Generation of GJB2 Gene-Edited Porcine Embryos as a Model for Human Congenital Deafness via CRISPR/Cas9 and Cytosine base editors

preprint OA: closed
Full text JSON View at publisher
Full text 187,761 characters · extracted from preprint-html · click to expand
Generation of GJB2 Gene-Edited Porcine Embryos as a Model for Human Congenital Deafness via CRISPR/Cas9 and Cytosine base editors | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Generation of GJB2 Gene-Edited Porcine Embryos as a Model for Human Congenital Deafness via CRISPR/Cas9 and Cytosine base editors Celia Piñeiro-Silva, Pablo Bermejo-Álvarez, Francisco José García-Purriños, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7999953/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 18 Apr, 2026 Read the published version in Scientific Reports → Version 1 posted 4 You are reading this latest preprint version Abstract Mutations in the GJB2 gene, which encodes Connexin 26 (Cx26), are responsible for the majority of cases of non-syndromic congenital hearing loss in humans. While murine GJB2 knockout models have provided mechanistic insight, anatomical and physiological differences limit their translational relevance. Pigs represent a valuable large-animal model because their auditory anatomy and maturation closely resemble those of humans. This study compared two genome-editing approaches to disrupt GJB2 in porcine oocytes before fertilization: (1) electroporation with CRISPR/Cas9 ribonucleoprotein and (2) microinjection with cytosine base editor (BE3) and single-guide RNAs (sgRNAs). Electroporation produced high mutation rates (70–90%) across three concentrations of Cas9/sgRNA but yielded mostly heterozygous or mosaic blastocysts, with limited homozygous knockouts (< 4%). BE3 achieved precise cytosine-to-thymine conversions that introduced premature stop codons, reaching up to 47% total editing and 20% homozygous nonsense alleles. However, blastocyst formation declined at higher component concentrations. Overall, BE3 produced more predictable mutations than conventional CRISPR/Cas9, although embryo developmental competence was dose-dependent. Both methods effectively targeted GJB2 and demonstrated feasibility of pre-fertilization genome editing in porcine oocytes. These findings establish the groundwork for generating GJB2 -deficient pigs as translational models of Cx26-related congenital deafness and for future evaluation of gene-therapy strategies in a large-animal system. Biological sciences/Biological techniques Biological sciences/Biotechnology Biological sciences/Developmental biology Biological sciences/Genetics Biological sciences/Molecular biology Pig embryos CRISPR/Cas9 cytosine base editor GJB2 Connexin 26 gene editing hearing loss Figures Figure 1 Figure 2 Figure 3 1. Introduction The Introduction section, of referenced text1 expands on the background of the work (some overlap with the Abstract is acceptable). The introduction should not include subheadings. Connexin 26 (Cx26) deficiency is a leading cause of hearing loss worldwide [ 1 ]. It accounts for over 50% of cases of non-syndromic hearing loss and is estimated to affect 1 in 500 newborns and 1 in 300 children by the age of four [ 2 ]. Cx26, encoded by the Gap Junction Beta 2 gene ( GJB2 ), forms gap junctions between supporting cells in the organ of Corti. These junctions are crucial for potassium recycling and intercellular signaling in the inner ear, facilitating the movement of ions and small molecules that are necessary for auditory function [ 3 ]. Defective trafficking, misfolding or aberrant oligomerization of Cx26 results in non-functional hemichannels and/or an inability to form gap junctions [ 4 ]. In particular, various point mutations and premature stop codons within the GJB2 gene have been linked to Cx26-related hearing loss [ 1 ]. These mutations occur throughout the 226 amino acids of the protein, resulting in different deafness phenotypes depending on which regions are affected [ 5 ]. The severity of hearing loss associated with GJB2 mutations can range from mild to profound, depending on the specific mutation (revised by Ke et al. [ 3 ]). GJB2 knockout (KO) and conditional knockout (cKO) mouse models have provided valuable insight into the mechanisms of congenital deafness, including cochlear developmental abnormalities, hair cell degeneration and reduced endocochlear potential [ 6 – 11 ]. The efficacy of gene therapy for the safe and effective correction of the disease has also been explored using these murine KO models [ 10 , 12 , 13 ]. Unfortunately, despite these useful insights, murine models differ from humans in terms of size, anatomy and physiology and large animal models are required to test potential clinical interventions in humans. Pigs constitute a particularly well-suited model to perform auditory studies due to the anatomical and physiological similarities between their auditory system and that of humans [ 13 , 14 ]. Due to the anatomical similarities, pigs have been widely used in developing surgical techniques for cochlear fenestration and fine tomography and they arguably constitute the closest model (second to primates) to study hearing loss and test potential treatments [ 15 – 17 ]. Besides, and in contrast to rodents whose auditory systems mature after birth, pigs and humans display a more mature auditory system at birth [ 14 ]. Moreover, the structure of GJB2 gene is similar between humans and pigs: in both species it contains two exons and the entire coding sequence is located in exon 2 [ 18 ]. Consequently, generating GJB2 mutant pigs could significantly impact on the study of genetic hearing loss and the development of therapeutic solutions. Recent advances in gene editing have led to the development of pig models with human-equivalent GJB2 mutations. Xie et al. reported the successful generation of gene-edited pigs with orthologous human mutations using an innovative CRISPR/Cas9 approach [ 18 ]. Their method involved double-cutting, using CRISPR/Cas9 with two single guide RNAs (sgRNAs) to generate cuts flanking the target mutation site, and homology-directed repair (HDR) using long single-stranded DNA (lssDNA) as templates for precise mutation insertion. They generated two porcine models with GJB2 p.V37I and GJB2 c.235delC mutations. These mutations are particularly relevant because they are the most common GJB2 mutations observed in Asian populations [ 19 ]. The objective of this study has been to optimize techniques to generate a porcine model that replicates the functional impairment of Cx26 seen in human congenital deafness. In particular, we have tested the efficiency of two advanced gene editing methods: electroporation delivery of the CRISPR/Cas9 system and microinjection delivery of a cytosine base editor (CBE). This model, which introduces precise mutations in the GJB2 gene, will serve as a valuable tool for studying the underlying mechanisms of hearing loss and testing potential therapeutic interventions. 2. Material and methods 2.1. Ethical issues This work was approved by the Ethics Committee of the University of Murcia and the Murcia Regional Government for the use of Genetically Modified Organisms (Establishment license Reference A/ES/16/I-22; Activity reference A/ES/16/79; Project GENOCRISPR reference A13221206). 2.2. Chemicals and reagents Unless otherwise indicated, all chemicals were purchased from Merck Life Science S.L.U. (Madrid, Spain). 2.3. sgRNA design For the conventional CRISPR/Cas9 system, a single-guide RNA (sgRNA) targeting the GJB2 gene was designed using software from the National Center for Biotechnology of the Spanish National Research Council (CNB-CSIC; https://bioinfogp.cnb.csic.es/tools/breakingcas , Table 1 ) [ 20 ]. The sgRNA and Cas9 protein were purchased from Integrated DNA Technologies (IDT, Leuven, Belgium). Ribonucleoprotein complexes were prepared according to the manufacturer's instructions. Table 1 Target sequences for the sgRNAs designed for electroporation (experiment 1) and base editing (CBE, experiment 2). PAM sequence is indicated in bold letters. Sequence (5’◊3’) sgRNA for electroporation TTTCTTCTCGTGTCGCCGGT AGG sgRNA 1 for BE ACCGGCGACACGAGAAGAAA AGG sgRNA 2 for BE ACCCAGAAGGTCCGCATCGA GGG sgRNA 3 for BE GCCACGCGTTGCACTTGACC AGG As an alternative, GJB2 ablation was achieved by generating a stop codon with the cytosine base editor BE3 (CBE) [ 21 ]. Unlike CRISPR/Cas9-induced double-strand break (DSB) gene editing, which leads to randomly generated indels, CBE converts cytosine to thymidine. This conversion can generate a stop codon, thereby disrupting protein formation [ 22 ]. Three different sgRNAs were designed to target the unique coding exon of GJB2 , which produces a protein consisting of 226 amino acids (Table 1 ). Specifically, sgRNA 1 was designed to convert CGA to TGA, resulting in a 98 amino acid-long truncated protein; sgRNA 2 was designed to convert CAG to TAG, resulting in a 123 amino acid-long truncated protein; and sgRNA 3 was designed to convert TGG to TAG, TGA, or TAA, resulting in a 171 amino acid-long truncated protein. sgRNAs were synthesized using the Guide-it ™ sgRNA In Vitro Transcription kit (Takara Bio Europe, France) with primers containing a T7 promoter and the sgRNA sequence, as previously described [ 23 ]. Capped polyadenylated CBE-encoding mRNA was produced by in vitro transcription using the T7 ULTRA kit® (Life Technologies) and the BbsI-linearized plasmid pCMV-BE3 (Addgene #73021). Finally, the mRNA was purified using the MEGAclear ™ kit (Thermo Fisher Scientific, Madrid, Spain). 2.4. In vitro maturation (IVM) Cumulus-oocyte complexes (COCs) were obtained from gilt ovaries at the slaughterhouse and were processed as previously described [ 24 ]. Briefly, the ovaries were transported in saline solution at 38 ºC, washed once in a 0.04% cetrimide solution and twice in saline solution, both at 38 ºC. The COCs were collected by aspiration from follicles measuring between 3 and 6 mm in diameter. They were washed in Dulbecco’s PBS with 0.2 g/l polyvinyl alcohol (DPBS-PVA) and subsequently in IVM medium (PIG-IVM1-LYO, Embryocloud, Murcia, Spain). Groups of 50 COCs were then cultured in 500 µl of PIG-IVM1-LYO medium, supplemented with 40 ng/mL fibroblast growth factor 2 (FGF2), 20 ng/mL leukemia inhibitory factor (LIF), and 20 ng/mL insulin-like growth factor 1 (IGF1) [ 25 ], for 20–22 hours at 38.5 ºC under 5% CO 2 and 7% O 2 conditions. This was followed by an additional 20–22 h in PIG-IVM2-LYO (Embryocloud, Murcia, Spain) supplemented with FGF2, LIF, and IGF1. After IVM, the COCs were denuded of cumulus cells by adding 25 µL of hyaluronidase at 0.5% to each well and gently pipetting until most of the cumulus cells were removed. 2.5 Electroporation of in vitro matured oocytes prior to in vitro fertilization (IVF) in the Presence of Cas9 protein and sgRNA Electroporation of the in vitro -matured oocytes was performed just before in vitro fertilization (IVF), as previously described by [ 26 ]. In brief, the oocytes were washed in Opti-MEM (Thermo Fisher Scientific. Madrid, Spain) and then electroporated on a slide between 1 mm gap electrodes (45–0104, BTX, Harvard Apparatus, Holliston, MA, USA), which were connected to an ECM 830 electroporation system (BTX, Harvard Apparatus, Holliston, MA, USA). Four pulses of 30 V with a pulse duration of 1 ms and an interval of 100 ms were applied, and the Cas9 protein and sgRNA concentrations were between 25 to 100 ng/µL and 12.5 to 50 ng/µL, respectively. 2.6. Microinjection of in vitro matured oocytes prior to IVF with CBE-encoding mRNA and sgRNA Microinjection of in vitro -matured oocytes was performed just before IVF, as previously described [ 27 ]. The oocytes were placed in a drop of DPBS-PVA that was covered by mineral oil. Then, an inverted Eclipse Ts2R microscope (Nikon, Tokyo, Japan) and a Transfer man 4R micromanipulation system (Eppendorf, Hamburg, Germany) were used to microinject the oocytes with a solution of CBE-encoding mRNA (100–200 ng/µL) and sgRNA (50–100 ng/µL) in Opti-MEM. 2.7. In vitro fertilization and embryo culture IVF was performed as previously described [ 28 ]. The i n vitro- matured oocytes were transferred to an IVF medium (PIG-IVF-LYO, Embryocloud, Murcia, Spain). The oocytes were inseminated with frozen-thawed ejaculated spermatozoa that were selected using a swim-up procedure [ 27 ]. In brief, a 0.25-ml straw of semen was thawed in a water bath at 38°C for 30 seconds. Then, the frozen-thawed semen was diluted in sperm swim-up medium (PIG-SUM-LYO, Embryocloud, Murcia, Spain) at 38 ºC. Sperm selection was performed by adding 1 ml of the sperm swim-up medium to a conical tube, followed by 1 ml of the thawed, diluted sperm added to the bottom of the tube. The tubes were then incubated at 38°C for 20 minutes at a 45° angle. Then, 500 µl of the top medium was aspirated, and the sperm was selected by swim-up and diluted in PIG-IVF-LYO. The oocytes were inseminated with a final concentration of 6000 sperm/ml. The gametes were co-cultured at 38.5 ºC with 5% CO 2 and 7% O 2 for 18–20 h. After co-culture, the remaining cumulus cells and zona-attached spermatozoa were removed from the putative zygotes by pipetting. The zygotes were then cultured in PIG-IVC1-LYO (Embryocloud, Murcia, Spain) for 24 h, followed by culturing in PIG-IVC2-LYO (Embryocloud, Murcia, Spain) at 38.5 ºC, 5% CO 2 and 7% O 2 until 156 h post fertilization (hpf) [ 27 ]. After culturing for 24 h in PIG-IVC1-LYO medium, the cleavage rate was evaluated, and 2–4 cell embryos were transferred to PIG-IVC2-LYO medium. On day 6.5, the formation of blastocysts was assessed, and the resulting blastocysts were retrieved. 2.8. Mutation analysis in blastocysts derived from electroporation and microinjection procedures The zona pellucida was removed from the blastocysts by incubating them in a solution of 0.5% pronase (a protease derived from the bacterium Streptomyces griseus ), followed by washing them in nuclease-free water. The zona-free blastocysts were then stored individually at -20°C until analysis. The Phire Animal Tissue Direct PCR Kit (Thermo Fisher Scientific, Madrid, Spain) was used for DNA extraction and PCR following the manufacturer's instructions. PCR reactions were performed using a 12.5 µl PCR reaction mix containing 0.5 µM primers (FW: 5’-CCACTACTTCCCCATCTCGC; REV: 5’- TTCGGTGACGTTGAGCAGAA) and 1 µl of sample. To detect the indels generated following the conventional CRISPR/Cas9 strategy, the blastocysts were genotyped by fluorescent PCR-capillary gel electrophoresis as previously described [ 27 ]. PCR was conducted using 6-FAM forward primers. After PCR amplification, the samples were diluted 1:100 v/v in TE buffer. Then 1 µl of the diluted samples was mixed with 11.5 µl Hi-DiTM formamide (Thermo Fisher Scientific. Madrid, Spain) and 0.1 µl GeneScanTM 500 LIZ Size Standard (Thermo Fisher Scientific. Madrid, Spain). Such mix was incubated at 95 ºC for 3 min and then immediately chilled on ice for 2 min. Subsequently, the samples were analyzed by capillary gel electrophoresis using a 3500 Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific. Madrid, Spain). The details of the instrumental protocol were similar to those described in a previous work [ 29 ]. This included a capillary length of 50 cm, POP7 polymer; a G5 dye set, a run voltage of 19.5 kV, a pre-run voltage of 15 kV, an injection voltage of 1.6 kV, a run time of 1330 s, a pre-run time of 180 s, an injection time of 15 s, a data delay of 1 s, a size standard of GS500 (250) LIZ, and a size-caller using SizeCaller v1.10 software. The results were analyzed using Gene Mapper 5 software (Applied Biosystems). To detect the cytosine substitutions generated by the CBE strategy, the PCR products were purified using the PureLink™ Quick Gel Extraction Kit (Invitrogen, Thermo Fisher Scientific. Madrid, Spain) and sequenced using the Sanger method. 2.9. Statistical analysis Data are presented as percentages or the mean ± standard error of the mean (SEM). All data analyses were performed using IBM SPSS Statistics for Windows, Version 28.0. (IBM Corp., Armonk, NY). Proportions (cleavage/oocyte, blastocyst/oocyte, edited/blastocyst, and KO-homozygous per blastocyst and per oocyte) were analyzed using generalized linear mixed models (binomial, logit link), including replicate as a random intercept (GENLINMIXED). When the effect was significant (p < 0.05), pairwise comparisons between groups were obtained from estimated marginal means with a Bonferroni adjustment for multiple comparisons. Continuous variables (number of alleles per embryo) that did not meet the assumptions of normality were analyzed using the nonparametric Kruskal–Wallis test. When the result was significant, the Conover–Iman test was used for pairwise comparisons. Finally, multi-cell genotype tables were analyzed using Fisher's exact test. All tests were two-sided, and significance was set at p < 0.05. 3. Experimental design Two in vitro experiments (Fig. 1 ) were performed to generate a premature stop codon in the GJB2 gene. In one experiment, conventional CRISPR/Cas9 system was delivered by electroporation to induce a double-strand break (DSB) at the target site, leading to the generation of random indels. The other experiment delivered CBE via microinjection to convert cytosine to thymine at specific sites. This conversion can generate a stop codon, thereby disrupting protein formation. 3.1. Oocyte electroporation with conventional CRISPR/Cas9 system. Effect of the concentration of sgRNA and Cas9 The goal was to disrupt the porcine GJB2 gene by generating random frame-disrupting insertions and/or deletions (indels) through non-homologous end joining (NHEJ) repair of double-strand breaks (DSBs) generated by the conventional CRISPR/Cas9 system. Randomly generated indels that are not multiple of three can disrupt the open reading frame of the gene, resulting in a truncated protein. Three different concentrations of the components of the CRISPR/Cas9 system were tested during electroporation of porcine in vitro- matured oocytes: 1x (25 ng/µL Cas9 protein and 12.5 ng/µL sgRNA), 2x (50 ng/µL Cas9 and 25 ng/µL sgRNA), and 4x (100 ng/µL Cas9 and 50 ng/µL sgRNA). A group without electroporation treatment served as the control. Three replicates were performed. Embryonic development was assessed in all the experimental groups, including cleavage rates and blastocyst formation rates. Blastocysts were genotyped using fluorescent PCR-capillary gel electrophoresis. The embryos were classified as wild type (WT) (containing no mutated alleles), heterozygous (containing WT and KO alleles), or homozygous KO (containing only alleles edited ). Other parameters were calculated from the edited blastocysts, including the mosaicism rate (the percentage of edited embryos containing more than two alleles). The number of alleles in edited embryos was also calculated, including wild-type (WT) alleles if present. The total and homozygous edition efficiency rate was calculated by dividing the number of gene-edited blastocysts by the total number of electroporated oocytes. This parameter simultaneously evaluates embryo development and mutation rates. 3.2. Oocyte microinjection with Cytosine Base Editor. Effect of components concentration and sgRNA designs The goal was to ablate the porcine GJB2 gene through the generation of a premature stop codon by the cytosine base editor BE3 (CBE) [ 21 ]. For each of the three designed sgRNAs, three to four cytosines in the GJB2 gene were susceptible to modification by the CBE. Thus, the editing rates were analyzed for each cytosine and sgRNA. In some cases, the change from cytosine to thymine was a silent mutation (no amino acid change), while in others, it induced a change in amino acids but not a stop codon (Fig. 2 ). The protocol was initially validated using sgRNA1. Two concentrations of the cytosine base editor and the sgRNAs were tested: 1x (100 ng/µL CBE and 50 ng/µL sgRNA) and 2x (200 ng/µL CBE and 100 ng/µL sgRNA). One group was microinjected with Opti-MEM only. This group served as the microinjection control for embryo development. Another group received no treatment. This group served as the non-microinjected control for embryo development. Subsequent experiments involving sgRNAs 2 and 3 tested the same two concentrations and compared developmental rates to those of the non-microinjected control. Three replicates were performed in all the experiments. Embryonic development was assessed in all the experimental groups, including cleavage rates and blastocyst formation rates. The embryos were classified as wild type (WT) (containing no mutated alleles), heterozygous (containing WT and KO alleles), or homozygous KO (containing only alleles with a premature stop codon). The total and homozygous edition efficiency was calculated by dividing the number of mutant blastocysts or the mutant homozygous blastocysts (with induced premature stop codon) by the total number of microinjected oocytes. This final parameter simultaneously evaluates both embryo development and mutation rates. 4. Results 4.1 Use of oocyte electroporation with conventional CRISPR/Cas9 techniques. Effect of the concentration of sgRNA and Cas9 Compared with the non-electroporated control group, electroporation of oocytes with the CRISPR/Cas9 components increased cleavage rates (Table 2 , p 0.05). Table 2 The cleavage and blastocyst rates (per total oocytes) are shown for oocytes electroporated with CRISPR/Cas9 components at different concentrations. Group Cleavage Blastocyst/oocyte n % n % Control 73/144 50.69 a 40/144 27.78 Electroporation X1 94/141 66.67 b 34/141 24.11 Electroporation X2 94/150 62.67 b 28/150 18.67 Electroporation X4 110/166 66.27 b 28/166 16.87 P value 0.010 0.148 Different superscripts ( a , b ) in the same column indicate significant differences (p 0.05). However, most embryos were heterozygous, harboring also the WT allele. Homozygous KO embryos (i.e., harboring only alleles formed by frame-disrupting indels) were detected only in the group microinjected with the highest concentration (X4 group, 3.8% of the total embryos, 13% from the edited one; Table 3 ). High mosaicism rates were observed across all groups, ranging from 79% to 96%, with no significant differences among concentrations (p > 0.05; Table 4 ). The mean number of alleles was higher in the group electroporated with the highest concentration (3.65 ± 0.12) than in the group with the lowest concentration (3.13 ± 0.15; Table 4 ; p < 0.05). Overall total and homozygous editing efficiency, calculated as the percentage of edited blastocysts derived from all oocytes electroporated, was similar among groups, ranging from 14.5% to 17% for total efficiency and 0 to 1.8% for homozygous edition (p > 0.05, Table 4 ). Table 3 Frequency distribution of genotypes of the blastocyst edited by CBE at different cytosine positions with two concentrations. WT: wild type; Het: heterozygous edition; Hom: homozygous edition. P value for Fisher’s exact test (two-sided) = 0.192. Group N blastocytes genotyped WT Het Hom Electroporation X1 34 29.4% 70.6% 0.0% Electroporation X2 28 14.3% 85.7% 0.0% Electroporation X4 26 11.5% 84.6% 3.8% Total 88 19.3% 79.5% 1.1% Table 4 Edition parameters for oocytes electroporated with CRISPR/Cas9 components at different concentrations. The efficiency total and homozygous edition rates were calculated from the total number of oocytes used. The mosaicism rate, and number of alleles per blastocyst were calculated based on edited embryos. Values are expressed in percentage or as mean ± SEM. Group Mosaicism rate (%)* Number of alleles* Efficiency total edition (%) † Efficiency homozygous edition (%) † Electroporation X1 79.17% 3.13 ± 0.15 a 17.02% 0 Electroporation X2 83.33% 3.50 ± 0.17 ab 16.00% 0 Electroporation X4 95.65% 3.65 ± 0.12 b 14.46% 1.81% P value 0.198 0.034 0.822 0.080 Different superscripts ( a , b ) in the same column indicate significant differences (p < 0.05). * Calculated based on edited embryos. † Calculated based on total oocytes electroporated 4.2. Microinjection of oocytes with cytosine base editor: effect of components concentration using sgRNA1 Microinjection of oocytes with or without CBE components did not affect the cleavage rate assessed two days after fertilization compared to the control group of non-microinjected oocytes (Table 5 , p > 0.05). However, the blastocyst formation rate was lower in the group microinjected with the highest concentration of components (X2) than in the non-microinjected control group (Table 5 , p < 0.05). No differences were observed between the group microinjected with the lowest concentration (X1) and the microinjection control group. Table 5 Cleavage and blastocyst rates (per total oocytes) from oocytes microinjected with Cytosine Base Editor and sgRNA1 with two different concentrations. Values are expressed as mean ± SEM. Group Cleavage Blastocyst/oocyte n % n % Non-microinjected control 63/155 40.65 36/155 23.23 a Microinjection Control 55/144 38.19 22/144 15.28 ab Microinjection CBE + sgRNA 1x 87/195 44.62 43/195 22.05 a Microinjection CBE + sgRNA 2x 70/190 36.84 15/190 7.89 b P value 0.406 < 0.001 Different superscripts ( a , b ) in the same column indicate significant differences (p < 0.05). The mutation rates were assessed at the position necessary to generate a premature stop codon (position 0, P0) and at two additional cytosines located at positions − 3 (P-3) and − 4 (P-4). The cytosine substitutions at P-3 and P-4 result in either an amino acid change from arginine to tryptophan (Arg98Trp) or a silent mutation, respectively. Mutation rates at P0, P-3 and P-4 increased in a similar way at higher concentrations of CBE components, rising from a mutation rate of 10–17% at the lower concentration to around 50% at the higher concentration (Table 6 , p < 0.05). The genotype frequency distribution (homozygous, heterozygous and wild type) changed with increasing concentration (Table 6 , Fisher’s exact test (two-sided), p < 0.05). Homozygous mutation at positions P0 and P-4 was only achieved at the highest concentration of CBE components. Table 6 Frequency distribution of genotypes of the blastocyst edited by CBE at different cytosine positions with two concentrations of sgRNA1. WT: wild type; Het: heterozygous edition; Hom: homozygous edition. P value for Fisher’s exact test (two-sided). CBE X1 (n = 41) CBE X2 (n = 15) Cytosine position WT Het Hom WT Het Hom P value P0 82.9% 17.1% 0% 53.3% 26.7% 20.0% 0.011 P-3 85.4% 9.8% 4.9% 53.3% 33.3% 13.3% 0.028 P-4 90.2% 9.8% 0% 53.3% 40.0% 6.7% 0.005 The overall efficiency, which considers both homozygous mutation generation efficiency and embryo development, remained low, with 3.59–3.68% of microinjected oocytes producing a KO blastocyst harboring a stop codon for both concentrations of CBE components (Fig. 3 , p > 0.05). 4.3. Effect of the sgRNA used with base editors The rates of embryo development were similar for all microinjected groups, with cleavage rates ranging from 51 to 60% and blastocyst formation rates ranging from 12 to 19% (Table 7 ; P > 0.05). However, the cleavage rate was lower than that of the control group (51–60 vs. 65%) and the blastocyst rates were consistently lower (12–19 vs. 36%; P < 0.001; Table 7 ). Table 7 Cleavage and blastocyst rates (per total oocytes) from oocytes microinjected with CBE components at different concentrations. Values are expressed as mean ± SEM Group Cleavage Blastocyst/oocyte n % n % Non-microinjected control 118/181 65.19 a 65/181 35.91 a sgRNA2 x1 91/174 52.30 b 28/174 16.09 b sgRNA2 x2 106/178 59.55 ab 33/178 18.54 b sgRNA3 x1 104/177 58.76 ab 30/177 16.95 b sgRNA3 x2 92/181 50.83 b 22/181 12.15 b P value 0.037 < 0.001 Different superscripts ( a , b ) in the same column indicate significant differences (p < 0.05). For sgRNA2, the mutation rate at the target site (position 0, P0), which generates a premature stop codon, was similar at the two CBE concentrations tested (approximately 10%, p < 0.05, Table 8 ). However, homozygous editions were only observed in the 2X group in 6% of the blastocysts (Table 8 ). Mutation rates of a cytosine located at position − 2 (P-2, resulting in a threonine to isoleucine substitution, Thr123Ile) and another cytosine located at position 1 (P-1, silent mutation) were not significantly different between both concentration groups, and no homozygous editions were observed (Table 8 , p > 0.05). Table 8 Frequency distribution of genotypes of the blastocyst edited by CBE at different cytosine positions with two concentrations of sgRNA2. WT: wild type; Het: heterozygous edition; Hom: homozygous edition. P value for Fisher’s exact test (two-sided). CBE X1 (n = 28) CBE X2 (n = 33) Cytosine position WT Het Hom WT Het Hom P value P0 89,3% 10,7% 0,0% 90,9% 3,0% 6,1% 0.285 P-1 92,9% 7,1% 0,0% 97,0% 3.0% 0,0% 0.438 P-2 92,9% 7,1% 0,0% 97,0% 3.0% 0,0% 0.438 For sgRNA3, the mutation rate at the target sites (positions P0 and P-1, both of which generate a premature stop codon) was similar at the two CBE concentrations tested, with values of 6.67% and 10% for the low and high concentrations, respectively (Table 9 , p > 0.05). The homozygous mutation rate (76.7% vs. 35%) of a cytosine located at position − 3 (P-3, resulting in a silent mutation) was higher in the microinjected group with the lower CBE concentration (p < 0.05). The mutation rate of another cytosine at position − 5 (P-5, resulting in an alanine-to-threonine substitution, Ala171Thr) did not differ significantly between the microinjected groups (13.3% vs. 5%, p > 0.05), although homozygous embryos could only be obtained in the group with the lower concentration (3.3% vs. 0%, p > 0.05). Table 9 Frequency distribution of genotypes of the blastocyst edited by CBE at different cytosine positions with two concentrations of sgRNA3. WT: wild type; Het: heterozygous edition; Hom: homozygous edition. P value for Fisher’s exact test (two-sided). CBE X1 (n = 30) CBE X2 (n = 20) Cytosine position WT Het Hom WT Het Hom P value P0 or P-1 93.3% 0% 6.7% 90% 0% 10.0% 0.141 P-3 13.3% 10.0% 76.7% 40.0% 25% 35% 0.013 P-5 86.7% 10.0% 3.3% 95.0% 5.0% 0% 0.782 Figure 3 shows a summary of the efficiency of total and homozygous blastocysts over microinjected oocytes when using the three different sgRNAs at low and high concentrations. While the percentage of total edition was similar to all the experimental group (combination of sgRNA and concentration) (p > 0.05), percentage of homozygous edition efficiency was affected (p < 0.010), because for low concentration of sgRNA 1 and 2, the percentage of homozygous edition is null. 5. Discussion CRISPR/Cas technologies facilitates the generation of genetically modified large animals that can serve as valuable models for human diseases, such as non-syndromic hearing loss (reviewed by Wang et al. [ 17 ]). With the rapid advancement of gene therapy, these gene-edited large animals will be of great interest for testing different therapeutic strategies [ 30 ]. A clear example in this field is gene therapy targeting mutations in the otoferlin ( OTOF ) gene, which are associated with non-syndromic forms of deafness [ 31 ]. The development of OTOF KO animal models, including mouse and sheep [ 32 ], has enabled the evaluation of the efficacy and safety of this gene therapy, which is currently undergoing clinical trials in humans [ 33 ]. We investigated the use of the conventional CRISPR/Cas9 system and a cytosine base editor to generate gene-edited pig embryos. If viable, the next step would be to produce GJB2 KO piglets through embryo transfer. These GJB2 KO piglets could serve as valuable models for studying human Cx26–related hearing loss and for developing novel therapeutic approaches, such as gene therapy. They would provide complementary insights to those obtained from mouse models [ 34 ]. In this sense, the identity rate of the amino acid chain of the Cx26 protein between pigs and humans (216/226 aa, 95.58%) is slightly higher than between mice and humans (210/226, 92.92%), whereas the identity rate between pig and mouse decreases to 89.82% (203/226). To achieve this objective, we first applied electroporation to in vitro –matured oocytes using CRISPR/Cas9 components. Electroporation of oocytes or zygotes to generate gene-edited embryos is a valuable approach that enables the assessment of RNA guide efficiency and the evaluation of potential detrimental effects on embryo development (reviewed by Piñeiro-Silva and Gadea [ 35 ]). Since the efficiency of genome editing following electroporation depends on sgRNA concentration [ 26 , 35 ], three different concentrations were tested to optimize embryo development and editing efficiency while minimizing mosaicism. Regarding embryo development, the electroporated groups displayed higher cleavage rates than the control, in agreement with prior observations [ 26 , 36 – 38 ]. This increase in cleavage rates is associated with parthenogenetic activation of the electroporated oocytes [ 39 ]. However, the blastocyst rate was similar for all the experimental groups. Regarding editing efficiency and mosaicism rates, although the mutation rates obtained after electroporation were high (> 70% across all concentration groups), low rates of homozygous mutations (0–15%) and high levels of mosaicism (> 79%) were observed. The low rates of homozygous mutations present significant challenges to the procedure's overall efficiency, since breeding of heterozygous animals would be required to produce offspring with mutations in both alleles (homozygous), thereby delaying the production of the desired genotypes and increasing animal maintenance and breeding costs. The high mosaicism rate is inherently bound to low homozygous mutation rate and also complicates the genotyping of animals derived from these embryos. Mosaicism, the coexistence of distinct cell populations with different mutations in the same individual, hinders accurately assessing each mutation's phenotypic impact and increases genetic variant numbers in the F1 generation [ 40 ]. To both reduce the mosaicism rate and increase homozygous edition, alternative gene-editing strategies can be employed. Cytosine base editors (CBEs) are genome-editing tools that can introduce precise point mutations by converting cytosine (C) to thymine (T) without creating double-strand breaks in DNA [ 21 , 41 ]. CBEs generally induce more predictable mutations than the insertions or deletions (indels) resulting from double-strand break repair in the conventional CRISPR/Cas9 system. As summarized in Table 10 , CBEs have been used to modify somatic cells in culture, including fetal porcine fibroblasts [ 42 – 46 ], as well as human HEK cells [ 44 ]. CBEs have also enabled the generation of subsequent generations of piglets via somatic cell nuclear transfer [ 42 , 47 , 48 ]. Additionally, CBEs can be directly injected into germinal vesicle (GV) oocytes [ 49 ], parthenotes or zygotes [ 43 , 47 , 50 ], but, to our knowledge, CBE microinjection into mature porcine oocytes was not tested before. This approach may offer several advantages, as our group has previously demonstrated with the microinjection of CRISPR/Cas9 components [ 27 ]. Editing at the oocyte stage allows the machinery to act before DNA replication occurs, which reduces mosaicism in the resulting embryos [ 23 ]. This method also enables the simultaneous targeting of maternal and paternal alleles, which may favor high-fidelity DNA repair pathways and improve the precision of modifications. Table 10 Summary of the use of CBEs for editing porcine somatic cells, gametes and embryos Gene(s) Model Base Editor(s) Cell Type(s) Reference TWIST2, TYR Ablepharon macrostomia syndrome (AMS), Oculocutaneous albinism type 1 (OCA1) BE3 PFF Li et al., 2018 [ 42 ] DMR, TYR, LMNA, RAG1, RAG2, IL2RG, POL Duchenne muscular dystrophy (DMD), Albinism, Hutchinson-Gilford Progeria Syndrome (HGPS), Immune deficiencies, PERV BE3 hA3A-BE3 PFF Parthenotes Zygotes Xie et al. , 2019 [ 43 ] GGAT1, B4galNT2, CMAH Xenotransplantation BE4-Gam AncBE4max PFF Parthenotes Zygotes Yuan et al. , 2020 [ 47 ] X-linked DMD (5 gRNAs) Duchenne muscular dystrophy BE3 GV oocytes Su et al. , 2020 [ 49 ] CD163, APN, MSTN, MC4R PRRS virus resistance, TGEV resistance, Muscle growth, Melanocortin-4 receptor hA3A-BE3-NG HEK293T PFF Wang et al. , 2020 [ 44 ] P53 Cancer pCMV-BE3 PFF Li et al., 2021 [ 52 ] APOA5, LDLR, CD163, MSTN ApoA-V, LDL receptor, PRRS virus resistance, Muscle growth YE1-BE4maxNG PFF Pan et al., 2021 [ 45 ] CD163, MSTN, IGF2 PRRS virus resistance, Muscle growth, Meat production rA1-BE3 hA3A-BE3 hA3A-BE3-Y130F hA3A-BE-Y130F PEF Parthenotes Zygotes Song et al. , 2022 [ 50 ] PERV Porcine endogenous retrovirus BE4max ST cells Zheng et al ., 2022 [ 46 ] IGF2 Meat production BE3 PFF Duo et al. , 2023 [ 48 ] CBEs can introduce specific genetic modifications through targeted point mutations or generate knockout (KO) alleles [ 51 ]. Even when the goal is to create a premature stop codon, CBEs can edit multiple cytosines within the target region. Consequently, unintended amino acid substitutions may occur in the encoded protein, as demonstrated in this study using three different guide RNAs. Cytosine base editors have proven effective in creating missense mutations and early stop codons. They have applications in human disease modeling (e.g., LMNA G608G ) [ 18 ], organ xenotransplantation (e.g., GGAT1, B4GalNT2 and CMAH genes) [ 47 ], and porcine production and health (e.g., C163, IGF2, and MSTN genes) [ 50 ]. Beyond these applications, CBEs could be used in the pig industry to manipulate single nucleotide polymorphisms (SNPs) and improve breeding. Several SNPs have been associated with significant productive traits, such as meat quality, growth, and resistance to viral diseases (reviewed by Song et al. [ 51 ]). In our study, CBE microinjection yielded superior homozygous edition rates than conventional CRISPR/Cas9, but this efficiency varied depending on the sgRNA used and the concentration employed in the microinjection solution. Giner et al. described factors that can affect CBE efficiency. These factors include the context-based efficiency of BEs (including chromatin accessibility and dinucleotide sequence motifs), the sequence-based efficiency of BEs (activity window size and PAM flexibility), and sgRNA length and secondary structure [ 53 ]. Previous studies have reported differences in mutation efficiency using different guides, ranging from 6.8% to 54.8%, when CBE was injected into GV oocytes [ 49 ]. However, according to our results, in addition to the specific RNA guide, the concentration also affected embryo development and the mutation rate. On the other hand, differences in blastocyst and/or mutation rates were found when using different CBEs with the same sgRNA after injection into parthenotes [ 47 , 50 ]. In this study we have used cytosine base editor BE3, initially described by Komor et al. [ 21 ] and successfully used for editing rabbit and cattle embryos [ 54 ]. So, it appears that optimizing the RNA guide, CBE, and concentration is necessary to optimize the system for each target. We used BE3 to ensure feasibility and comparability with previous work. However, the next generation CBEs as AncBE4max, YE1-BE4max-NG and A3A-BE-Y130F provide engineered deaminases and/or NG PAM compatibility. This tightens the deamination window and reduces off-target activity. These properties are expected to increase edit purity and reduce dose-related toxicity, potentially improving the competence of developing embryos at equivalent on-target rates. Apart from creating a stop codon, using different guides and CBE induced changes to the amino acid chain produced the following mutations: arginine to tryptophan (Arg98Trp) with sgRNA1, threonine to isoleucine (Thr123Ile) with sgRNA2, and alanine to threonine (Ala171Thr) with sgRNA3. Whereas these substitutions are functionally irrelevant if a stop codon is introduced, given the lack of functionality of the truncated protein, these substitutions alone might affect the functionality of a non-truncated protein. The original amino acids at positions 98, 123, and 171 are identical in pig and human proteins, but the mutations generated using CBE are not associated with any known human phenotypes. The structure of the human connexin 26 gap junction channel has been studied at a high resolution [ 55 ], which allows to hypothesize about the possible functional consequences of these substitution. The Arg98Trp substitution in Cx26 potentially disrupts channel function by replacing a positively charged arginine, typically involved in stabilizing ionic interactions, with the neutral amino acid tryptophan. The Thr123Ile substitution may have variable functional effects because threonine is a polar, uncharged amino acid with a hydroxyl group that can participate in hydrogen bonding and undergo phosphorylation. In contrast, isoleucine is hydrophobic and apolar, lacking the ability to form hydrogen bonds. The substitution of alanine with threonine at position 171 could affect the protein's functionality. Alanine is hydrophobic and apolar with a small methyl side chain that contributes to protein stability. In contrast, threonine is polar and uncharged with a hydroxyl group that can form hydrogen bonds and undergo phosphorylation. Additionally, alanine is smaller and more compact, while threonine is larger and has greater potential for molecular interactions. Further studies, including functional assays and clinical correlations, would be necessary to determine the impact of these substitutions on protein function and auditory pathways. In this study, we demonstrated the efficiency of generating GJB2 KO embryos using the traditional CRISPR/Cas9 system and CBEs. Our current work on embryos was designed to produce loss-of-function (null) GJB2 alleles as a first step in measuring the effectiveness of CRISPR/Cas9 and cytosine base editing at the oocyte stage. A null porcine model most closely represents homozygous truncating genotypes in humans (e.g. 35delG, 235delC), which typically underline congenital severe-to-profound Nonsyndromic Hearing Loss and Deafness (DFNB1) [ 56 ]. With the information derived from this first null model, missense models (e.g., p.V37) will be pursued in subsequent studies. Using pigs to study congenital deafness associated with GJB2 mutations could facilitate the development of an animal model more similar to humans in terms of genetics, physiology, and body size. This model is ideal for testing gene augmentation (AAV-GJB2), delivery routes (e.g. canalostomy), treatment timing around birth, dose-response and safety/immune readouts, as it has a large cochlea that approximates human anatomy and maturation. Future work will focus on the transfer of edited embryos to produce live GJB2 –/– piglets. These animals will allow comprehensive phenotypic characterization, including auditory brainstem response testing, cochlear histopathology, and Cx26 expression analysis. Once validated, this model will be used to evaluate the efficacy and safety of in vivo gene-therapy approaches targeting GJB2 -related deafness. In conclusion, the generation of genetically modified pig models for human deafness using the CRISPR/Cas9 system or CBEs is possible, and they can be used to test both gene therapy or diagnostic techniques. Nevertheless, more research is needed in order to increase homozygous efficiency in order to achieve the desired genotype in the first generation. Declarations Competing interests The authors declare no competing interests. Funding This research was funded by Fundación Seneca 22065/PI/22 and 22545/PDC/24; and Universidad de Murcia predoctoral fellowship R-496/2022. Author Contribution Celia Piñeiro-Silva: Writing – review & editing, Writing – original draft, Methodology, Investigation, Data curation, Conceptualization. Pablo Bermejo-Álvarez: Investigation, Conceptualization, Writing – review & editing. Francisco José García-Purriños: Conceptualization, Writing – review & editing. Joaquín Gadea: Writing – review & editing, Writing – original draft, Resources, Project administration, Funding acquisition, Formal analysis, Data curation, Conceptualization. Acknowledgements The authors wish to thank CEFU, SA, and El Pozo, SA, for providing the ovaries from which the oocytes were generated, and Juan Antonio Carvajal for collecting the ovaries at the slaughterhouse. Data Availability Additional raw data are available from the corresponding author upon reasonable request. References Kenneson, A., Van Naarden Braun, K. & Boyle, C. GJB2 (connexin 26) variants and nonsyndromic sensorineural hearing loss: a HuGE review. Genet. Med. Off J. Am. Coll. Med. Genet. 4 , 258–274 (2002). Chan, D. K. & Chang, K. W. GJB2-associated hearing loss: systematic review of worldwide prevalence, genotype, and auditory phenotype. Laryngoscope 124 , E34–53 (2014). Ke, Y., Liu, X. & Sun, Y. Regulatory mechanisms of connexin26. Neuroscience 570 , 9–15 (2025). Beach, R. et al. GJB2 Mutations Linked to Hearing Loss Exhibit Differential Trafficking and Functional Defects as Revealed in Cochlear-Relevant Cells. Front. Cell. Dev. Biol. 8 , 215 (2020). Snoeckx, R. L. et al. GJB2 mutations and degree of hearing loss: a multicenter study. Am. J. Hum. Genet. 77 , 945–957 (2005). Cohen-Salmon, M. et al. Targeted ablation of connexin26 in the inner ear epithelial gap junction network causes hearing impairment and cell death. Curr. Biol. CB . 12 , 1106–1111 (2002). Wang, Y. et al. Targeted connexin26 ablation arrests postnatal development of the organ of Corti. Biochem. Biophys. Res. Commun. 385 , 33–37 (2009). Lin, L. et al. Ultrastructural pathological changes in the cochlear cells of connexin 26 conditional knockout mice. Mol. Med. Rep. 8 , 1029–1036 (2013). Chen, J., Chen, J., Zhu, Y., Liang, C. & Zhao, H. B. Deafness induced by Connexin 26 (GJB2) deficiency is not determined by endocochlear potential (EP) reduction but is associated with cochlear developmental disorders. Biochem. Biophys. Res. Commun. 448 , 28–32 (2014). Sun, Q. et al. Combined AAV-mediated specific Gjb2 expression restores hearing in DFNB1 mouse models. Mol. Ther. J. Am. Soc. Gene Ther. 33 , 3006–3021 (2025). Domínguez-Ruiz, M. et al. A murine model for the del(GJB6-D13S1830) deletion recapitulating the phenotype of human DFNB1 hearing impairment: generation and functional and histopathological study. BMC Genom. 25 , 359 (2024). Crispino, G. et al. In vivo genetic manipulation of inner ear connexin expression by bovine adeno-associated viral vectors. Sci. Rep. 7 , 6567 (2017). Guo, J. et al. GJB2 gene therapy and conditional deletion reveal developmental stage-dependent effects on inner ear structure and function. Mol. Ther. Methods Clin. Dev. 23 , 319–333 (2021). Guo, W. & Yang, S. M. Advantages of a miniature pig model in research on human hereditary hearing loss. J. Otol . 10 , 105–107 (2015). Guo, W., Lei, C., Hui–zhan, L. & Jian–he, S. Shi–ming, Y. Hearing and Cochlear structures in a Swine Model. J. Otol . 5 , 97–100 (2010). Reis, A., Dalmolin, S. & Dallegrave, E. Animal models for hearing evaluations: a literature review. Rev. CEFAC . 19 , 417–428 (2017). Wang, X. et al. Genetically modified pigs: Emerging animal models for hereditary hearing loss. Zool. Res. 45 , 284–291 (2024). Xie, F. et al. Production of gene-edited pigs harboring orthologous human mutations via double cutting by CRISPR/Cas9 with long single-stranded DNAs as homology-directed repair templates by zygote injection. Transgenic Res. 29 , 587–598 (2020). Dai, P. et al. The prevalence of the 235delC GJB2 mutation in a Chinese deaf population. Genet. Med. Off J. Am. Coll. Med. Genet. 9 , 283–289 (2007). Oliveros, J. C. et al. Breaking-Cas-interactive design of guide RNAs for CRISPR-Cas experiments for ENSEMBL genomes. Nucleic Acids Res. 44 , W267–W271 (2016). Komor, A. C., Kim, Y. B., Packer, M. S., Zuris, J. A. & Liu, D. R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533 , 420–424 (2016). Pérez-Gómez, A. et al. The role of TEAD4 in trophectoderm commitment and development is not conserved in non-rodent mammals. Dev. Camb. Engl. 151 , dev202993 (2024). Lamas-Toranzo, I. et al. Strategies to reduce genetic mosaicism following CRISPR-mediated genome edition in bovine embryos. Sci. Rep. 9 , 14900 (2019). Canovas, S. et al. DNA methylation and gene expression changes derived from assisted reproductive technologies can be decreased by reproductive fluids. eLife 6, (2017). Yuan, Y. et al. Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. Proc. Natl. Acad. Sci. U. S. A. 114, E5796–E5804 (2017). Navarro-Serna, S. et al. Oocyte electroporation prior to in vitro fertilization is an efficient method to generate single, double, and multiple knockout porcine embryos of interest in biomedicine and animal production. Theriogenology 218 , 111–118 (2024). Navarro-Serna, S. et al. Generation of Nonmosaic, Two-Pore Channel 2 Biallelic Knockout Pigs in One Generation by CRISPR-Cas9 Microinjection before Oocyte Insemination. CRISPR J. 4 , 132–146 (2021). Piñeiro-Silva, C. & Gadea, J. Optimization of lipofection protocols for CRISPR/Cas9 delivery in porcine zona pellucida intact oocytes: A study of coincubation duration and reagent efficacy. Theriogenology 230 , 121–129 (2024). Ramlee, M. K., Yan, T., Cheung, A. M. S., Chuah, C. T. H. & Li, S. High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent PCR-capillary gel electrophoresis. Sci Rep 5 , (2015). Ji, X. J. et al. Canalostomy is an ideal surgery route for inner ear gene delivery in big animal model. Acta Otolaryngol. (Stockh) . 139 , 939–947 (2019). Yasunaga, S. et al. A mutation in OTOF, encoding otoferlin, a FER-1-like protein, causes DFNB9, a nonsyndromic form of deafness. Nat. Genet. 21 , 363–369 (1999). Menchaca, A. et al. Otoferlin gene editing in sheep via CRISPR-assisted ssODN-mediated Homology Directed Repair. Sci. Rep. 10 , 5995 (2020). Landegger, L. D. et al. The rise of cochlear gene therapy. Mol. Ther. J. Am. Soc. Gene Ther. 33 , 2343–2349 (2025). Sun, Q. et al. Combined AAV-mediated specific Gjb2 expression restores hearing in DFNB1 mouse models. Mol. Ther. J. Am. Soc. Gene Ther. 33 , 3006–3021 (2025). Piñeiro-Silva, C. & Gadea, J. Optimizing gene editing in pigs: The role of electroporation and lipofection. Anim. Reprod. Sci. 278 , 107874 (2025). Navarro-Serna et al. Effect of Aphidicolin, a Reversible Inhibitor of Eukaryotic Nuclear DNA Replication, on the Production of Genetically Modified Porcine Embryos by CRISPR/Cas9. Int. J. Mol. Sci. 23 , 2135 (2022). Navarro-Serna et al. Generation of Calpain-3 knock-out porcine embryos by CRISPR-Cas9 electroporation and intracytoplasmic microinjection of oocytes before insemination. Theriogenology 186 , 175–184 (2022). Piñeiro-Silva, C., Navarro-Serna, S., Belda-Pérez, R. & Gadea, J. Production of Genetically Modified Porcine Embryos via Lipofection of Zona-Pellucida-Intact Oocytes Using the CRISPR/Cas9 System. Animals 13 , 342 (2023). Piñeiro-Silva, C. & Gadea, J. Optimizing oocyte electroporation for genetic modification of porcine embryos: Evaluation of the parthenogenetic activation. Theriogenology 218 , 126–136 (2024). Mehravar, M., Shirazi, A., Nazari, M. & Banan, M. Mosaicism in CRISPR/Cas9-mediated genome editing. Dev. Biol. 445 , 156–162 (2019). Nishida, K. et al. Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science 353 , aaf8729 (2016). Li, Z. et al. Efficient RNA-guided base editing for disease modeling in pigs. Cell. Discov . 4 , 64 (2018). Xie, J. et al. Efficient base editing for multiple genes and loci in pigs using base editors. Nat. Commun. 10 , 2852 (2019). Wang, Y. et al. Cytosine Base Editor (hA3A-BE3-NG)-Mediated Multiple Gene Editing for Pyramid Breeding in Pigs. Front. Genet. 11 , 592623 (2020). Pan, J. S. et al. Application of the modified cytosine base-editing in the cultured cells of bama minipig. Biotechnol. Lett. 43 , 1699–1714 (2021). Zheng, S. et al. Efficient and Safe Editing of Porcine Endogenous Retrovirus Genomes by Multiple-Site Base-Editing Editor. Cells 11 , 3975 (2022). Yuan, H. et al. Efficient base editing by RNA-guided cytidine base editors (CBEs) in pigs. Cell. Mol. Life Sci. CMLS . 77 , 719–733 (2020). Duo, T. et al. Single-base editing in IGF2 improves meat production and intramuscular fat deposition in Liang Guang Small Spotted pigs. J. Anim. Sci. Biotechnol. 14 , 141 (2023). Su, X. et al. Effective generation of maternal genome point mutated porcine embryos by injection of cytosine base editor into germinal vesicle oocytes. Sci. China Life Sci. 63 , 996–1005 (2020). Song, R. et al. One-step base editing in multiple genes by direct embryo injection for pig trait improvement. Sci. China Life Sci. 65 , 739–752 (2022). Song, R., Wang, Y. & Zhao, J. Base editing in pigs for precision breeding. Front. Agric. Sci. Eng. 7 , 161–170 (2020). Li, H. et al. Efficient Generation of P53 Biallelic Mutations in Diannan Miniature Pigs Using RNA-Guided Base Editing. Life Basel Switz. 11 , 1417 (2021). Giner, G., Ikram, S., Herold, M. J. & Papenfuss, A. T. A systematic review of computational methods for designing efficient guides for CRISPR DNA base editor systems. Brief. Bioinform . 24 , bbad205 (2023). Pérez-Gómez, A. et al. PPARG is dispensable for bovine embryo development up to tubular stages†. Biol. Reprod. 111 , 557–566 (2024). Maeda, S. et al. Structure of the connexin 26 gap junction channel at 3.5 Å resolution. Nature 458 , 597–602 (2009). Dzhemileva, L. U. et al. Carrier frequency of GJB2 gene mutations c.35delG, c.235delC and c.167delT among the populations of Eurasia. J. Hum. Genet. 55 , 749–754 (2010). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 18 Apr, 2026 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 12 Nov, 2025 Editor assigned by journal 01 Nov, 2025 Submission checks completed at journal 01 Nov, 2025 First submitted to journal 31 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7999953","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":543672812,"identity":"338ddc54-0403-4150-974f-c48eae7bacd7","order_by":0,"name":"Celia Piñeiro-Silva","email":"","orcid":"","institution":"University of Murcia, International Excellence Campus for Higher Education and Research “Campus Mare Nostrum” and and Biomedical Research Institute of Murcia Pascual Parrilla–IMIB","correspondingAuthor":false,"prefix":"","firstName":"Celia","middleName":"","lastName":"Piñeiro-Silva","suffix":""},{"id":543672813,"identity":"1cf92c9f-5a17-47bf-9935-a8f977909ce1","order_by":1,"name":"Pablo Bermejo-Álvarez","email":"","orcid":"","institution":"INIA, CSIC","correspondingAuthor":false,"prefix":"","firstName":"Pablo","middleName":"","lastName":"Bermejo-Álvarez","suffix":""},{"id":543672814,"identity":"457fe301-2638-4b73-95e4-483df160b0c4","order_by":2,"name":"Francisco José García-Purriños","email":"","orcid":"","institution":"Los Arcos del Mar Menor University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Francisco","middleName":"José","lastName":"García-Purriños","suffix":""},{"id":543672815,"identity":"d1a3167d-f357-428a-8591-9e0358540f14","order_by":3,"name":"Joaquín Gadea","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAo0lEQVRIiWNgGAWjYBACxgYGBgkGBhvStaSRaBNQy2ESlDP3L35440PN+cS1DcyHPxDnsBnPjC1nHLuduO0AW5oEkVoOmEnzsIG08JgR5zDGGce/Sf/5dw6ohf8zkQ7r7zGTZmw7ALKFgViH8RRb9vYlG287zGZGnBbD/uMbb/z4Zie77XjzY+IcZjgjAcpiJko9EMjzHyBW6SgYBaNgFIxYAAABbjQSdYuDCQAAAABJRU5ErkJggg==","orcid":"","institution":"University of Murcia, International Excellence Campus for Higher Education and Research “Campus Mare Nostrum” and and Biomedical Research Institute of Murcia Pascual Parrilla–IMIB","correspondingAuthor":true,"prefix":"","firstName":"Joaquín","middleName":"","lastName":"Gadea","suffix":""}],"badges":[],"createdAt":"2025-10-31 15:38:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7999953/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7999953/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-026-49229-0","type":"published","date":"2026-04-18T15:58:04+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":96243712,"identity":"c4569024-b1b4-4f83-9c2d-6bdc0e269441","added_by":"auto","created_at":"2025-11-19 07:16:52","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":267528,"visible":true,"origin":"","legend":"","description":"","filename":"conexinascireports.docx","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/93922ea476d07a45947d3eb9.docx"},{"id":95896020,"identity":"95022e0f-b3ea-4794-aca8-6d3a9927e27d","added_by":"auto","created_at":"2025-11-14 07:18:16","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6155,"visible":true,"origin":"","legend":"","description":"","filename":"b63ed2a04cc5477e8c764b934605845c.json","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/ad865939215329d8f22b3e55.json"},{"id":95896026,"identity":"38653a9c-bf2c-43e0-8bb6-ce1723113621","added_by":"auto","created_at":"2025-11-14 07:18:16","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":155679,"visible":true,"origin":"","legend":"","description":"","filename":"b63ed2a04cc5477e8c764b934605845c1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/667f5638f71109f1db77ee7a.xml"},{"id":96242963,"identity":"e4dc4e0c-83cc-41ad-bb9d-3625229b170e","added_by":"auto","created_at":"2025-11-19 07:15:03","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":56943,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/dd888b1f6944edda8977e345.png"},{"id":95896021,"identity":"9214d599-a1bc-4d80-b98b-77b4868b562d","added_by":"auto","created_at":"2025-11-14 07:18:16","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23093,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/0e546ec03be9796308752090.png"},{"id":95896028,"identity":"fa442675-00c8-4fcc-bb7f-c1b59a6df88b","added_by":"auto","created_at":"2025-11-14 07:18:16","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10610,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/9c984188bf9652b6a065f791.png"},{"id":95896029,"identity":"639546db-7372-40bd-868b-86072d36ccdb","added_by":"auto","created_at":"2025-11-14 07:18:16","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":156889,"visible":true,"origin":"","legend":"","description":"","filename":"b63ed2a04cc5477e8c764b934605845c1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/2b164f9792f16caafa64196e.xml"},{"id":95896030,"identity":"d1df9816-ebff-4af6-af83-4ca29ffd60aa","added_by":"auto","created_at":"2025-11-14 07:18:16","extension":"html","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":169320,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/fb316a216e6e978e8e57220c.html"},{"id":95896022,"identity":"fc9449fc-d0fe-4f06-a110-60b6bb5ebcfb","added_by":"auto","created_at":"2025-11-14 07:18:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":57139,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental design of in vitro experiments using the conventional CRISPR/Cas9 system (by electroporation) and the Cytosine Base Editor (by microinjection).\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/853ac20c5f9b968023241026.png"},{"id":96243019,"identity":"cc0032a6-de20-4958-ba5d-b639c7639d81","added_by":"auto","created_at":"2025-11-19 07:15:12","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":24182,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic representation of the sgRNAs used in the CBE strategy and their potential mutation sites. The target codon is marked in pink, and the PAM sequence is marked in red. P-5 to P0 are the possible mutation points.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/f258035c90678d83fbbbc834.png"},{"id":95896024,"identity":"edb59bcd-cb3b-4f43-a7dd-04cd92f9923e","added_by":"auto","created_at":"2025-11-14 07:18:16","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":32448,"visible":true,"origin":"","legend":"\u003cp\u003eStop codon generation efficiency (percentage of homozygous mutant blastocysts with a premature stop codon out of the total number of oocytes) after using CBE with three different sgRNAs (1, 2 and 3) and two concentrations (x1 and x2). Fisher’s exact test (two-sided), p=0.47.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/2bbc9357b612cbe9ba0402c3.png"},{"id":107352678,"identity":"2d18cf6d-4d12-4a56-bb08-311a62ab3195","added_by":"auto","created_at":"2026-04-20 16:14:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1030829,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7999953/v1/d3914f0d-2fe7-4837-adc7-26409bd68c1d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Generation of GJB2 Gene-Edited Porcine Embryos as a Model for Human Congenital Deafness via CRISPR/Cas9 and Cytosine base editors","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eThe Introduction section, of referenced text1 expands on the background of the work (some overlap with the Abstract is acceptable). The introduction should not include subheadings.\u003c/p\u003e\u003cp\u003eConnexin 26 (Cx26) deficiency is a leading cause of hearing loss worldwide [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It accounts for over 50% of cases of non-syndromic hearing loss and is estimated to affect 1 in 500 newborns and 1 in 300 children by the age of four [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Cx26, encoded by the Gap Junction Beta 2 gene (\u003cem\u003eGJB2\u003c/em\u003e), forms gap junctions between supporting cells in the organ of Corti. These junctions are crucial for potassium recycling and intercellular signaling in the inner ear, facilitating the movement of ions and small molecules that are necessary for auditory function [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Defective trafficking, misfolding or aberrant oligomerization of Cx26 results in non-functional hemichannels and/or an inability to form gap junctions [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In particular, various point mutations and premature stop codons within the \u003cem\u003eGJB2\u003c/em\u003e gene have been linked to Cx26-related hearing loss [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. These mutations occur throughout the 226 amino acids of the protein, resulting in different deafness phenotypes depending on which regions are affected [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The severity of hearing loss associated with \u003cem\u003eGJB2\u003c/em\u003e mutations can range from mild to profound, depending on the specific mutation (revised by Ke \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]).\u003c/p\u003e\u003cp\u003e\u003cem\u003eGJB2\u003c/em\u003e knockout (KO) and conditional knockout (cKO) mouse models have provided valuable insight into the mechanisms of congenital deafness, including cochlear developmental abnormalities, hair cell degeneration and reduced endocochlear potential [\u003cspan additionalcitationids=\"CR7 CR8 CR9 CR10\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. The efficacy of gene therapy for the safe and effective correction of the disease has also been explored using these murine KO models [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Unfortunately, despite these useful insights, murine models differ from humans in terms of size, anatomy and physiology and large animal models are required to test potential clinical interventions in humans.\u003c/p\u003e\u003cp\u003ePigs constitute a particularly well-suited model to perform auditory studies due to the anatomical and physiological similarities between their auditory system and that of humans [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Due to the anatomical similarities, pigs have been widely used in developing surgical techniques for cochlear fenestration and fine tomography and they arguably constitute the closest model (second to primates) to study hearing loss and test potential treatments [\u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Besides, and in contrast to rodents whose auditory systems mature after birth, pigs and humans display a more mature auditory system at birth [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Moreover, the structure of \u003cem\u003eGJB2\u003c/em\u003e gene is similar between humans and pigs: in both species it contains two exons and the entire coding sequence is located in exon 2 [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Consequently, generating \u003cem\u003eGJB2\u003c/em\u003e mutant pigs could significantly impact on the study of genetic hearing loss and the development of therapeutic solutions. Recent advances in gene editing have led to the development of pig models with human-equivalent \u003cem\u003eGJB2\u003c/em\u003e mutations. Xie \u003cem\u003eet al.\u003c/em\u003e reported the successful generation of gene-edited pigs with orthologous human mutations using an innovative CRISPR/Cas9 approach [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Their method involved double-cutting, using CRISPR/Cas9 with two single guide RNAs (sgRNAs) to generate cuts flanking the target mutation site, and homology-directed repair (HDR) using long single-stranded DNA (lssDNA) as templates for precise mutation insertion. They generated two porcine models with \u003cem\u003eGJB2\u003c/em\u003e p.V37I and \u003cem\u003eGJB2\u003c/em\u003e c.235delC mutations. These mutations are particularly relevant because they are the most common \u003cem\u003eGJB2\u003c/em\u003e mutations observed in Asian populations [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe objective of this study has been to optimize techniques to generate a porcine model that replicates the functional impairment of Cx26 seen in human congenital deafness. In particular, we have tested the efficiency of two advanced gene editing methods: electroporation delivery of the CRISPR/Cas9 system and microinjection delivery of a cytosine base editor (CBE). This model, which introduces precise mutations in the \u003cem\u003eGJB2\u003c/em\u003e gene, will serve as a valuable tool for studying the underlying mechanisms of hearing loss and testing potential therapeutic interventions.\u003c/p\u003e"},{"header":"2. Material and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Ethical issues\u003c/h2\u003e\u003cp\u003e This work was approved by the Ethics Committee of the University of Murcia and the Murcia Regional Government for the use of Genetically Modified Organisms (Establishment license Reference A/ES/16/I-22; Activity reference A/ES/16/79; Project GENOCRISPR reference A13221206).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Chemicals and reagents\u003c/h2\u003e\u003cp\u003eUnless otherwise indicated, all chemicals were purchased from Merck Life Science S.L.U. (Madrid, Spain).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. sgRNA design\u003c/h2\u003e\u003cp\u003eFor the conventional CRISPR/Cas9 system, a single-guide RNA (sgRNA) targeting the \u003cem\u003eGJB2\u003c/em\u003e gene was designed using software from the National Center for Biotechnology of the Spanish National Research Council (CNB-CSIC; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://bioinfogp.cnb.csic.es/tools/breakingcas\u003c/span\u003e\u003cspan address=\"https://bioinfogp.cnb.csic.es/tools/breakingcas\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The sgRNA and Cas9 protein were purchased from Integrated DNA Technologies (IDT, Leuven, Belgium). Ribonucleoprotein complexes were prepared according to the manufacturer's instructions.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eTarget sequences for the sgRNAs designed for electroporation (experiment 1) and base editing (CBE, experiment 2). PAM sequence is indicated in bold letters.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence (5\u0026rsquo;\u0026loz;3\u0026rsquo;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esgRNA for electroporation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTTCTTCTCGTGTCGCCGGT\u003cb\u003eAGG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esgRNA 1 for BE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACCGGCGACACGAGAAGAAA\u003cb\u003eAGG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esgRNA 2 for BE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACCCAGAAGGTCCGCATCGA\u003cb\u003eGGG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esgRNA 3 for BE\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCCACGCGTTGCACTTGACC\u003cb\u003eAGG\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eAs an alternative, \u003cem\u003eGJB2\u003c/em\u003e ablation was achieved by generating a stop codon with the cytosine base editor BE3 (CBE) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Unlike CRISPR/Cas9-induced double-strand break (DSB) gene editing, which leads to randomly generated indels, CBE converts cytosine to thymidine. This conversion can generate a stop codon, thereby disrupting protein formation [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Three different sgRNAs were designed to target the unique coding exon of \u003cem\u003eGJB2\u003c/em\u003e, which produces a protein consisting of 226 amino acids (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Specifically, sgRNA 1 was designed to convert CGA to TGA, resulting in a 98 amino acid-long truncated protein; sgRNA 2 was designed to convert CAG to TAG, resulting in a 123 amino acid-long truncated protein; and sgRNA 3 was designed to convert TGG to TAG, TGA, or TAA, resulting in a 171 amino acid-long truncated protein.\u003c/p\u003e\u003cp\u003esgRNAs were synthesized using the Guide-it \u0026trade; sgRNA \u003cem\u003eIn Vitro\u003c/em\u003e Transcription kit (Takara Bio Europe, France) with primers containing a T7 promoter and the sgRNA sequence, as previously described [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Capped polyadenylated CBE-encoding mRNA was produced by \u003cem\u003ein vitro\u003c/em\u003e transcription using the T7 ULTRA kit\u0026reg; (Life Technologies) and the BbsI-linearized plasmid pCMV-BE3 (Addgene #73021). Finally, the mRNA was purified using the MEGAclear \u0026trade; kit (Thermo Fisher Scientific, Madrid, Spain).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. \u003cem\u003eIn vitro\u003c/em\u003e maturation (IVM)\u003c/h2\u003e\u003cp\u003eCumulus-oocyte complexes (COCs) were obtained from gilt ovaries at the slaughterhouse and were processed as previously described [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Briefly, the ovaries were transported in saline solution at 38 \u0026ordm;C, washed once in a 0.04% cetrimide solution and twice in saline solution, both at 38 \u0026ordm;C. The COCs were collected by aspiration from follicles measuring between 3 and 6 mm in diameter. They were washed in Dulbecco\u0026rsquo;s PBS with 0.2 g/l polyvinyl alcohol (DPBS-PVA) and subsequently in IVM medium (PIG-IVM1-LYO, Embryocloud, Murcia, Spain).\u003c/p\u003e\u003cp\u003eGroups of 50 COCs were then cultured in 500 \u0026micro;l of PIG-IVM1-LYO medium, supplemented with 40 ng/mL fibroblast growth factor 2 (FGF2), 20 ng/mL leukemia inhibitory factor (LIF), and 20 ng/mL insulin-like growth factor 1 (IGF1) [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], for 20\u0026ndash;22 hours at 38.5 \u0026ordm;C under 5% CO\u003csub\u003e2\u003c/sub\u003e and 7% O\u003csub\u003e2\u003c/sub\u003e conditions. This was followed by an additional 20\u0026ndash;22 h in PIG-IVM2-LYO (Embryocloud, Murcia, Spain) supplemented with FGF2, LIF, and IGF1. After IVM, the COCs were denuded of cumulus cells by adding 25 \u0026micro;L of hyaluronidase at 0.5% to each well and gently pipetting until most of the cumulus cells were removed.\u003c/p\u003e\u003cp\u003e\u003cb\u003e2.5 Electroporation of\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003ematured oocytes prior to\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003efertilization (IVF) in the Presence of Cas9 protein and sgRNA\u003c/b\u003e\u003c/p\u003e\u003cp\u003eElectroporation of the \u003cem\u003ein vitro\u003c/em\u003e-matured oocytes was performed just before \u003cem\u003ein vitro\u003c/em\u003e fertilization (IVF), as previously described by [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In brief, the oocytes were washed in Opti-MEM (Thermo Fisher Scientific. Madrid, Spain) and then electroporated on a slide between 1 mm gap electrodes (45\u0026ndash;0104, BTX, Harvard Apparatus, Holliston, MA, USA), which were connected to an ECM 830 electroporation system (BTX, Harvard Apparatus, Holliston, MA, USA). Four pulses of 30 V with a pulse duration of 1 ms and an interval of 100 ms were applied, and the Cas9 protein and sgRNA concentrations were between 25 to 100 ng/\u0026micro;L and 12.5 to 50 ng/\u0026micro;L, respectively.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.6. Microinjection of \u003cem\u003ein vitro\u003c/em\u003e matured oocytes prior to IVF with CBE-encoding mRNA and sgRNA\u003c/h2\u003e\u003cp\u003eMicroinjection of \u003cem\u003ein vitro\u003c/em\u003e-matured oocytes was performed just before IVF, as previously described [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The oocytes were placed in a drop of DPBS-PVA that was covered by mineral oil. Then, an inverted Eclipse Ts2R microscope (Nikon, Tokyo, Japan) and a Transfer man 4R micromanipulation system (Eppendorf, Hamburg, Germany) were used to microinject the oocytes with a solution of CBE-encoding mRNA (100\u0026ndash;200 ng/\u0026micro;L) and sgRNA (50\u0026ndash;100 ng/\u0026micro;L) in Opti-MEM.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.7. \u003cem\u003eIn vitro\u003c/em\u003e fertilization and embryo culture\u003c/h2\u003e\u003cp\u003eIVF was performed as previously described [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The i\u003cem\u003en vitro-\u003c/em\u003ematured oocytes were transferred to an IVF medium (PIG-IVF-LYO, Embryocloud, Murcia, Spain). The oocytes were inseminated with frozen-thawed ejaculated spermatozoa that were selected using a swim-up procedure [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In brief, a 0.25-ml straw of semen was thawed in a water bath at 38\u0026deg;C for 30 seconds. Then, the frozen-thawed semen was diluted in sperm swim-up medium (PIG-SUM-LYO, Embryocloud, Murcia, Spain) at 38 \u0026ordm;C. Sperm selection was performed by adding 1 ml of the sperm swim-up medium to a conical tube, followed by 1 ml of the thawed, diluted sperm added to the bottom of the tube. The tubes were then incubated at 38\u0026deg;C for 20 minutes at a 45\u0026deg; angle. Then, 500 \u0026micro;l of the top medium was aspirated, and the sperm was selected by swim-up and diluted in PIG-IVF-LYO.\u003c/p\u003e\u003cp\u003eThe oocytes were inseminated with a final concentration of 6000 sperm/ml. The gametes were co-cultured at 38.5 \u0026ordm;C with 5% CO\u003csub\u003e2\u003c/sub\u003e and 7% O\u003csub\u003e2\u003c/sub\u003e for 18\u0026ndash;20 h. After co-culture, the remaining cumulus cells and zona-attached spermatozoa were removed from the putative zygotes by pipetting. The zygotes were then cultured in PIG-IVC1-LYO (Embryocloud, Murcia, Spain) for 24 h, followed by culturing in PIG-IVC2-LYO (Embryocloud, Murcia, Spain) at 38.5 \u0026ordm;C, 5% CO\u003csub\u003e2\u003c/sub\u003e and 7% O\u003csub\u003e2\u003c/sub\u003e until 156 h post fertilization (hpf) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. After culturing for 24 h in PIG-IVC1-LYO medium, the cleavage rate was evaluated, and 2\u0026ndash;4 cell embryos were transferred to PIG-IVC2-LYO medium. On day 6.5, the formation of blastocysts was assessed, and the resulting blastocysts were retrieved.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.8. Mutation analysis in blastocysts derived from electroporation and microinjection procedures\u003c/h2\u003e\u003cp\u003eThe \u003cem\u003ezona pellucida\u003c/em\u003e was removed from the blastocysts by incubating them in a solution of 0.5% pronase (a protease derived from the bacterium \u003cem\u003eStreptomyces griseus\u003c/em\u003e), followed by washing them in nuclease-free water. The zona-free blastocysts were then stored individually at -20\u0026deg;C until analysis.\u003c/p\u003e\u003cp\u003eThe Phire Animal Tissue Direct PCR Kit (Thermo Fisher Scientific, Madrid, Spain) was used for DNA extraction and PCR following the manufacturer's instructions. PCR reactions were performed using a 12.5 \u0026micro;l PCR reaction mix containing 0.5 \u0026micro;M primers (FW: 5\u0026rsquo;-CCACTACTTCCCCATCTCGC; REV: 5\u0026rsquo;- TTCGGTGACGTTGAGCAGAA) and 1 \u0026micro;l of sample.\u003c/p\u003e\u003cp\u003eTo detect the indels generated following the conventional CRISPR/Cas9 strategy, the blastocysts were genotyped by fluorescent PCR-capillary gel electrophoresis as previously described [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. PCR was conducted using 6-FAM forward primers. After PCR amplification, the samples were diluted 1:100 v/v in TE buffer. Then 1 \u0026micro;l of the diluted samples was mixed with 11.5 \u0026micro;l Hi-DiTM formamide (Thermo Fisher Scientific. Madrid, Spain) and 0.1 \u0026micro;l GeneScanTM 500 LIZ Size Standard (Thermo Fisher Scientific. Madrid, Spain). Such mix was incubated at 95 \u0026ordm;C for 3 min and then immediately chilled on ice for 2 min. Subsequently, the samples were analyzed by capillary gel electrophoresis using a 3500 Genetic Analyzer (Applied Biosystems, Thermo Fisher Scientific. Madrid, Spain). The details of the instrumental protocol were similar to those described in a previous work [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. This included a capillary length of 50 cm, POP7 polymer; a G5 dye set, a run voltage of 19.5 kV, a pre-run voltage of 15 kV, an injection voltage of 1.6 kV, a run time of 1330 s, a pre-run time of 180 s, an injection time of 15 s, a data delay of 1 s, a size standard of GS500 (250) LIZ, and a size-caller using SizeCaller v1.10 software. The results were analyzed using Gene Mapper 5 software (Applied Biosystems).\u003c/p\u003e\u003cp\u003eTo detect the cytosine substitutions generated by the CBE strategy, the PCR products were purified using the PureLink\u0026trade; Quick Gel Extraction Kit (Invitrogen, Thermo Fisher Scientific. Madrid, Spain) and sequenced using the Sanger method.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Statistical analysis\u003c/h2\u003e\u003cp\u003eData are presented as percentages or the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). All data analyses were performed using IBM SPSS Statistics for Windows, Version 28.0. (IBM Corp., Armonk, NY). Proportions (cleavage/oocyte, blastocyst/oocyte, edited/blastocyst, and KO-homozygous per blastocyst and per oocyte) were analyzed using generalized linear mixed models (binomial, logit link), including replicate as a random intercept (GENLINMIXED). When the effect was significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), pairwise comparisons between groups were obtained from estimated marginal means with a Bonferroni adjustment for multiple comparisons.\u003c/p\u003e\u003cp\u003eContinuous variables (number of alleles per embryo) that did not meet the assumptions of normality were analyzed using the nonparametric Kruskal\u0026ndash;Wallis test. When the result was significant, the Conover\u0026ndash;Iman test was used for pairwise comparisons. Finally, multi-cell genotype tables were analyzed using Fisher's exact test. All tests were two-sided, and significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Experimental design","content":"\u003cp\u003eTwo \u003cem\u003ein vitro\u003c/em\u003e experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were performed to generate a premature stop codon in the \u003cem\u003eGJB2\u003c/em\u003e gene. In one experiment, conventional CRISPR/Cas9 system was delivered by electroporation to induce a double-strand break (DSB) at the target site, leading to the generation of random indels. The other experiment delivered CBE via microinjection to convert cytosine to thymine at specific sites. This conversion can generate a stop codon, thereby disrupting protein formation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e3.1. Oocyte electroporation with conventional CRISPR/Cas9 system. Effect of the concentration of sgRNA and Cas9\u003c/h2\u003e\u003cp\u003eThe goal was to disrupt the porcine \u003cem\u003eGJB2\u003c/em\u003e gene by generating random frame-disrupting insertions and/or deletions (indels) through non-homologous end joining (NHEJ) repair of double-strand breaks (DSBs) generated by the conventional CRISPR/Cas9 system. Randomly generated indels that are not multiple of three can disrupt the open reading frame of the gene, resulting in a truncated protein. Three different concentrations of the components of the CRISPR/Cas9 system were tested during electroporation of porcine \u003cem\u003ein vitro-\u003c/em\u003ematured oocytes: 1x (25 ng/\u0026micro;L Cas9 protein and 12.5 ng/\u0026micro;L sgRNA), 2x (50 ng/\u0026micro;L Cas9 and 25 ng/\u0026micro;L sgRNA), and 4x (100 ng/\u0026micro;L Cas9 and 50 ng/\u0026micro;L sgRNA). A group without electroporation treatment served as the control. Three replicates were performed.\u003c/p\u003e\u003cp\u003eEmbryonic development was assessed in all the experimental groups, including cleavage rates and blastocyst formation rates. Blastocysts were genotyped using fluorescent PCR-capillary gel electrophoresis. The embryos were classified as wild type (WT) (containing no mutated alleles), heterozygous (containing WT and KO alleles), or homozygous KO (containing only alleles edited\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOther parameters were calculated from the edited blastocysts, including the mosaicism rate (the percentage of edited embryos containing more than two alleles). The number of alleles in edited embryos was also calculated, including wild-type (WT) alleles if present. The total and homozygous edition efficiency rate was calculated by dividing the number of gene-edited blastocysts by the total number of electroporated oocytes. This parameter simultaneously evaluates embryo development and mutation rates.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e3.2. Oocyte microinjection with Cytosine Base Editor. Effect of components concentration and sgRNA designs\u003c/h2\u003e\u003cp\u003eThe goal was to ablate the porcine \u003cem\u003eGJB2\u003c/em\u003e gene through the generation of a premature stop codon by the cytosine base editor BE3 (CBE) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. For each of the three designed sgRNAs, three to four cytosines in the \u003cem\u003eGJB2\u003c/em\u003e gene were susceptible to modification by the CBE. Thus, the editing rates were analyzed for each cytosine and sgRNA. In some cases, the change from cytosine to thymine was a silent mutation (no amino acid change), while in others, it induced a change in amino acids but not a stop codon (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eThe protocol was initially validated using sgRNA1. Two concentrations of the cytosine base editor and the sgRNAs were tested: 1x (100 ng/\u0026micro;L CBE and 50 ng/\u0026micro;L sgRNA) and 2x (200 ng/\u0026micro;L CBE and 100 ng/\u0026micro;L sgRNA). One group was microinjected with Opti-MEM only. This group served as the microinjection control for embryo development. Another group received no treatment. This group served as the non-microinjected control for embryo development. Subsequent experiments involving sgRNAs 2 and 3 tested the same two concentrations and compared developmental rates to those of the non-microinjected control. Three replicates were performed in all the experiments.\u003c/p\u003e\u003cp\u003eEmbryonic development was assessed in all the experimental groups, including cleavage rates and blastocyst formation rates. The embryos were classified as wild type (WT) (containing no mutated alleles), heterozygous (containing WT and KO alleles), or homozygous KO (containing only alleles with a premature stop codon).\u003c/p\u003e\u003cp\u003eThe total and homozygous edition efficiency was calculated by dividing the number of mutant blastocysts or the mutant homozygous blastocysts (with induced premature stop codon) by the total number of microinjected oocytes. This final parameter simultaneously evaluates both embryo development and mutation rates.\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Results","content":"\u003cp\u003e\u003cb\u003e4.1 Use of oocyte electroporation with conventional CRISPR/Cas9 techniques. Effect of the concentration of sgRNA and Cas9\u003c/b\u003e\u003c/p\u003e\u003cp\u003eCompared with the non-electroporated control group, electroporation of oocytes with the CRISPR/Cas9 components increased cleavage rates (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). There were no noticeable differences among the different concentrations of CRISPR/Cas9 tested. However, the blastocyst rates were similar for all the groups (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e; p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eThe cleavage and blastocyst rates (per total oocytes) are shown for oocytes electroporated with CRISPR/Cas9 components at different concentrations.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGroup\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003eCleavage\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003eBlastocyst/oocyte\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003en\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e%\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003en\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e%\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eControl\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e73/144\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e50.69\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e40/144\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e27.78\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectroporation X1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94/141\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e66.67\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e34/141\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e24.11\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectroporation X2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e94/150\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e62.67\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e28/150\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e18.67\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectroporation X4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e110/166\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e66.27\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e28/166\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e16.87\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP value\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.010\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.148\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eDifferent superscripts (\u003csup\u003ea\u003c/sup\u003e, \u003csup\u003eb\u003c/sup\u003e) in the same column indicate significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eElectroporation generated high mutation rates ranging from 70\u0026ndash;90%, regardless of the concentration of CRISPR/Cas9 (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, most embryos were heterozygous, harboring also the WT allele. Homozygous KO embryos (i.e., harboring only alleles formed by frame-disrupting indels) were detected only in the group microinjected with the highest concentration (X4 group, 3.8% of the total embryos, 13% from the edited one; Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). High mosaicism rates were observed across all groups, ranging from 79% to 96%, with no significant differences among concentrations (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05; Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The mean number of alleles was higher in the group electroporated with the highest concentration (3.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12) than in the group with the lowest concentration (3.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15; Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Overall total and homozygous editing efficiency, calculated as the percentage of edited blastocysts derived from all oocytes electroporated, was similar among groups, ranging from 14.5% to 17% for total efficiency and 0 to 1.8% for homozygous edition (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05, Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eFrequency distribution of genotypes of the blastocyst edited by CBE at different cytosine positions with two concentrations. WT: wild type; Het: heterozygous edition; Hom: homozygous edition. P value for Fisher\u0026rsquo;s exact test (two-sided)\u0026thinsp;=\u0026thinsp;0.192.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGroup\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eN blastocytes\u003c/p\u003e\u003cp\u003egenotyped\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eWT\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHet\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eHom\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectroporation X1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e34\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e29.4%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e70.6%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.0%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectroporation X2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e28\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e14.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e85.7%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e0.0%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectroporation X4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e11.5%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e84.6%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e3.8%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTotal\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e88\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e19.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e79.5%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1.1%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eEdition parameters for oocytes electroporated with CRISPR/Cas9 components at different concentrations. The efficiency total and homozygous edition rates were calculated from the total number of oocytes used. The mosaicism rate, and number of alleles per blastocyst were calculated based on edited embryos. Values are expressed in percentage or as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGroup\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMosaicism rate (%)*\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNumber of alleles*\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eEfficiency total edition (%)\u003csup\u003e\u0026dagger;\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eEfficiency homozygous edition (%)\u003csup\u003e\u0026dagger;\u003c/sup\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectroporation X1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e79.17%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e17.02%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectroporation X2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e83.33%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e16.00%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eElectroporation X4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e95.65%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e3.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e14.46%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1.81%\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP value\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e0.198\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.034\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0.822\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e0.080\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eDifferent superscripts (\u003csup\u003ea\u003c/sup\u003e, \u003csup\u003eb\u003c/sup\u003e) in the same column indicate significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003cem\u003e*\u003c/em\u003eCalculated based on edited embryos. \u003csup\u003e\u0026dagger;\u003c/sup\u003eCalculated based on total oocytes electroporated\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e4.2. Microinjection of oocytes with cytosine base editor: effect of components concentration using sgRNA1\u003c/h2\u003e\u003cp\u003eMicroinjection of oocytes with or without CBE components did not affect the cleavage rate assessed two days after fertilization compared to the control group of non-microinjected oocytes (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, the blastocyst formation rate was lower in the group microinjected with the highest concentration of components (X2) than in the non-microinjected control group (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). No differences were observed between the group microinjected with the lowest concentration (X1) and the microinjection control group.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eCleavage and blastocyst rates (per total oocytes) from oocytes microinjected with Cytosine Base Editor and sgRNA1 with two different concentrations. Values are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGroup\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003eCleavage\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003eBlastocyst/oocyte\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003en\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e%\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003en\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e%\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNon-microinjected control\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e63/155\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e40.65\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e36/155\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e23.23\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMicroinjection Control\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e55/144\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e38.19\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e22/144\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e15.28\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMicroinjection CBE\u0026thinsp;+\u0026thinsp;sgRNA 1x\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e87/195\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e44.62\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e43/195\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e22.05\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMicroinjection CBE\u0026thinsp;+\u0026thinsp;sgRNA 2x\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e70/190\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e36.84\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15/190\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e7.89\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP value\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0.406\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eDifferent superscripts (\u003csup\u003ea\u003c/sup\u003e, \u003csup\u003eb\u003c/sup\u003e) in the same column indicate significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eThe mutation rates were assessed at the position necessary to generate a premature stop codon (position 0, P0) and at two additional cytosines located at positions \u0026minus;\u0026thinsp;3 (P-3) and \u0026minus;\u0026thinsp;4 (P-4). The cytosine substitutions at P-3 and P-4 result in either an amino acid change from arginine to tryptophan (Arg98Trp) or a silent mutation, respectively.\u003c/p\u003e\u003cp\u003eMutation rates at P0, P-3 and P-4 increased in a similar way at higher concentrations of CBE components, rising from a mutation rate of 10\u0026ndash;17% at the lower concentration to around 50% at the higher concentration (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The genotype frequency distribution (homozygous, heterozygous and wild type) changed with increasing concentration (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, Fisher\u0026rsquo;s exact test (two-sided), p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Homozygous mutation at positions P0 and P-4 was only achieved at the highest concentration of CBE components.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eFrequency distribution of genotypes of the blastocyst edited by CBE at different cytosine positions with two concentrations of sgRNA1. WT: wild type; Het: heterozygous edition; Hom: homozygous edition. P value for Fisher\u0026rsquo;s exact test (two-sided).\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\u003cp\u003eCBE X1 (n\u0026thinsp;=\u0026thinsp;41)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e\u003cp\u003eCBE X2 (n\u0026thinsp;=\u0026thinsp;15)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCytosine\u003c/p\u003e\u003cp\u003eposition\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWT\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHet\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHom\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWT\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eHet\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eHom\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eP value\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e82.9%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e17.1%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e53.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e26.7%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e20.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e0.011\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP-3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e85.4%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e9.8%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e4.9%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e53.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e33.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e13.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e0.028\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP-4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e90.2%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e9.8%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e53.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e\u003cp\u003e40.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e\u003cp\u003e6.7%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e0.005\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eThe overall efficiency, which considers both homozygous mutation generation efficiency and embryo development, remained low, with 3.59\u0026ndash;3.68% of microinjected oocytes producing a KO blastocyst harboring a stop codon for both concentrations of CBE components (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e4.3. Effect of the sgRNA used with base editors\u003c/h2\u003e\u003cp\u003eThe rates of embryo development were similar for all microinjected groups, with cleavage rates ranging from 51 to 60% and blastocyst formation rates ranging from 12 to 19% (Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e; P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). However, the cleavage rate was lower than that of the control group (51\u0026ndash;60 vs. 65%) and the blastocyst rates were consistently lower (12\u0026ndash;19 vs. 36%; P\u0026thinsp;\u0026lt;\u0026thinsp;0.001; Table\u0026nbsp;\u003cspan refid=\"Tab7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab7\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 7\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eCleavage and blastocyst rates (per total oocytes) from oocytes microinjected with CBE components at different concentrations. Values are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u003cp\u003eGroup\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003eCleavage\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e\u003cp\u003eBlastocyst/oocyte\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003en\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003e%\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003en\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003e%\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNon-microinjected control\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e118/181\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e65.19\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e65/181\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e35.91\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esgRNA2 x1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e91/174\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e52.30\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e28/174\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e16.09\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esgRNA2 x2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e106/178\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e59.55\u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e33/178\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e18.54 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esgRNA3 x1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e104/177\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e58.76 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e30/177\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e16.95 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esgRNA3 x2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e92/181\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e50.83\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e22/181\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e12.15 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP value\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0.037\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"5\"\u003eDifferent superscripts (\u003csup\u003ea\u003c/sup\u003e, \u003csup\u003eb\u003c/sup\u003e) in the same column indicate significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eFor sgRNA2, the mutation rate at the target site (position 0, P0), which generates a premature stop codon, was similar at the two CBE concentrations tested (approximately 10%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). However, homozygous editions were only observed in the 2X group in 6% of the blastocysts (Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). Mutation rates of a cytosine located at position \u0026minus;\u0026thinsp;2 (P-2, resulting in a threonine to isoleucine substitution, Thr123Ile) and another cytosine located at position 1 (P-1, silent mutation) were not significantly different between both concentration groups, and no homozygous editions were observed (Table\u0026nbsp;\u003cspan refid=\"Tab8\" class=\"InternalRef\"\u003e8\u003c/span\u003e, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab8\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 8\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eFrequency distribution of genotypes of the blastocyst edited by CBE at different cytosine positions with two concentrations of sgRNA2. WT: wild type; Het: heterozygous edition; Hom: homozygous edition. P value for Fisher\u0026rsquo;s exact test (two-sided).\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\u003cp\u003eCBE X1 (n\u0026thinsp;=\u0026thinsp;28)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e\u003cp\u003eCBE X2 (n\u0026thinsp;=\u0026thinsp;33)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCytosine\u003c/p\u003e\u003cp\u003eposition\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWT\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHet\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHom\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWT\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eHet\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eHom\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eP value\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e89,3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10,7%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0,0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e90,9%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e3,0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e6,1%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e0.285\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e92,9%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e7,1%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0,0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e97,0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e3.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0,0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e0.438\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e92,9%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e7,1%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0,0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e97,0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e3.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0,0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e0.438\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eFor sgRNA3, the mutation rate at the target sites (positions P0 and P-1, both of which generate a premature stop codon) was similar at the two CBE concentrations tested, with values of 6.67% and 10% for the low and high concentrations, respectively (Table\u0026nbsp;\u003cspan refid=\"Tab9\" class=\"InternalRef\"\u003e9\u003c/span\u003e, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The homozygous mutation rate (76.7% vs. 35%) of a cytosine located at position \u0026minus;\u0026thinsp;3 (P-3, resulting in a silent mutation) was higher in the microinjected group with the lower CBE concentration (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The mutation rate of another cytosine at position \u0026minus;\u0026thinsp;5 (P-5, resulting in an alanine-to-threonine substitution, Ala171Thr) did not differ significantly between the microinjected groups (13.3% vs. 5%, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), although homozygous embryos could only be obtained in the group with the lower concentration (3.3% vs. 0%, p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab9\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 9\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eFrequency distribution of genotypes of the blastocyst edited by CBE at different cytosine positions with two concentrations of sgRNA3. WT: wild type; Het: heterozygous edition; Hom: homozygous edition. P value for Fisher\u0026rsquo;s exact test (two-sided).\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\u003cp\u003eCBE X1 (n\u0026thinsp;=\u0026thinsp;30)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e\u003cp\u003eCBE X2 (n\u0026thinsp;=\u0026thinsp;20)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/th\u003e\u003c/tr\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCytosine\u003c/p\u003e\u003cp\u003eposition\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eWT\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eHet\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHom\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWT\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eHet\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eHom\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eP value\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP0 or P-1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e93.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e6.7%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e90%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e10.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e0.141\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP-3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e13.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e76.7%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e40.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e25%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e35%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e0.013\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP-5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e86.7%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e10.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e3.3%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e95.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e5.0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e0%\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e\u003cp\u003e0.782\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e shows a summary of the efficiency of total and homozygous blastocysts over microinjected oocytes when using the three different sgRNAs at low and high concentrations. While the percentage of total edition was similar to all the experimental group (combination of sgRNA and concentration) (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05), percentage of homozygous edition efficiency was affected (p\u0026thinsp;\u0026lt;\u0026thinsp;0.010), because for low concentration of sgRNA 1 and 2, the percentage of homozygous edition is null.\u003c/p\u003e\u003c/div\u003e"},{"header":"5. Discussion","content":"\u003cp\u003eCRISPR/Cas technologies facilitates the generation of genetically modified large animals that can serve as valuable models for human diseases, such as non-syndromic hearing loss (reviewed by Wang \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]). With the rapid advancement of gene therapy, these gene-edited large animals will be of great interest for testing different therapeutic strategies [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. A clear example in this field is gene therapy targeting mutations in the \u003cem\u003eotoferlin\u003c/em\u003e (\u003cem\u003eOTOF\u003c/em\u003e) gene, which are associated with non-syndromic forms of deafness [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The development of \u003cem\u003eOTOF\u003c/em\u003e KO animal models, including mouse and sheep [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], has enabled the evaluation of the efficacy and safety of this gene therapy, which is currently undergoing clinical trials in humans [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWe investigated the use of the conventional CRISPR/Cas9 system and a cytosine base editor to generate gene-edited pig embryos. If viable, the next step would be to produce \u003cem\u003eGJB2\u003c/em\u003e KO piglets through embryo transfer. These \u003cem\u003eGJB2\u003c/em\u003e KO piglets could serve as valuable models for studying human Cx26\u0026ndash;related hearing loss and for developing novel therapeutic approaches, such as gene therapy. They would provide complementary insights to those obtained from mouse models [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In this sense, the identity rate of the amino acid chain of the Cx26 protein between pigs and humans (216/226 aa, 95.58%) is slightly higher than between mice and humans (210/226, 92.92%), whereas the identity rate between pig and mouse decreases to 89.82% (203/226).\u003c/p\u003e\u003cp\u003eTo achieve this objective, we first applied electroporation to \u003cem\u003ein vitro\u003c/em\u003e\u0026ndash;matured oocytes using CRISPR/Cas9 components. Electroporation of oocytes or zygotes to generate gene-edited embryos is a valuable approach that enables the assessment of RNA guide efficiency and the evaluation of potential detrimental effects on embryo development (reviewed by Pi\u0026ntilde;eiro-Silva and Gadea [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]). Since the efficiency of genome editing following electroporation depends on sgRNA concentration [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], three different concentrations were tested to optimize embryo development and editing efficiency while minimizing mosaicism. Regarding embryo development, the electroporated groups displayed higher cleavage rates than the control, in agreement with prior observations [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan additionalcitationids=\"CR37\" citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. This increase in cleavage rates is associated with parthenogenetic activation of the electroporated oocytes [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. However, the blastocyst rate was similar for all the experimental groups.\u003c/p\u003e\u003cp\u003eRegarding editing efficiency and mosaicism rates, although the mutation rates obtained after electroporation were high (\u0026gt;\u0026thinsp;70% across all concentration groups), low rates of homozygous mutations (0\u0026ndash;15%) and high levels of mosaicism (\u0026gt;\u0026thinsp;79%) were observed. The low rates of homozygous mutations present significant challenges to the procedure's overall efficiency, since breeding of heterozygous animals would be required to produce offspring with mutations in both alleles (homozygous), thereby delaying the production of the desired genotypes and increasing animal maintenance and breeding costs. The high mosaicism rate is inherently bound to low homozygous mutation rate and also complicates the genotyping of animals derived from these embryos. Mosaicism, the coexistence of distinct cell populations with different mutations in the same individual, hinders accurately assessing each mutation's phenotypic impact and increases genetic variant numbers in the F1 generation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo both reduce the mosaicism rate and increase homozygous edition, alternative gene-editing strategies can be employed. Cytosine base editors (CBEs) are genome-editing tools that can introduce precise point mutations by converting cytosine (C) to thymine (T) without creating double-strand breaks in DNA [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. CBEs generally induce more predictable mutations than the insertions or deletions (indels) resulting from double-strand break repair in the conventional CRISPR/Cas9 system. As summarized in Table\u0026nbsp;\u003cspan refid=\"Tab10\" class=\"InternalRef\"\u003e10\u003c/span\u003e, CBEs have been used to modify somatic cells in culture, including fetal porcine fibroblasts [\u003cspan additionalcitationids=\"CR43 CR44 CR45\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], as well as human HEK cells [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. CBEs have also enabled the generation of subsequent generations of piglets via somatic cell nuclear transfer [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Additionally, CBEs can be directly injected into germinal vesicle (GV) oocytes [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], parthenotes or zygotes [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], but, to our knowledge, CBE microinjection into mature porcine oocytes was not tested before. This approach may offer several advantages, as our group has previously demonstrated with the microinjection of CRISPR/Cas9 components [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Editing at the oocyte stage allows the machinery to act before DNA replication occurs, which reduces mosaicism in the resulting embryos [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. This method also enables the simultaneous targeting of maternal and paternal alleles, which may favor high-fidelity DNA repair pathways and improve the precision of modifications.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab10\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 10\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSummary of the use of CBEs for editing porcine somatic cells, gametes and embryos\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"5\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene(s)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eModel\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBase Editor(s)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCell Type(s)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eReference\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTWIST2, TYR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAblepharon macrostomia syndrome (AMS), Oculocutaneous albinism type 1 (OCA1)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBE3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePFF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eLi \u003cem\u003eet al., 2018\u003c/em\u003e [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDMR, TYR, LMNA, RAG1, RAG2, IL2RG, POL\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDuchenne muscular dystrophy (DMD), Albinism, Hutchinson-Gilford Progeria Syndrome (HGPS), Immune deficiencies, PERV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBE3\u003c/p\u003e\u003cp\u003ehA3A-BE3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePFF\u003c/p\u003e\u003cp\u003eParthenotes Zygotes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eXie \u003cem\u003eet al.\u003c/em\u003e, 2019 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGGAT1, B4galNT2, CMAH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eXenotransplantation\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBE4-Gam\u003c/p\u003e\u003cp\u003eAncBE4max\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePFF\u003c/p\u003e\u003cp\u003eParthenotes Zygotes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eYuan \u003cem\u003eet al.\u003c/em\u003e, 2020 [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eX-linked DMD (5 gRNAs)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eDuchenne muscular dystrophy\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBE3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eGV oocytes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSu \u003cem\u003eet al.\u003c/em\u003e, 2020 [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCD163, APN, MSTN, MC4R\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePRRS virus resistance, TGEV resistance, Muscle growth, Melanocortin-4 receptor\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003ehA3A-BE3-NG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eHEK293T\u003c/p\u003e\u003cp\u003ePFF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eWang \u003cem\u003eet al.\u003c/em\u003e, 2020 [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eP53\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCancer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003epCMV-BE3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePFF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eLi \u003cem\u003eet al., 2021\u003c/em\u003e [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAPOA5, LDLR, CD163, MSTN\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eApoA-V, LDL receptor, PRRS virus resistance, Muscle growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eYE1-BE4maxNG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePFF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003ePan \u003cem\u003eet al., 2021\u003c/em\u003e [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCD163, MSTN, IGF2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePRRS virus resistance, Muscle growth, Meat production\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003erA1-BE3\u003c/p\u003e\u003cp\u003ehA3A-BE3\u003c/p\u003e\u003cp\u003ehA3A-BE3-Y130F hA3A-BE-Y130F\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePEF\u003c/p\u003e\u003cp\u003eParthenotes\u003c/p\u003e\u003cp\u003eZygotes\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSong \u003cem\u003eet al.\u003c/em\u003e, 2022 [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePERV\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePorcine endogenous retrovirus\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBE4max\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eST cells\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eZheng \u003cem\u003eet al\u003c/em\u003e., 2022 [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIGF2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eMeat production\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBE3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003ePFF\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eDuo \u003cem\u003eet al.\u003c/em\u003e, 2023 [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eCBEs can introduce specific genetic modifications through targeted point mutations or generate knockout (KO) alleles [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Even when the goal is to create a premature stop codon, CBEs can edit multiple cytosines within the target region. Consequently, unintended amino acid substitutions may occur in the encoded protein, as demonstrated in this study using three different guide RNAs.\u003c/p\u003e\u003cp\u003eCytosine base editors have proven effective in creating missense mutations and early stop codons. They have applications in human disease modeling (e.g., LMNA \u003csup\u003eG608G\u003c/sup\u003e) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], organ xenotransplantation (e.g., GGAT1, B4GalNT2 and CMAH genes) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], and porcine production and health (e.g., C163, IGF2, and MSTN genes) [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Beyond these applications, CBEs could be used in the pig industry to manipulate single nucleotide polymorphisms (SNPs) and improve breeding. Several SNPs have been associated with significant productive traits, such as meat quality, growth, and resistance to viral diseases (reviewed by Song \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]).\u003c/p\u003e\u003cp\u003eIn our study, CBE microinjection yielded superior homozygous edition rates than conventional CRISPR/Cas9, but this efficiency varied depending on the sgRNA used and the concentration employed in the microinjection solution. Giner \u003cem\u003eet al.\u003c/em\u003e described factors that can affect CBE efficiency. These factors include the context-based efficiency of BEs (including chromatin accessibility and dinucleotide sequence motifs), the sequence-based efficiency of BEs (activity window size and PAM flexibility), and sgRNA length and secondary structure [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Previous studies have reported differences in mutation efficiency using different guides, ranging from 6.8% to 54.8%, when CBE was injected into GV oocytes [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. However, according to our results, in addition to the specific RNA guide, the concentration also affected embryo development and the mutation rate. On the other hand, differences in blastocyst and/or mutation rates were found when using different CBEs with the same sgRNA after injection into parthenotes [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. In this study we have used cytosine base editor BE3, initially described by Komor \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] and successfully used for editing rabbit and cattle embryos [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. So, it appears that optimizing the RNA guide, CBE, and concentration is necessary to optimize the system for each target. We used BE3 to ensure feasibility and comparability with previous work. However, the next generation CBEs as AncBE4max, YE1-BE4max-NG and A3A-BE-Y130F provide engineered deaminases and/or NG PAM compatibility. This tightens the deamination window and reduces off-target activity. These properties are expected to increase edit purity and reduce dose-related toxicity, potentially improving the competence of developing embryos at equivalent on-target rates.\u003c/p\u003e\u003cp\u003eApart from creating a stop codon, using different guides and CBE induced changes to the amino acid chain produced the following mutations: arginine to tryptophan (Arg98Trp) with sgRNA1, threonine to isoleucine (Thr123Ile) with sgRNA2, and alanine to threonine (Ala171Thr) with sgRNA3. Whereas these substitutions are functionally irrelevant if a stop codon is introduced, given the lack of functionality of the truncated protein, these substitutions alone might affect the functionality of a non-truncated protein. The original amino acids at positions 98, 123, and 171 are identical in pig and human proteins, but the mutations generated using CBE are not associated with any known human phenotypes. The structure of the human connexin 26 gap junction channel has been studied at a high resolution [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e], which allows to hypothesize about the possible functional consequences of these substitution. The Arg98Trp substitution in Cx26 potentially disrupts channel function by replacing a positively charged arginine, typically involved in stabilizing ionic interactions, with the neutral amino acid tryptophan. The Thr123Ile substitution may have variable functional effects because threonine is a polar, uncharged amino acid with a hydroxyl group that can participate in hydrogen bonding and undergo phosphorylation. In contrast, isoleucine is hydrophobic and apolar, lacking the ability to form hydrogen bonds. The substitution of alanine with threonine at position 171 could affect the protein's functionality. Alanine is hydrophobic and apolar with a small methyl side chain that contributes to protein stability. In contrast, threonine is polar and uncharged with a hydroxyl group that can form hydrogen bonds and undergo phosphorylation. Additionally, alanine is smaller and more compact, while threonine is larger and has greater potential for molecular interactions. Further studies, including functional assays and clinical correlations, would be necessary to determine the impact of these substitutions on protein function and auditory pathways.\u003c/p\u003e\u003cp\u003eIn this study, we demonstrated the efficiency of generating GJB2 KO embryos using the traditional CRISPR/Cas9 system and CBEs. Our current work on embryos was designed to produce loss-of-function (null) \u003cem\u003eGJB2\u003c/em\u003e alleles as a first step in measuring the effectiveness of CRISPR/Cas9 and cytosine base editing at the oocyte stage. A null porcine model most closely represents homozygous truncating genotypes in humans (e.g. 35delG, 235delC), which typically underline congenital severe-to-profound Nonsyndromic Hearing Loss and Deafness (DFNB1) [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. With the information derived from this first null model, missense models (e.g., p.V37) will be pursued in subsequent studies. Using pigs to study congenital deafness associated with \u003cem\u003eGJB2\u003c/em\u003e mutations could facilitate the development of an animal model more similar to humans in terms of genetics, physiology, and body size. This model is ideal for testing gene augmentation (AAV-GJB2), delivery routes (e.g. canalostomy), treatment timing around birth, dose-response and safety/immune readouts, as it has a large cochlea that approximates human anatomy and maturation.\u003c/p\u003e\u003cp\u003eFuture work will focus on the transfer of edited embryos to produce live \u003cem\u003eGJB2\u003c/em\u003e\u0026ndash;/\u0026ndash; piglets. These animals will allow comprehensive phenotypic characterization, including auditory brainstem response testing, cochlear histopathology, and Cx26 expression analysis. Once validated, this model will be used to evaluate the efficacy and safety of \u003cem\u003ein vivo\u003c/em\u003e gene-therapy approaches targeting \u003cem\u003eGJB2\u003c/em\u003e-related deafness.\u003c/p\u003e\u003cp\u003eIn conclusion, the generation of genetically modified pig models for human deafness using the CRISPR/Cas9 system or CBEs is possible, and they can be used to test both gene therapy or diagnostic techniques. Nevertheless, more research is needed in order to increase homozygous efficiency in order to achieve the desired genotype in the first generation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eCompeting interests\u003c/h2\u003e\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis research was funded by Fundaci\u0026oacute;n Seneca 22065/PI/22 and 22545/PDC/24; and Universidad de Murcia predoctoral fellowship R-496/2022.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eCelia Pi\u0026ntilde;eiro-Silva: Writing \u0026ndash; review \u0026amp; editing, Writing \u0026ndash; original draft, Methodology, Investigation, Data curation, Conceptualization. Pablo Bermejo-\u0026Aacute;lvarez: Investigation, Conceptualization, Writing \u0026ndash; review \u0026amp; editing. Francisco Jos\u0026eacute; Garc\u0026iacute;a-Purri\u0026ntilde;os: Conceptualization, Writing \u0026ndash; review \u0026amp; editing. Joaqu\u0026iacute;n Gadea: Writing \u0026ndash; review \u0026amp; editing, Writing \u0026ndash; original draft, Resources, Project administration, Funding acquisition, Formal analysis, Data curation, Conceptualization.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e\u003cp\u003eThe authors wish to thank CEFU, SA, and El Pozo, SA, for providing the ovaries from which the oocytes were generated, and Juan Antonio Carvajal for collecting the ovaries at the slaughterhouse.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAdditional raw data are available from the corresponding author upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKenneson, A., Van Naarden Braun, K. \u0026amp; Boyle, C. GJB2 (connexin 26) variants and nonsyndromic sensorineural hearing loss: a HuGE review. \u003cem\u003eGenet. Med. Off J. Am. Coll. Med. Genet.\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e, 258\u0026ndash;274 (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChan, D. K. \u0026amp; Chang, K. W. GJB2-associated hearing loss: systematic review of worldwide prevalence, genotype, and auditory phenotype. \u003cem\u003eLaryngoscope\u003c/em\u003e \u003cb\u003e124\u003c/b\u003e, E34\u0026ndash;53 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKe, Y., Liu, X. \u0026amp; Sun, Y. Regulatory mechanisms of connexin26. \u003cem\u003eNeuroscience\u003c/em\u003e \u003cb\u003e570\u003c/b\u003e, 9\u0026ndash;15 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBeach, R. et al. GJB2 Mutations Linked to Hearing Loss Exhibit Differential Trafficking and Functional Defects as Revealed in Cochlear-Relevant Cells. \u003cem\u003eFront. Cell. Dev. Biol.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 215 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSnoeckx, R. L. et al. GJB2 mutations and degree of hearing loss: a multicenter study. \u003cem\u003eAm. J. Hum. Genet.\u003c/em\u003e \u003cb\u003e77\u003c/b\u003e, 945\u0026ndash;957 (2005).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCohen-Salmon, M. et al. Targeted ablation of connexin26 in the inner ear epithelial gap junction network causes hearing impairment and cell death. \u003cem\u003eCurr. Biol. CB\u003c/em\u003e. \u003cb\u003e12\u003c/b\u003e, 1106\u0026ndash;1111 (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, Y. et al. Targeted connexin26 ablation arrests postnatal development of the organ of Corti. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cb\u003e385\u003c/b\u003e, 33\u0026ndash;37 (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin, L. et al. Ultrastructural pathological changes in the cochlear cells of connexin 26 conditional knockout mice. \u003cem\u003eMol. Med. Rep.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e, 1029\u0026ndash;1036 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, J., Chen, J., Zhu, Y., Liang, C. \u0026amp; Zhao, H. B. Deafness induced by Connexin 26 (GJB2) deficiency is not determined by endocochlear potential (EP) reduction but is associated with cochlear developmental disorders. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cb\u003e448\u003c/b\u003e, 28\u0026ndash;32 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun, Q. et al. Combined AAV-mediated specific Gjb2 expression restores hearing in DFNB1 mouse models. \u003cem\u003eMol. Ther. J. Am. Soc. Gene Ther.\u003c/em\u003e \u003cb\u003e33\u003c/b\u003e, 3006\u0026ndash;3021 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDom\u0026iacute;nguez-Ruiz, M. et al. A murine model for the del(GJB6-D13S1830) deletion recapitulating the phenotype of human DFNB1 hearing impairment: generation and functional and histopathological study. \u003cem\u003eBMC Genom.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 359 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCrispino, G. et al. In vivo genetic manipulation of inner ear connexin expression by bovine adeno-associated viral vectors. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 6567 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo, J. et al. GJB2 gene therapy and conditional deletion reveal developmental stage-dependent effects on inner ear structure and function. \u003cem\u003eMol. Ther. Methods Clin. Dev.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 319\u0026ndash;333 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo, W. \u0026amp; Yang, S. M. Advantages of a miniature pig model in research on human hereditary hearing loss. \u003cem\u003eJ. Otol\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, 105\u0026ndash;107 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo, W., Lei, C., Hui\u0026ndash;zhan, L. \u0026amp; Jian\u0026ndash;he, S. Shi\u0026ndash;ming, Y. Hearing and Cochlear structures in a Swine Model. \u003cem\u003eJ. Otol\u003c/em\u003e. \u003cb\u003e5\u003c/b\u003e, 97\u0026ndash;100 (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReis, A., Dalmolin, S. \u0026amp; Dallegrave, E. Animal models for hearing evaluations: a literature review. \u003cem\u003eRev. CEFAC\u003c/em\u003e. \u003cb\u003e19\u003c/b\u003e, 417\u0026ndash;428 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, X. et al. Genetically modified pigs: Emerging animal models for hereditary hearing loss. \u003cem\u003eZool. Res.\u003c/em\u003e \u003cb\u003e45\u003c/b\u003e, 284\u0026ndash;291 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXie, F. et al. Production of gene-edited pigs harboring orthologous human mutations via double cutting by CRISPR/Cas9 with long single-stranded DNAs as homology-directed repair templates by zygote injection. \u003cem\u003eTransgenic Res.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, 587\u0026ndash;598 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDai, P. et al. The prevalence of the 235delC GJB2 mutation in a Chinese deaf population. \u003cem\u003eGenet. Med. Off J. Am. Coll. Med. Genet.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 283\u0026ndash;289 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOliveros, J. C. et al. Breaking-Cas-interactive design of guide RNAs for CRISPR-Cas experiments for ENSEMBL genomes. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e44\u003c/b\u003e, W267\u0026ndash;W271 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKomor, A. C., Kim, Y. B., Packer, M. S., Zuris, J. A. \u0026amp; Liu, D. R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. \u003cem\u003eNature\u003c/em\u003e \u003cb\u003e533\u003c/b\u003e, 420\u0026ndash;424 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eP\u0026eacute;rez-G\u0026oacute;mez, A. et al. The role of TEAD4 in trophectoderm commitment and development is not conserved in non-rodent mammals. \u003cem\u003eDev. Camb. Engl.\u003c/em\u003e \u003cb\u003e151\u003c/b\u003e, dev202993 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLamas-Toranzo, I. et al. Strategies to reduce genetic mosaicism following CRISPR-mediated genome edition in bovine embryos. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, 14900 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCanovas, S. et al. DNA methylation and gene expression changes derived from assisted reproductive technologies can be decreased by reproductive fluids. \u003cem\u003eeLife\u003c/em\u003e 6, (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYuan, Y. et al. Quadrupling efficiency in production of genetically modified pigs through improved oocyte maturation. \u003cem\u003eProc. Natl. Acad. Sci. U. S. A.\u003c/em\u003e 114, E5796\u0026ndash;E5804 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNavarro-Serna, S. et al. Oocyte electroporation prior to in vitro fertilization is an efficient method to generate single, double, and multiple knockout porcine embryos of interest in biomedicine and animal production. \u003cem\u003eTheriogenology\u003c/em\u003e \u003cb\u003e218\u003c/b\u003e, 111\u0026ndash;118 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNavarro-Serna, S. et al. Generation of Nonmosaic, Two-Pore Channel 2 Biallelic Knockout Pigs in One Generation by CRISPR-Cas9 Microinjection before Oocyte Insemination. \u003cem\u003eCRISPR J.\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e, 132\u0026ndash;146 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePi\u0026ntilde;eiro-Silva, C. \u0026amp; Gadea, J. Optimization of lipofection protocols for CRISPR/Cas9 delivery in porcine zona pellucida intact oocytes: A study of coincubation duration and reagent efficacy. \u003cem\u003eTheriogenology\u003c/em\u003e \u003cb\u003e230\u003c/b\u003e, 121\u0026ndash;129 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRamlee, M. K., Yan, T., Cheung, A. M. S., Chuah, C. T. H. \u0026amp; Li, S. High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent PCR-capillary gel electrophoresis. \u003cem\u003eSci Rep\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e, (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJi, X. J. et al. Canalostomy is an ideal surgery route for inner ear gene delivery in big animal model. \u003cem\u003eActa Otolaryngol. (Stockh)\u003c/em\u003e. \u003cb\u003e139\u003c/b\u003e, 939\u0026ndash;947 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYasunaga, S. et al. A mutation in OTOF, encoding otoferlin, a FER-1-like protein, causes DFNB9, a nonsyndromic form of deafness. \u003cem\u003eNat. Genet.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 363\u0026ndash;369 (1999).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMenchaca, A. et al. Otoferlin gene editing in sheep via CRISPR-assisted ssODN-mediated Homology Directed Repair. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 5995 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLandegger, L. D. et al. The rise of cochlear gene therapy. \u003cem\u003eMol. Ther. J. Am. Soc. Gene Ther.\u003c/em\u003e \u003cb\u003e33\u003c/b\u003e, 2343\u0026ndash;2349 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSun, Q. et al. Combined AAV-mediated specific Gjb2 expression restores hearing in DFNB1 mouse models. \u003cem\u003eMol. Ther. J. Am. Soc. Gene Ther.\u003c/em\u003e \u003cb\u003e33\u003c/b\u003e, 3006\u0026ndash;3021 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePi\u0026ntilde;eiro-Silva, C. \u0026amp; Gadea, J. Optimizing gene editing in pigs: The role of electroporation and lipofection. \u003cem\u003eAnim. Reprod. Sci.\u003c/em\u003e \u003cb\u003e278\u003c/b\u003e, 107874 (2025).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNavarro-Serna et al. Effect of Aphidicolin, a Reversible Inhibitor of Eukaryotic Nuclear DNA Replication, on the Production of Genetically Modified Porcine Embryos by CRISPR/Cas9. \u003cem\u003eInt. J. Mol. Sci.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 2135 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNavarro-Serna et al. Generation of Calpain-3 knock-out porcine embryos by CRISPR-Cas9 electroporation and intracytoplasmic microinjection of oocytes before insemination. \u003cem\u003eTheriogenology\u003c/em\u003e \u003cb\u003e186\u003c/b\u003e, 175\u0026ndash;184 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePi\u0026ntilde;eiro-Silva, C., Navarro-Serna, S., Belda-P\u0026eacute;rez, R. \u0026amp; Gadea, J. Production of Genetically Modified Porcine Embryos via Lipofection of Zona-Pellucida-Intact Oocytes Using the CRISPR/Cas9 System. \u003cem\u003eAnimals\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 342 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePi\u0026ntilde;eiro-Silva, C. \u0026amp; Gadea, J. Optimizing oocyte electroporation for genetic modification of porcine embryos: Evaluation of the parthenogenetic activation. \u003cem\u003eTheriogenology\u003c/em\u003e \u003cb\u003e218\u003c/b\u003e, 126\u0026ndash;136 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMehravar, M., Shirazi, A., Nazari, M. \u0026amp; Banan, M. Mosaicism in CRISPR/Cas9-mediated genome editing. \u003cem\u003eDev. Biol.\u003c/em\u003e \u003cb\u003e445\u003c/b\u003e, 156\u0026ndash;162 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNishida, K. et al. Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. \u003cem\u003eScience\u003c/em\u003e \u003cb\u003e353\u003c/b\u003e, aaf8729 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, Z. et al. Efficient RNA-guided base editing for disease modeling in pigs. \u003cem\u003eCell. Discov\u003c/em\u003e. \u003cb\u003e4\u003c/b\u003e, 64 (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXie, J. et al. Efficient base editing for multiple genes and loci in pigs using base editors. \u003cem\u003eNat. Commun.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 2852 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang, Y. et al. Cytosine Base Editor (hA3A-BE3-NG)-Mediated Multiple Gene Editing for Pyramid Breeding in Pigs. \u003cem\u003eFront. Genet.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 592623 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePan, J. S. et al. Application of the modified cytosine base-editing in the cultured cells of bama minipig. \u003cem\u003eBiotechnol. Lett.\u003c/em\u003e \u003cb\u003e43\u003c/b\u003e, 1699\u0026ndash;1714 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZheng, S. et al. Efficient and Safe Editing of Porcine Endogenous Retrovirus Genomes by Multiple-Site Base-Editing Editor. \u003cem\u003eCells\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 3975 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYuan, H. et al. Efficient base editing by RNA-guided cytidine base editors (CBEs) in pigs. \u003cem\u003eCell. Mol. Life Sci. CMLS\u003c/em\u003e. \u003cb\u003e77\u003c/b\u003e, 719\u0026ndash;733 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDuo, T. et al. Single-base editing in IGF2 improves meat production and intramuscular fat deposition in Liang Guang Small Spotted pigs. \u003cem\u003eJ. Anim. Sci. Biotechnol.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 141 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSu, X. et al. Effective generation of maternal genome point mutated porcine embryos by injection of cytosine base editor into germinal vesicle oocytes. \u003cem\u003eSci. China Life Sci.\u003c/em\u003e \u003cb\u003e63\u003c/b\u003e, 996\u0026ndash;1005 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong, R. et al. One-step base editing in multiple genes by direct embryo injection for pig trait improvement. \u003cem\u003eSci. China Life Sci.\u003c/em\u003e \u003cb\u003e65\u003c/b\u003e, 739\u0026ndash;752 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong, R., Wang, Y. \u0026amp; Zhao, J. Base editing in pigs for precision breeding. \u003cem\u003eFront. Agric. Sci. Eng.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 161\u0026ndash;170 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi, H. et al. Efficient Generation of P53 Biallelic Mutations in Diannan Miniature Pigs Using RNA-Guided Base Editing. \u003cem\u003eLife Basel Switz.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1417 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGiner, G., Ikram, S., Herold, M. J. \u0026amp; Papenfuss, A. T. A systematic review of computational methods for designing efficient guides for CRISPR DNA base editor systems. \u003cem\u003eBrief. Bioinform\u003c/em\u003e. \u003cb\u003e24\u003c/b\u003e, bbad205 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eP\u0026eacute;rez-G\u0026oacute;mez, A. et al. PPARG is dispensable for bovine embryo development up to tubular stages\u0026dagger;. \u003cem\u003eBiol. Reprod.\u003c/em\u003e \u003cb\u003e111\u003c/b\u003e, 557\u0026ndash;566 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMaeda, S. et al. Structure of the connexin 26 gap junction channel at 3.5 \u0026Aring; resolution. \u003cem\u003eNature\u003c/em\u003e \u003cb\u003e458\u003c/b\u003e, 597\u0026ndash;602 (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDzhemileva, L. U. et al. Carrier frequency of GJB2 gene mutations c.35delG, c.235delC and c.167delT among the populations of Eurasia. \u003cem\u003eJ. Hum. Genet.\u003c/em\u003e \u003cb\u003e55\u003c/b\u003e, 749\u0026ndash;754 (2010).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Pig embryos, CRISPR/Cas9, cytosine base editor, GJB2, Connexin 26, gene editing, hearing loss","lastPublishedDoi":"10.21203/rs.3.rs-7999953/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7999953/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMutations in the \u003cem\u003eGJB2\u003c/em\u003e gene, which encodes Connexin 26 (Cx26), are responsible for the majority of cases of non-syndromic congenital hearing loss in humans. While murine \u003cem\u003eGJB2\u003c/em\u003e knockout models have provided mechanistic insight, anatomical and physiological differences limit their translational relevance. Pigs represent a valuable large-animal model because their auditory anatomy and maturation closely resemble those of humans. This study compared two genome-editing approaches to disrupt \u003cem\u003eGJB2\u003c/em\u003e in porcine oocytes before fertilization: (1) electroporation with CRISPR/Cas9 ribonucleoprotein and (2) microinjection with cytosine base editor (BE3) and single-guide RNAs (sgRNAs). Electroporation produced high mutation rates (70\u0026ndash;90%) across three concentrations of Cas9/sgRNA but yielded mostly heterozygous or mosaic blastocysts, with limited homozygous knockouts (\u0026lt;\u0026thinsp;4%). BE3 achieved precise cytosine-to-thymine conversions that introduced premature stop codons, reaching up to 47% total editing and 20% homozygous nonsense alleles. However, blastocyst formation declined at higher component concentrations. Overall, BE3 produced more predictable mutations than conventional CRISPR/Cas9, although embryo developmental competence was dose-dependent. Both methods effectively targeted \u003cem\u003eGJB2\u003c/em\u003e and demonstrated feasibility of pre-fertilization genome editing in porcine oocytes. These findings establish the groundwork for generating \u003cem\u003eGJB2\u003c/em\u003e-deficient pigs as translational models of Cx26-related congenital deafness and for future evaluation of gene-therapy strategies in a large-animal system.\u003c/p\u003e","manuscriptTitle":"Generation of GJB2 Gene-Edited Porcine Embryos as a Model for Human Congenital Deafness via CRISPR/Cas9 and Cytosine base editors","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-14 07:18:11","doi":"10.21203/rs.3.rs-7999953/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-12T05:04:50+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-01T04:35:37+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-01T04:35:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-10-31T15:24:32+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3a2757d6-ea7a-4e86-bba5-2d61e194176a","owner":[],"postedDate":"November 14th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":57840665,"name":"Biological sciences/Biological techniques"},{"id":57840666,"name":"Biological sciences/Biotechnology"},{"id":57840667,"name":"Biological sciences/Developmental biology"},{"id":57840668,"name":"Biological sciences/Genetics"},{"id":57840669,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2026-04-20T16:13:46+00:00","versionOfRecord":{"articleIdentity":"rs-7999953","link":"https://doi.org/10.1038/s41598-026-49229-0","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2026-04-18 15:58:04","publishedOnDateReadable":"April 18th, 2026"},"versionCreatedAt":"2025-11-14 07:18:11","video":"","vorDoi":"10.1038/s41598-026-49229-0","vorDoiUrl":"https://doi.org/10.1038/s41598-026-49229-0","workflowStages":[]},"version":"v1","identity":"rs-7999953","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7999953","identity":"rs-7999953","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00