miR-107-3p alleviates osteoarthritis by regulating the NF-κB pathway to inhibit chondrocyte pyroptosis

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Osteoarthritis (OA) is a degenerative disease with a complex pathogenesis, making it difficult to treat. Although miR-107-3p is dysregulated in arthritis, its role in OA remains unexplored. This study investigated the function and mechanism of miR-107-3p in OA. Our findings revealed that miR-107-3p is downregulated in patients with OA and chondrocytes. Its overexpression suppresses chondrocyte pyroptosis, enhances cell viability, promotes anabolic activity, downregulates catabolism, alleviates inflammation, inhibits p65 nuclear translocation, decreases p-p65 levels, and suppresses NF-κB signaling. These results suggest that miR-107-3p mitigates OA-related chondrocyte inflammation and injury by inhibiting pyroptosis.
Full text 71,001 characters · extracted from preprint-html · click to expand
miR-107-3p alleviates osteoarthritis by regulating the NF-κB pathway to inhibit chondrocyte pyroptosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article miR-107-3p alleviates osteoarthritis by regulating the NF-κB pathway to inhibit chondrocyte pyroptosis Lei Wang, Zhang Miao, yang Cao This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8629442/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Osteoarthritis (OA) is a degenerative disease with a complex pathogenesis, making it difficult to treat. Although miR-107-3p is dysregulated in arthritis, its role in OA remains unexplored. This study investigated the function and mechanism of miR-107-3p in OA. Our findings revealed that miR-107-3p is downregulated in patients with OA and chondrocytes. Its overexpression suppresses chondrocyte pyroptosis, enhances cell viability, promotes anabolic activity, downregulates catabolism, alleviates inflammation, inhibits p65 nuclear translocation, decreases p-p65 levels, and suppresses NF-κB signaling. These results suggest that miR-107-3p mitigates OA-related chondrocyte inflammation and injury by inhibiting pyroptosis. Biological sciences/Cell biology Health sciences/Diseases Biological sciences/Molecular biology miR-107-3p NF-κB Osteoarthritis pyroptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Osteoarthritis (OA) is the most prevalent degenerative joint disorder, affecting nearly one-fourth of adults. Currently, no treatment effectively repairs joint cartilage damage or slows OA progression, and its pathogenesis remains poorly understood. Pyroptosis, an inflammatory form of programmed cell death mediated by inflammasomes, leads to cellular damage and the release of cytoplasmic contents [ 2 ]. It is characterized by caspase-1 activation, triggering interleukin-1β (IL-1β) production and promoting inflammation [ 3 ]. Given its role in chondrocyte damage and extracellular matrix (ECM) degradation, targeting pyroptosis presents a promising therapeutic strategy for OA [ 4 ]. Numerous microRNAs (miRNAs) have been implicated in cartilage development, osteogenic differentiation, osteoclastic activity, and the pathogenesis of OA [ 5 – 7 ]. The OA-related miRNAs can be categorized based on their functions, including the regulation of apoptosis, chondrocyte signaling pathways, and the A Disintegrin And Metalloproteinase with Thrombospondin Motifs (ADAMTS) and matrix metalloproteinase (MMP) pathways. Several studies have reported miRNA involvement in OA-related pyroptosis, such as miRNA upregulation in lipopolysaccharide (LPS)-treated chondrocytes, contributing to pyroptosis through the modulation of associated proteins [ 9 – 10 ]. For instance, miR-140-5p targets cathepsin B (CTSB), inhibiting chondrocyte pyroptosis and mitigating OA progression [ 11 ]. Based on evidence from the literature indicating that miR-107-3p alleviates neuroinflammation [ 12 ], it is hypothesized that it may similarly reduce chondrocyte inflammation in OA. Despite advancements in OA research, the role of cell pyroptosis in OA pathogenesis remains incompletely understood [ 13 ]. Nuclear factor-kappa B (NF-κB) is a crucial transcription factor in DNA regulation, cytokine production, and cell survival. Present in nearly all animal cell types, NF-κB plays a significant role in various diseases, including rheumatoid arthritis and inflammatory conditions affecting the heart and brain. Pharmacological inhibition of the NF-kB signaling pathway has emerged as a potential therapeutic strategy [ 14 ]. The NF-κB activation is essential for initiating the NOD-, LRR-, and pyrin domain-containing protein 3 (NLRP3) inflammasome, making its blockade a promising approach for targeted inhibition of cell apoptosis [ 15 ]. It was hypothesized that miR-107-3p modulates the NF-κB pathway, thereby mitigating OA progression. This study aimed to investigate the role and underlying mechanisms of miR-107-3p in OA, offering novel insights into miRNA-based targeted therapy. Materials and Methods 1.1 Cell culture and treatment Rat immortalized chondrocytes (C518) were obtained from Shanghai Yaji Biotechnology Co., Ltd. (Shanghai, China) and cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 µg/mL streptomycin at 37°C in a humidified 5% CO 2 incubator. Cells were stimulated with tumor necrotic factor-α (TNF-α) (20 ng/mL) for 48 hours to establish an OA model. The miR-107-3p overexpression was induced via lentiviral transfection (Shandong Weizhen, China) for 48 hours using Lipofectamine 3000 (Invitrogen, USA), following the manufacturer’s protocol.The sequences of the miR-107-3p mimic is TCCCCACAGACCCAGAGCCGTTCAAGAGACGGCTCTGGGTCTGTGGGGATTTTTT.The sequences of the miR-107-3p mimics negative control is TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTT.The name of the lentiviral vector is plent-U6-mir-107-3p-CMV-copGFP-P2A-Puro. The regulatory role of miR-107-3p was examined in chondrocyte pyroptosis by assigning the cells to three groups: NC group (control chondrocytes), OA group (chondrocytes treated with TNF-α), and OA + miR-107-3p group (chondrocytes treated with TNF-α and transfected with miR-107-3p). Meanwhile, discarded cartilage specimens were obtained from ten male patients undergoing knee arthroplasty for OA. Written informed consent was obtained from all participants, and the study adhered to the principles of the Declaration of Helsinki. According to the International Cartilage Repair Society (ICRS) classification [ 16 ], undamaged cartilage (ICRS Grade 0) was categorized into one group, while damaged cartilage (ICRS Grades 1–4) formed another. All patients have obtained written informed consent.These cartilage samples were collected in Fuxin Central Hospital from May 2022 to December 2022, and archived cartilage tissues were used in this experiment.The Ethics Committee of Central Hospital (Fuxin, China; approval number:RB-RT-2005-051) approved the study protocol. 1.2 CCK-8 assay When cell confluence reached 90%, cells in the logarithmic growth phase were seeded into 96-well plates following the instructions of the cell counting kit-8 (CCK-8) kit (Soleibao, China). Optical density (OD) values were measured at 450 nm. 1.3 Immunofluorescence analysis Chondrocytes were subjected to group-specific treatments before fixation with 4% paraformaldehyde and permeabilization with Triton X-100 (Sigma-Aldrich, Darmstadt, Germany) to ensure optimal cell morphology and vitality. Cells were incubated overnight at 4℃ with primary antibodies (p65, 1:200; Collagen Type II Alpha 1 Chain [COL2A1], 1:200), followed by Cy3-labeled goat anti-rabbit IgG (1:100) in the dark. Finally, 4′,6-diamidino-2-phenylindole (DAPI) was used for nuclear staining, and images were captured after sealing the slides. 1.4 Enzyme-linked immunosorbent assay (ELISA) Once cell confluence reached 80%, treatments were applied, and the culture supernatant was collected for analysis. The concentration of IL-1β in the medium was measured using a rat ELISA kit (CoBio, Shanghai, China), following the manufacturer's protocol. Absorbance was recorded at 450 nm. 1.5 Western blot analysis Cells were lysed using radioimmunoprecipitation assay (RIPA) lysis buffer, and total protein was extracted according to the protocol. After centrifugation, the lysate was collected, and protein concentration was quantified using a bicinchoninic acid (BCA) assay kit. Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, USA). Membranes were blocked with 5% skim milk at room temperature for 1 hour, then incubated overnight at 4°C with primary antibodies: anti-MMP13 (Affinity Biosciences), cleaved-caspase-1 (Affinity), anti-gasdermin D (GSDMD) (Affinity), anti-NLRP3 (Affinity), anti-phosphorylated (p)-p65 (Affinity), and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Wuhan Sanying Biotechnology Co., Ltd., Wuhan, Hubei, China). After incubation with corresponding secondary antibodies, grayscale analysis was performed using ImageJ software. 1.6 Quantitative Fluorescence Polymerase Chain Reaction (PCR) Total RNA was extracted using TRIzol (Invitrogen) and reverse-transcribed into complementary DNA (cDNA) with a reverse transcription kit (Full Gold). Quantitative Reverse Transcription (qRT)-PCR was performed using the PerfectStart® Green qPCR SuperMix kit (Full Gold) under the following conditions: initial denaturation at 95℃ for 3 min, followed by 40 cycles of 95℃ for 30 s, 58℃ for 45 s, and extension at 72℃ for 6 min. GAPDH served as the internal control, and relative gene expression was calculated using the 2^-ΔΔCt method. Primers (synthesized by Wuhan Bolf Biodesign [Wuhan, China]) were as follows: Rat NLRP3: F: GCACCAAAGAGCCTAGCAGA, R: GAATGTCTCCCCTCACAGCC; Rat MMP13: F: TGAGTTTGCAGAGCACTACTTG, R: CAGGCACTCCACATCTTGGT; Rat GSDMD-N : F: GTGAGCCACCCTGCTATTCA, R: GCAGGCATCCAGGCAATAGA; Rat cleaved-caspase-1: F: GACCGAGTGGTTCCCTCAAG, R: GACGTGTACGAGTGGGTGTT; rno-miR-107-3p loop primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGATAGCC; rno-miR-107-3p F primer: TGCGCAGCAGCATTGTACAGG; Rat GAPDH: F: ACTCTACCCACGGCAAGTTC, R: TGGGTTTCCCGTTGATGACC;U6:F:CGCTTCGGCAGCACATATAC,R:AAATATGGAACGCTTCACGA. 1.7 Statistical Analysis Data analysis and visualization were performed using GraphPad Prism 9.0. Statistical significance was assessed using one-way analysis of variance (ANOVA) or t-tests. Results are presented as mean ± standard deviation (SD), and statistical significance was set at p < 0.05. All experiments were conducted at least three times. Results 2.1 Downregulation of miR-107-3p in human and OA chondrocytes Discarded cartilage samples were obtained from knee replacement surgeries to examine miR-107-3p expression in OA. Cartilage was classified into damaged (D) and undamaged (U) areas based on the extent of degeneration. The qPCR analysis revealed that miR-107-3p expression was significantly downregulated in OA cartilage (Fig. 1 . A). Subsequently, TNF-α-treated rat immortalized chondrocytes exhibited miR-107-3p downregulation (Fig. 1 . B), reinforcing its potential role in OA pathogenesis. These findings validated the transfection efficiency of miR-107-3p lentivirus (Fig. 1 . B). 2.2 miR-107-3p overexpression enhances chondrocyte anabolism and suppresses catabolism Although miR-107-3p is downregulated in OA, its functional role remains unclear. Therefore, OA chondrocytes were transfected with overexpressed miR-107-3p, and a significant increase was observed in cell viability (Fig. 2 . A). Immunofluorescence staining, immunoblotting, and qPCR analyses demonstrated that miR-107-3p upregulated the anabolic marker type II collagen while downregulating the catabolic marker MMP-13 (Fig. 2 . B, C, D, E). These results suggest that miR-107-3p mitigates OA-associated chondrocyte degeneration. 2.3 miR-107-3p overexpression alleviates chondrocyte pyroptosis Chondrocyte pyroptosis was assessed by evaluating NLRP3 expression using immunoblotting and qPCR to explore how miR-107-3p alleviates OA. Overexpression of miR-107-3p substantially downregulated NLRP3, and the protein and mRNA levels of cleaved-caspase-1 and GSDMD-N (Fig. 3), indicating its protective role in suppressing pyroptotic cell death. 2.4 miR-107-3p mitigates chondrocyte inflammation via NF-κB pathway regulation Tumor necrosis factor-α (TNF-α) activates the NF-κB signaling pathway in chondrocytes [ 17 – 18 ]. Consistent with this, immunofluorescence confirmed that TNF-α treatment of rat chondrocytes (C518) induced nuclear translocation of p65 (Fig. 4 . A). Immunoblotting further revealed increased p-p65, confirming NF-κB activation (Fig. 4 . B, C). However, miR-107-3p overexpression reversed this effect, inhibiting NF-κB signaling and reducing chondrocyte inflammation. Our findings establish miR-107-3p as a potent NF-κB inhibitor that regulates chondrocyte pyroptosis by modulating the NF-κB signaling pathway. Therefore, we propose that the miR-107-3p/NF-κB axis plays a crucial role in OA progression by influencing chondrocyte survival and inflammatory responses. Discussion Despite decades of research, OA remains challenging to treat [19–20]. No drugs offer high efficacy and minimal side effects [21]. Non-coding RNAs, especially miRNAs, mediate cellular pyroptosis in various diseases [ 22 ] and are closely linked to musculoskeletal injuries [ 23 ]. The miRNAs regulate cell pyroptosis, autophagy, and apoptosis through multiple signaling pathways, including Wingless/Integrated (Wnt)/β-catenin, transforming growth factor (TGF-β), Phosphoinositide 3-kinase (PI3K)/Protein kinase B (AKT)/Mammalian target of rapamycin pathway, and NLRP3/caspase-1. As key regulators of OA cartilage homeostasis and chondrocyte proliferation, miRNAs influence cell survival and renewal, while their deficiency accelerates cartilage degeneration [ 24 ]. miR-107 is widely expressed in mammalian organs, particularly brain tissue [25], where it participates in numerous biological processes. However, its function in chondrocytes remains unclear. Our study demonstrated that miR-107-3p is considerably downregulated in OA cartilage, providing a foundation for further investigation. The OA chondrocytes exhibit reduced matrix synthesis and increased catabolic activity [ 26 – 27 ]. The ECM is essential for cartilage integrity, and its degradation contributes to OA progression [28–29]. Proteoglycan aggregates and type II collagen, both key ECM components, are vital in maintaining cartilage function [ 30 ]. Matrix metalloproteinases (MMPs), particularly MMP-13, play a key role in the degradation of aggrecans and type II collagen, contributing to ECM breakdown in OA pathogenesis [31–32]. Our findings indicate that miR-107-3p enhances matrix synthesis while mitigating chondrocyte damage by regulating MMP-13 and type II collagen expression. The ELISA results further confirmed that miR-107-3p suppresses IL-1β expression, reducing inflammation. Collectively, these findings suggest that miR-107-3p exerts a protective effect on chondrocytes. Recent studies have implicated chondrocyte pyroptosis in OA progression [ 33 – 34 ]. However, research on pyroptosis in OA remains in its early stages, and the precise regulatory mechanisms are not yet fully understood [ 30 ]. The classic inflammatory pathway is driven by caspase-1 activation rather than caspase-11 (in mice) or caspase-4/5 (in humans) [ 35 ]. In this pathway, the NLRP3 inflammasome responds to pathogen- or damage-associated molecular patterns (PAMPs/DAMPs), triggering caspase-1-mediated cytokine release and GSDMD-dependent pyroptosis. Xu Liang et al. [ 36 ] demonstrated that TNF-α (20 ng/mL) induces chondrocyte pyroptosis in rat models, leading to cell membrane rupture, increased NLRP3 levels, and elevated expression of IL-1β and MMP-13, successfully establishing an OA cell model. Similarly, our study utilized TNF-α to induce chondrocyte pyroptosis, and miR-107-3p lentiviral transfection significantly reduced pyroptosis markers. Bougault et al. [ 37 ] reported that NLRP3 deletion did not suppress MMP-3, MMP-9, or MMP-13 expression in cultured chondrocytes, nor did caspase-1 or IL-1β inhibition. Similarly, Busso et al. [38] found that IL-1α and IL-1β were not essential mediators of OA in a mouse model, and IL-1α or NLRP3 deficiency exacerbated cartilage erosion. These findings suggest that IL-1β inhibition alone is unlikely to be a viable therapeutic strategy. Given these insights, our study focused on the NF-κB pathway, a critical regulator of inflammation in OA. NF-κB activation promotes the expression of cleaved caspase-1, NLRP, and IL-1β, exacerbating inflammatory responses [ 39 ]. Our results demonstrate that miR-107-3p inhibits NF-κB signaling, thereby attenuating chondrocyte inflammation. This study has several limitations. First, immortalized rat chondrocytes were utilized instead of primary chondrocytes, which may introduce variations in experimental outcomes. Second, in vivo validation was not performed, limiting the translational relevance of our findings. Finally, our human cartilage samples were limited to 10 male patients, potentially restricting the generalizability of our results. Future studies will expand the sample size, including female patients, to assess the impact of these limitations on our conclusions. In summary, it is demonstrated that miR-107-3p is downregulated in chondrocytes and cartilage of rats and patients with OA. Importantly, our findings suggest that miR-107-3p alleviates OA progression by regulating the NF-κB pathway and inhibiting chondrocyte pyroptosis, highlighting its potential as a therapeutic target. Additional in vivo studies in rat models will be conducted to validate these findings. Declarations Competing interests All authors declare no conflicts of interest. Ethics approval and consent to participate The Ethics Committee of Fuxin Central Hospital approved this study. Patient consent for publication Not applicable. Funding This work was partially supported by the Fund of Central Hospital of Fuxin (Project No. FZX-YJKY-019) to LW. Author Contribution Wang Lei conceptualized the study, performed the experiments, and drafted the manuscript. Zhang Miao and Yang Cao contributed to data collection. All authors have approved the final version for publication. Acknowledgments Not applicable Data Availability The strip has been uploaded as an auxiliary file. References Wang, T. Q. et al. A novel extracellular vesicles production system harnessing matrix homeostasis and macrophage reprogramming mitigates osteoarthritis[J]. J. Nanobiotechnol. 22 (1), 79 (2024). Wu, Q. C. et al. Micro(nano)-plastics exposure induced programmed cell death and corresponding influence factors[J]. Sci. Total Environ. 921 , 171230 (2024). He, Y. Hara H,Nunez G.Mechanism and regulation of NLRP3 inflammasome activation[J]. Trends Biochem. Sci. 41 , 1012–1021 (2016). Bao, J., Chen, Z., Xu, L., Wu, L. & Xiong, Y. Rapamycin protects chondrocytes against IL-18-induced apoptosis and ameliorates rat osteoarthritis Vol. 12, 5152–5167 (Aging, 2020). 6. Peng, Y. W. et al. Non-coding RNAs involved in fibroblast-like synoviocyte functioning in arthritis rheumatoid: From pathogenesis to therapy[J].Cytokine,2024,173:156418. Yirixiati Aihaiti, X. et al. Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis[J]. Mol. Med. Rep. 22 (4), 3513–3524 (2020). Zhang, R. et al. Identification of potential biomarkers for differential diagnosis between rheumatoid arthritis and osteoarthritis via integrative genome-wide gene expression profiling analysis[J]. Mol. Med. Rep. 19 (1), 30–40 (2019 ). Roszkowski, S. Therapeutic potential of mesenchymal stem cell-derived exosomes for regenerative medicine[J]. Clin. Exp. Med. 24 (1), 46 (2024). Li, G. et al. miR-155 inhibits chondrocyte pyroptosis in knee osteoarthritis by targeting SMAD2 and inhibiting the NLRP3/Caspase-1 pathway[J]. J. Orthop. Surg. Res. 17 , 48 (2022). Zhou, B. et al. Tanshinone IIA ameliorates inflammation response in osteoarthritis via inhibition of miR-155/FOXO3 axis[J].Pharmacology,2021, 106 :20–28 . Zhang, L. et al. MicroRNA-140-5p represses chondrocyte pyroptosis and relieves cartilage injury in osteoarthritis by inhibiting cathepsin B/Nod-like receptor protein 3[J].Bioengineered,2021, 12 (2):9949–9964 . Jin-Jin Song,Hui Li,Nan Wang,et al.Gastrodin ameliorates the lipopolysaccharide-induced neuroinflammation in mice by downregulating miR-107-3p[J].Front Pharmacol,2022,8:13:1044375 . Zhang, Y. et al. CY-09 attenuates the progression of osteoarthritis via inhibiting NLRP3 inflammasome-mediated pyroptosis[J]. Biochem. Biophys. Res. Commun. 553 , 119–125 (2021). Kao, W. C. et al. The Role of Autophagy in Osteoarthritic Cartilage[J].Biomolecules,2022, 12 (10):1357 . He, Y. Hara H,Nunez G.Mechanism and regulation of NLRP3 inflammasome activation[J]. Trends Biochem. Sci. 41 , 1012–1021 (2016). Borne, M. P. J. et al. International Cartilage Repair Society (ICRS) and Oswestry macroscopic cartilage evaluation scores validated for use in Autologous Chondrocyte Implantation (ACI) and microfracture[J]. Osteoarthr. Cartil. 15 (12), 1397–1402 (2007). Su, X. Y. et al. DNMT3A promotes glioma growth and malignancy via TNF-α/NF-κB signaling pathway[J]. Transl Cancer Res. 2024 , 13 (4):1786–1806 . SYin, Q. et al. Anti-rheumatoid arthritis effects of traditional Chinese medicine Fufang Xiaohuoluo pill on collagen-induced arthritis rats and MH7A cells[J].Front Pharmacol,2024,15:1374485. Shiyu, D. X. et al. Quercetin attenuates the symptoms of osteoarthritis in vitro and in vivo by suppressing ferroptosis via activation of AMPK/Nrf2/Gpx4 signaling[J].Mol Med Rep, 31(3):60. Tianlong Pan, Dengying Wu, Alpha-Mangostin protects rat articular chondrocytes against IL-1β-induced inflammation and slows the progression of osteoarthritis in a rat model.Int Immunopharmacol. 2017;52:34–43. doi: 10.1016/j.intimp. Qi Guo, Meng Zhang, Yonghui Dong.Isobavachalcone ameliorates the progression of osteoarthritis by suppressing NF-κB signaling pathway.Int Immunopharmacol. 2023;119:110102. (2025). 10.1016/j.intimp.2023.110102 Li, A. et al. MiR-135b protects cardiomyocytes from infarction through restraining the NLRP3/caspase-1/IL-1beta pathway[J]. Int. J. Cardiol. 307 , 137–145 (2020). Giordano, L. et al. Therapeutic potential of microRNA in tendon injuries[J]. Br. Med. Bull. 133 (1), 79–94 (2020). Swingler, T. E. et al. The function of microRNAs in cartilage and osteoarthritis[J]. Clin. Exp. Rheumatol. 2019 , 37 (5):40–47 . Baskerville, S. & Bartel, D. P. Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes. RNA 11 , 241–247. 10.1261/rna.7240905 (2005). Chen, B. & Fu, W. Chunyang Jie,et al.GPX7 reduces chondrocyte inflammation and extracellular matrix degradation triggered by IL–1β, via a mechanism mediated by ferroptosis[J]. Mol. Med. Rep. 30 (1), 118 (2024 ). Balaskas, P. et al. MicroRNA Signatures in Cartilage Ageing and Osteoarthritis[J].Biomedicines,2023,11(4): 1189. Krishnan, Y. & Grodzinsky, A. J. Cartilage diseases. Matrix Biol. 71–72 , 51–69. 10.1016/j.matbio.2018.05.005 (2018). Liu, C. et al. Protective effects of the pericellular matrix of chondrocyte on articular cartilage against the development of osteoarthritis. Histol. Histopathol . 33 (8), 757–764. 10.14670/HH-11-967 (2018). Shahid, M. et al. A systemic review of existing serological possibilities to diagnose canine osteoarthritis with a particular focus on extracellular matrix proteoglycans and protein. Pol. J. Vet. Sci. 20 (1), 189–201. 10.1515/pjvs-2017-0024 (2017). Malemud, C. J. et al. Matrix metalloproteinase-9 production by immortalized human chondrocyte lines. J. Clin. Cell. Immunol. 7 (3), 422. 10.4172/2155-9899.1000422 (2016). Mehana, E. E., Khafaga, A. F. & El-Blehi, S. S. The role of matrix metalloproteinases in osteoarthritis pathogenesis: an updated review. Life Sci. 234 , 116786. 10.1016/j.lfs.2019.116786 (2019). Zhou, J. Y. et al. α-Solanine attenuates chondrocyte pyroptosis to improve osteoarthritis via suppressing NF-κB pathway[J]. J. Cell. Mol. Med. 2024 , 28 (4):e18132 . Qi, W. Z. et al. Modulating synovial macrophage pyroptosis and mitophagy interactions to mitigate osteoarthritis progression using functionalized nanoparticles[J]. Acta Biomater. 181 , 425–439 (2024). Kayagaki, N. et al. Non-canonical inflammasome activation targets caspase-11. Nature 479 , 117–121 (2011). Xu Liang, W. & Yujiao Yuan Xiaoyang, etc Establishment and evaluation of TNF - α induced chondrocyte pyroptosis model in rats [J]. J. Anhui Med. Univ. 57 (5), 781–785 (2022). Bougault, C. et al. Stress-induced cartilage degradation does not depend on the NLRP3 inflammasome in human osteoarthritis and mouse models[J].Arthritis Rheum, 64 :3972–3981. (2012). Lu, J. P., Wu, Z. X. & Xiong, Y. Knockdown of long noncoding RNA HOTAIR inhibits osteoarthritis chondrocyte injury by miR-107/CXCL12 axis[J]. J. Orthop. Surg. Res. 16 (1), 410 (2021). Jian Yang, S. Targeting Cell Death: Pyroptosis, Ferroptosis, Apoptosis and Necroptosis in Osteoarthritis. Front. Cell. Dev. Biol. 9 , 789948 (2022). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8629442","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":628913772,"identity":"9563c3ef-76a9-451a-9284-e7214c318945","order_by":0,"name":"Lei Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwUlEQVRIie3QsQrCMBCA4YRAu5y6ZvQRAoVOAR/E5bpk0lU6FCwIdZLOvkUfIXLgVOwrpG/Q0dHi5iCJm0P++T6OO8ZisT8srRm3WOpjKwS5IAKWMet6w6/nxKhgchsb4t0AaxlG5E7ZojEiI2CKVXrrJ9Ariw+d5LSwjt3NvvaRTXrpLB4M5LRExWvyExCLmSQksxMoGUbeWxpSSgQTGCaLvUFJ85Mx5BaQphifpcZVS+SmSvvJZ/jbeCwWi8W+9QKeeENIO2mnfgAAAABJRU5ErkJggg==","orcid":"","institution":"Fuxin Central Hospital","correspondingAuthor":true,"prefix":"","firstName":"Lei","middleName":"","lastName":"Wang","suffix":""},{"id":628913773,"identity":"313850a3-c1fb-48d7-b411-26d69a2f3434","order_by":1,"name":"Zhang Miao","email":"","orcid":"","institution":"Fuxin Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhang","middleName":"","lastName":"Miao","suffix":""},{"id":628913774,"identity":"9c83904b-2437-4602-adf0-958145913efc","order_by":2,"name":"yang Cao","email":"","orcid":"","institution":"Fuxin Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"yang","middleName":"","lastName":"Cao","suffix":""}],"badges":[],"createdAt":"2026-01-18 06:08:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8629442/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8629442/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":107916920,"identity":"6c55660f-d154-425b-8281-9a48db596e1e","added_by":"auto","created_at":"2026-04-27 14:20:04","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":22939,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-107-3p is downregulated in human OA and TNF-α-treated rat chondrocytes. A: miR-107-3p expression is reduced in the injured cartilage of patients with OA. B: miR-107-3p is downregulated in rat immortalized chondrocytes (C518) treated with TNF-α, with expression levels assessed post-lentiviral transfection. Data are presented as mean ± SD from three independent experiments. **** p \u0026lt; 0.0001.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8629442/v1/eeebef79cef03cb9ef156974.png"},{"id":108012923,"identity":"0a7062e2-1349-484d-9fee-72631c6eb2aa","added_by":"auto","created_at":"2026-04-28 13:16:50","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":69547,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-107-3p promotes chondrocyte viability and reduces cartilage damage in OA. A: The viability of OA rat chondrocytes (C518) decreases but is restored following miR-107-3p transfection. B: Immunofluorescence micrographs of Col2 across different treatment groups (scale bar: 2.5 μm). C: Representative western blot of MMP-13 expression in rat chondrocytes (C518). D: Relative \u003c/strong\u003e\u003ca href=\"https://www.sciencedirect.com/topics/medicine-and-dentistry/protein-expression\" title=\"Learn more about protein expression from ScienceDirect's AI-generated Topic Pages\"\u003e\u003cstrong\u003eprotein expression\u003c/strong\u003e\u003c/a\u003e\u003cstrong\u003e of MMP-13 normalized to GAPDH. E: Relative \u003c/strong\u003e\u003ca href=\"https://www.sciencedirect.com/topics/medicine-and-dentistry/protein-expression\" title=\"Learn more about protein expression from ScienceDirect's AI-generated Topic Pages\"\u003e\u003cstrong\u003emRNA expression\u003c/strong\u003e\u003c/a\u003e\u003cstrong\u003e of MMP-13. Data are expressed as mean ± SD from three independent experiments. **** p \u0026lt; 0.0001.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8629442/v1/6f5ced9a25611c2b64de297b.png"},{"id":107916917,"identity":"218a6a6c-1b6e-4c8b-9590-e40f9a4cdfbe","added_by":"auto","created_at":"2026-04-27 14:20:04","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":65521,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-107-3p overexpression alleviates chondrocyte pyroptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChondrocyte pyroptosis was assessed by evaluating NLRP3 expression using immunoblotting and qPCR to explore how miR-107-3p alleviates OA. Overexpression of miR-107-3p substantially downregulated NLRP3, and the protein and mRNA levels of cleaved-caspase-1 and GSDMD-N (Fig), indicating its protective role in suppressing pyroptotic cell death.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8629442/v1/557b3133024072896a2a7cd7.png"},{"id":107916919,"identity":"3c6d3a52-d51f-4344-9844-9b41b11246b6","added_by":"auto","created_at":"2026-04-27 14:20:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":180195,"visible":true,"origin":"","legend":"\u003cp\u003emiR-107-3p alleviates OA by regulating the NF-κB pathway. A: Immunofluorescence micrographs of p65 in different treatment groups (scale bar: 5μm). B: Representative western blot of p-p65 expression in rat chondrocytes (C518). C: Relative \u003ca href=\"https://www.sciencedirect.com/topics/medicine-and-dentistry/protein-expression\" title=\"Learn more about protein expression from ScienceDirect's AI-generated Topic Pages\"\u003eprotein expression\u003c/a\u003e of p-p65 normalized to GAPDH. D: Relative IL-1β levels across treatment groups. Data are expressed as mean ± SD from three independent experiments. * p \u0026lt; 0.05, **** p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8629442/v1/b57dca655747fade0c30441a.png"},{"id":109070231,"identity":"aeec66dc-6c3e-4907-a885-52b94f658984","added_by":"auto","created_at":"2026-05-12 10:29:39","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":692444,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8629442/v1/acf29108-2b39-41e2-b94e-9563c83763b9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"miR-107-3p alleviates osteoarthritis by regulating the NF-κB pathway to inhibit chondrocyte pyroptosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eOsteoarthritis (OA) is the most prevalent degenerative joint disorder, affecting nearly one-fourth of adults. Currently, no treatment effectively repairs joint cartilage damage or slows OA progression, and its pathogenesis remains poorly understood. Pyroptosis, an inflammatory form of programmed cell death mediated by inflammasomes, leads to cellular damage and the release of cytoplasmic contents [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. It is characterized by caspase-1 activation, triggering interleukin-1β (IL-1β) production and promoting inflammation [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Given its role in chondrocyte damage and extracellular matrix (ECM) degradation, targeting pyroptosis presents a promising therapeutic strategy for OA [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNumerous microRNAs (miRNAs) have been implicated in cartilage development, osteogenic differentiation, osteoclastic activity, and the pathogenesis of OA [\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The OA-related miRNAs can be categorized based on their functions, including the regulation of apoptosis, chondrocyte signaling pathways, and the A Disintegrin And Metalloproteinase with Thrombospondin Motifs (ADAMTS) and matrix metalloproteinase (MMP) pathways. Several studies have reported miRNA involvement in OA-related pyroptosis, such as miRNA upregulation in lipopolysaccharide (LPS)-treated chondrocytes, contributing to pyroptosis through the modulation of associated proteins [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. For instance, miR-140-5p targets cathepsin B (CTSB), inhibiting chondrocyte pyroptosis and mitigating OA progression [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Based on evidence from the literature indicating that miR-107-3p alleviates neuroinflammation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], it is hypothesized that it may similarly reduce chondrocyte inflammation in OA.\u003c/p\u003e \u003cp\u003eDespite advancements in OA research, the role of cell pyroptosis in OA pathogenesis remains incompletely understood [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Nuclear factor-kappa B (NF-κB) is a crucial transcription factor in DNA regulation, cytokine production, and cell survival. Present in nearly all animal cell types, NF-κB plays a significant role in various diseases, including rheumatoid arthritis and inflammatory conditions affecting the heart and brain. Pharmacological inhibition of the NF-kB signaling pathway has emerged as a potential therapeutic strategy [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The NF-κB activation is essential for initiating the NOD-, LRR-, and pyrin domain-containing protein 3 (NLRP3) inflammasome, making its blockade a promising approach for targeted inhibition of cell apoptosis [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It was hypothesized that miR-107-3p modulates the NF-κB pathway, thereby mitigating OA progression.\u003c/p\u003e \u003cp\u003eThis study aimed to investigate the role and underlying mechanisms of miR-107-3p in OA, offering novel insights into miRNA-based targeted therapy.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1.1 Cell culture and treatment\u003c/h2\u003e \u003cp\u003eRat immortalized chondrocytes (C518) were obtained from Shanghai Yaji Biotechnology Co., Ltd. (Shanghai, China) and cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS), 100 U/mL penicillin, and 100 \u0026micro;g/mL streptomycin at 37\u0026deg;C in a humidified 5% CO\u003csub\u003e2\u003c/sub\u003e incubator. Cells were stimulated with tumor necrotic factor-α (TNF-α) (20 ng/mL) for 48 hours to establish an OA model. The miR-107-3p overexpression was induced via lentiviral transfection (Shandong Weizhen, China) for 48 hours using Lipofectamine 3000 (Invitrogen, USA), following the manufacturer\u0026rsquo;s protocol.The sequences of the miR-107-3p mimic is TCCCCACAGACCCAGAGCCGTTCAAGAGACGGCTCTGGGTCTGTGGGGATTTTTT.The sequences of the miR-107-3p mimics negative control is TTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTT.The name of the lentiviral vector is plent-U6-mir-107-3p-CMV-copGFP-P2A-Puro. The regulatory role of miR-107-3p was examined in chondrocyte pyroptosis by assigning the cells to three groups: NC group (control chondrocytes), OA group (chondrocytes treated with TNF-α), and OA\u0026thinsp;+\u0026thinsp;miR-107-3p group (chondrocytes treated with TNF-α and transfected with miR-107-3p).\u003c/p\u003e \u003cp\u003eMeanwhile, discarded cartilage specimens were obtained from ten male patients undergoing knee arthroplasty for OA. Written informed consent was obtained from all participants, and the study adhered to the principles of the Declaration of Helsinki. According to the International Cartilage Repair Society (ICRS) classification [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], undamaged cartilage (ICRS Grade 0) was categorized into one group, while damaged cartilage (ICRS Grades 1\u0026ndash;4) formed another. All patients have obtained written informed consent.These cartilage samples were collected in Fuxin Central Hospital from May 2022 to December 2022, and archived cartilage tissues were used in this experiment.The Ethics Committee of Central Hospital (Fuxin, China; approval number:RB-RT-2005-051) approved the study protocol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e1.2 CCK-8 assay\u003c/h2\u003e \u003cp\u003eWhen cell confluence reached 90%, cells in the logarithmic growth phase were seeded into 96-well plates following the instructions of the cell counting kit-8 (CCK-8) kit (Soleibao, China). Optical density (OD) values were measured at 450 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e1.3 Immunofluorescence analysis\u003c/h2\u003e \u003cp\u003eChondrocytes were subjected to group-specific treatments before fixation with 4% paraformaldehyde and permeabilization with Triton X-100 (Sigma-Aldrich, Darmstadt, Germany) to ensure optimal cell morphology and vitality. Cells were incubated overnight at 4℃ with primary antibodies (p65, 1:200; Collagen Type II Alpha 1 Chain [COL2A1], 1:200), followed by Cy3-labeled goat anti-rabbit IgG (1:100) in the dark. Finally, 4\u0026prime;,6-diamidino-2-phenylindole (DAPI) was used for nuclear staining, and images were captured after sealing the slides.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e1.4 Enzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003eOnce cell confluence reached 80%, treatments were applied, and the culture supernatant was collected for analysis. The concentration of IL-1β in the medium was measured using a rat ELISA kit (CoBio, Shanghai, China), following the manufacturer's protocol. Absorbance was recorded at 450 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e1.5 Western blot analysis\u003c/h2\u003e \u003cp\u003eCells were lysed using radioimmunoprecipitation assay (RIPA) lysis buffer, and total protein was extracted according to the protocol. After centrifugation, the lysate was collected, and protein concentration was quantified using a bicinchoninic acid (BCA) assay kit. Equal amounts of protein were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene fluoride (PVDF) membranes (Millipore, USA). Membranes were blocked with 5% skim milk at room temperature for 1 hour, then incubated overnight at 4\u0026deg;C with primary antibodies: anti-MMP13 (Affinity Biosciences), cleaved-caspase-1 (Affinity), anti-gasdermin D (GSDMD) (Affinity), anti-NLRP3 (Affinity), anti-phosphorylated (p)-p65 (Affinity), and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Wuhan Sanying Biotechnology Co., Ltd., Wuhan, Hubei, China). After incubation with corresponding secondary antibodies, grayscale analysis was performed using ImageJ software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e1.6 Quantitative Fluorescence Polymerase Chain Reaction (PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using TRIzol (Invitrogen) and reverse-transcribed into complementary DNA (cDNA) with a reverse transcription kit (Full Gold). Quantitative Reverse Transcription (qRT)-PCR was performed using the PerfectStart\u0026reg; Green qPCR SuperMix kit (Full Gold) under the following conditions: initial denaturation at 95℃ for 3 min, followed by 40 cycles of 95℃ for 30 s, 58℃ for 45 s, and extension at 72℃ for 6 min. GAPDH served as the internal control, and relative gene expression was calculated using the 2^-ΔΔCt method. Primers (synthesized by Wuhan Bolf Biodesign [Wuhan, China]) were as follows: Rat NLRP3: F: GCACCAAAGAGCCTAGCAGA, R: GAATGTCTCCCCTCACAGCC; Rat MMP13: F: TGAGTTTGCAGAGCACTACTTG, R: CAGGCACTCCACATCTTGGT; Rat GSDMD-N : F: GTGAGCCACCCTGCTATTCA, R: GCAGGCATCCAGGCAATAGA; Rat cleaved-caspase-1: F: GACCGAGTGGTTCCCTCAAG, R: GACGTGTACGAGTGGGTGTT; rno-miR-107-3p loop primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGATAGCC; rno-miR-107-3p F primer: TGCGCAGCAGCATTGTACAGG; Rat GAPDH: F: ACTCTACCCACGGCAAGTTC, R: TGGGTTTCCCGTTGATGACC;U6:F:CGCTTCGGCAGCACATATAC,R:AAATATGGAACGCTTCACGA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e1.7 Statistical Analysis\u003c/h2\u003e \u003cp\u003eData analysis and visualization were performed using GraphPad Prism 9.0. Statistical significance was assessed using one-way analysis of variance (ANOVA) or t-tests. Results are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD), and statistical significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. All experiments were conducted at least three times.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Downregulation of miR-107-3p in human and OA chondrocytes\u003c/h2\u003e \u003cp\u003eDiscarded cartilage samples were obtained from knee replacement surgeries to examine miR-107-3p expression in OA. Cartilage was classified into damaged (D) and undamaged (U) areas based on the extent of degeneration. The qPCR analysis revealed that miR-107-3p expression was significantly downregulated in OA cartilage (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. A). Subsequently, TNF-α-treated rat immortalized chondrocytes exhibited miR-107-3p downregulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. B), reinforcing its potential role in OA pathogenesis. These findings validated the transfection efficiency of miR-107-3p lentivirus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.2 miR-107-3p overexpression enhances chondrocyte anabolism and suppresses catabolism\u003c/h2\u003e \u003cp\u003eAlthough miR-107-3p is downregulated in OA, its functional role remains unclear. Therefore, OA chondrocytes were transfected with overexpressed miR-107-3p, and a significant increase was observed in cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. A). Immunofluorescence staining, immunoblotting, and qPCR analyses demonstrated that miR-107-3p upregulated the anabolic marker type II collagen while downregulating the catabolic marker MMP-13 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. B, C, D, E). These results suggest that miR-107-3p mitigates OA-associated chondrocyte degeneration.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.3 miR-107-3p overexpression alleviates chondrocyte pyroptosis\u003c/h2\u003e \u003cp\u003eChondrocyte pyroptosis was assessed by evaluating NLRP3 expression using immunoblotting and qPCR to explore how miR-107-3p alleviates OA. Overexpression of miR-107-3p substantially downregulated NLRP3, and the protein and mRNA levels of cleaved-caspase-1 and GSDMD-N (Fig.\u0026nbsp;3), indicating its protective role in suppressing pyroptotic cell death.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.4 miR-107-3p mitigates chondrocyte inflammation via NF-κB pathway regulation\u003c/h2\u003e \u003cp\u003eTumor necrosis factor-α (TNF-α) activates the NF-κB signaling pathway in chondrocytes [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Consistent with this, immunofluorescence confirmed that TNF-α treatment of rat chondrocytes (C518) induced nuclear translocation of p65 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e. A). Immunoblotting further revealed increased p-p65, confirming NF-κB activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e4\u003c/span\u003e. B, C). However, miR-107-3p overexpression reversed this effect, inhibiting NF-κB signaling and reducing chondrocyte inflammation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOur findings establish miR-107-3p as a potent NF-κB inhibitor that regulates chondrocyte pyroptosis by modulating the NF-κB signaling pathway. Therefore, we propose that the miR-107-3p/NF-κB axis plays a crucial role in OA progression by influencing chondrocyte survival and inflammatory responses.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDespite decades of research, OA remains challenging to treat [19\u0026ndash;20]. No drugs offer high efficacy and minimal side effects [21]. Non-coding RNAs, especially miRNAs, mediate cellular pyroptosis in various diseases [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and are closely linked to musculoskeletal injuries [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. The miRNAs regulate cell pyroptosis, autophagy, and apoptosis through multiple signaling pathways, including Wingless/Integrated (Wnt)/β-catenin, transforming growth factor (TGF-β), Phosphoinositide 3-kinase (PI3K)/Protein kinase B (AKT)/Mammalian target of rapamycin pathway, and NLRP3/caspase-1. As key regulators of OA cartilage homeostasis and chondrocyte proliferation, miRNAs influence cell survival and renewal, while their deficiency accelerates cartilage degeneration [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003emiR-107 is widely expressed in mammalian organs, particularly brain tissue [25], where it participates in numerous biological processes. However, its function in chondrocytes remains unclear. Our study demonstrated that miR-107-3p is considerably downregulated in OA cartilage, providing a foundation for further investigation.\u003c/p\u003e \u003cp\u003eThe OA chondrocytes exhibit reduced matrix synthesis and increased catabolic activity [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The ECM is essential for cartilage integrity, and its degradation contributes to OA progression [28\u0026ndash;29]. Proteoglycan aggregates and type II collagen, both key ECM components, are vital in maintaining cartilage function [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Matrix metalloproteinases (MMPs), particularly MMP-13, play a key role in the degradation of aggrecans and type II collagen, contributing to ECM breakdown in OA pathogenesis [31\u0026ndash;32]. Our findings indicate that miR-107-3p enhances matrix synthesis while mitigating chondrocyte damage by regulating MMP-13 and type II collagen expression. The ELISA results further confirmed that miR-107-3p suppresses IL-1β expression, reducing inflammation. Collectively, these findings suggest that miR-107-3p exerts a protective effect on chondrocytes.\u003c/p\u003e \u003cp\u003eRecent studies have implicated chondrocyte pyroptosis in OA progression [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. However, research on pyroptosis in OA remains in its early stages, and the precise regulatory mechanisms are not yet fully understood [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The classic inflammatory pathway is driven by caspase-1 activation rather than caspase-11 (in mice) or caspase-4/5 (in humans) [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In this pathway, the NLRP3 inflammasome responds to pathogen- or damage-associated molecular patterns (PAMPs/DAMPs), triggering caspase-1-mediated cytokine release and GSDMD-dependent pyroptosis. Xu Liang et al. [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] demonstrated that TNF-α (20 ng/mL) induces chondrocyte pyroptosis in rat models, leading to cell membrane rupture, increased NLRP3 levels, and elevated expression of IL-1β and MMP-13, successfully establishing an OA cell model. Similarly, our study utilized TNF-α to induce chondrocyte pyroptosis, and miR-107-3p lentiviral transfection significantly reduced pyroptosis markers.\u003c/p\u003e \u003cp\u003eBougault et al. [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e37\u003c/span\u003e] reported that NLRP3 deletion did not suppress MMP-3, MMP-9, or MMP-13 expression in cultured chondrocytes, nor did caspase-1 or IL-1β inhibition. Similarly, Busso et al. [38] found that IL-1α and IL-1β were not essential mediators of OA in a mouse model, and IL-1α or NLRP3 deficiency exacerbated cartilage erosion. These findings suggest that IL-1β inhibition alone is unlikely to be a viable therapeutic strategy. Given these insights, our study focused on the NF-κB pathway, a critical regulator of inflammation in OA. NF-κB activation promotes the expression of cleaved caspase-1, NLRP, and IL-1β, exacerbating inflammatory responses [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Our results demonstrate that miR-107-3p inhibits NF-κB signaling, thereby attenuating chondrocyte inflammation.\u003c/p\u003e \u003cp\u003eThis study has several limitations. First, immortalized rat chondrocytes were utilized instead of primary chondrocytes, which may introduce variations in experimental outcomes. Second, in vivo validation was not performed, limiting the translational relevance of our findings. Finally, our human cartilage samples were limited to 10 male patients, potentially restricting the generalizability of our results. Future studies will expand the sample size, including female patients, to assess the impact of these limitations on our conclusions.\u003c/p\u003e \u003cp\u003eIn summary, it is demonstrated that miR-107-3p is downregulated in chondrocytes and cartilage of rats and patients with OA. Importantly, our findings suggest that miR-107-3p alleviates OA progression by regulating the NF-κB pathway and inhibiting chondrocyte pyroptosis, highlighting its potential as a therapeutic target. Additional in vivo studies in rat models will be conducted to validate these findings.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eAll authors declare no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e \u003cp\u003e The Ethics Committee of Fuxin Central Hospital approved this study.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003ePatient consent for publication\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was partially supported by the Fund of Central Hospital of Fuxin (Project No. FZX-YJKY-019) to LW.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eWang Lei conceptualized the study, performed the experiments, and drafted the manuscript. Zhang Miao and Yang Cao contributed to data collection. All authors have approved the final version for publication.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eNot applicable\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe strip has been uploaded as an auxiliary file.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003e\u003cspan\u003eWang, T. Q. et al. A novel extracellular vesicles production system harnessing matrix homeostasis and macrophage reprogramming mitigates osteoarthritis[J]. \u003cem\u003eJ. Nanobiotechnol.\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e (1), 79 (2024).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWu, Q. C. et al. Micro(nano)-plastics exposure induced programmed cell death and corresponding influence factors[J]. \u003cem\u003eSci. Total Environ.\u003c/em\u003e \u003cstrong\u003e921\u003c/strong\u003e, 171230 (2024).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHe, Y. Hara H,Nunez G.Mechanism and regulation of NLRP3 inflammasome activation[J]. \u003cem\u003eTrends Biochem. Sci.\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 1012\u0026ndash;1021 (2016).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBao, J., Chen, Z., Xu, L., Wu, L. \u0026amp; Xiong, Y. \u003cem\u003eRapamycin protects chondrocytes against IL-18-induced apoptosis and ameliorates rat osteoarthritis\u003c/em\u003e Vol. 12, 5152\u0026ndash;5167 (Aging, 2020). 6.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePeng, Y. W. et al. Non-coding RNAs involved in fibroblast-like synoviocyte functioning in arthritis rheumatoid: From pathogenesis to therapy[J].Cytokine,2024,173:156418.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eYirixiati Aihaiti, X. et al. Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis[J]. \u003cem\u003eMol. Med. Rep.\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e (4), 3513\u0026ndash;3524 (2020).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZhang, R. et al. Identification of potential biomarkers for differential diagnosis between rheumatoid arthritis and osteoarthritis via integrative genome-wide gene expression profiling analysis[J]. \u003cem\u003eMol. Med. Rep.\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e (1), 30\u0026ndash;40 (2019 ).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eRoszkowski, S. Therapeutic potential of mesenchymal stem cell-derived exosomes for regenerative medicine[J]. \u003cem\u003eClin. Exp. Med.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e (1), 46 (2024).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLi, G. et al. miR-155 inhibits chondrocyte pyroptosis in knee osteoarthritis by targeting SMAD2 and inhibiting the NLRP3/Caspase-1 pathway[J]. \u003cem\u003eJ. Orthop. Surg. Res.\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 48 (2022).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZhou, B. et al. Tanshinone IIA ameliorates inflammation response in osteoarthritis via inhibition of miR-155/FOXO3 axis[J].Pharmacology,2021,\u003cstrong\u003e106\u003c/strong\u003e:20\u0026ndash;28 .\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZhang, L. et al. MicroRNA-140-5p represses chondrocyte pyroptosis and relieves cartilage injury in osteoarthritis by inhibiting cathepsin B/Nod-like receptor protein 3[J].Bioengineered,2021,\u003cstrong\u003e12\u003c/strong\u003e(2):9949\u0026ndash;9964 .\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eJin-Jin Song,Hui Li,Nan Wang,et al.Gastrodin ameliorates the lipopolysaccharide-induced neuroinflammation in mice by downregulating miR-107-3p[J].Front Pharmacol,2022,8:13:1044375 .\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZhang, Y. et al. CY-09 attenuates the progression of osteoarthritis via inhibiting NLRP3 inflammasome-mediated pyroptosis[J]. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cstrong\u003e553\u003c/strong\u003e, 119\u0026ndash;125 (2021).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKao, W. C. et al. The Role of Autophagy in Osteoarthritic Cartilage[J].Biomolecules,2022,\u003cstrong\u003e12\u003c/strong\u003e(10):1357 .\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHe, Y. Hara H,Nunez G.Mechanism and regulation of NLRP3 inflammasome activation[J]. \u003cem\u003eTrends Biochem. Sci.\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 1012\u0026ndash;1021 (2016).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBorne, M. P. J. et al. International Cartilage Repair Society (ICRS) and Oswestry macroscopic cartilage evaluation scores validated for use in Autologous Chondrocyte Implantation (ACI) and microfracture[J]. \u003cem\u003eOsteoarthr. Cartil.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e (12), 1397\u0026ndash;1402 (2007).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSu, X. Y. et al. DNMT3A promotes glioma growth and malignancy via TNF-\u0026alpha;/NF-\u0026kappa;B signaling pathway[J]. \u003cem\u003eTransl Cancer Res. 2024\u003c/em\u003e, \u003cstrong\u003e13\u003c/strong\u003e(4):1786\u0026ndash;1806 .\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSYin, Q. et al. Anti-rheumatoid arthritis effects of traditional Chinese medicine Fufang Xiaohuoluo pill on collagen-induced arthritis rats and MH7A cells[J].Front Pharmacol,2024,15:1374485.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eShiyu, D. X. et al. Quercetin attenuates the symptoms of osteoarthritis in vitro and in vivo by suppressing ferroptosis via activation of AMPK/Nrf2/Gpx4 signaling[J].Mol Med Rep, 31(3):60.\u0026nbsp;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTianlong Pan, Dengying Wu, Alpha-Mangostin protects rat articular chondrocytes against IL-1\u0026beta;-induced inflammation and slows the progression of osteoarthritis in a rat model.Int Immunopharmacol. 2017;52:34\u0026ndash;43. doi: 10.1016/j.intimp.\u0026nbsp;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eQi Guo, Meng Zhang, Yonghui Dong.Isobavachalcone ameliorates the progression of osteoarthritis by suppressing NF-\u0026kappa;B signaling pathway.Int Immunopharmacol. 2023;119:110102. (2025). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.intimp.2023.110102\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLi, A. et al. MiR-135b protects cardiomyocytes from infarction through restraining the NLRP3/caspase-1/IL-1beta pathway[J]. \u003cem\u003eInt. J. Cardiol.\u003c/em\u003e \u003cstrong\u003e307\u003c/strong\u003e, 137\u0026ndash;145 (2020).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eGiordano, L. et al. Therapeutic potential of microRNA in tendon injuries[J]. \u003cem\u003eBr. Med. Bull.\u003c/em\u003e \u003cstrong\u003e133\u003c/strong\u003e (1), 79\u0026ndash;94 (2020).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSwingler, T. E. et al. The function of microRNAs in cartilage and osteoarthritis[J]. \u003cem\u003eClin. Exp. Rheumatol. 2019\u003c/em\u003e, \u003cstrong\u003e37\u003c/strong\u003e(5):40\u0026ndash;47 .\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBaskerville, S. \u0026amp; Bartel, D. P. Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes. \u003cem\u003eRNA\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 241\u0026ndash;247. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1261/rna.7240905\u003c/span\u003e\u003c/span\u003e (2005).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eChen, B. \u0026amp; Fu, W. Chunyang Jie,et al.GPX7 reduces chondrocyte inflammation and extracellular matrix degradation triggered by IL\u0026ndash;1\u0026beta;, via a mechanism mediated by ferroptosis[J]. \u003cem\u003eMol. Med. Rep.\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e (1), 118 (2024 ).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBalaskas, P. et al. MicroRNA Signatures in Cartilage Ageing and Osteoarthritis[J].Biomedicines,2023,11(4): 1189.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKrishnan, Y. \u0026amp; Grodzinsky, A. J. Cartilage diseases. \u003cem\u003eMatrix Biol.\u003c/em\u003e \u003cstrong\u003e71\u0026ndash;72\u003c/strong\u003e, 51\u0026ndash;69. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.matbio.2018.05.005\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLiu, C. et al. Protective effects of the pericellular matrix of chondrocyte on articular cartilage against the development of osteoarthritis. \u003cem\u003eHistol. Histopathol\u003c/em\u003e. \u003cstrong\u003e33\u003c/strong\u003e (8), 757\u0026ndash;764. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.14670/HH-11-967\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eShahid, M. et al. A systemic review of existing serological possibilities to diagnose canine osteoarthritis with a particular focus on extracellular matrix proteoglycans and protein. \u003cem\u003ePol. J. Vet. Sci.\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e (1), 189\u0026ndash;201. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1515/pjvs-2017-0024\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMalemud, C. J. et al. Matrix metalloproteinase-9 production by immortalized human chondrocyte lines. \u003cem\u003eJ. Clin. Cell. Immunol.\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e (3), 422. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.4172/2155-9899.1000422\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMehana, E. E., Khafaga, A. F. \u0026amp; El-Blehi, S. S. The role of matrix metalloproteinases in osteoarthritis pathogenesis: an updated review. \u003cem\u003eLife Sci.\u003c/em\u003e \u003cstrong\u003e234\u003c/strong\u003e, 116786. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.lfs.2019.116786\u003c/span\u003e\u003c/span\u003e (2019).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZhou, J. Y. et al. \u0026alpha;-Solanine attenuates chondrocyte pyroptosis to improve osteoarthritis via suppressing NF-\u0026kappa;B pathway[J]. \u003cem\u003eJ. Cell. Mol. Med. 2024\u003c/em\u003e, \u003cstrong\u003e28\u003c/strong\u003e(4):e18132 .\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eQi, W. Z. et al. Modulating synovial macrophage pyroptosis and mitophagy interactions to mitigate osteoarthritis progression using functionalized nanoparticles[J]. \u003cem\u003eActa Biomater.\u003c/em\u003e \u003cstrong\u003e181\u003c/strong\u003e, 425\u0026ndash;439 (2024).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKayagaki, N. et al. Non-canonical inflammasome activation targets caspase-11. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e479\u003c/strong\u003e, 117\u0026ndash;121 (2011).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eXu Liang, W. \u0026amp; Yujiao Yuan Xiaoyang, etc Establishment and evaluation of TNF - \u0026alpha; induced chondrocyte pyroptosis model in rats [J]. \u003cem\u003eJ. Anhui Med. Univ.\u003c/em\u003e \u003cstrong\u003e57\u003c/strong\u003e (5), 781\u0026ndash;785 (2022).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBougault, C. et al. Stress-induced cartilage degradation does not depend on the NLRP3 inflammasome in human osteoarthritis and mouse models[J].Arthritis Rheum, \u003cstrong\u003e64\u003c/strong\u003e:3972\u0026ndash;3981. (2012).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLu, J. P., Wu, Z. X. \u0026amp; Xiong, Y. Knockdown of long noncoding RNA HOTAIR inhibits osteoarthritis chondrocyte injury by miR-107/CXCL12 axis[J]. \u003cem\u003eJ. Orthop. Surg. Res.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e (1), 410 (2021).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eJian Yang, S. Targeting Cell Death: Pyroptosis, Ferroptosis, Apoptosis and Necroptosis in Osteoarthritis. \u003cem\u003eFront. Cell. Dev. Biol.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 789948 (2022).\u003c/span\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"miR-107-3p, NF-κB, Osteoarthritis, pyroptosis","lastPublishedDoi":"10.21203/rs.3.rs-8629442/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8629442/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOsteoarthritis (OA) is a degenerative disease with a complex pathogenesis, making it difficult to treat. Although miR-107-3p is dysregulated in arthritis, its role in OA remains unexplored. This study investigated the function and mechanism of miR-107-3p in OA. Our findings revealed that miR-107-3p is downregulated in patients with OA and chondrocytes. Its overexpression suppresses chondrocyte pyroptosis, enhances cell viability, promotes anabolic activity, downregulates catabolism, alleviates inflammation, inhibits p65 nuclear translocation, decreases p-p65 levels, and suppresses NF-κB signaling. These results suggest that miR-107-3p mitigates OA-related chondrocyte inflammation and injury by inhibiting pyroptosis.\u003c/p\u003e","manuscriptTitle":"miR-107-3p alleviates osteoarthritis by regulating the NF-κB pathway to inhibit chondrocyte pyroptosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-27 14:20:00","doi":"10.21203/rs.3.rs-8629442/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"9c2b458b-315a-44c1-8ff3-799192804e2e","owner":[],"postedDate":"April 27th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":66940020,"name":"Biological sciences/Cell biology"},{"id":66940021,"name":"Health sciences/Diseases"},{"id":66940022,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-04-28T12:59:26+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-27 14:20:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8629442","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8629442","identity":"rs-8629442","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00