, S., Kagawa, H., Ohkubo, N., Hiramatsu, N., Sullivan, C.V. and Matsubara, T., Molecular characterization of three forms of vitellogenin and their yolk protein products during oocyte growth and maturation in red seabream ( Pagrus major ), a marine teleost spawning pelagic eggs. Mol. Reprod. Dev 73 no. 6 (2006):719-736. Sébert ME, Legros C, Weltzien FA, Malpaux B, Chemineau P, Dufour S (2008) Melatonin activates brain dopaminergic systems in the eel with an inhibitory impact on reproductive function. J. Neuroendocrinol , 20 no. 7: 917-929. Servili A, Lethimonier C, Lareyre JJ, Lopez-Olmeda JF, Sanchez-Vazquez FJ, Kah O, Munoz-Cueto JA (2010) The highly conserved gonadotropin-releasing hormone-2 form acts as a melatonin-releasing factor in the pineal of a teleost fish, the European sea bass Dicentrarchus labrax . Endocrinology , 151 no. 5 : 2265-2275. Singh R, Singh AK, Tripathi M (2012) Melatonin induced changes in specific growth rate, gonadal maturity, lipid and protein production in Nile tilapia Oreochromis niloticus (Linnaeus 1758). Asian-Australasian Journal of Animal Sciences, 25 no 1: 37-43 Şirinyıldız F, Ek RO (2021) Effects of melatonin at different doses on experimental epilepsy model induced by pentylenetetrazole. Meand. Med Dent J. 22 no. 2 : 177. Srivastava PP, Raizada S, Dayal R, Chowdhary S, Lakra WS, Yadav AK, Sharma P, Gupta J (2012) Breeding and larval rearing of Asian catfish, Clarias batrachus (Linnaeus, 1758) on live and artificial feed. Aquac Res Dev. , 3 : 4. DOI: 10.4172/2155-9546.1000134 Subramanian P, Mirunalini S, Pandi-Perumal SR, Trakht I, Cardinali DP (2007) Melatonin treatment improves the antioxidant status and decreases lipid content in brain and liver of rats . Eur. J. Pharmacol. , 571 no.2-3 : 116-119. Tamura H, Jozaki M, Tanabe M, Shirafuta Y, Mihara Y, Shinagawa M, Tamura I, Maekawa R, Sato S, Taketani T, Takasaki A (2020) Importance of melatonin in assisted reproductive technology and ovarian aging. Int. J. Mol. Sci.. , 21 no. 3:1135. Tamura H, Takasaki A, Taketani T, Tanabe M, Kizuka F, Lee L, Tamura I, Maekawa R, Asada H, Yamagata Y, Sugino N (2013) Melatonin as a free radical scavenger in the ovarian follicle. Endocrine journal , 60 no.1: 1-13. Tan DX, Reiter RJ, Manchester LC, Yan MT, El-Sawi M, Sainz RM, Mayo JC, Kohen R, Allegra MC, Hardeland R (2002) Chemical and physical properties and potential mechanisms: melatonin as a broad spectrum antioxidant and free radical scavenger. Curr. Top. Med. Chem , 2 no. 2: 181-197. Taylor JF, Migaud H, Porter MJR, Bromage NR (2005) Photoperiod influences growth rate and plasma insulin-like growth factor-I levels in juvenile rainbow trout, Oncorhynchus mykiss . Gen. Comp. Endocrinol. 142 no. 1-2 : 169-185. Wallace RA, Selman K (1981) Cellular dynamic aspect of oocyte growth in teleosts. American Zoology , 21: 325–343 Zachmann A, Falcon J, Knijff SC, M Bolliet V, Ali MA (1992) Effects of photoperiod and temperature on rhythmic melatonin secretion from the pineal organ of the white sucker ( Catostomus commersoni ) in vitro. Gen. Comp. Endocrinol , 86 no 1: .26-33. Plates Plates 1 to 9 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files plates.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6279678","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":435991447,"identity":"71c3b094-5575-4ef3-9b7d-dec1304a6d7d","order_by":0,"name":"Gyandeep Gupta","email":"","orcid":"","institution":"ICAR-Central Institute of Fisheries Education","correspondingAuthor":false,"prefix":"","firstName":"Gyandeep","middleName":"","lastName":"Gupta","suffix":""},{"id":435991448,"identity":"b6ed2ee3-c0a4-43a3-a571-29e49eb9ed5e","order_by":1,"name":"Prem Prakash Srivastava","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/UlEQVRIiWNgGAWjYLCCBBjjA4MEP4iWACNCWniAmHEGg4RkA1FaGKBamIEETAtuYC7d/uzDwzY7e3v2M4afbWosgC5jPnibh8EiD5cWyzlnjGcktiUn9vDkGEvnHJMAuowt2ZqHQaIYlxaDGznMDAlnmBN4GNISpHMbJOoMDvCYSQO1JDbg1JL+GKil3p6H/1nyb8sGCQn7A/zfCGhJMGZIqDjM2CORfEyaEajFgIGHDa8WkF+AWo4n9tx4fMyyB+gXicNsxpZzDHBrAYbYY8YfBtX27P2JzTd+1NRJ8Lc3P7zxpqIOt8Mwo4AZLI5DPXYto2AUjIJRMArQAACgQkrNwXhwhwAAAABJRU5ErkJggg==","orcid":"","institution":"ICAR-Central Institute of Fisheries Education","correspondingAuthor":true,"prefix":"","firstName":"Prem","middleName":"Prakash","lastName":"Srivastava","suffix":""},{"id":435991449,"identity":"968713aa-6745-4fce-8de0-f07643934d6a","order_by":2,"name":"Munish Kumar","email":"","orcid":"","institution":"ICAR-Central Institute of Fisheries Education","correspondingAuthor":false,"prefix":"","firstName":"Munish","middleName":"","lastName":"Kumar","suffix":""},{"id":435991450,"identity":"a1add8d1-17ae-4c1e-986b-086d81d338ed","order_by":3,"name":"Tincy Varghese","email":"","orcid":"","institution":"ICAR-Central Institute of Fisheries Education","correspondingAuthor":false,"prefix":"","firstName":"Tincy","middleName":"","lastName":"Varghese","suffix":""},{"id":435991454,"identity":"0d99918e-840c-4847-b571-054dfcb7ad8f","order_by":4,"name":"Thongam Ibemcha Chanu","email":"","orcid":"","institution":"ICAR-Central Institute of Fisheries Education","correspondingAuthor":false,"prefix":"","firstName":"Thongam","middleName":"Ibemcha","lastName":"Chanu","suffix":""},{"id":435991455,"identity":"c983721a-56c9-4ef6-af79-df1e324eb366","order_by":5,"name":"Subodh Gupta","email":"","orcid":"","institution":"ICAR-Central Institute of Fisheries Education","correspondingAuthor":false,"prefix":"","firstName":"Subodh","middleName":"","lastName":"Gupta","suffix":""},{"id":435991458,"identity":"0391fed4-c294-405a-af6b-b0225229a88c","order_by":6,"name":"Muralidhar P. Ande","email":"","orcid":"","institution":"ICAR-Central Institute of Fisheries Education","correspondingAuthor":false,"prefix":"","firstName":"Muralidhar","middleName":"P.","lastName":"Ande","suffix":""}],"badges":[],"createdAt":"2025-03-21 18:08:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6279678/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6279678/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":79758711,"identity":"d05aefc9-e15c-4835-880a-9aa49bd76158","added_by":"auto","created_at":"2025-04-02 10:50:15","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":35287,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHSI (%) of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. magur\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e fed with different concentration of melatonin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDifferent letters above the bars denoted significant difference among the diet groups at the p\u0026lt;0.05. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6279678/v1/fba72831a400a19588c6bf1d.png"},{"id":79758712,"identity":"48311209-b22a-421d-8073-66e3dd57255e","added_by":"auto","created_at":"2025-04-02 10:50:15","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":30537,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMonthly changes in FSH gene expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. magur \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003efed with different concentration of melatonin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDifferent letters above the bars denoted significant difference among diet groups at the p\u0026lt;0.05. a,b,c… denoted the significant difference of II sampling, while A,B,C… denoted the significant difference of III\u003csup\u003e \u003c/sup\u003esampling among the experimental groups. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6279678/v1/1d285ad48ff0773736ec5560.png"},{"id":79758713,"identity":"d808c323-7c9a-4c4f-a180-6289284eb0b4","added_by":"auto","created_at":"2025-04-02 10:50:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":29516,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMonthly changes in LH gene expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. magur \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003efed with different concentration of melatonin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDifferent letters above the bars denoted significant difference among diet groups at the p\u0026lt;0.05. a,b,c… denoted the significant difference II sampling, while A,B,C… denoted the significant difference of III sampling among the experimental groups. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6279678/v1/6499c5c7451f2784cf98b6b7.png"},{"id":79758715,"identity":"0b4a7cbc-a760-4639-8158-232a31634299","added_by":"auto","created_at":"2025-04-02 10:50:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":29991,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMonthly changes in Vtg gene expression of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. magur \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003efed with different concentration of melatonin\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDifferent letters above the bars denoted significant difference among diet groups at the p\u0026lt;0.05. a,b,c… denoted the significant difference of II sampling, while A,B,C… denoted the significant difference of III sampling among the experimental groups. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg)\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6279678/v1/10ab89019a0ea21400030562.png"},{"id":79758714,"identity":"576d124f-cf51-42a4-8365-139da540ee34","added_by":"auto","created_at":"2025-04-02 10:50:16","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":18756,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of different concentration of melatonin on GST activity of liver in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. magur female \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ebroodstock\u003c/strong\u003e\u003cbr\u003e\n Different letters above the bars denoted significant difference among diet groups at the p\u0026lt;0.05. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg)\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6279678/v1/d84f053755458dd20758bca5.png"},{"id":79759808,"identity":"540c928f-1a9f-4392-839b-544b2ac74ef7","added_by":"auto","created_at":"2025-04-02 10:58:16","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":15944,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of different concentration of melatonin on GST activity of ovary in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eC. magur female \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ebroodstok\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eDifferent letters above the bars denoted significant difference among diet groups at the p\u0026lt;0.05. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg)\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6279678/v1/de2a0a6bcacbefca57909d6e.png"},{"id":83034424,"identity":"95dfd275-ae03-41a1-863e-90b623c2a1ae","added_by":"auto","created_at":"2025-05-19 09:38:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2099004,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6279678/v1/9637cce7-4d51-4dcb-b598-1e7c7e097273.pdf"},{"id":79760336,"identity":"d5155f10-054a-4c2c-bb97-1117727e0a29","added_by":"auto","created_at":"2025-04-02 11:06:16","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":666390,"visible":true,"origin":"","legend":"","description":"","filename":"plates.docx","url":"https://assets-eu.researchsquare.com/files/rs-6279678/v1/9b105534367febf510de81c5.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effect of melatonin supplementation on gonadotropins, Vitellogenin gene expression, antioxidant status, ovarian histology and reproductive performance in female Clarias magur","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eIn India, the fisheries and aquaculture sector provides livelihoods to over 14.5\u0026nbsp;million people. The country achieved a record fish production of 17.545\u0026nbsp;million tonnes in the fiscal year 2022\u0026ndash;2023, solidifying its position as the third-largest fish-producing nation globally, with an 8% share in worldwide production (Ministry of Fisheries, Animal Husbandry \u0026amp; Dairying 2023). These advancements underscore the growing significance of aquaculture in meeting global fish consumption demands and its vital role in supporting livelihoods, particularly in countries like India.\u003c/p\u003e \u003cp\u003eIndian aquaculture is mainly based on carp fishes and contributes around 85% of the total aquaculture production of the country. However, there are more than 20 species in the queue to be commercialized and adopted in the intensified aquaculture system. Therefore, the developmental strategies in terms of culture techniques, species diversification, and nutritional intervention are the major areas to increase the production and productivity of available resources per unit area. Among the different catfishes such as magur, singhi, and pangasius, \u003cem\u003eClarias magur\u003c/em\u003e is an important candidate species in the intensified aquaculture system such as ponds, re-circulatory-aquaculture systems and biofloc-based aquaculture systems.\u003c/p\u003e \u003cp\u003e \u003cem\u003eC. magur\u003c/em\u003e is commonly known as walking catfish. It is a medium-sized, air-breathing catfish which can tolerate hypoxia as well as utilize aerial oxygen. it has a 3\u0026ndash;4 times high market price (approx. ₹ 400/kg) due to presence of higher amount of protein, iron and low fat in their tissues (15.0,protein, 710 iron, 1.0 fat mg/100g tissues (Hossain et al.2006). It has been reported that the magur is prescribed prophylactically to anaemic and malnourished individuals as well as for convalescent individuals due to its nutritional superiority. Its excellent nutritional profile makes \u003cem\u003eClarias\u003c/em\u003e a suitable candidate species for intensification of aquaculture systems. However, the major constraint for the widespread intensified aquaculture of this species is the non-availability of seed/ quality seed, both from hatcheries and the wild. The availability of wild seeds is also scarce due to the depletion of natural stocks or breeding grounds (Srivastava et al.2012) Nowadays, intensified aquaculture will not be depending on natural seed resources because of the inconsistent availability of natural resources. In hatchery-produced seed, low survival was observed during its early larval stage, especially during spawn to fry. The reasons for low survival could be poor broodstock management, lack of knowledge of stocking density and nutrients requirement at various culture periods of \u003cem\u003eC. magur\u003c/em\u003e (Sahoo et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). The commercial production of this species hampered seriously due to the insufficient seed availability and low survival during the early larval rearing and this might be the major constraint for large-scale production of \u003cem\u003eC. magur\u003c/em\u003e (Mir et al.2020). Another major constraint for this species is poor response to synthetic hormones for gonadal maturation and spawning (Sahoo et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). To consider the major problem of reproductive performance and larval survival in the mind, melatonin as a dietary supplementation was selected to improve the reproductive performance and larval survival of \u003cem\u003eC. magur\u003c/em\u003e in an early stage to commercialize the production of magur in an intensified aquaculture system.\u003c/p\u003e \u003cp\u003eMelatonin rhythm is the most studied circadian clock in vertebrates. Melatonin concentration is highest at night and lowest during the daytime. Tryptophan amino acid is the precursor of melatonin, which is taken up by the pineal cells of pineal gland. Aralkylamine\u0026ndash;acetyltransferase (and) is the key gene of melatonin synthesis, which convert tryptophan into N-acetyl serotonin, from tryptophan (Lima-Cabello et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). It has been reported, during the rupture of the ovarian follicle and ovulatory process produced an immense amount of ROS (Agarwal et al, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) which has various deterioration effects on lipids of cell membrane, disturbed DNA structure and promotes apoptosis (Kowaltowski and Vercesi \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). Reiter et al. (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) described that melatonin have potent free radical scavenging capacity and display a broad spectrum antioxidant activity; it protects the ovary from free radical damage and enhances the oocytes quality. In female teleosts, melatonin can stimulate the production of a maturation-inducing hormone (MIH), maturation of oocyte and normal development of embryo (Chattoraj et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2005\u003c/span\u003e: Danilova et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Danilova et al.(2004) concluded that melatonin exert their function by specific melatonin receptor and enhances the cell proliferation in the embryo of zebrafish. During oocyte maturation and ovulation large amount of free radicals generated which elevated oxidative stress that causes the impairment of oocytes, accelerated oocyte ageing and ultimately deteriorates oocyte quality (Tamura, et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Several studies reported, melatonin and its metabolites also play an important role in free radical scavenging and prevent the ovary from free radical damage ultimately improving the quality of oocytes (Reiter et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). In ovarian follicle melatonin indirectly reduce oxidative stress by activating antioxidant enzymes like superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) (Reiter et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Popek (\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e1991\u003c/span\u003e) reported that the pineal gland and melatonin play a role in promoting the final phases of sexual maturation by synchronization of fully grown oocytes with optimum spawning period and it also induces vitellogenesis in in the post-spawning period in carp.\u003c/p\u003e \u003cp\u003eThus, considering the importance of melatonin in reproduction, the present study aimed to optimize the use of melatonin in the diet of \u003cem\u003eC. magur\u003c/em\u003e brooders. The response to the supplementation of melatonin was evaluated by assessing the gene expression, growth, reproductive performance and ovarian histology.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003e2.1. Experimental site and animal\u003c/h2\u003e\n \u003cp\u003eThe healthy brooders of \u003cem\u003eC. magur\u003c/em\u003e (female) with an average wt. 140\u0026thinsp;\u0026plusmn;\u0026thinsp;5 g were collected from brood stock pond of the freshwater farm of Central Institute of Fisheries Education, Balbhadrapuram, Andhra Pradesh, India. The experiment was conducted in the cement tanks at the same site for a period of 60 days. Fish were acclimatized in cemented tank for a period of 15 days. During acclimatization period, fish were fed with the control diet with 3% body weight and the ration was split into two portions at morning and evening at 7 am and 6 pm respectively.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003e2.2. Feed preparation and proximate composition\u003c/h2\u003e\n \u003cp\u003eThe basal diet was prepared with the help of locally available ingredients viz, groundnut oil cake (GNOC), fish meal, soybean meal, soybean oil and fish oil. Four isonitrogenous and isocaloric diets were prepared with different inclusion viz.,Control (0 mg/kg melatonin), T1 (100 mg/kg melatonin), T2 (200 mg/kg melatonin), and T3 (300 mg/kg melatonin). All the ingredients grinded and sieved for removal of impurity and uniform powder of different ingredient obtained. All the ingredients were accurately weighed according to formulation and mixed properly. Dough was prepared by adding water and cooked in pressure cooker for 30 min. After cooking, all the vitamin mineral premix and oil along with graded level of Melatonin was added in respective diets. The vitamin mineral premix was added, when dough was cooled. After adding all the ingredients, mixed well and pellets were formed with the help of hand pelletizer. Pellets were dried in shadow and after drying all the respective diets were kept in air tight polythene bags and stored at 4\u003csup\u003e0\u003c/sup\u003e C. Feed formulation used in experiment shown in Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The feeds\u0026apos; proximate composition underwent analysis following the AOAC\u0026apos;s standard methods (AOAC., 1995). To determine the moisture content of the experimental diets, samples were dried to a constant weight at 100\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C in a hot air oven. Crude protein content (expressed as TN% \u0026times; 6.25) was assessed using the micro-Kjeldahl method (Kelplus, PELICAN), while ether extract was determined via the soxhlet extraction method (SOCS plus, SAS-AS 08, PELICAN). Ash content was measured by incinerating samples in a muffle furnace at 550\u0026deg;C for 6 hours, and fiber estimation was conducted using Fiber tech equipment (Tulin equipment) (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTable 1: Feed formulation and proximate analysis\u003c/strong\u003e\u003c/p\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eIngredients (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 103px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eC\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eT1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eT2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eT3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eFish meal\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e22.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e22.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e22.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e22.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eSoybean \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e22.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e22.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e22.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e22.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eGNOC\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eDORB\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e15.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e15.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e15.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e15.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eWheat flour\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e13.84\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e13.74\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e13.64\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e13.54\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eFish oil\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eVeg. oil\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eVitamin premix*\u003csup\u003eb\u0026nbsp;\u003c/sup\u003e(vitamin D free)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 103px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eMineral premix\u003csup\u003eb\u003c/sup\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 103px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eCMC\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eVitamin C\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eBHT\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eCholine chloride\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eMelatonin(mg/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 103px;\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e200\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e300\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\" valign=\"top\" style=\"width: 605px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProximate composition (% dry matter)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eDry matter\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 103px;\"\u003e\n \u003cp\u003e90.56 \u0026plusmn;0.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e90.56 \u0026plusmn; 0.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e90.56 \u0026plusmn; 0.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e90.56 \u0026plusmn; 0.21\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eCrude protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e35.19 \u0026plusmn; 0.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e35.25 \u0026plusmn; 0.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e35.40 \u0026plusmn; 0.18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e35.17 \u0026plusmn; 0.12\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eCrude fat\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e8.26 \u0026plusmn; 0.28\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e8.30 \u0026plusmn; 0.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e8.18 \u0026plusmn; 0.034\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e8.41 \u0026plusmn; 0.18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eCrude fiber\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e8.05 \u0026plusmn; 0.16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e8.18 \u0026plusmn; 0.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e8.06 \u0026plusmn; 0.26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e8.21 \u0026plusmn; 0.31\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eAsh\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 103px;\"\u003e\n \u003cp\u003e9.05 \u0026plusmn; 0.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e9.14 \u0026plusmn; 0.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e9.07 \u0026plusmn; 0.37\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e9.08 \u0026plusmn; 0.16\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eNitrogen free extract\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 103px;\"\u003e\n \u003cp\u003e39.45 \u0026plusmn;0.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e39.45 \u0026plusmn; 0.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e39.45 \u0026plusmn; 0.51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e39.45 \u0026plusmn; 0.51\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 141px;\"\u003e\n \u003cp\u003eDigestible energy (Kcal/ 100 g)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 103px;\"\u003e\n \u003cp\u003e372.90\u0026plusmn;1.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e372.90\u0026plusmn;1.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e372.90\u0026plusmn;1.73\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 120px;\"\u003e\n \u003cp\u003e372.90\u0026plusmn;1.73\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003eData are expressed as Mean \u0026plusmn; SE, n = 3\u003c/p\u003e\n \u003cp\u003eC, (0 mg/kg melatonin), T1 (100 mg/kg melatonin), T2 (200 mg/kg melatonin), and T3 (300 mg/kg melatonin).\u0026nbsp;CMC, Carboxymethyl cellulose; 4BHT, Butylatedhydroxyltoluene; \u0026nbsp;\u003c/p\u003e\n \u003cp\u003e5Digestible energy = (%CP \u0026times; 4) + (% EE \u0026times; 9) + (%NFE \u0026times; 4), Halver (1976)\u003c/p\u003e\n \u003cp\u003e\u003csup\u003ea\u003c/sup\u003e Practical ingredients procured from local market .\u003c/p\u003e\n \u003cp\u003e\u003csup\u003eb\u0026nbsp;\u003c/sup\u003eProcured from Himedia\u003c/p\u003e\n \u003cp\u003eMineral premix (g/100g mixture): NaCl, 4.33; MgSO\u003csub\u003e4\u003c/sub\u003e.7 H\u003csub\u003e2\u003c/sub\u003eO, 13.63; NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e. 2H\u003csub\u003e2\u003c/sub\u003eO, 8.67; KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 23.86; Ca(H\u003csub\u003e2\u003c/sub\u003eP O\u003csub\u003e4\u003c/sub\u003e)\u003csub\u003e2\u003c/sub\u003e. H\u003csub\u003e2\u003c/sub\u003eO, 13.51; Fe-Citrate, 2.95; Ca-Lactate, 32.53; AlCl\u003csub\u003e3\u003c/sub\u003e, 0.015; KI, 0.015; CuCl, 0.010; MnSO\u003csub\u003e4\u003c/sub\u003e, 0.080; CoCl\u003csub\u003e2\u003c/sub\u003e, 0.100; cellulose used as carrier. Vitamin premix (mg/ 100g mixture): Thiamin-HCl, 5; riboflavin, 20; pyridoxin-HCl,5; choline chloride, 500; nicotinic acid, 75; calcium pantothenate, 50; inositol, 200; folic acid, 1.5; cyanocobalamine, 0.01; menadione, 4; \u0026alpha;-tocopherol, 40; retinyl acetate, 2000; Cholecalciferol 1000 IU, cellulose used as carrier.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003e2.3. Experimental design\u003c/h2\u003e\n \u003cp\u003eIn present study one hundred and eighty female \u003cem\u003eC. magur\u003c/em\u003e (average weight 145\u0026thinsp;\u0026plusmn;\u0026thinsp;5.0 g) were allocated to twelve cemented tanks with dimensions of 4.5 \u0026times; 2 \u0026times; 1 m for a period of 60 days. Fish were distributed in four groups with three replicates following the completely randomized design. Fifteen fish kept in each cemented tank. The first group treated as control (C) fed with basal diet without melatonin; remaining groups were fed with basal diet having 100, 200 and 300 mg/kg melatonin and treated as T1, T2 and T3 respectively. To maintain the adequate oxygen level aeration was provided in each tank. Fish of each treatment group fed with respective diets upto satiation. Ration was divided in two equal half and given twice a day (morning and evening). To maintain the optimum water quality parameters, water was exchanged fortnightly by opening the valves of tanks. The physiochemical parameters of viz. water temperature, dissolved oxygen and pH were 27\u0026ndash;29 \u003csup\u003eo\u003c/sup\u003e C, 6.2\u0026ndash;7.4 and 7.5\u0026ndash;8.2 respectively throughout the experimental period.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003e2.4. Total RNA isolation and cDNA synthesis\u003c/h2\u003e\n \u003cp\u003eBefore sacrificing, fish were subjected to anaesthesia, by using clove oil (50 \u0026micro;l/L). RNAlater\u0026trade; solution (Qiagen, Netherlands) was used to store samples (liver, n\u0026thinsp;=\u0026thinsp;3) were. For gene expression study, three replicates samples for each treatment were prepared by pooling the liver tissue. About 50 mg liver sample was added in 1 ml of TRIzol (Invitrogen) reagent and total RNA was isolated by following manufacturer\u0026apos;s protocol. NanoDrop spectrophotometer (Thermo Scientific) was used to check the purity and concentration of isolated RNA. Isolated RNA was subjected to DNAse treatment, to avoid the contamination of genomic DNA. DNAse treatment was carried out as per the protocol of manufacturer (Thermo scientific). After DNAse treatment of RNA, it was used as templates for Complementary DNA (cDNA) synthesis (first-strand cDNA synthesis kit (Thermo Scientific). cDNA stored at \u0026minus;\u0026thinsp;20\u0026deg;C for further use or immediately use for q RT PCR analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\n \u003ch2\u003e2.5. Relative quantification of mRNA expression\u003c/h2\u003e\n \u003cp\u003eThe gene expression study was performed in Real time PCR Light Cycler\u0026reg; 480 detection system (Roche, Switzerland). Gene runner software (Version 3.05).was used to design the primer. For the quantification of gene expression, a reaction mixture was prepared by adding following components 10 \u0026micro;l containing 5 \u0026micro;l of 2\u0026times; Maxima\u0026trade; SYBR Green qPCR Master Mix (Thermo Scientific), 1 \u0026micro;l of (5 pmol) gene-specific primer 1 \u0026micro;l of cDNA and remaining nuclease-free water. All the reaction were performed in duplicate. At the end of each PCR reaction the CT (threshold cycle) and melting curve analysis was done, to quantify the fold change of StAR mRNA. The relative StAR mRNA (KJ662668.1) was analysed by using CT value method described by Livak and Schmittgen (\u003cspan class=\"CitationRef\"\u003e2001\u003c/span\u003e) and comparison was made between StAR gene and \u0026beta;-actin (Acc No.-EU527190.2), which was selected as reference gene. The primer sequence is shown in the Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n \u003cp\u003e\u003c/p\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eList of primer sequence used for gene expression study\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAccession number\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026beta;-Actin FP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAAGGTTATGCCCTGCCCCATGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eEU527190.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026beta;-Actin RP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCCTCTCGGCTGTGGTGGTGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFSH- \u0026beta; FP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFTACCCTGTGGCTCTGAGCTGTGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eMF373411.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFSH- \u0026beta; FP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCTGTTGGCTGAGCTGATGTGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLH- \u0026beta; FP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAGCGGACACTGCTTCACCAAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eKM258876.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLH- \u0026beta; RP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCAGGCGAATGGTTTCATAGCGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVitellogenin FP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCAAAGACCTGAACAACTGCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eKJ845350.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVitellogenin RP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACCTTTGTCAGTGGGCTTCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003e\u0026Delta;ct\u0026thinsp;=\u0026thinsp;target gene ct value\u0026thinsp;\u0026minus;\u0026thinsp;reference gene ct value\u003c/p\u003e\n \u003cp\u003e\u0026Delta;\u0026Delta;ct value\u0026thinsp;=\u0026thinsp;\u0026Delta;ct value of treatment group\u0026thinsp;\u0026minus;\u0026thinsp;\u0026Delta;ct value of control group.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003e2.6. Growth parameters\u003c/h2\u003e\n \u003cp\u003eThe growth of fish was measured by weighing the initial and final weight of fish, and the various growth parameters like percentage weight gain (WG %), specific growth rate (SGR), feed conversion ratio (FCR) and protein efficiency ratio (PER) were analysed at the end of the experiment by using the following formulae:\u003c/p\u003e\n \u003cp\u003eWG% = (final wt.-initial wt.) \u0026times; 100/ initial wt.\u003c/p\u003e\n \u003cp\u003eSGR = (Loge final weight - Loge initial weight) \u0026times; 100 /Number of days\u003c/p\u003e\n \u003cp\u003ePER\u0026thinsp;=\u0026thinsp;Weight gain (g)/protein intake (g)\u003c/p\u003e\n \u003cp\u003eFCR\u0026thinsp;=\u0026thinsp;Feed given dry/ weight gain\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003e2.7. Gonado-somatic index and fecundity\u003c/h2\u003e\n \u003cp\u003eThe Gonadosomatic index and fecundity are two key parameters to analyse the reproductive capacity of fish. The ovaries were removed by dissecting the fish and weighed. A small batch of egg separated, weighed and the number of eggs were counted.\u003c/p\u003e\n \u003cp\u003eGSI (%)\u0026thinsp;=\u0026thinsp;Ovary Weight \u0026times; 100/Body Weight\u003c/p\u003e\n \u003cp\u003eFecundity\u0026thinsp;=\u0026thinsp;Number of eggs in 1g of ovary \u0026times; total ovary weight (g)\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e2.8. Histological analysis\u003c/h2\u003e\n \u003cp\u003eThe ovary samples was collected from each treatment groups and fixed in 10% neutral buffer formalin (NBF) for 24 h, dehydrated in 90% alcohol for 1 h and three times in absolute alcohol for 45 min each, separately. The samples were then cleared two times in xylene for 30 min each and embedded in paraffin for 45 min. The samples were then blocked, allowed to cool, cut on a rotary microtome at 5 \u0026micro;m and mounted section were de-waxed in xylene and dehydrated serially in alcohol and then the slides were washed in tap water for 1 min, stained in haematoxylin for 12 min, washed with tap water, dipped in 2% acid alcohol and again washed in tap water. The sections were dehydrated through 50%, 70% and 90% alcohol for 2 min each and stained in eosin for 4 min and dipped in absolute alcohol for 1 min. Finally, the stained sections were cleared in xylene for 5 min and mounted with DPX. Histological sections were observed under an Olympus FSX-100 phase contrast microscope equipped with a canon EOS 500D digital camera and photographs taken.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e2.9. Induced breeding\u003c/h2\u003e\n \u003cp\u003eArtificial breeding was carried out from each treatment for evaluating the reproductive performance of \u003cem\u003eC. magur.\u003c/em\u003e Male and female were selected based on the breeding specific morphological charter for this species as described by Sahoo et al. (2005). Ovatide (Hemmo Pharma, Mumbai, India) was used for induced breeding, the male and female were injected with dose of 0.4 ml and 0.2 ml respectably.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e2.10. Reproductive performance\u003c/h2\u003e\n \u003cp\u003eAfter optimum latency period, which is 14\u0026ndash;17 hr as reported by Sahoo et al (2020). Sperm suspension was prepared by dissecting male and removes the testis and cut into small pieces, squeezed and mixed with physiological saline solution (0.9%). Simultaneously, the stripping of females was carried out and stripped eggs were collected in small clean dry plastic trays. Spermatozoa were activated by adding distilled water and sperm suspension were poured over the stripped eggs and mixed gently by disinfected feather. After mixing eggs were washed with distilled water in order to remove small pieces of testis and ovarian tissue. \u003cem\u003eEichhornia\u003c/em\u003e roots were used for collection of fertilized eggs and shifted to rectangular FRP troughs (1.25\u0026rsquo; x 0.5\u0026rsquo; x0.2\u0026rsquo;m\u003csup\u003e3\u003c/sup\u003e having a fixed water level of 8 cm). Flow through system with water flow 2 lit/hr and aeration were provided in each rectangular FRP troughs. For further analysis of breeding performance a batch of small quantity of eggs were collected to a pre-weighed Petriplate and weighed in an electronic balance. Weight of the fish was taken before and after stripping for estimation of stripped egg weight and spawning fecundity. Spawning fecundity (Total number of stripped out eggs) of each treatment was calculated as per the method described by Hossain and Islam (\u003cspan class=\"CitationRef\"\u003e1990\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e\n \u003ch2\u003e2.10.1. Fertilization rate\u003c/h2\u003e\n \u003cp\u003eThe number of fertilized eggs and fertilization rate was calculated by counting the number of white eggs (unfertilized) and brown eggs (Fertilized). The fertilization rate was calculated by using method given by Dhara and Das (\u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). The fertilization rate was calculated by using the following formula:\u003c/p\u003e\n \u003cp\u003eFertilization rate = (Fertilized Eggs x 100)/Total no. of eggs in the collected egg mass.\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e\n \u003ch2\u003e2.10.2. Hatching rate\u003c/h2\u003e\n \u003cp\u003eThe eggs attached with the root of \u003cem\u003eEichhornia\u003c/em\u003e were hatched out within 24\u0026ndash;28 hrs. The number of hatchling and hatching rate was calculated by the method described by Dhara and Das (\u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eHatching rate = (Total number of hatchlings x 100)/Total no. of eggs released in a tray\u003c/p\u003e\n \u003c/div\u003e\n \u003cdiv id=\"Sec15\" class=\"Section3\"\u003e\n \u003ch2\u003e2.10.3. Larval and fry rearing\u003c/h2\u003e\n \u003cp\u003eHatchling was reared in inflow-through system upto 4 day. Larvae were fed with mixed zooplankton (dominated by Moina sp.) @ 20 ml per trough (500 No./ml ) after yolk absorption to till 10 days of post hatch. The larval survival was evaluated as per method described by Srivastava et al (\u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e). Fry rearing was carried out at Magur fry rearing unit of a freshwater farm of ICAR-CIFE, Kakinada Centre, Balbhadrapuram. Rearing of 15 days old larvae were carried out in eight rectangular FRP tanks with dimension 6\u0026rsquo; x 2\u0026rsquo; x1.5\u0026rsquo;, the 15 days dhp were distributed in eight rectangular FRP tanks in duplicates @ 4 No./lit. Fry were fed with mixed zooplankton (dominated by Moina sp.) and artemia flakes (7%). Fry survival was estimated as per the method given by Sahoo et al (\u003cspan class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003e2.11. Statistical analysis\u003c/h2\u003e\n \u003cp\u003eAll the data after analysing the normality and homogeneity of the variance were statistically analysed by one-way analysis of variance (ANOVA). The results were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. In one-way ANOVA, the post hoc analysis was performed using Duncan\u0026apos;s multiple range test (DMRT) to determine the level of significance among means. The significance level of means was observed at 5% probability level (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Growth Performance\u003c/h2\u003e \u003cp\u003eIn present study, growth performance parameters such as percentage weight gain (WG %), specific growth rate (SGR), feed conversion ratio (FCR) were calculated at the end of experimental trial and growth performance data depicted in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. There was no significant difference in weight gain between control and T1 group while, it was decreased significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in medium (T2) and higher melatonin (T3) supplemented groups. Similarly, the SGR also decreased with increasing melatonin level in the diet of \u003cem\u003eC. magur\u003c/em\u003e, when compared to the control group. The FCR was lowest in control group and there was no significant difference between control and T1 group, however it was highest in T3 group followed by T2 group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGrowth performance of \u003cem\u003eC. magur\u003c/em\u003e broodstock fed with different levels of melatonin\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eInitial weight\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e140\u0026thinsp;\u0026plusmn;\u0026thinsp;4.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e141.26\u0026thinsp;\u0026plusmn;\u0026thinsp;4.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e140.72\u0026thinsp;\u0026plusmn;\u0026thinsp;3.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e141.37\u0026thinsp;\u0026plusmn;\u0026thinsp;3.72\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWG%\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e47.06\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48.13\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e41.32\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;2.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e37.50\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFCR\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.07\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.28\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04055\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.86\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.68\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSGR\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.59\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.74\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.45\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.33\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.002\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePER\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.93\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.98\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.79\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.50\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eValues are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE, Main effect means followed by the different superscript letters in the same row are significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). WG: Weight gain (gram), FCR: Food conversion ratio SGR: Specific growth rate; PER: Protein efficiency ratio. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Gonadosomatic Index and Fecundity\u003c/h2\u003e \u003cp\u003eIn the present study, GSI and fecundity were calculated at one month interval. During the initial sampling (I sampling, before starting the feeding trial) the GSI and fecundity was lowest and there was no significant (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) difference in all treatment groups. At II sampling (May, after one month feeding trial), there was a significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in both GSI and fecundity between control and treatment groups. In T1 group, both GSI and fecundity were significantly higher as compared to the control group, while in T2 and T3 groups, GSI and fecundity decreased significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) when compared to the control group. However, there was no significant difference between T2 and T3 groups in term of GSI and fecundity at II sampling. At the last sampling (III sampling, June, before breeding) the highest GSI and fecundity was reported in T1 group followed by control group while lowest GSI and fecundity were reported in T3 group followed by T2 group. At the III sampling, there was a significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in both GSI and fecundity between T2 and T3 groups. The GSI and fecundity is depicted in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMonthly changes in GSI and fecundity of \u003cem\u003eC. magur\u003c/em\u003e female broodstock fed with different levels of dietary melatonin\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGSI\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eI sampling\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eII sampling\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eIII sampling\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.34\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14.29\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.49\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e14.92\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.79\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e17.06\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.68\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.95\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14.07\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11.19\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12.59\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eP value\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFecundity\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2205.23\u0026thinsp;\u0026plusmn;\u0026thinsp;107.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e9986.11\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;352.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12252.01\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;281.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT1\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2316.00\u0026thinsp;\u0026plusmn;\u0026thinsp;107.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11107.71\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;476.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e14035.65\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;611.94\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT2\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2155.23\u0026thinsp;\u0026plusmn;\u0026thinsp;107.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8370.16\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;265.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10098.46\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;435.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eT3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2035.23\u0026thinsp;\u0026plusmn;\u0026thinsp;107.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8299.43\u003csup\u003ecd\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;352.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8191.31\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;281.25\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eP value\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eValues are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE, Main effect means followed by the different superscript letters in the same column vary significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Hepato-Somatic Index (HSI)\u003c/h2\u003e \u003cp\u003eThe HSI, of different experimental group was calculated at the end of experiment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). There was decreasing trend observed in HSI with increase in the concentration of melatonin in the diet of \u003cem\u003eC. magur.\u003c/em\u003e The highest HSI was reported in T1 group and there was no significant difference (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) observed in control and T1 group. The lowest HSI was recorded in T3 group compared to the control group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Gonadotropin Gene Expression\u003c/h2\u003e \u003cp\u003eThe gonadotropin gene expression was checked in pituitary gland of \u003cem\u003eC. magur\u003c/em\u003e female broodstock fed with different levels of melatonin. Three sampling were carried out to see the effect melatonin on gonadotropin gene expression in \u003cem\u003eC. magur\u003c/em\u003e. At the beginning of experiment (I sampling, April), there was no significant difference (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) in both FSH and LH mRNA expression. At I sampling, the expression of gonadotropins gene was at lowest level. After one month of feeding trial II sampling (May) was carried out. At II sampling, there was increasing trend observed in FSH m RNA expression and it was significantly higher (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in T1 group followed by control group while, in T2 and T3 group expression levels decreased as compared to the control group The last sampling i.e III sampling (June) was carried out before the breeding of \u003cem\u003eC. magur\u003c/em\u003e and it was reported that FSH decreased in all the treatment groups. The lowest FSH expression level was observed in T2 and T3 groups compared to the control group.\u003c/p\u003e \u003cp\u003eAt I sampling, the LH m RNA expression did not vary significantly in all groups, However, it was increased at the II and reached to peak value at III sampling, when fish approached the breeding season. The highest LH m RNA expression was recorded at III sampling (June). At III sampling, the LH mRNA expression was significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) higher in T1 group followed by control group. On the other hand, LH expression decreased in both T2 and T3 groups as compared to the control group. The mRNA expression levels of both gonadotropins are shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.6. Vitellogenin Gene Expression\u003c/h2\u003e \u003cp\u003eThe Vtg m RNA was checked in liver of \u003cem\u003eC. magur\u003c/em\u003e fed with graded levels of melatonin. The vitellogenin m RNA expression profile was shown Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. There was no significant difference in Vtg mRNA expression at I sampling in all treatment groups and it was lowest at I sampling (April). After one month of feeding trial (II sampling), Vtg m RNA increased in all treatment groups, and it was highest in T1 group as compared to the control group. At II sampling the Vtg m RNA expression was decreased significantly (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) in both T2 and T3 groups and lowest expression was reported in T3 group compared to the control group The last sampling was carried out before breeding (III), Vtg m RNA expression decreased in all groups but the lowest expression was found in T2 and T3 groups compared to the control group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Antioxidant Enzymes\u003c/h2\u003e \u003cdiv id=\"Sec24\" class=\"Section3\"\u003e \u003ch2\u003e3.7.1. Superoxide Dismutase Enzyme Activity\u003c/h2\u003e \u003cp\u003eIn the present study, SOD activity was measured in liver, muscle, ovary and ovulated eggs of \u003cem\u003eC. magur\u003c/em\u003e fed with graded levels of melatonin (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The significant higher (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) SOD activity was reported in liver and ovary of T3 group followed by T2 group. However, the lowest SOD activity was reported in liver and ovary of T1 group as compared to the control group. There was no significant difference (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) observed in muscle SOD activity of all treatment groups. The ovulated eggs of T1 group showed the lowest SOD activity compared to the control group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of melatonin on SOD enzymes activity in \u003cem\u003eC. magur\u003c/em\u003e fed with different levels of melatonin\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP Value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSOD (Muscle)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.41\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSOD (liver)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.93\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.54\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7.31\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.87\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e11.94\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;1.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSOD (Ovary)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.65\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.58\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.041\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2.57\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.43\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.059\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSOD (ovulated eggs)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.41\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.61\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8.59\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e10.13\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eValues are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. Main effect means followed by the different superscript letter in same row are significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). SOD activity is expressed as 50% inhibition of epinephrine auto oxidation/mg protein/min. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg).\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003e3.7.2. Catalase Activity Enzyme Activity\u003c/h2\u003e \u003cp\u003eThe catalase activity was measured in liver, muscle, ovary and ovulated eggs of \u003cem\u003eC. magur\u003c/em\u003e fed with different levels of melatonin. The catalase activity in liver and ovary followed similar trend as SOD activity. There was a significant (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) higher catalase activity observed in T2 and T3 group in ovulated eggs The lowest catalase activity was reported in T1 group compared to the control group The catalase activity in liver, muscle, ovary and ovulated eggs are shown in Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEffect of melatonin on catalase enzymes activity in \u003cem\u003eC. magur\u003c/em\u003e fed with different levels of melatonin\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP Value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCatalase (Muscle)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.39\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e4.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.13\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCatalase (liver)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.52\u003csup\u003ecd\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.13\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.39\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12.40\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCatalase (ovary)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.60\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.49\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.43\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e7.57\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCatalase Ovulated egg\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7.56\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.65\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e9.59\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e12.55\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eValues are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. Main effect means followed by the different superscript letter in the same row are significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Catalase activity expressed as Nano moles H2O2 decomposed/min/mg protein. C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003e3.7.3. Glutathione Peroxidase Enzyme Activity\u003c/h2\u003e \u003cp\u003eIn the present study, Gpx activity was measured in the liver, muscle, and ovary and ovulated egg of \u003cem\u003eC. magur\u003c/em\u003e fed with melatonin (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The Gpx activity was increased in liver, ovary and ovulated egg with increasing the melatonin concentration in the diet of \u003cem\u003eC. magur\u003c/em\u003e, while in muscle, there was no significant difference observed inT2 and T3 groups. The highest Gpx activity was reported in the liver and ovary of T3 group followed by T2 group. In ovulated eggs, the lowest Gpx activity was found in T1 group compared to the control group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGpx activity of \u003cem\u003eC. magur\u003c/em\u003e female broodstock fed with different levels of melatonin\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGpX (muscle)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.23\u0026thinsp;\u0026plusmn;\u0026thinsp;0.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.59\u0026thinsp;\u0026plusmn;\u0026thinsp;0.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.290\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGpX (liver)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6.17\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5.05\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6.96\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.37\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGPX (Ovary)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.26\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.17\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.52\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e8.22\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGpX (ovulated eggs)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.40\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.68\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.63\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e5.55\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eValues are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE. Main effect means followed by the different superscript letter in the same column are significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Glutathione peroxidase activity expressed as unit/mg protein/min (unit-decrease in Log GSH by 0.001/min/mg protein). C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003e3.7.4. Glutathione- S-transferase Enzyme Activity\u003c/h2\u003e \u003cp\u003eIn the present study, GST activity also measured in liver and ovary of \u003cem\u003eC. magur\u003c/em\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The GST activity was highest in the liver and ovary of T3 group followed by T2 group, while there was no significant difference in GST activity of T1 and control groups. In ovary, the lowest GST activity was found in T1 group while there was no significant difference in T2 and T3 group compared to the control group.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003e3.8. Histology of Ovary\u003c/h2\u003e \u003cp\u003eThe histological study of \u003cem\u003eC. magur\u003c/em\u003e showed that number of atretic oocytes increases in higher melatonin (T3) supplemented group however at lower dose (T1) ovary is dominated by mature oocyte and few oocytes were at Primary yolk stage (PYS), Secondary yolk stage (SYS) at III sampling. In present study, ovarian histological section of lower dose melatonin (T1 group) showed the oocytes at dominancy of Primary yolk stage (PYS), Secondary yolk stage (SYS) and few oocytes were at Tertiary yolk stage (TYS) at II sampling while at III sampling number of mature oocytes increased significantly, few oocytes were in Secondary yolk stage (SYS). The medium dose of melatonin (T2) inhibited the development of oocytes, ovary of medium group (T2) group showed the oocytes at Secondary yolk stage (SYS) and atretic oocytes also reported, no mature oocyte were reported at II sampling, while at III sampling number of mature oocytes increased along with Perinucleolar stage follicles (PNS). In T3 group (high melatonin supplemented group) showed the maximum oocytes Secondary yolk stage (SYS) with few mature oocyte, the number of atretic oocytes were also reported at II sampling, however at III sampling number mature oocytes along with Secondary yolk stage (SYS) increased while number of atretic oocytes also increased significantly (Plate 1\u0026ndash;9).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003e3.9. Reproductive Performance of \u003cem\u003eC. magur\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eAt the end of feeding trial, induced breeding trial was conducted to evaluate the effect of different levels of melatonin on reproductive performance of \u003cem\u003eC. magur.\u003c/em\u003e Reproductive performance was evaluated by fertilization rate, hatching rate, larval survival and fry survival in different experimental diets of melatonin in \u003cem\u003eC. magur\u003c/em\u003e.\u003c/p\u003e \u003cdiv id=\"Sec30\" class=\"Section3\"\u003e \u003ch2\u003e3.9.1. Fertilization Rate\u003c/h2\u003e \u003cp\u003eIn the present study, fertilization rate decreased with increasing melatonin supplementation. The fertilization rate was significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) higher in T1 group compared to other groups. While it was reduced in both T2 and T3 groups (Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e)\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab8\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 8\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReproductive performance of \u003cem\u003eC. magur\u003c/em\u003e fed with different dose of melatonin\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eT1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eT2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eT3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eP Value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSpawning fecundity\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8042.08\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;516.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12427.54\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;626.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7176.33\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;425.55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e6150.19\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;318.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFertilized eggs\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5860.10\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;152.56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e10685.19\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;376.48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4443.85\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;274.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3001.92\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;376.46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eNo of hatchlings\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3955.00\u003csup\u003eb\u003c/sup\u003e. \u0026plusmn; 143.21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e8908.56\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;381.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2157.97c\u0026thinsp;\u0026plusmn;\u0026thinsp;155.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e719.81\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;61.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal no. of fry\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1528.00\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;54.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4512.33\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;159.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e523.58\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;24.75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.31\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;2.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFertilization rate\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e72.86\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;3.61\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e85.98\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;8.32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e61.92\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;5.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e48.81\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;3.12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHatching rate\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e67.48\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;2.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e83.35\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;4.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e48.53\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;3.83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e23.95\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;2.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLarval survival\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e61.87\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;3.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e78.12\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;4.18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e55.75\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;2.95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e28.54\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;1.41\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eFry survival\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e67.46\u003csup\u003eb\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;2.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e83.06\u003csup\u003ea\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;3.17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e55.20\u003csup\u003ec\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;1.84\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e14.86\u003csup\u003ed\u003c/sup\u003e\u0026thinsp;\u0026plusmn;\u0026thinsp;1.92\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eValues are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE, Main effect means followed by the different superscript letters in the same row are significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). C (0 mg/kg melatonin); T1 (melatonin 100 mg/Kg); T2 (melatonin 200mg/Kg); T3 (melatonin 300mg/Kg)\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003e3.9. 2. Hatching Rate\u003c/h2\u003e \u003cp\u003eIn the present study, it was found that there was significant difference in hatching rate of \u003cem\u003eC. magur\u003c/em\u003e fed with different levels of melatonin (Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The highest hatching rate was reported in T1 group and lowest hatching rate was reported in higher melatonin supplemented group (T3).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003e3.9. 3. Larval and Fry Survival\u003c/h2\u003e \u003cp\u003eIn present experiment, it was found that larva and fry survival increased significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in the T1 group compared to the control group (Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The larval and fry survival decreased with the increase in the dietary melatonin supplementation. Larval and fry survival were decreased significantly (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) in T2 and T3 groups compared to the control group.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cdiv id=\"Sec34\" class=\"Section2\"\u003e \u003ch2\u003e4.1. Growth Performance of \u003cem\u003eC. magur\u003c/em\u003e Fed with Melatonin\u003c/h2\u003e \u003cp\u003eIn the present study, it was found that continuous supplementation of melatonin in the diet of \u003cem\u003eC. magur\u003c/em\u003e brooder leads to decreased growth performance. The low dose (T1) showed similar percentage weight gain and SGR with control while, in medium and high dose, the growth performance decreased. Similarly, Singh et al. (\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) reported that melatonin supplementation decreased SGR compared to control; however, Aripin et al. (2015 a) reported that there was no significant difference in weight gain in control and melatonin treated \u003cem\u003eClarias Macrocephalus\u003c/em\u003e Broodstock. The reduction of weight gain in melatonin treatment groups might be due to the decrease in feeding intake. The finding of the present study is supported by the earlier reports of Lopez et al. (2006) and De Pedro et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), who concluded that reduction of body weight of gold fish was due to the reduction of food intake. In most of the vertebrates, melatonin was reported in the gastrointestinal tissues and it perform various functions such as metabolite secretion and regulation, protection of mucosa and digestive motility Bubenik (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Bubenik et al. (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2000\u003c/span\u003e) reported that during fasting and feeding GIT melatonin increases and it play an important role in feeding regulation. In present study it was reported that lower dose of melatonin having positive effects on growth performance in \u003cem\u003eC. magur\u003c/em\u003e. The current study corroborated with previous finding of Aarseth et al (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), who concluded that melatonin affects the body mass and condition factor of Arctic charr, \u003cem\u003eSalvelinus alpines\u003c/em\u003e. Intra-peritoneal injection of melatonin under short photoperiod in gold fish resulted in increased growth and weight gain (De Vlaming \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1980\u003c/span\u003e). In Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e), implantation of melatonin increased growth (Porter et al.1998), while, reduced weight gain in trout \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e (Taylor et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec35\" class=\"Section2\"\u003e \u003ch2\u003e4.2. Gonadosomatic Index and Fecundity\u003c/h2\u003e \u003cp\u003eIn the current experiment, GSI and fecundity increased in the group fed with low dose of melatonin while increasing the concentration of melatonin in the diet of \u003cem\u003eC. magur\u003c/em\u003e female brooder resulted in decreased GSI and fecundity. The present study is supported by Aripin et al. (2015 a) they reported that melatonin treatment increased GSI and fecundity of C. macrocephalus at optimal dose. Similar results have been documented in rat, salmon, Channa punctatus, zebrafish and Japanese medaka. Amano et al.(2000) reported a positive effect of melatonin and found that GSI of Male Masu Salmon was increased after melatonin treatment. In the present study, low dose of melatonin increased GSI and fecundity of \u003cem\u003eC. magur.\u003c/em\u003e Similarly, Carnevali et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) reported that melatonin significantly affected fecundity of zebra fish and it increases the number of ovulated eggs and they also suggested the possible reason of that might be due to change in Cox2A gene expression. Renuka and Joshi (2005) reported that continuous exposure of melatonin increased GSI of Channa punctatus concomitant with an increase in vitellogenic follicle in ovary. In the present study, higher supplementation of melatonin reduced GSI in \u003cem\u003eC. magur\u003c/em\u003e. Similarly, Ghosh and Nath (2000) reported the inhibitory role of melatonin on GSI of \u003cem\u003eC. batrachus\u003c/em\u003e. Ghosh and Nath (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) reported that melatonin exert the variable effect (inhibitory and/or no effect) on GSI of C. batrachus. The effect of melatonin is dependent upon method of administration, dose, time and duration of treatment (Zachmann et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e1992\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec36\" class=\"Section2\"\u003e \u003ch2\u003e4.3. Hepatosomatic Index (HSI)\u003c/h2\u003e \u003cp\u003eIn the present study, HSI was measured at the end of experiment. The HSI was decreased with increasing melatonin concentration in the diet of \u003cem\u003eC. magur.\u003c/em\u003e This result is supported by Alvarado et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), who found that melatonin supplementation decreased HSI in male sea bass during spermatogenesis. Previous study suggested that melatonin has a role in energy homeostasis of fish (Pinillos et.al.2001:. Amano et al.2004) Melatonin also exhibited anorexic action in sea bass as suggested by Alvarado et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In the present study, melatonin at higher concentration inhibited the growth of \u003cem\u003eC. magur\u003c/em\u003e compared to the control group In fact, it was reported by several researchers that melatonin reduced food intake and digestive process in fish (Amano et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2004\u003c/span\u003e: Taylor et al. \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; L\u0026oacute;pez-Olmeda et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; De Pedro et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Handeland et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Hence, the decreased HSI might be the result of decreased food intake and subsequent reduction of hepatic energy stores.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec37\" class=\"Section2\"\u003e \u003ch2\u003e4.4. Gonadotropin Gene Expression\u003c/h2\u003e \u003cp\u003ePineal gland in fish secretes melatonin under darkness. Pineal gland secretes melatonin hormone to the blood and it act over the hypothalamo\u0026ndash;hypophyseal\u0026ndash;gonadal axis and regulate the development of oocytes (Maitra and Hasan \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In the present study, effect of melatonin in \u003cem\u003eC. magur\u003c/em\u003e on gonadotropin gene expression was evaluated and it was found that melatonin supplementation inhibited the gonadotropin gene expression in pituitary gland at medium and higher (T2 and T3 groups) concentration of melatonin. Kim et al.2018 reported that melatonin inhibit the GnRH and GTH expression through increasing the GnIH, when injecting melatonin intra-peritonial in tilapia, they concluded that melatonin suppress the hypothalamus-pituitary-gonad (HPG) through the GnIH. In various vertebrates, the relationship between melatonin and GnRH is well documented. The melatonin administration led to inhibit the expression of GnRH-1, GnRH-3 and GnRH receptors in European sea bass (\u003cem\u003eDicentrachus labrax\u003c/em\u003e) (Servili et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Similarly in male masu salmon, melatonin inhibited the gonadal development by suppressing GnRH and GTH (Amano et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). In the present study, there was a dose dependent effect observed on FSH and LH gene expression, by increasing the concentration of melatonin, both FSH and LH decreased significantly. In a recent study conducted by Carnevali et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), zebrafish was exposed to different doses of melatonin and observed a dose dependent effect on kiss1, kiss2 and gnrh3 gene expression in the brain and of LH β in the pituitary. In contrast, implantation of melatonin decreased both FSH and LH m RNA expression without affecting the GnRH gene expression in \u003cem\u003eEuropean eel\u003c/em\u003e (S\u0026eacute;bert et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Exogenous treatment of melatonin in cultured\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec38\" class=\"Section2\"\u003e \u003ch2\u003e4.5. Vitellogenin Gene Expression\u003c/h2\u003e \u003cp\u003eVitellogenin (glycolipophosphoprotein) is chief egg yolk precursor protein synthesized by the liver in the influence of estradiol and it is prerequisite process of oocyte growth and it takes place during the oogenesis (Wallace and Selman \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e1981\u003c/span\u003e; Sawaguchi, et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). The synthesis of vitellogenin depends upon estradiol level which depends on gonadotropin (FSH). In present study, the highest Vtg mRNA expression was reported in T1 group followed by control group, while in T2 and T3 group Vtg mRNA expression decreased as compared to the control group at II sampling. It might be due to increased FSH level and it was highest at II sampling (May) suggesting that vitellogenesis peaks during this stage. This was also confirmed by the Vtg m RNA expression at II sampling. Similarly, the lowest dose melatonin supplemented group showed highest FSH concomitant with highest Vtg m RNA expression. Also, higher dose of melatonin inhibited gonadotropin expression and inhibited Vtg m RNA expression in \u003cem\u003eC. magur.\u003c/em\u003e Our results are in agreement with Carnevali et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) who also reported that melatonin treatment resulted to increase in the gene and protein of vitellogenin and estradiol receptor in the liver of zebrafish. Similarly, Renuka and Joshi (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) found higher proportion of vitellogenic follicles after melatonin treatment (via water for 24hr) in \u003cem\u003eChanna punctatus\u003c/em\u003e. Mondal et al. (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) reviewed the possible role of melatonin on vitellogenesis; melatonin may directly act on liver and regulate vitellogenesis, after that it stored into to mature follicle. The higher dose of melatonin in both sexes of \u003cem\u003eGasterosteus aculeatus\u003c/em\u003e led to an antigonadal effect while low dose induced progonadal effect under long photoperiod (Borg and Ekstr\u0026ouml;m \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1981\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec39\" class=\"Section2\"\u003e \u003ch2\u003e4.6. Antioxidant Enzymes Activities\u003c/h2\u003e \u003cp\u003eIt is well documented that melatonin not only act as hormone but also as a potent free radical scavenger and antioxidant (Reiter \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Due lipophilic nature, melatonin easily crosses cell membrane and work as antioxidant by scavenging free radicals. In the present study, antioxidant enzymes such as SOD, Catalase, GpX and GST were measured after supplementation of graded levels of melatonin in the diet of \u003cem\u003eC. magur.\u003c/em\u003e It is reported that melatonin has antioxidant, anti-inflammatory and anti-apoptotic property that is beneficial for treating reproductive abnormalities (Chowdhury, and Haldar \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). SOD is class of important enzyme which is involved in breakdown of superoxide free radical into H2O2 (Gupta et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Gupta et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In the present study, SOD activity was highest in liver, muscle and ovary of highest melatonin supplemented group. In ovulated eggs, SOD activity was highest in control group while lowest activity was reported in the low dose melatonin group. The highest SOD activity in control group might be due to generation of high quantity of ROS. During the steroidogenesis, the developing oocytes produce huge quantity of free radicals mainly nitrogen species (RNS) and reactive oxygen species (ROS) (Agarwal et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Agarwal et al.(2012) reported that during meiotic maturation of oocyte plenty of free radicals are generated and accumulated which produce oxidative stress in developing oocytes and prevent cell division. Melatonin level in oocytes increased during the follicular growth and ovulation (Nakamura et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Tamura et al.2013). Tamura et al. (\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) reported that melatonin plays an important role in protecting oocytes from the harmful effect of ROS. Similarly, Reiter et al. (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2000\u003c/span\u003e) reported that melatonin in ovarian follicle activate major antioxidant defence enzymes such as superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) and reduce oxidative stress in vivo condition.. The direct and indirect action of melatonin on free radical scavenging activity might have reduced the SOD activity in all tissues of the group fed with low dose of melatonin; this might be possible reason of decreased antioxidant enzymes activities in at lower dose of melatonin. Tan et al. (\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2002\u003c/span\u003e) found that due to the amphiphilic nature of melatonin it can cross the cellular barrier and directly scavenger of free radicals as well as promotes indirectly to the oxidative stress enzyme. Melatonin prevent ovary from damage by minimizing free radical and improve the oocytes quality (Reiter et al \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2013\u003c/span\u003e0). In the present study, SOD activity increased with increasing melatonin. Similar result was reported in human model by Şirinyıldız et al.(2021) they reported that both SOD and catalase enzyme activities increases with increasing melatonin administration.\u003c/p\u003e \u003cp\u003eIn the current experiment, Catalase and Gpx activity were also measured in liver, muscle and ovary. Catalase and Gpx followed same trend as SOD. In the present study, catalase activity was highest in liver, muscle and ovary of groups fed with melatonin. High catalase activity in control group might be due to generation of more ROS than the other groups. High ROS production might have resulted in the production of H2O2 by the SOD hence catalase activity increased significantly to prevent cell damage by ROS. GpX activity follow similar trend as catalase activity. Melatonin reduces the oxidative stress during the growth, development and maturation of oocytes (Hasan et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Melatonin reduces oxidative stress by two process i.e it act as direct scavenger of free radical as well as antioxidant (Reiter et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). The decrease in SOD, catalase and GPx activity might be due to melatonin, as it is reported that melatonin inhibited free redical (\u0026bull;OH radicals) and converts H2O2 in to singlet oxygen (İkbal et al.2009). Similarly, Gonenc et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) also reported increased GPx activity after administration of melatonin. In the present study, SOD, Catalase and Gpx activity reduced in group fed with low dose group melatonin. However, with increasing concentration of melatonin in the diet, all antioxidant enzyme activities increased significantly. Hence, it is clearly indicated that lower dose of melatonin exhibited beneficial role in \u003cem\u003eC. magur\u003c/em\u003e. Similarly, Subramanian et al.(2007) reported that melatonin at pharmacological amount reduced oxidative stress in brain and liver of rat.\u003c/p\u003e \u003cp\u003eReiter et al. (1996) concluded that melatonin act as a powerful antioxidant and it is superior to glutathione in term of neutralizing free radical. It also protects cell membrane from oxidative damage more effectively than vitamin E. In the present study, GST activity also measured in liver and ovary of \u003cem\u003eC. magur.\u003c/em\u003e GST activity was highest in the liver and ovary of higher dose melatonin supplementation. The present finding was supported by Świderska-Kołacz et al. (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) who reported that melatonin increased GST activity in the liver of mouse. In Catla, melatonin supplementation increased GST activity (Bhattacharya et al.2007).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec40\" class=\"Section2\"\u003e \u003ch2\u003e4.7. Ovarian Histology\u003c/h2\u003e \u003cp\u003eMelatonin (MT) not only regulate the body\u0026rsquo;s seasonal and circadian rhythms; but also delay ovarian senescence, regulate ovarian biological rhythm, promote follicles formation, and improve oocyte quality and fertilization rate (Guo et al.2021).\u003c/p\u003e \u003cp\u003eIn present study, ovarian histological section of lower dose melatonin (T1 group) showed the oocytes at dominancy of Primary yolk stage (PYS), Secondary yolk stage (SYS) and few oocytes were at Tertiary yolk stage (TYS) at II sampling while at III sampling number of mature oocytes increased significantly, few oocytes were in Secondary yolk stage (SYS). The present study is supported by the result of Renuka and Joshi (\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) they reported that number of vitellogenic oocytes increased when \u003cem\u003eChanna punctatus\u003c/em\u003e continuously exposed to melatonin and reduced the number of atretic oocyte in the ovary Maitra et al. (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) reported that the dose (50-100mg/100 g body weight) induced maturation of oocytes in Catla at preparatory phase, while no effect at pre-spawning and spawning phase. Carnevali et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) reported that melatonin increases the germinal vesicle break down (GVBD) stage in zebrafish. In present study it was reported that medium dose (T2) and higher dose (T3) inhibited the Tertiary yolk stage oocyte and promote the atresia in the oocytes. Similarly Imamura et al (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) reported the inhibitory effect of melatonin Sapphire Devil fish; they found the atresia and arrest of recruitment in vitellogenic oocytes in melatonin treat fish. Singh et al.(2012) also reported the inhibitory effect to melatonin in Tilapia, the number of perinucleolus stage oocytes were dominant in melatonin treated fish as compared to control group. In present study dose dependent effect of melatonin was reported on oocytes development in \u003cem\u003eC. magur.\u003c/em\u003e The present finding is supported by Panchal and Rani.(2019) they reported that atretic oocytes increased with increasing the melatonin administration in \u003cem\u003eHeteropneustes fossilis.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec41\" class=\"Section2\"\u003e \u003ch2\u003e4.8. Reproductive Performance of \u003cem\u003eC. magur\u003c/em\u003e Fed with Melatonin\u003c/h2\u003e \u003cp\u003eIn the present experiment, reproductive performance was evaluated at the end of experiment (July). Reproductive performance was evaluated by fertilization rate, hatching rate, larval survival and fry survival in different experiment of melatonin in \u003cem\u003eC. magur.\u003c/em\u003e In the present study, fertilization rate decreased with increasing melatonin supplementation. The highest fertilization rate was reported in lowest melatonin supplemented group. The present work is supported by previous findings that melatonin has positive role on oocytes quality and fertilization rate (Nakamura et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Nakamura et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Tamura et al. (\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) reported that melatonin improved quality of oocytes as well as fertilization rate. It might be due to the antioxidant property of melatonin, which protects oocytes from oxidative stress and aging as well (Reiter \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Melatonin is also present in ovarian follicular fluid and provide beneficial role in oocyte maturation, fertilization, and embryo development (Tamura et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Aprin et al. (2015 a) reported there was no significant difference in fertilization rate after supplementation of melatonin in \u003cem\u003eC. macrocephalus\u003c/em\u003e. The present findings demonstrated that lower dose of melatonin stimulated fertilization rate in \u003cem\u003eC. magur\u003c/em\u003e by ROS scavenging action. Similarly, Ishizuka et al. (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) reported that fertilization rate and early development of embryo is supported by ROS scavenging action of melatonin. Nishihara et al. (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) reported that oral supplementation of melatonin in women support fertilization as well the quality of embryo.\u003c/p\u003e \u003cp\u003eIn the present study, it was found that there was a significant difference in hatching rate of \u003cem\u003eC. magur\u003c/em\u003e fed with different levels of melatonin. The highest hatching rate was reported in the group fed with lowest levels of melatonin. Danilova et al.(2004) reported that hatching of zebra fish embryo depends on the concentration of melatonin. Tamura et al. (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) found that melatonin was present inside the follicular fluid and oocytes; the role of this stored melatonin is to protect the cells during the oxidative stress and support oocyte maturation, fertilization and development of growing embryo. Similarly, the intra-ovarian melatonin reduced the oxidative stress and enhances the ovarian function during spawning of carp (Hasan et al \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In the present experiment, it was found that larva and fry survival increased significantly in the group fed with lowest levels of melatonin. Larval and fry survival was decreased by increasing the melatonin supplementation in the diet of \u003cem\u003eC. magur.\u003c/em\u003e Low dose of melatonin enhanced survival of larval and fry of \u003cem\u003eC. magur\u003c/em\u003e, which might be due to the decreasing oxidative stress by maternal melatonin, which enhances the embryo development. Tamura et al. (\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) reported that melatonin improved the quality of oocytes. Melatonin increased larval survival in \u003cem\u003eClarias macrocephalus\u003c/em\u003e (Aripin et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2015a\u003c/span\u003e). Melatonin enhanced the cell proliferation and development of embryonic tissues in dose dependent manner in one day old larvae of zebra fish, hence accelerating their development Danilova et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Melatonin induced cell proliferation and differentiation process in zebra fish, when growth hormone and prolactin supply is not sufficient Danilova et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). During spawning season, the intra-ovarian melatonin concentration is five times more than that measured during post spawning in carp ovary (Hasan et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The increase in larval and fry survival might be due to the increase the quality of oocyte in term of GSI, fecundity and other reproductive genes, which are vital factors for successful bloodstock maturation. The exogenous supplementation of melatonin influence larval growth and weight and the effect depends on the dose of exogenous melatonin (Mhalhel et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). On the other hand, caudal fin complex abnormalities in gilthead seabream were reported by exogenous supplementation and these abnormalities are dose dependent with exogenous melatonin (Mhalhel et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Supplementation of melatonin @ 100 mg/kg diet in \u003cem\u003eC .magur\u003c/em\u003e significantly improved reproductive performance in term of fry and larval survival.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthics Statement\u003c/h2\u003e \u003cp\u003eThe research undertaken complies with the current animal welfare laws in India, and the use of animals in this study was in accordance with the guidelines of the CPCSEA (Committee for the Purpose of Control and Supervision of Experiments on Animals), Ministry of Environment \u0026amp; Forests (Animal Welfare Division), Govt. of India on care and use of animals in scientific research. The study was undertaken with the approval of statutory authorities of the Central Institute of Fisheries Education, Mumbai, India (University under Sec.3 of University Grants Commission Act and ISO 9001:2008 certified).\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eConflicts of Interest\u003c/h2\u003e \u003cp\u003eThere is no conflict of interest for the publication of this manuscript, among the Authors\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003ePrem Prakash Srivastva designed and conceptualization of research work, checked the results, interpreted them and manuscript correction.Gyandeep Gupta experimental setup, sample collection, data analysis and preparation of manuscript.Munish Kumar helped in sample collection and statistical analysis. Tincy Varghese helped in manuscript writing and correction Thongam Ibemcha Chanu checked and revised the manuscript. Subodh Gupta helped in analysis. Muralidhar P. Ande checked and revised the manuscript and helped in conducting experiment at ICAR-CIFE, Kakinda, Andhra Pradesh, India. All of the authors read and approved the final manuscript\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe Authors are grateful to the Director, ICAR-Central Institute of Fisheries Education (Deemed University), Mumbai, for providing necessary facilities and funding for carrying out the research work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAarseth JJ, Fr\u0026oslash;iland E, J\u0026oslash;rgensen EH (2010) Melatonin implantation during spring and summer does not affect the seasonal rhythm of feeding in anadromous Arctic charr (\u003cem\u003eSalvelinus alpinus\u003c/em\u003e). \u003cem\u003ePolar Biol.\u003c/em\u003e, 33: 379-388.\u003c/li\u003e\n \u003cli\u003eAgarwal A, Aponte-Mellado A, Premkumar BJ, Shaman A, Gupta S (2012) The effects of oxidative stress on female reproduction: a review. \u003cem\u003eReprod. biol. endocrinol.\u003c/em\u003e10 : 1-31.\u003c/li\u003e\n \u003cli\u003eAgarwal A, Gupta S, Sikka S (2006) The role of free radicals and antioxidants in reproduction. \u003cem\u003eCurr Opin Obstet Gynecol\u003c/em\u003e, 18 no.: 325-332.\u003c/li\u003e\n \u003cli\u003eAlvarado MV, Carrillo M, Felip A (2015) Melatonin-induced changes in kiss/gnrh gene expression patterns in the brain of male sea bass during spermatogenesis. \u003cem\u003eComp. Biochem. Physiol. A Mol. Integr. Physiol.\u003c/em\u003e 185: 69-79.\u003c/li\u003e\n \u003cli\u003eAmano M, Iigo M, Ikuta K, Kitamura, S, Okuzawa K, Yamada H (2004) and Yamamori, K., \u0026nbsp;Disturbance of plasma melatonin profile by high dose melatonin administration inhibits testicular maturation of precocious male masu salmon. \u003cem\u003eZool. Sci\u003c/em\u003e, 21 no. 1: 79-85.\u003c/li\u003e\n \u003cli\u003eAmano M, Iigo M, Ikuta K, Kitamura S, Yamada H, Yamamori K (2000) Roles of melatonin in gonadal maturation of underyearling precocious male masu salmon. \u003cem\u003eGen. Comp. Endocrinol,\u003c/em\u003e 120(2): 190-197.\u003c/li\u003e\n \u003cli\u003eAOAC., (1995). Association of Official Analytical Chemists. Official Methods of Analysis of the Association Official Analytical Chemists, 16th ed. AOAC, \u003cem\u003eInc., Arlington, Virginia,\u003c/em\u003e USA.\u003c/li\u003e\n \u003cli\u003eAripin SA, Jintasataporn O, Yoonpundh R (2015a) Effects of melatonin on \u003cem\u003eClarias macrocephalus\u003c/em\u003e female broodstock performance. \u003cem\u003eInt. J. Appl. Sci.,\u003c/em\u003e 21 no 1: 129-137.\u003c/li\u003e\n \u003cli\u003eBhattacharya S, Chattoraj A Maitra SK (2007) Melatonin in the regulation of annual testicular events in carp \u003cem\u003eCatla catla\u003c/em\u003e: evidence from the studies on the effects of exogenous melatonin, continuous light, and continuous darkness. \u003cem\u003eChronobiol. Int.\u003c/em\u003e, 24 no. 4: 629-650.\u003c/li\u003e\n \u003cli\u003eBorg B, Ekstr\u0026ouml;m P (1981). Gonadal effects of melatonin in the three-spined stickleback, \u003cem\u003eGasterosteus aculeatus\u003c/em\u003e L., during different seasons and photoperiods. \u003cem\u003eReprod. Nutr. Dev.\u003c/em\u003e, 21 no. 6A: 919-927.\u003c/li\u003e\n \u003cli\u003eBubenik GA (2002) Gastrointestinal melatonin: localization, function, and clinical relevance. \u003cem\u003eDig. Dis. Sci\u003c/em\u003e, 47: 2336-2348.\u003c/li\u003e\n \u003cli\u003eBubenik GA, Pang SF, Cockshut JR, Smith PS, Grovum L W (2000) Friendship, R. M. and Hacker, R. R., Circadian variation of portal, arterial and venous blood levels of melatonin in pigs and its relationship to food intake and sleep, \u003cem\u003eJ. Pineal Res\u003c/em\u003e 28 no 1: 9-15.\u003c/li\u003e\n \u003cli\u003eCarnevali O, Gioacchini G, Maradonna F, Olivotto I, Migliarini B (2011) Melatonin induces follicle maturation in \u003cem\u003eDanio rerio\u003c/em\u003e. \u003cem\u003ePLoS One\u003c/em\u003e, 6 no 5: e19978.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Chattoraj A, Bhattacharyya S, Basu D, Bhattacharya S, Bhattacharya S, Maitra SK (2005) Melatonin accelerates maturation inducing hormone (MIH): induced oocyte maturation in carps. \u003cem\u003eGen. Comp. Endocrinol\u003c/em\u003e, 140 no. 3: 145-155.\u003c/li\u003e\n \u003cli\u003eChowdhury JP, Haldar C (2022) Stress associated ovarian dysfunctions in a seasonal breeder \u003cem\u003eFunambulus pennanti\u003c/em\u003e: Role of glucocorticoids and possible amelioration by melatonin. \u003cem\u003eGen. Comp. Endocrinol\u003c/em\u003e, 316: 113962.\u003c/li\u003e\n \u003cli\u003eDanilova N, Krupnik VE, Sugden D Zhdanova IV (2004) Melatonin stimulates cell proliferation in zebrafish embryo and accelerates its development. \u003cem\u003eThe FASEB Journal,\u003c/em\u003e 18 no. 6: 751-753.\u003c/li\u003e\n \u003cli\u003eDe Pedro N, Mart\u0026iacute;nez‐\u0026Aacute;lvarez RM, Delgado MJ (2008) Melatonin reduces body weight in goldfish (\u003cem\u003eCarassius auratus\u003c/em\u003e): effects on metabolic resources and some feeding regulators. \u003cem\u003eJ. Pineal Res.\u003c/em\u003e, 45 no. 1: 32-39.\u003c/li\u003e\n \u003cli\u003eDe Vlaming, V., (1980). Effects of pinealectomy and melatonin treatment on growth in the goldfish, \u003cem\u003eCarassius auratus\u003c/em\u003e. \u003cem\u003eGen. Comp. Endocrinol.\u003c/em\u003e, 40 no 2: 245-250.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Dhara K, Das UN (2018) Breeding performance of the walking catfish \u003cem\u003eClarias batrachus\u003c/em\u003e (Linnaeus, 1758) using synthetic inducing agent, Alpa-FH with special reference to the occurrence of morphological deformities in their early stage of life. \u003cem\u003eJ. Entomol. Zool. Stud.\u003c/em\u003e, 6 : 957\u0026ndash;963.\u003c/li\u003e\n \u003cli\u003eGhosh, J, Nath P (2005) Reported the seasonal effects of Melatonin on ovary and plasma gonadotropin and vitellogenin levels in intact and pinealectomized catfish, \u003cem\u003eClarias batrachus\u003c/em\u003e (L.). \u003cem\u003eIndian J. Exp. Biol\u003c/em\u003e, 43: 224 -232.\u003c/li\u003e\n \u003cli\u003eGonenc S, Uysal N, Acikgoz O, Kayatekin BM, Sonmez A, Kiray M, Aksu I, Gulecer B, Topcu A, Semin I (2005) Effects of melatonin on oxidative stress and spatial memory impairment induced by acute ethanol treatment in rats. \u003cem\u003ePhysiol. Res.,\u003c/em\u003e 54: 341-348.\u003c/li\u003e\n \u003cli\u003eGuo YM, Sun TC, Wang HP, \u0026nbsp;Chen X (2021) Research progress of melatonin (MT) in improving ovarian function: a review of the current status. \u003cem\u003eAging (Albany NY),\u003c/em\u003e 13 no. 13: 17930.\u003c/li\u003e\n \u003cli\u003eGupta G, Chatterjee A, Kumar M, Sardar P, Varghese T, Srivastava PP, \u0026nbsp;Gupta S (2020) Efficacy of single and multiple doses of fenbendazole against gill parasites (\u003cem\u003eDactylogyrus\u003c/em\u003e sp.) of \u003cem\u003eLabeo rohita\u003c/em\u003e (Hamilton, 1822) and its physio‐metabolic effects on the fish. \u003cem\u003eAquac. Res.\u003c/em\u003e51 no. 3 : 1190-1199.\u003c/li\u003e\n \u003cli\u003eGupta G, Srivastava PP, Kumar M, Varghese T, Chanu TI, Gupta S, Ande MP Jana P (2021) The modulation effects of dietary zinc on reproductive performance and gonadotropins\u0026rsquo;(FSH and LH) expression in threatened Asian catfish, \u003cem\u003eClarias magur\u003c/em\u003e (Hamilton, 1822) broodfish. \u003cem\u003eAquac. Res.\u003c/em\u003e; 00: 1\u0026ndash;12.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Handeland SO, Imsland AK, Bj\u0026ouml;rnsson BT, Stefansson SO,Porter M (2013) Physiology during smoltification in Atlantic salmon: effect of melatonin implants. \u003cem\u003eFish Physiol. Biochem\u003c/em\u003e 39:1079-1088.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Hasan KN, Moniruzzaman M, Maitra SK (2014) Melatonin concentrations in relation to oxidative status and oocyte dynamics in the ovary during different reproductive phases of an annual cycle in carp \u003cem\u003eCatla catla\u003c/em\u003e. \u003cem\u003eTheriogenology\u003c/em\u003e, 82 no. 2: 1173-1185.\u003c/li\u003e\n \u003cli\u003eHossain MA, Islam MS (1990) The fecundity and sex ratio of the common punti, \u003cem\u003ePuntius stigma\u003c/em\u003e (Cuvier and Valenciennes) (Cypriniformes: Cyprinidae) from the river Padma near Rajshahi (in Bangladesh\u003cem\u003e). Univ. j. zool., Rajshahi Univ.\u003c/em\u003e, 9 : 69\u0026ndash;74.\u003c/li\u003e\n \u003cli\u003eHossain Q, Hossain MA, Parween S (2006) Artificial breeding and nursery practices of \u003cem\u003eClarias batrachus\u003c/em\u003e (Linnaeus, 1758). \u003cem\u003eScientific World\u003c/em\u003e, 4,no 4: 32-37.\u003c/li\u003e\n \u003cli\u003eİkbal AGAH, Zafer EREN, G\u0026uuml;rkanli İ (2009) Effect of melatonin on the antioxidant enzyme status in the liver of Swiss albino laboratory mice in single circadian rhythm. \u003cem\u003eJ. Appl. Biol. Sci\u003c/em\u003e 3 no. 1: 1-5.\u003c/li\u003e\n \u003cli\u003eImamura S, Hur, SP, Takeuchi Y, Badruzzaman M, Mahardini A, Rizky D, \u0026nbsp;Takemura A (2022) Effect of short-and long-term melatonin treatments on the reproductive activity of the tropical damselfish \u003cem\u003eChrysiptera cyanea\u003c/em\u003e. \u003cem\u003eFish Physiol. Biochem\u003c/em\u003e48 no. 1:253-262.\u003c/li\u003e\n \u003cli\u003eIshizuka B, Kuribayashi Y, Murai K, Amemiya A, Itoh MT (2020) The effect of melatonin on in vitro fertilization and embryo development in mice. \u003cem\u003e. Pineal Res,\u003c/em\u003e 28 no. 1:48-51.\u003c/li\u003e\n \u003cli\u003eKim JH, Park JW, Jin YH, Kim DJ, Kwon JY (2018) \u0026nbsp;Effect of melatonin on GnIH precursor gene expression in Nile tilapia, \u003cem\u003eOreochromis niloticus.\u003c/em\u003e \u003cem\u003eBiol. Rhythm Res.,\u003c/em\u003e 49 no. 2: 303-313.\u003c/li\u003e\n \u003cli\u003eKołacz Swiderska- G, Klusek J, Kołataj A (2006) The effect of melatonin on glutathione and glutathione transferase and glutathione peroxidase activities in the mouse liver and kidney in vivo. \u003cem\u003eNeuroendocrinol. Lett\u003c/em\u003e, 27 no.3.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Kowaltowski A, J, Vercesi AE (1999) Mitochondrial damage induced by conditions of oxidative stress. \u003cem\u003eFree Radic. Biol. Med.\u003c/em\u003e, 26 no. 3-4: 463-471.\u003c/li\u003e\n \u003cli\u003eLima‐Cabello E, D\u0026iacute;az‐Casado ME, Guerrero JA, Otalora BB, Escames G, L\u0026oacute;pez L C, Reiter RJ. Acu\u0026ntilde;a‐Castroviejo D (2014) A review of the melatonin functions in zebrafish physiology. \u003cem\u003eJ. Pineal Res\u003c/em\u003e, 57 no 1: 1-9.\u003c/li\u003e\n \u003cli\u003eLivak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using realtime quantitative PCR and the 2\u0026minus;\u0026Delta;\u0026Delta;CT method. \u003cem\u003eMethods,\u003c/em\u003e 25 no 4: 402\u0026ndash;408.\u003c/li\u003e\n \u003cli\u003eL\u0026oacute;pez-Olmeda, JF, Madrid JA, S\u0026aacute;nchez-V\u0026aacute;zquez FJ (2006) Melatonin effects on food intake and activity rhythms in two fish species with different activity patterns: Diurnal (goldfish) and nocturnal (tench). \u003cem\u003eComp. Biochem. Physiol. A Mol. Integr. Physiol.\u003c/em\u003e, 144 no. 2: 180-187\u003c/li\u003e\n \u003cli\u003eMaitra SK Hasan KN (2016) The role of melatonin as a hormone and an antioxidant in the control of fish reproduction. \u003cem\u003eFront. Endocrinol\u003c/em\u003e, 7: 38.\u003c/li\u003e\n \u003cli\u003eMaitra SK, Chattoraj A, Bhattacharyya S (2005) Implication of melatonin in oocyte maturation in Indian major carp \u003cem\u003eCatla catla\u0026nbsp;\u003c/em\u003eFish Physiol. Biochem, 31: 201-207.\u003c/li\u003e\n \u003cli\u003eMhalhel K, German\u0026agrave; A, Abbate F, Guerrera MC (2020) Levanti, M., Laur\u0026agrave;, R. and Montalbano, G., 2020. The Effect of Orally Supplemented Melatonin on Larval Performance and Skeletal Deformities in Farmed Gilthead Seabream (\u003cem\u003eSparus aurata\u0026nbsp;\u003c/em\u003eInt. J. Mol. Sci., 21 no. 24: 9597.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Ministry of Fisheries, Animal Husbandry \u0026amp; Dairying 2023\u003c/li\u003e\n \u003cli\u003eMir IN, Srivastava PP, Bhat IA, Jaffar YD, Sushila N, Sardar P, Kumar S, Muralidhar A P, \u0026nbsp; Jain K K (2020) Optimal dietary lipid and protein level for growth and survival of catfish \u003cem\u003eClarias magur\u003c/em\u003e larvae. \u003cem\u003eAquaculture\u003c/em\u003e, 520 : 734678.\u003c/li\u003e\n \u003cli\u003eMondal P, Hira SK, Saha NC (2019) The functional role of melatonin and kisspeptin in fish reproduction. \u003cem\u003eInnovare Journal of Sciences\u003c/em\u003e, 7 no. 3 (2019): 1-7\u003c/li\u003e\n \u003cli\u003eNakamura Y, Tamura H, Takayama H, Kato H (2003) Increased endogenous level of melatonin in preovulatory human follicles does not directly influence progesterone production. \u003cem\u003eFertil Steril\u003c/em\u003e, 80 no. 4: 1012-1016.\u003c/li\u003e\n \u003cli\u003eNishihara T, Hashimoto S, Ito K, Nakaoka Y, Matsumoto K, Hosoi Y, \u0026nbsp;Morimoto Y (2014) Oral melatonin supplementation improves oocyte and embryo quality in women undergoing in vitro fertilization-embryo transfer.\u003cem\u003e\u0026nbsp;Gynecol. Endocrinol\u003c/em\u003e, 30 no. 5:359-362.\u003c/li\u003e\n \u003cli\u003ePanchal R, Rani S (2019) Effect of melatonin and pinealectomy on gonadal activity during prespawning period of catfish (\u003cem\u003eHeteropneustes fossilis\u003c/em\u003e). \u003cem\u003eJ. Environ. Biol.,\u003c/em\u003e 40 no. 4: 698-704.\u003c/li\u003e\n \u003cli\u003ePinillos ML, De Pedro N, Alonso-G\u0026oacute;mez A L, Alonso-Bedate M, Delgado M J (2001) Food intake inhibition by melatonin in goldfish (\u003cem\u003eCarassius auratus\u003c/em\u003e). \u003cem\u003ePhysiol. Behav.\u003c/em\u003e72 no. 5: 629-634.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Popek, W. \u0026quot;Role of pineal gland in development and gonad maturation in common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e L) Ph. D.\u0026quot; PhD diss., Thesis, 1991..\u003c/li\u003e\n \u003cli\u003ePorter MJR, Randall CF, Bromage NR, Thorpe JE (1998) The role of melatonin and the pineal gland on development and smoltification of Atlantic salmon (\u003cem\u003eSalmo salar\u003c/em\u003e) parr. \u003cem\u003eAquaculture\u003c/em\u003e, 168 no 1-4 :139-155.\u003c/li\u003e\n \u003cli\u003eReiter RJ (1996) Antioxidant actions of melatonin. \u003cem\u003eAdv. Pharmacol\u003c/em\u003e, 38 :103-117.\u003c/li\u003e\n \u003cli\u003eReiter RJ, Rosales-Corral SA, Manchester LC, Tan D X (2013) Peripheral reproductive organ health and melatonin: ready for prime time. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e, 14 no.4: 7231-7272.\u003c/li\u003e\n \u003cli\u003e\u0026nbsp;Reiter RJ, Tan DX, Maldonado MD (2005) Melatonin as an antioxidant: physiology versus pharmacology. \u003cem\u003eJ. Pineal Res\u003c/em\u003e, 39 no. 2: 215-216.\u003c/li\u003e\n \u003cli\u003eReiter RJ, Tan D X, Manchester LC, Paredes SD, Mayo JC, Sainz RM (2009) Melatonin and reproduction revisited. \u003cem\u003eBiol. Reprod.\u003c/em\u003e 81 no. 3: 445-456.\u003c/li\u003e\n \u003cli\u003eReiter R J, Tan DX, Osuna C, \u0026nbsp;Gitto E (2000) Actions of melatonin in the reduction of oxidative stress: a review. \u003cem\u003eJ. Biomed. Sci.\u003c/em\u003e, 7 no 6: 444-458\u003c/li\u003e\n \u003cli\u003eRenuka K, Joshi B. N (2010) Melatonin-induced changes in ovarian function in the freshwater fish \u003cem\u003eChanna punctatus\u003c/em\u003e (Bloch) held in long days and continuous light. \u003cem\u003eGen. Comp. Endocrinol\u0026nbsp;\u003c/em\u003e165: 42\u0026ndash;46.\u003c/li\u003e\n \u003cli\u003eSahoo SK, Giri SS, Sahu AK (2004) Effect of stocking density on growth and survival of \u003cem\u003eClarias batrachus\u003c/em\u003e (Linn.) larvae and fry during hatchery rearing. \u003cem\u003eJ. Appl. Ichthyol,\u003c/em\u003e 20: 302\u0026ndash; 305.\u003c/li\u003e\n \u003cli\u003eSahoo SK, Giri SS, Sahu AK (20050 Induced spawning of Asian catfish, \u003cem\u003eClarias batrachus\u003c/em\u003e (Linn.): effect of various latency periods and SGnRHa and domperidone doses on spawning performance and egg quality. \u003cem\u003eAquac. Res.\u003c/em\u003e, 36 no. 13: 1273-1278\u003c/li\u003e\n \u003cli\u003eSahoo SK, Giri SS, Chandra S, Mohapatra BC (2008) Evaluation of breeding performance of Asian catfish \u003cem\u003eClarias batrachus\u003c/em\u003e at different dose of HCG and latency period combinations. \u003cem\u003eTurkish Journal of Fisheries and Aquatic Sciences\u003c/em\u003e, 8 no. 2.\u003c/li\u003e\n \u003cli\u003eSawaguchi, S., Kagawa, H., Ohkubo, N., Hiramatsu, N., Sullivan, C.V. and Matsubara, T., Molecular characterization of three forms of vitellogenin and their yolk protein products during oocyte growth and maturation in red seabream (\u003cem\u003ePagrus major\u003c/em\u003e), a marine teleost spawning pelagic eggs. \u003cem\u003eMol. Reprod. Dev\u003c/em\u003e 73 no. 6 (2006):719-736.\u003c/li\u003e\n \u003cli\u003eS\u0026eacute;bert ME, Legros C, Weltzien FA, Malpaux B, Chemineau P, Dufour S (2008) Melatonin activates brain dopaminergic systems in the eel with an inhibitory impact on reproductive function. \u003cem\u003eJ. Neuroendocrinol\u003c/em\u003e, 20 no. 7: 917-929.\u003c/li\u003e\n \u003cli\u003eServili A, Lethimonier C, Lareyre JJ, Lopez-Olmeda JF, Sanchez-Vazquez FJ, Kah O, Munoz-Cueto JA (2010) The highly conserved gonadotropin-releasing hormone-2 form acts as a melatonin-releasing factor in the pineal of a teleost fish, the European sea bass \u003cem\u003eDicentrarchus labrax\u003c/em\u003e. \u003cem\u003eEndocrinology\u003c/em\u003e, 151 no. 5 : 2265-2275.\u003c/li\u003e\n \u003cli\u003eSingh R, Singh AK, Tripathi M (2012) Melatonin induced changes in specific growth rate, gonadal maturity, lipid and protein production in Nile tilapia \u003cem\u003eOreochromis niloticus\u003c/em\u003e (Linnaeus 1758). \u003cem\u003eAsian-Australasian Journal of Animal Sciences,\u003c/em\u003e 25 no 1: 37-43\u003c/li\u003e\n \u003cli\u003eŞirinyıldız F, Ek RO (2021) Effects of melatonin at different doses on experimental epilepsy model induced by pentylenetetrazole. \u003cem\u003eMeand. Med Dent J.\u0026nbsp;\u003c/em\u003e22 no. 2 : 177.\u003c/li\u003e\n \u003cli\u003eSrivastava PP, Raizada S, Dayal R, Chowdhary S, Lakra WS, Yadav AK, Sharma P, \u0026nbsp;Gupta J (2012) Breeding and larval rearing of Asian catfish, \u003cem\u003eClarias batrachus\u003c/em\u003e (Linnaeus, 1758) on live and artificial feed. \u003cem\u003eAquac Res Dev.\u003c/em\u003e, 3 : 4. DOI: 10.4172/2155-9546.1000134\u003c/li\u003e\n \u003cli\u003eSubramanian P, Mirunalini S, Pandi-Perumal SR, Trakht I, Cardinali DP (2007) Melatonin treatment improves the antioxidant status and decreases lipid content in brain and liver of rats\u003cem\u003e. Eur. J. Pharmacol.\u003c/em\u003e, 571 no.2-3 : 116-119.\u003c/li\u003e\n \u003cli\u003eTamura H, Jozaki M, Tanabe M, Shirafuta Y, Mihara Y, Shinagawa M, Tamura I, Maekawa R, Sato S, Taketani T, Takasaki A (2020) Importance of melatonin in assisted reproductive technology and ovarian aging. \u003cem\u003eInt. J. Mol. Sci..\u003c/em\u003e, 21 no. 3:1135.\u003c/li\u003e\n \u003cli\u003eTamura H, Takasaki A, Taketani T, Tanabe M, Kizuka F, Lee L, Tamura I, Maekawa R, Asada H, Yamagata Y, Sugino N (2013) Melatonin as a free radical scavenger in the ovarian follicle. \u003cem\u003eEndocrine journal\u003c/em\u003e, 60 no.1: 1-13.\u003c/li\u003e\n \u003cli\u003eTan DX, Reiter RJ, Manchester LC, Yan MT, El-Sawi M, Sainz RM, Mayo JC, Kohen R, Allegra MC, Hardeland R (2002) Chemical and physical properties and potential mechanisms: melatonin as a broad spectrum antioxidant and free radical scavenger. \u003cem\u003eCurr. Top. Med. Chem\u003c/em\u003e, 2 no. 2: 181-197.\u003c/li\u003e\n \u003cli\u003eTaylor JF, Migaud H, Porter MJR, Bromage NR (2005) Photoperiod influences growth rate and plasma insulin-like growth factor-I levels in juvenile rainbow trout, \u003cem\u003eOncorhynchus mykiss\u003c/em\u003e. \u003cem\u003eGen. Comp. Endocrinol.\u0026nbsp;\u003c/em\u003e142 no. 1-2 : 169-185.\u003c/li\u003e\n \u003cli\u003eWallace RA, Selman K (1981) Cellular dynamic aspect of oocyte growth in teleosts. \u003cem\u003eAmerican Zoology\u003c/em\u003e, 21: 325\u0026ndash;343\u003c/li\u003e\n \u003cli\u003eZachmann A, Falcon J, Knijff SC, M Bolliet V, Ali MA (1992) Effects of photoperiod and temperature on rhythmic melatonin secretion from the pineal organ of the white sucker (\u003cem\u003eCatostomus commersoni\u003c/em\u003e) in vitro. \u003cem\u003eGen. Comp. Endocrinol\u003c/em\u003e, 86 no 1: .26-33.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Plates","content":"\u003cp\u003ePlates 1 to 9 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Melatonin, Gonadotropins, Vitellogenin, Antioxidant status, Ovarian histology, Reproductive performance, Clarias magur","lastPublishedDoi":"10.21203/rs.3.rs-6279678/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6279678/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThis study investigates the effects of melatonin supplementation on gonadotropin gene expression, vitellogenin (Vtg) gene expression, antioxidant status, ovarian histology, and reproductive performance in female \u003cem\u003eClarias magur\u003c/em\u003e. Four experimental diets were formulated: control (0 mg/kg melatonin), T1 (100 mg/kg melatonin), T2 (200 mg/kg melatonin), and T3 (300 mg/kg melatonin). Results showed no significant difference in weight gain between the control and T1 groups, while weight gain decreased notably in T2 and T3. Gonadosomatic index (GSI) and fecundity were monitored over a 60-day feeding trial. The T1 group exhibited significantly higher GSI and fecundity compared to the control, whereas T2 and T3 groups showed significant reductions in both parameters. Histological evaluation revealed more atretic eggs in T3, while T1 contained mature and primary/secondary yolk stage (PYS/SYS) oocytes. Gonadotropin and vitellogenin gene expression in \u003cem\u003eClarias magur\u003c/em\u003e was evaluated from April to June, with samples collected at three time points: April (I sampling, before the start of the feeding trial), May (II sampling, after one month of the feeding trial), and June (III sampling, at the end of the feeding trial).Gonadotropin gene expression (FSH and LH) was significantly affected by melatonin. FSH gene expression peaked at the II sampling in the T1 group, while it was lowest in T3. LH gene expression peaked at the III sampling in the T1 group, showing a marked reduction in higher melatonin doses (T2 and T3 group). Vtg gene expression increased in the T1, reaching the highest levels at the II sampling, while it was inhibited in the T3 group. Antioxidant enzymes (SOD, CAT, GPX, GST) varied significantly with melatonin doses. Lower melatonin doses (T1) reduced antioxidant enzyme activity, while higher doses (T3) enhanced it. Induced breeding outcomes demonstrated that melatonin at 100 mg/kg significantly improved fertilization, hatching, larval survival, and fry survival, outperforming the control group. Our findings indicate that melatonin supplementation at 100 mg/kg enhances reproductive performance in \u003cem\u003eClarias magur\u003c/em\u003e by modulating ovarian development, gonadotropin gene expression, oxidative stress, and improving survival rates in the early life stages.\u003c/p\u003e","manuscriptTitle":"Effect of melatonin supplementation on gonadotropins, Vitellogenin gene expression, antioxidant status, ovarian histology and reproductive performance in female Clarias magur","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-02 10:50:11","doi":"10.21203/rs.3.rs-6279678/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7022aa06-0a68-4a97-a5cc-c6fe21d03402","owner":[],"postedDate":"April 2nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-05-19T09:38:09+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-02 10:50:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6279678","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6279678","identity":"rs-6279678","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}