The Wnt/β-catenin pathway maintains homeostasis of amniocytes in Down syndrome | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Wnt/β-catenin pathway maintains homeostasis of amniocytes in Down syndrome Xiaoying Chen, Miaochun Lin, Shan Chen, Zhengsen Wang, Zhaohui Li, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4461929/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 31 Jan, 2026 Read the published version in BMC Molecular and Cell Biology → Version 1 posted 4 You are reading this latest preprint version Abstract Background Down syndrome (DS), which is caused by partial or complete triplication of chromosome 21, may cause a range of clinical features. Although most fetuses with DS exhibit typical characteristics, the molecular pathogenesis underlying DS remains unclear. Wnt signaling is known to play a crucial role in fetal growth and development. However, the link between Wnt signaling and the abnormal development of fetuses with DS remains poorly understood. In this study, our objective was to investigate the dysregulation of Wnt signaling in the amniocytes of fetuses diagnosed with DS. To this end, we determined β-catenin protein expression, oxidative stress, cell proliferation, and apoptosis in amniocytes from fetuses diagnosed with DS. Subsequently, we upregulated the Wnt/β-catenin pathway components in amniocytes from fetuses diagnosed with DS and detected the expression of related proteins. Results We found that downregulating the Wnt/β-catenin pathway components decreased cell proliferation while increasing oxidative stress and apoptosis in the amniocytes derived from fetuses diagnosed with DS compared with those seen in normal fetal amniocytes. In contrast, upregulating the Wnt/β-catenin pathway components in DS amniocytes increased cell proliferation and decreased oxidative stress and apoptosis, resulting in improved cell growth. Conclusions The Wnt/β-catenin pathway may maintain homeostasis in DS amniocytes and normalize cell growth to levels similar to those in normal cells. These findings reveal a novel molecular mechanism underlying the abnormal regulation of Wnt/β-catenin signaling during the development of fetuses with DS, thereby suggesting potential targeted therapies for DS. Down syndrome Wnt/β-catenin pathway amniocyte homeostasis dysregulation Figures Figure 1 Figure 2 Figure 3 Background Down syndrome (DS), occurring in approximately 1/600–800 live births, is a common chromosomal disorder that reflects intellectual disability [ 1 ]. DS is caused by the trisomy of Homo sapiens chromosome 21 (HSA21) and is accompanied by a series of distinctive features, including intellectual disability, characteristic facial features, growth retardation, cardiac defects, digestive anomalies, autoimmune diseases, and Alzheimer's disease. Most fetuses with DS exhibit distinctive physical features, including characteristic facial features, cardiac defects, and internal anomalies [ 2 ]. Despite the high incidence of DS and the reported presence of supernumerary chromosome 21 as early as 1959 [ 3 ], the molecular pathogenesis remains unclear, with no specific treatments in sight [ 4 , 5 ]. Although DS is a multisystem and multiorgan abnormal disease, most existing studies have focused on one abnormal system or organ [ 6 ]. Determining the root causes as well as molecular mechanisms underlying the abnormal development of multisystem and multiorgan maladies is difficult. Current studies investigating DS focus on the construction of an animal transgenic DS model that entails the insertion of some genes on human chromosome 21; however, this animal DS model does not fully simulate the human DS phenotype [ 7 ], and most research participants are adolescents and adults with DS [ 8 – 10 ]. DS is a congenital genetic disease; therefore, it is more meaningful to study its molecular mechanisms during the fetal period. The canonical Wnt/β-catenin pathway is a signal transduction pathway that relies on Wnt extracellular signals and β-catenin intracellular signals. This pathway is highly evolutionarily conserved and plays an important role in the embryonic development and physiological and pathological processes of various organs. It is involved in the regulation of embryonic nervous system development and adult nerve homeostasis [ 11 , 12 ]. Previous studies have indicated that dysregulation of the Wnt signaling pathway is associated with several neurodegenerative diseases, such as Huntington's disease, Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis, and Alzheimer's disease [ 13 – 16 ]. The Wnt/β-catenin signaling pathway was found to be suppressed in the hippocampus of adults with DS and Alzheimer's disease [ 17 , 18 ]. In addition, the Wnt/β-catenin pathway regulates the development and regeneration of the heart [ 19 ]. This raises the possibility of the abnormal development of fetuses with DS being associated with dysregulation of the Wnt/β-catenin signaling pathway, suggesting the need for an in-depth understanding of such an association via exploratory research. To explore the molecular mechanism of the DS phenotype induced by chromosome 21 triploidy, several DS cell models have been established, including induced pluripotent stem cells (iPSCs), monocytes, blood cells, and primary fibroblasts [ 20 , 21 ]. However, these cell models represent the adult stage and do not represent the fetal development of DS. The amniotic fluid (AF) is formed during early pregnancy and encased in the amniotic cavity. It exists throughout embryonic development and provides an environment for the growth and mobility of the fetus [ 22 ]. There is a continuous bidirectional exchange of substances, including transmitting signal molecules and stem cells, between the AF and the fetus [ 23 ]. Amniocytes, shed by the three germ layers of the fetus, are free-flowing fetal cells present in the AF [ 4 , 24 ]. Therefore amniocytes may be more suitable for monitoring fetal development. In this study, we aimed to investigate the etiology of abnormal development of DS from the viewpoint of amniocytes. Methods Participants and samples Pregnant women who consulted the Prenatal Diagnostic Center of Mindong Hospital Affiliated to Fujian Medical University and had undergone amniocentesis and karyotype analysis were included in the study. Cases with amniocytes diagnosed with DS (n=10) via chromosome karyotype analysis were included in the experimental group, whereas cases with a normal karyotype (n=10) were included in the control group. This study was approved by the Ethics Committee of Mindong Hospital affiliated to Fujian Medical University (0820-03) and conformed to the Declaration of Helsinki. Written consent was obtained from all participants after a full explanation of the purpose and nature of procedures used. Amniocentesis and fetal karyotyping The gestational age at amniocentesis was 19 +0 –22 +6 weeks. All pregnant women provided informed consent prior to amniocentesis. Amniocentesis was performed under ultrasound guidance. After 2 ml of AF was extracted and discarded, 20 ml of AF was collected, centrifuged, and seeded into the medium (Biosan, Zhejiang, China) and cultured in an incubator (Thermo Fisher Scientific, Waltham, MA, USA)at 5% CO 2 at 37 °C. Amniocytes were cultured according to the standard protocol of the Mindong Hospital Affiliated to Fujian Medical University of Human Cytogenetics Guidelines. After G-banding, chromosomal analysis with a targeted 360–420 band level was performed for each sample using a GSL-120 high-throughput automatic chromosome scanning platform (Leica, Germany). At least 30 metaphase divisions were counted and at least 5 karyotypes were analyzed, following which the karyotypes were named according to the International System for Human Cytogenetics Nomenclature (ISCN, 2020). Immunofluorescence Amniocytes were seeded on glass coverslips pre-coated with 0.1 mg/ml poly-D lysine (NEST, Wuxi, China) and cultured in six-well plates. After 72 h, the cells were fixed with 4% paraformaldehyde (PFA) for 20 min at 4 °C. Samples were blocked with goat serum (ZSGB-BIO, Beijing, China) for 30 min at room temperature (RT). The following antibodies were diluted with phosphate-buffered saline and added to the cells at 4 ℃ overnight: anti-β-Catenin (1:200; mouse monoclonal, Millipore 05-665), anti-8-OhdG (1:200; mouse monoclonal, Santa Cruz sc-66036), and anti-Ki67 (1:200; rabbit monoclonal, Abcam ab16667). Secondary anti-rabbit antibodies, Alexa Fluor 488 (1:1000; Thermo- Fisher Scientific, A-21206) and secondary anti-mouse antibodies, Alexa Fluor 594 (1:1000; Thermo- Fisher Scientific, R37115) were incubated with the samples for 1 h at RT. The cells were treated with 4',6-diamidino-2-phenylindole (1:1000; Thermo Fisher Scientific, 62248) diluted in phosphate-buffered saline and incubated for 5 min at RT to label the nuclei. Western blot analysis Harvested amniocytes were lysed in radioimmunoprecipitation lysis buffer. Next, 25 μg protein samples were added into a 12% sodium dodecyl sulfate–polyacrylamide gel for electrophoretic separation and subsequently transferred to nitrocellulose membranes (Millipore, Z741975-1ROL). The membranes were blocked in Tris-buffered saline, 0.1% Tween 20 (TBS-T) with 5% non-fat dry milk at RT for 1 h, washed three times in TBS-T buffer, and incubated with the following primary antibodies overnight at 4 ℃: β-Catenin (1:1000; mouse monoclonal, Millipore 05-665), Caspase-3 (1:500; rabbit polyclonal, Abcam ab44976), Actin (1:1000; mouse monoclonal, Santa Cruz sc58673), and β-tubulin (1:1000; rabbit monoclonal, Abcam ab179511). The membranes were then incubated with fluorescent secondary anti-rabbit antibodies (1:2000; Thermo Fisher Scientific, 31210) and anti-mouse antibodies (1:2000; Thermo Fisher Scientific, 31160) for 1 h at RT. An Odyssey Clx (LI-COR Biosciences, Lincoln, NE, USA) infrared fluorescence scanning imaging system was used to scan the membranes, and the protein bands were analyzed and quantified using Image Studio software (LI-COR Biosciences). RNA preparation and real-time PCR Total amniocyte RNA was prepared using a Biospin Total RNA Extraction Kit (BioFlux, BSC63S1) following the manufacturer’s instructions. Next, 5 μg RNA was reverse-transcribed into cDNA according to the protocol of a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, k1621). The cDNA was used in Real-Time PCR Detection Systems to examine the transcript levels of target genes. Real-Time PCR was performed using a PrimeScript TM RT Reagent Kit (TaKaRa, RR037Q). A complete list of primers is provided in Table 1. Table 1. Primer sequences for real-time PCR RT-qPCR Gene name Forward primer (5′-3′) Reverse primer (5′-3′) 1.1 Wnt1 CGATGGTGGGGTATTGTGAAC CCGGATTTTGGCGTATCAGAC 1.2 Wnt2 CCGAGGTCAACTCTTCATGGT CCTGGCACATTATCGCACAT 1.3 Wnt3 AGGGCACCTCCACCATTTG GACACTAACACGCCGAAGTCA 1.4 Wnt4 GTACGCCATCTCTTCGGCAG GCGATGTTGTCAGAGCATCCT 1.5 Wnt5a GCCAGTATCAATTCCGACATCG TCACCGCGTATGTGAAGGC 1.6 GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC Pharmacological treatment of cells Amniocytes, identified via chromosome karyotype analysis as trisomy 21, were collected and inoculated into culture bottles. Wnt signaling activation was achieved by treatment with 1 μM CHIR99021 (Solarbio, 252917-06-9) and 3 μM CHIR99021 for 48 h each. Dimethylsulfoxide (0.1‰) was used as a control. CHIR99021 was prepared according to manufacturer’s instructions. Statistical analysis SPSS 22.0 software was used for statistical analysis, and quantification results are presented as mean ± standard error of mean (SEM). Student's t- test was used to calculate statistical significance. Statistical significance was set at P < 0.05. Results Wnt signaling is downregulated in DS amniocytes Amniocytes from fetuses diagnosed with DS via chromosomal karyotype analysis during the second trimester were collected for the study, whereas amniocytes with normal chromosomal karyotypes were used as the control group (Fig. 1 a). After 7 d of primary culture, the number of DS amniocyte clones was markedly lower than that of the control amniocytes, and cell aging and shedding occurred early (Fig. 1 d). Subsequently, we sub-cultured the amniocytes and found that the number of DS amniocytes was markedly lower than that of the control after 3 d (Fig. 1 b). This led us to wonder whether the aberrant growth of DS amniocytes was abnormally regulated by signaling pathways. As Wnt signaling plays an important regulatory role in embryonic development, we speculated that the growth of DS amniocytes may be associated with Wnt signaling. We sought to determine whether canonical Wnt signaling is dysregulated in DS amniocytes. β-catenin is a key protein in the canonical Wnt signaling pathway [ 25 ]. In this study, western blot was used to detect the expression of the β-catenin protein to reflect the activity levels of the Wnt signaling pathway. We found that β-catenin protein expression in DS amniocytes was significantly reduced compared with that in normal amniocytes (Fig. 1 f, h; P = 0.0061). In addition, we verified via immunofluorescence that the expression level of β-catenin in the nuclei of DS amniocytes was lower than that of normal amniocytes (Fig. 1 c). The expression of Wnt1 , Wnt2 , Wnt3 , Wnt4 , and Wnt5 in DS amniocytes was detected using real-time PCR. Wnt1 (P = 0.026), Wnt2 (P = 0.002), and Wnt4 (P = 0.007) were downregulated compared with those in the control group (Fig. 1 e). This demonstrates that Wnt signaling pathway activity is dysregulated in DS amniocytes. Molecular abnormalities in DS amniocytes Studies have shown that the occurrence of abnormal phenotypes in patients with DS is associated with increased oxidative stress [ 26 , 27 ]. This prompted us to explore whether oxidative stress is already elevated in fetuses with DS during pregnancy. It is known that 8-hydroxydeoxyguanine (8-OHdG) is a common product of oxidative stress. Reactive oxygen species can directly attack DNA and oxidize the 8-position carbon atom of guanine, resulting in 8-OHdG [ 28 ]. In the current study, the expression of 8-OHdG in the amniocytes of fetuses in the DS and control groups was detected using immunofluorescence. The results showed that a small amount of 8-OHdG was expressed in the amniocytes of the control group, whereas a large amount of 8-OHdG was detected in DS amniocytes. This indicates that oxidative stress was increased in DS amniocytes (Fig. 2 a). Excessive oxidative stress can cause cell injury and apoptosis, resulting in an imbalance between cell proliferation and apoptosis, as well as a series of abnormal phenotypes [ 29 ]. This necessitated an investigation into the proliferation and apoptosis of DS amniocytes. Caspase-3, the main terminal shear enzyme involved in apoptosis, was selected as an apoptosis marker. Ki67 is a nuclear protein that is expressed in all phases of cell proliferation (G1, S, G2, and M), although not in the quiescent phase (G0), and thus may be used as a marker of cell proliferation [ 30 ]. In the current study, western blotting and immunofluorescence were used to detect the expression of Caspase-3 and Ki67 in AF. The results showed that the expression of Caspase-3 in DS fetal amniocytes was higher than that in the control group (Fig. 2 c, d; P = 0.0088). This indicated that a large number of apoptotic cells were present in DS amniocytes. In addition, a large number of cells in the control group expressed Ki67, whereas only a small number of fetal AF cells with DS expressed Ki67 (Fig. 2 b, e; P = 0.0047). Considered together, these data suggest that in DS amniocytes, the Wnt signaling pathway is dysregulated, oxidative stress is increased, and cell proliferation and apoptosis are unbalanced. Pharmacological rescue Studies have shown that dysregulation of the Wnt signaling pathway may affect cellular oxidative stress, cell proliferation, and apoptosis [ 31 ]. Next, we investigated whether increasing Wnt signaling activity would reduce the abnormal state of DS amniocytes. We used CHIR99021, a GSK-3 inhibitor that activates Wnt signaling in human iPSCs [ 32 ], to improve Wnt signaling pathway activity [ 33 ]. DS amniocytes were collected and inoculated into culture bottles. A concentration gradient was treated with 1 µM and 3 µM CHIR99021 for 48 h, and the growth state of the cells was observed. The growth state of DS amniocytes treated with 1 µM CHIR99021 was substantially better than that of the DS amniocytes not treated with CHIR99021 or treated with 3 µM CHIR99021 (Fig. 3 a, b, e). In order to investigate whether the Wnt signaling pathway regulates oxidative stress levels, cell proliferation, and apoptosis, we selected 1 µM CHIR99021-treated DS amniocytes for further analyses. The expression levels of Caspase-3, Ki67, and 8-OhdG were detected via immunofluorescence and western blotting. The expression levels of Caspase-3 (P = 0.003) and 8-OhdG in DS amniocytes treated with 1 µM CHIR99021 were downregulated, whereas the expression level of Ki67 was increased compared with that in DS amniocytes without CHIR99021 treatment (Fig. 3 c–g; P = 0.0148). This indicates that the upregulation of the Wnt signaling pathway decreases oxidative stress in DS amniocytes and maintains a balance between cell proliferation and apoptosis. Discussion DS is caused by the trisomy of chromosome 21, and most patients display a particular phenotype during development [ 34 ], indicating that it may be more meaningful to study the molecular mechanisms underlying DS during the fetal period. Owing to ethical restrictions, we were unable to obtain embryos with DS for research. AF cells, which are shed by the fetus, may reflect fetal development [ 35 , 36 ]. Therefore, we selected DS amniocytes to investigate the molecular mechanisms underlying DS during the fetal period. Our results indicated that Wnt/β-catenin signaling was dysregulated in amniocytes from fetuses diagnosed with DS during the second trimester. Furthermore, DS amniocytes showed increased oxidative stress and imbalanced cell proliferation and apoptosis, thereby providing further evidence that Wnt signaling may maintain DS amniocyte homeostasis by regulating oxidative stress and balancing cell proliferation and apoptosis. Thus, our findings may provide new insights into the occurrence of abnormal phenotypes in patients with DS. Wnt signaling, which is evolutionarily highly conserved, plays a complex role in development, health, and diseases [ 37 – 39 ]. This signaling pathway is essential for neuronal, cardiovascular, musculoskeletal, and craniofacial development. The development of the neurological, cardiovascular, and musculoskeletal systems is particularly affected in patients with DS [ 9 , 40 , 41 ]. We found that Wnt expression was downregulated in DS amniocytes. Dysregulation of this key developmental signal may explain some of the abnormal DS phenotypes that are observed. Chi et al. constructed a mouse DS model and found that Wnt signaling was downregulated in the entire DS embryo at E9.5, a result that substantiates our findings [ 41 ]. Most fetuses with DS exhibit a thickening of fetal nuchal translucency, heart defects, visceral abnormalities, and other phenotypes detected via ultrasound during the second trimester [ 10 ]. These abnormalities may be related to the suppression of the Wnt pathway. Studies on DS have indicated that Wnt signaling acts as a driver of cardiac defects [ 19 , 41 , 42 ]. Therefore, we hypothesized that the abnormal development of DS fetal hearts may be related to the downregulation of Wnt signaling. Wnt signaling also has an important impact on the development of neurological disorders, especially those closely linked to Alzheimer's disease. Downregulation of Wnt signaling has been observed in the hippocampus of adult patients [ 18 ]. This led us to suspect that the fetal nervous system in DS is abnormally regulated by Wnt signaling during the second trimester. Therefore, we propose that the abnormal development of multiple organs in fetuses with DS during the second trimester may be caused by the downregulation of Wnt signaling due to the tripling of chromosome 21. We found that 8-OHDG, a common product of oxidative stress, was highly expressed in DS amniocytes, indicating increased oxidative stress in DS amniocytes. Multiple studies have confirmed that oxidative stress is increased in individuals with DS. Oxidative stress is associated with the development of abnormal DS phenotypes caused by trisomy 21 [ 26 ]. The gene encoding Cu/Zn superoxide dismutase (SOD) is present on chromosome 21, as a result of which a tripling of the gene dose may increase SOD activity, leading to an imbalance between oxidant and antioxidant activities [ 43 , 44 ]. Increased oxidative stress is known to induce DNA damage and defective DNA repair, cause mitochondrial dysfunction, and promote premature cell aging and apoptosis [ 27 , 29 , 45 ]. This may also account for the excessive apoptosis seen in DS amniocytes. We further speculate that increased oxidative stress may explain the short life span and progeria syndrome of individuals with DS. In addition, increased oxidative stress affects the differentiation of nerve cells, impairs normal neuronal function, causes cognitive and neuronal dysfunction, and promotes neurodegenerative changes [ 46 , 47 ]. Weitzdoerfer et al. observed structural damage to dendritic spines and synaptosomes in fetuses with DS [ 48 ], and Milenkovic et al. reported functional tau disorders in DS brains during development [ 49 ]. Therefore, we strongly suspect that the development of neuropathology in patients with DS may be traced back to the fetal period and that the phenotypic features of the DS brain and cognitive performance may have originated during the early stages of development, with all of these features being linked to increased oxidative stress. This issue may need to be addressed in future studies. Abnormal apoptosis of cells is thought to be one of the mechanisms leading to different DS phenotypes. Multiple studies have shown that apoptosis plays a prominent role in heart abnormalities, impaired retinal development, immune alterations, susceptibility to different types of cancers, and neurodegeneration in later life in patients with DS [ 50 ]. A previous study has shown an increase in apoptosis in the brains of adult DS individuals with Alzheimer's disease pathology [ 51 ], and the study of Guidi et al. showed an increase in the number of apoptotic cells in the hippocampal germy region, dentate gyrus, and subventricular region in fetuses with DS [ 52 ]. In the current study, excessive apoptosis and decreased cell proliferation of fetal AF cells were also found, suggesting that apoptosis begins to affect the development of DS phenotype in the fetal period. Wnt signaling may regulate oxidative stress, cell proliferation, and apoptosis [ 31 , 53 , 54 ]. Yang et al. reported the amelioration of Alzheimer's disease via regulation of apoptosis, oxidative stress, and neuroinflammation through increased Wnt signaling [ 55 ]. We treated DS amniocytes with CHIR99021, a GSK-3 inhibitor that enhances the activity of canonical Wnt signaling, and detected a decrease in 8-OHDG and Caspase-3 expression and an increase in Ki67 expression in DS amniocytes. These results indicate that the Wnt pathway may reduce oxidative stress and oxidative damage in DS amniocytes, thereby reducing the excessive apoptosis of DS amniocytes. Concurrently, an increase in Wnt signaling promotes cell proliferation [ 56 , 57 ], thus maintaining a balance between cell proliferation and apoptosis, improving the growth state of DS amniocytes in normal cells. Therefore, a reduction in oxidative stress may help delay the progression of premature aging and neurodegeneration in patients with DS [ 26 , 33 ]. In addition, increased Wnt signaling reportedly promotes cardiac differentiation of DS/congenital heart disease iPSCs [ 41 ]. This indicates that regulation of Wnt signaling may play a role in the development of potential multidimensional therapeutic endpoints for patients with DS. There are certain limitations in this study. The amniocytes in the study were shed fetal cells, which cannot specifically reflect the real state of various organs and systems. Whether upregulation of Wnt signaling can alleviate the occurrence and development of the DS phenotype will be studied in the future. Conclusions Overall, we attempted to understand the molecular pathogenesis of DS by studying DS amniocytes during the second trimester of development. Our data revealed that Wnt signaling was inhibited, and oxidative stress was increased in DS amniocytes. This suggests that the DS fetus may be abnormally regulated by Wnt signaling during the second trimester. Following the upregulation of Wnt signaling in DS amniocytes, oxidative stress was reduced, while cell proliferation and apoptosis were balanced, resulting in the growth state of DS amniocytes being improved. This suggests that Wnt signaling may regulate amniocyte homeostasis in DS and, most importantly, that Wnt signaling may be a potential target for DS therapy. Abbreviations Down syndrome (DS), amniotic fluid (AF), paraformaldehyde (PFA), room temperature (RT), nitrocellulose filter (NC), Tris-buffered saline, 0.1% Tween 20 (TBS-T), 8-hydroxydeoxyguanine (8-OHdG) Declarations Ethics Approval and Consent to Participate The study was approved by the Ethics Committee of Mindong Hospital affiliated to Fujian Medical University (0820-03) and conformed to the Declaration of Helsinki. Written consent has been obtained from the participants after a full explanation of the purpose and nature of all procedures used. Consent for Publication The participants in the study agreed to publish the article. The participants provided their written informed consents. Availability of Data and Materials The data used to support the findings of this study are available from the corresponding author upon reasonable request. Competing Interests The authors declare that they have no competing interests. Funding This work was supported by the Youth Research Program of Fujian Province (2020QNA094) and the Natural Science of Foundation of Fujian Province (2023J011909). Authors’ Contributions JZ conceived the study; JZ and ZL contributed to its design; XC drafted the manuscript; ML and SC collected the samples; ZW collected clinical data. All authors have read and approved the final manuscript. Acknowledgments Not applicable. Authors’ Information Laboratory of Prenatal Diagnosis, Mindong Hospital Affiliated to Fujian Medical University, Ningde, Fujian, China XC, ML, SC, ZL, JZ Central laboratory, Mindong Hospital Affiliated to Fujian Medical University, Ningde, China ML The Engineering Technological Center of Mushroom Industry, Minnan Normal University, Zhangzhou, Fujian, China ZW References Kazemi M, Salehi M, Kheirollahi M. Down syndrome: current status, challenges and future perspectives . Int J Mol Cell Med. 2016;5:125-33. Ramalho C, Brandão O, Matias A, Montenegro N. Phenotypic variability in fetuses with down syndrome: a case-control pathological evaluation . Fetal Diagn Ther. 2011;30:207-14. Hattori M, Fujiyama A, Taylor TD, Watanabe H, Yada T, Park HS, et al. The DNA sequence of human chromosome 21 . Nature. 2000;405:311-9. Cho CKJ, Drabovich AP, Karagiannis GS, Martínez-Morillo E, Dason S, Dimitromanolakis A, et al. Quantitative proteomic analysis of amniocytes reveals potentially dysregulated molecular networks in Down syndrome . Clin Proteomics. 2013;10:2. Reeves RH, Delabar J, Potier MC, Bhattacharyya A, Head E, Lemere C, et al. Paving the way for therapy: the second international conference of the trisomy 21 research society . Mol Syndromol. 2019;9:279-86. Lagan N, Huggard D, Mc Grane F, Leahy TR, Franklin O, Roche E, et al. Multiorgan involvement and management in children with Down syndrome . Acta Paediatr. 2020;109:1096-111. Herault Y, Delabar JM, Fisher EMC, Tybulewicz VLJ, Yu E, Brault V. Rodent models in Down syndrome research: impact and future opportunities . Dis Model Mech. 2017;10:1165-86. Lee JH, Lee AJ, Dang LH, Pang D, Kisselev S, Krinsky-McHale SJ, et al. Candidate gene analysis for Alzheimer's disease in adults with Down syndrome . Neurobiol Aging. 2017;56:150-8. Antonarakis SE. Down syndrome and the complexity of genome dosage imbalance . Nat Rev Genet. 2017;18:147-63. Antonarakis SE, Skotko BG, Rafii MS, Strydom A, Pape SE, Bianchi DW, et al. Down syndrome . Nat Rev Dis Primers. 2020;6:9. Harrison-Uy SJ, Pleasure SJ. Wnt signaling and forebrain development . Cold Spring Harb Perspect Biol. 2012;4:a008094. Salinas PC. Wnt signaling in the vertebrate central nervous system: from axon guidance to synaptic function . Cold Spring Harb Perspect Biol. 2012;4. Dupont P, Besson MT, Devaux J, Liévens JC. Reducing canonical Wingless/Wnt signaling pathway confers protection against mutant huntingtin toxicity in Drosophila . Neurobiol Dis. 2012;47:237-47. Zhang L, Deng J, Pan Q, Zhan Y, Fan JB, Zhang K, et al. Targeted methylation sequencing reveals dysregulated Wnt signaling in Parkinson disease . J Genet Genomics. 2016;43:587-92. Miyazaki K, Fujita T, Ozaki T, Kato C, Kurose Y, Sakamoto M, et al. NEDL1, a novel ubiquitin-protein isopeptide ligase for dishevelled-1, targets mutant superoxide dismutase-1 . J Biol Chem. 2004;279:11327-35. Libro R, Bramanti P, Mazzon E. The role of the Wnt canonical signaling in neurodegenerative diseases . Life Sci. 2016;158:78-88. Vallée A, Lecarpentier Y. Alzheimer disease: crosstalk between the canonical Wnt/beta-catenin pathway and PPARs alpha and gamma . Front Neurosci. 2016;10:459. Granno S, Nixon-Abell J, Berwick DC, Tosh J, Heaton G, Almudimeegh S, et al. Downregulated Wnt/beta-catenin signalling in the Down syndrome hippocampus . Sci Rep. 2019;9:7322. Li D, Sun J, Zhong TP. Wnt signaling in heart development and regeneration . Curr Cardiol Rep. 2022;24:1425-38. Antonaros F, Zenatelli R, Guerri G, Bertelli M, Locatelli C, Vione B, et al. The transcriptome profile of human trisomy 21 blood cells . Hum Genomics. 2021;15:25. Sobol M, Klar J, Laan L, Shahsavani M, Schuster J, Annerén G, et al. Transcriptome and proteome profiling of neural induced pluripotent stem cells from individuals with Down syndrome disclose dynamic dysregulations of key pathways and cellular functions . Mol Neurobiol. 2019;56:7113-27. Schmidt W. The amniotic fluid compartment: the fetal habitat . Adv Anat Embryol Cell Biol. 1992;127:1-100. Tong X. Amniotic fluid may act as a transporting pathway for signaling molecules and stem cells during the embryonic development of amniotes . J Chin Med Assoc. 2013;76:606–10. Underwood MA, Gilbert WM, Sherman MP. Amniotic fluid: not just fetal urine anymore . J Perinatol. 2005;25:341-8. Wang HY, Malbon CC. Wnt signaling, Ca2+, and cyclic GMP: visualizing Frizzled functions . Science. 2003;300:1529-30. Muchová J, Žitňanová I, Ďuračková Z. Oxidative stress and Down syndrome. Do antioxidants play a role in therapy? Physiol Res. 2014;63:535-42. Morawiec Z, Janik K, Kowalski M, Stetkiewicz T, Szaflik J, Morawiec-Bajda A, et al. DNA damage and repair in children with Down's syndrome . Mutat Res. 2008;637:118-23. Fischer BM, Voynow JA, Ghio AJ. COPD: balancing oxidants and antioxidants . Int J Chron Obstruct Pulmon Dis. 2015;10:261-76. Necchi D, Pinto A, Tillhon M, Dutto I, Serafini MM, Lanni C, et al. Defective DNA repair and increased chromatin binding of DNA repair factors in Down syndrome fibroblasts . Mutat Res. 2015;780:15-23. Imai K, Mercer BA, Schulman LL, Sonett JR, D’Armiento JM. Correlation of lung surface area to apoptosis and proliferation in human emphysema . Eur Respir J. 2005;25:250-8. Ma Q, Yu J, Zhang X, Wu X, Deng G. Wnt/beta-catenin signaling pathway-a versatile player in apoptosis and autophagy . Biochimie. 2023;211:57-67. Lian X, Zhang J, Azarin SM, Zhu K, Hazeltine LB, Bao X, et al. Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt/beta-catenin signaling under fully defined conditions . Nat Protoc. 2013;8:162-75. Prutton KM, Marentette JO, Leifheit BA, Esquer H, LaBarbera DV, Anderson CC, et al. Oxidative stress as a candidate mechanism for accelerated neuroectodermal differentiation due to trisomy 21 . Free Radic Biol Med. 2022;186:32–42. Traisrisilp K, Sirichotiyakul S, Tongprasert F, Srisupundit K, Luewan S, Jatavan P, et al. First trimester genetic sonogram for screening fetal Down syndrome: A population-based study . Taiwan J Obstet Gynecol. 2021;60:706-10. Fasoulakis Z, Theodora M, Tsirkas I, Tsirka T, Kalagasidou S, Inagamova L, et al. The role of microRNAs identified in the amniotic fluid . MicroRNA. 2020;9:8-16. Da Sacco S, De Filippo RE, Perin L. Amniotic fluid as a source of pluripotent and multipotent stem cells for organ regeneration . Curr Opin Organ Transplant. 2011;16:101–5. Nusse R, Varmus H. Three decades of Wnts: a personal perspective on how a scientific field developed . EMBO J. 2012;31:2670-84. Reya T, Clevers H. Wnt signalling in stem cells and cancer . Nature. 2005;434:843-50. McNeill H, Woodgett JR. When pathways collide: collaboration and connivance among signalling proteins in development . Nat Rev Mol Cell Biol. 2010;11:404-13. Antonarakis SE, Lyle R, Dermitzakis ET, Reymond A, Deutsch S. Chromosome 21 and down syndrome: from genomics to pathophysiology . Nat Rev Genet. 2004;5:725-38. Chi C, Knight WE, Riching AS, Zhang Z, Tatavosian R, Zhuang Y, et al. Interferon hyperactivity impairs cardiogenesis in Down syndrome via downregulation of canonical Wnt signaling. iScience. 2023;26:107012. Balatskyi VV, Sowka A, Dobrzyn P, Piven OO. WNT/beta-catenin pathway is a key regulator of cardiac function and energetic metabolism . Acta Physiol (Oxf). 2023;237:e13912. Tan YH, Tischfield J, Ruddle FH. The linkage of genes for the human interferon-induced antiviral protein and indophenol oxidase-B traits to chromosome G-21 . J Exp Med. 1973;137:317-30. Sustrová M, Saríková V. [Down's syndrome--effect of increased gene expression in chromosome 21 on the function of the immune and nervous system] . Bratisl Lek Listy. 1997;98:221-8. Tiano L, Padella L, Santoro L, Carnevali P, Principi F, Brugè F, et al. Prolonged coenzyme Q10 treatment in Down syndrome patients: effect on DNA oxidation . Neurobiol Aging. 2012;33:626.e1–8. Martínez-Cué C, Rueda N. Cellular senescence in neurodegenerative diseases . Front Cell Neurosci. 2020;14:16. Perluigi M, Butterfield DA. Oxidative stress and Down syndrome: A route toward alzheimer-like dementia . Curr Gerontol Geriatr Res. 2012;2012:724904. Weitzdoerfer R, Dierssen M, Fountoulakis M, Lubec G. Fetal life in Down syndrome starts with normal neuronal density but impaired dendritic spines and synaptosomal structure . J Neural Transm Suppl. 2001;(61):59-70. Milenkovic I, Jarc J, Dassler E, Aronica E, Iyer A, Adle-Biassette H, et al. The physiological phosphorylation of tau is critically changed in fetal brains of individuals with Down syndrome . Neuropathol Appl Neurobiol. 2018;44:314-27. Rueda N, Flórez J, Martínez-Cué C. Apoptosis in Down's syndrome: lessons from studies of human and mouse models . Apoptosis. 2013;18:121-34. Stadelmann C, Deckwerth TL, Srinivasan A, Bancher C, Brück W, Jellinger K, et al. Activation of caspase-3 in single neurons and autophagic granules of granulovacuolar degeneration in Alzheimer's disease. Evidence for apoptotic cell death . Am J Pathol. 1999;155:1459-66. Guidi S, Bonasoni P, Ceccarelli C, Santini D, Gualtieri F, Ciani E, et al. Neurogenesis impairment and increased cell death reduce total neuron number in the hippocampal region of fetuses with Down syndrome . Brain Pathol. 2008;18:180-97. Ali A, Ali A, Ahmad W, Ahmad N, Khan S, Nuruddin SM, et al. Deciphering the role of WNT signaling in metabolic syndrome-linked Alzheimer's disease . Mol Neurobiol. 2020;57:302-14. Yu B, Zhang J, Li H, Sun X. Silencing of aquaporin1 activates the Wnt signaling pathway to improve cognitive function in a mouse model of Alzheimer's disease . Gene. 2020;755:144904. Yang Y, Wang L, Zhang C, Guo Y, Li J, Wu C, et al. Ginsenoside Rg1 improves Alzheimer's disease by regulating oxidative stress, apoptosis, and neuroinflammation through Wnt/GSK-3β/β-catenin signaling pathway . Chem Biol Drug Des. 2022;99:884-96. Chidiac R, Angers S. Wnt signaling in stem cells during development and cell lineage specification . Curr Top Dev Biol. 2023;153:121-43. Habib SJ, Acebrón SP. Wnt signalling in cell division: from mechanisms to tissue engineering . Trends Cell Biol. 2022;32:1035-48. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 31 Jan, 2026 Read the published version in BMC Molecular and Cell Biology → Version 1 posted Editorial decision: Revision requested 13 Jun, 2024 Editor assigned by journal 03 Jun, 2024 Submission checks completed at journal 31 May, 2024 First submitted to journal 22 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4461929","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":312055183,"identity":"5d095317-29f4-4f40-8cef-586677b6fda1","order_by":0,"name":"Xiaoying Chen","email":"","orcid":"","institution":"Laboratory of Prenatal Diagnosis, Mindong Hospital Affiliated to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoying","middleName":"","lastName":"Chen","suffix":""},{"id":312055184,"identity":"ecf8f77c-c6fc-4bb1-bb1a-5b00b0476afb","order_by":1,"name":"Miaochun Lin","email":"","orcid":"","institution":"Laboratory of Prenatal Diagnosis, Mindong Hospital Affiliated to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Miaochun","middleName":"","lastName":"Lin","suffix":""},{"id":312055186,"identity":"4d039eb9-e6f4-43bb-982d-85f242050891","order_by":2,"name":"Shan Chen","email":"","orcid":"","institution":"Laboratory of Prenatal Diagnosis, Mindong Hospital Affiliated to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shan","middleName":"","lastName":"Chen","suffix":""},{"id":312055187,"identity":"7376d61c-51ce-44c2-9a85-cfa701d44175","order_by":3,"name":"Zhengsen Wang","email":"","orcid":"","institution":"Minnan Normal University","correspondingAuthor":false,"prefix":"","firstName":"Zhengsen","middleName":"","lastName":"Wang","suffix":""},{"id":312055190,"identity":"3b8d7046-58fc-4d9b-8884-6b24d5d3e683","order_by":4,"name":"Zhaohui Li","email":"","orcid":"","institution":"Laboratory of Prenatal Diagnosis, Mindong Hospital Affiliated to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhaohui","middleName":"","lastName":"Li","suffix":""},{"id":312055192,"identity":"ebe5a126-2220-47db-abf8-1fcee6efcd5a","order_by":5,"name":"Juan Zuo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA20lEQVRIiWNgGAWjYDACCcYGhgQGBjl+/uYDBz5UkKDFWHLGscSDM84QpQVCJW44kGN8mLeFCB3ys5sbbzzcUZvYcODMhwO8DQzy/GIH8GthnHOw2SLxzHHjxubeDQckdzAYzpydgF8Ls0RiGxAdk21mOLvhgOEZhgSD2wS0sEG1MLYx5Dw4kNhGhBYeiJYaxR6GHIYDB4nRIiGRCPRL2wFjCYljBgcbzkgQ9ov8jPSHN3+21cnZn29+/PlPhY08vzQBLWCbGBgOI7GJAUBldcSpHAWjYBSMgpEJAGt3TjVW5SyMAAAAAElFTkSuQmCC","orcid":"","institution":"Laboratory of Prenatal Diagnosis, Mindong Hospital Affiliated to Fujian Medical University","correspondingAuthor":true,"prefix":"","firstName":"Juan","middleName":"","lastName":"Zuo","suffix":""}],"badges":[],"createdAt":"2024-05-22 15:23:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4461929/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4461929/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12860-026-00569-9","type":"published","date":"2026-01-31T15:58:45+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":58263486,"identity":"c851c96a-5638-436b-8d24-995c8174a33a","added_by":"auto","created_at":"2024-06-13 06:46:35","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4508027,"visible":true,"origin":"","legend":"\u003cp\u003eCanonical Wnt/β-catenin signaling is downregulated in Down syndrome (DS) amniocytes. (a) G-banding karyotype of amniocytes from a normal fetus and DS fetus. (b, d) Poor growth of amniocytes in DS fetuses. (c, f–h) Representative co-immunolocalization, immunoblot, and quantitative protein expression analyses of β-catenin in DS amniocytes compared with control amniocytes. (e) mRNA expression levels of Wnt signaling family members in DS amniocytes compared with those in control amniocytes. Scale bars: 50 μm; * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001 by two-tailed \u003cem\u003et\u003c/em\u003e-test\u003c/p\u003e","description":"","filename":"figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4461929/v1/43da77743a11bc6a62012205.jpg"},{"id":58263487,"identity":"deb95723-b559-4711-981b-4dc1fc5b7f1c","added_by":"auto","created_at":"2024-06-13 06:46:35","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":7431489,"visible":true,"origin":"","legend":"\u003cp\u003eAbnormal expression analysis of proteins in Down syndrome (DS) amniocytes. (a) Oxidative damage in DS amniocytes. (b–c) Representative immunoblot and quantitative protein expression analyses of Caspase-3 in DS amniocytes compared with those in control amniocytes. (d) Proportion of Ki67\u003csup\u003e+\u003c/sup\u003e cells to total cells (n=3 samples per group). (e) The number of Ki67\u003csup\u003e+\u003c/sup\u003e cells decreased in DS amniocytes. Scale bars: 50 μm; * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001 by two-tailed \u003cem\u003et\u003c/em\u003e-test\u003c/p\u003e","description":"","filename":"figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4461929/v1/34d94ac3575cb65ea473af44.jpg"},{"id":58263488,"identity":"ade694f3-cf9d-4e03-a728-8efbe38c6c8e","added_by":"auto","created_at":"2024-06-13 06:46:35","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6921724,"visible":true,"origin":"","legend":"\u003cp\u003eEnhancing the Wnt/β-catenin signaling pathway improves the growth of Down syndrome (DS) amniocytes. (a) Growth state of DS amniocytes treated with different concentrations of CHIR99021. (b) Representative co-immunolocalization of β-catenin in DS amniocytes treated with CHIR99021. (c–d) Oxidative damage in 8-OHdG\u003csup\u003e+\u003c/sup\u003e and Ki67\u003csup\u003e+\u003c/sup\u003e cells in DS amniocytes treated with CHIR99021. (e–f) Representative immunoblot and quantitative protein expression analyses of β-catenin and caspase-3 in DS amniocytes treated with CHIR99021. (g) Proportion of Ki67\u003csup\u003e+\u003c/sup\u003e cells to total cells (n=3 samples per group). Scale bars: 50 μm; * P \u0026lt; 0.05, ** P \u0026lt; 0.01, *** P \u0026lt; 0.001 by two-tailed \u003cem\u003et\u003c/em\u003e-test\u003c/p\u003e","description":"","filename":"figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4461929/v1/47ff8c6d92290c5103116b73.jpg"},{"id":101690827,"identity":"d0f6d146-d7c1-4866-9281-da7d630ef72b","added_by":"auto","created_at":"2026-02-02 16:09:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":19510911,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4461929/v1/4223bdb4-e440-46de-a0bd-d65cb02f713d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Wnt/β-catenin pathway maintains homeostasis of amniocytes in Down syndrome","fulltext":[{"header":"Background","content":"\u003cp\u003eDown syndrome (DS), occurring in approximately 1/600\u0026ndash;800 live births, is a common chromosomal disorder that reflects intellectual disability [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. DS is caused by the trisomy of \u003cem\u003eHomo sapiens\u003c/em\u003e chromosome 21 (HSA21) and is accompanied by a series of distinctive features, including intellectual disability, characteristic facial features, growth retardation, cardiac defects, digestive anomalies, autoimmune diseases, and Alzheimer's disease. Most fetuses with DS exhibit distinctive physical features, including characteristic facial features, cardiac defects, and internal anomalies [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Despite the high incidence of DS and the reported presence of supernumerary chromosome 21 as early as 1959 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], the molecular pathogenesis remains unclear, with no specific treatments in sight [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Although DS is a multisystem and multiorgan abnormal disease, most existing studies have focused on one abnormal system or organ [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Determining the root causes as well as molecular mechanisms underlying the abnormal development of multisystem and multiorgan maladies is difficult. Current studies investigating DS focus on the construction of an animal transgenic DS model that entails the insertion of some genes on human chromosome 21; however, this animal DS model does not fully simulate the human DS phenotype [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], and most research participants are adolescents and adults with DS [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. DS is a congenital genetic disease; therefore, it is more meaningful to study its molecular mechanisms during the fetal period.\u003c/p\u003e \u003cp\u003eThe canonical Wnt/β-catenin pathway is a signal transduction pathway that relies on Wnt extracellular signals and β-catenin intracellular signals. This pathway is highly evolutionarily conserved and plays an important role in the embryonic development and physiological and pathological processes of various organs. It is involved in the regulation of embryonic nervous system development and adult nerve homeostasis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Previous studies have indicated that dysregulation of the Wnt signaling pathway is associated with several neurodegenerative diseases, such as Huntington's disease, Parkinson's disease, multiple sclerosis, amyotrophic lateral sclerosis, and Alzheimer's disease [\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The Wnt/β-catenin signaling pathway was found to be suppressed in the hippocampus of adults with DS and Alzheimer's disease [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In addition, the Wnt/β-catenin pathway regulates the development and regeneration of the heart [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. This raises the possibility of the abnormal development of fetuses with DS being associated with dysregulation of the Wnt/β-catenin signaling pathway, suggesting the need for an in-depth understanding of such an association via exploratory research.\u003c/p\u003e \u003cp\u003eTo explore the molecular mechanism of the DS phenotype induced by chromosome 21 triploidy, several DS cell models have been established, including induced pluripotent stem cells (iPSCs), monocytes, blood cells, and primary fibroblasts [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. However, these cell models represent the adult stage and do not represent the fetal development of DS. The amniotic fluid (AF) is formed during early pregnancy and encased in the amniotic cavity. It exists throughout embryonic development and provides an environment for the growth and mobility of the fetus [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. There is a continuous bidirectional exchange of substances, including transmitting signal molecules and stem cells, between the AF and the fetus [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Amniocytes, shed by the three germ layers of the fetus, are free-flowing fetal cells present in the AF [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Therefore amniocytes may be more suitable for monitoring fetal development. In this study, we aimed to investigate the etiology of abnormal development of DS from the viewpoint of amniocytes.\u003c/p\u003e"},{"header":"Methods","content":"\u003ch2\u003eParticipants and samples\u003c/h2\u003e\n\u003cp\u003e\u0026nbsp;Pregnant women who consulted the Prenatal Diagnostic Center of Mindong Hospital Affiliated to Fujian Medical University and had undergone amniocentesis and karyotype analysis were included in the study. Cases with amniocytes diagnosed with DS (n=10) via chromosome karyotype analysis were included in the experimental group, whereas cases with a normal karyotype (n=10) were included in the control group. This study was approved by the Ethics Committee of Mindong Hospital affiliated to Fujian Medical University (0820-03) and conformed to the Declaration of Helsinki. Written consent was obtained from all participants after a full explanation of the purpose and nature of procedures used.\u003c/p\u003e\n\u003ch2\u003eAmniocentesis and fetal karyotyping\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003e\u0026nbsp;The gestational age at amniocentesis was 19\u003csup\u003e+0\u003c/sup\u003e\u0026ndash;22\u003csup\u003e+6\u003c/sup\u003e weeks. All pregnant women provided informed consent prior to amniocentesis. Amniocentesis was performed under ultrasound guidance. After 2 ml of AF was extracted and discarded, 20 ml of AF was collected, centrifuged,\u0026nbsp;and seeded into the medium\u0026nbsp;(Biosan, Zhejiang, China)\u0026nbsp;and cultured in an incubator\u0026nbsp;(Thermo\u0026nbsp;Fisher Scientific, Waltham, MA, USA)at 5% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026nbsp;\u0026deg;C.\u0026nbsp;Amniocytes\u0026nbsp;were cultured according to the standard protocol of\u0026nbsp;the\u0026nbsp;Mindong Hospital Affiliated to Fujian Medical University of Human Cytogenetics Guidelines. After G-banding, chromosomal analysis with\u0026nbsp;a targeted\u0026nbsp;360\u0026ndash;420\u0026nbsp;band level was performed for each sample using a GSL-120 high-throughput automatic chromosome scanning platform (Leica, Germany). At least 30 metaphase divisions were counted and at least 5 karyotypes were analyzed, following which the karyotypes were named according to the International System for Human Cytogenetics Nomenclature (ISCN, 2020).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAmniocytes\u0026nbsp;were\u0026nbsp;seeded on\u0026nbsp;glass coverslips pre-coated with 0.1 mg/ml poly-D lysine\u0026nbsp;(NEST, Wuxi, China)\u0026nbsp;and cultured in six-well plates. After 72 h, the\u0026nbsp;cells were fixed with 4% paraformaldehyde (PFA) for 20 min at 4\u0026nbsp;\u0026deg;C. Samples were blocked with goat serum\u0026nbsp;(ZSGB-BIO, Beijing, China)\u0026nbsp;for 30 min at\u0026nbsp;room temperature (RT).\u0026nbsp;The following antibodies were diluted with phosphate-buffered saline and added to the cells at 4 ℃ overnight: anti-\u0026beta;-Catenin (1:200; mouse monoclonal, Millipore 05-665), anti-8-OhdG (1:200; mouse monoclonal, Santa Cruz sc-66036), and anti-Ki67 (1:200; rabbit monoclonal, Abcam ab16667). Secondary anti-rabbit antibodies, Alexa\u0026nbsp;Fluor 488 (1:1000; Thermo-\u0026nbsp;Fisher Scientific, A-21206) and secondary anti-mouse antibodies,\u0026nbsp;Alexa Fluor 594 (1:1000; Thermo-\u0026nbsp;Fisher Scientific, R37115) were incubated with\u0026nbsp;the samples for 1 h\u0026nbsp;at RT. The cells were treated with 4\u0026apos;,6-diamidino-2-phenylindole (1:1000;\u0026nbsp;Thermo\u0026nbsp;Fisher\u0026nbsp;Scientific, 62248) diluted in phosphate-buffered saline and incubated for 5\u0026nbsp;min\u0026nbsp;at RT to label the nuclei.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHarvested amniocytes were lysed in radioimmunoprecipitation lysis buffer. Next, 25 \u0026mu;g protein samples were added into a 12% sodium dodecyl sulfate\u0026ndash;polyacrylamide gel for electrophoretic separation and subsequently transferred to nitrocellulose membranes (Millipore, Z741975-1ROL). The membranes were\u0026nbsp;blocked in\u0026nbsp;Tris-buffered saline, 0.1% Tween 20 (TBS-T) with 5% non-fat dry milk at RT for 1 h, washed three times in TBS-T buffer, and incubated with the following primary antibodies overnight at 4 ℃: \u0026beta;-Catenin (1:1000; mouse monoclonal, Millipore 05-665), Caspase-3 (1:500; rabbit polyclonal,\u0026nbsp;Abcam ab44976), Actin (1:1000; mouse monoclonal, Santa Cruz sc58673), and \u0026beta;-tubulin (1:1000; rabbit monoclonal, Abcam ab179511). The membranes were then incubated with fluorescent secondary anti-rabbit antibodies (1:2000; Thermo\u0026nbsp;Fisher Scientific, 31210) and anti-mouse antibodies (1:2000; Thermo\u0026nbsp;Fisher Scientific, 31160) for 1 h at RT.\u0026nbsp;An Odyssey Clx\u0026nbsp;(LI-COR Biosciences, Lincoln, NE, USA)\u0026nbsp;infrared fluorescence scanning imaging system was used to scan the membranes, and the protein bands were analyzed and quantified\u0026nbsp;using Image Studio software (LI-COR Biosciences).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA preparation and real-time PCR\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal\u0026nbsp;amniocyte\u0026nbsp;RNA\u0026nbsp;was prepared using\u0026nbsp;a Biospin Total RNA Extraction Kit (BioFlux, BSC63S1)\u0026nbsp;following the manufacturer\u0026rsquo;s instructions. Next, 5 \u0026mu;g RNA was reverse-transcribed into cDNA according to the protocol of a RevertAid First Strand cDNA Synthesis Kit (Thermo\u0026nbsp;Fisher Scientific, k1621). The cDNA was used in Real-Time PCR Detection Systems to examine the transcript levels of target genes. Real-Time PCR was performed using a PrimeScript\u003csup\u003eTM\u0026nbsp;\u003c/sup\u003eRT Reagent Kit (TaKaRa, RR037Q). A complete list of primers is provided in Table 1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Primer sequences for\u0026nbsp;\u003cstrong\u003ereal-time PCR\u003c/strong\u003e RT-qPCR\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" align=\"\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.98950524737631%\"\u003e\n \u003cp\u003eGene name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.73013493253373%\"\u003e\n \u003cp\u003eForward primer (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.280359820089956%\"\u003e\n \u003cp\u003eReverse primer (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.98950524737631%\"\u003e\n \u003cp\u003e\u003cem\u003e1.1 \u0026nbsp; \u0026nbsp; Wnt1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.73013493253373%\"\u003e\n \u003cp\u003eCGATGGTGGGGTATTGTGAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.280359820089956%\"\u003e\n \u003cp\u003eCCGGATTTTGGCGTATCAGAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.98950524737631%\"\u003e\n \u003cp\u003e\u003cem\u003e1.2 \u0026nbsp; \u0026nbsp; Wnt2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.73013493253373%\"\u003e\n \u003cp\u003e\u0026nbsp;CCGAGGTCAACTCTTCATGGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.280359820089956%\"\u003e\n \u003cp\u003eCCTGGCACATTATCGCACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.98950524737631%\"\u003e\n \u003cp\u003e\u003cem\u003e1.3 \u0026nbsp; \u0026nbsp; Wnt3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.73013493253373%\"\u003e\n \u003cp\u003eAGGGCACCTCCACCATTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.280359820089956%\"\u003e\n \u003cp\u003eGACACTAACACGCCGAAGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.98950524737631%\"\u003e\n \u003cp\u003e\u003cem\u003e1.4 \u0026nbsp; \u0026nbsp; Wnt4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.73013493253373%\"\u003e\n \u003cp\u003eGTACGCCATCTCTTCGGCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.280359820089956%\"\u003e\n \u003cp\u003eGCGATGTTGTCAGAGCATCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.98950524737631%\"\u003e\n \u003cp\u003e\u003cem\u003e1.5 \u0026nbsp; \u0026nbsp; Wnt5a\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.73013493253373%\"\u003e\n \u003cp\u003eGCCAGTATCAATTCCGACATCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.280359820089956%\"\u003e\n \u003cp\u003eTCACCGCGTATGTGAAGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"20.98950524737631%\"\u003e\n \u003cp\u003e\u003cem\u003e1.6 \u0026nbsp; \u0026nbsp; GAPDH\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.73013493253373%\"\u003e\n \u003cp\u003eACAACTTTGGTATCGTGGAAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.280359820089956%\"\u003e\n \u003cp\u003eGCCATCACGCCACAGTTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003ePharmacological treatment of cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAmniocytes,\u0026nbsp;identified via chromosome karyotype analysis as trisomy 21, were collected and inoculated into culture bottles. Wnt signaling activation was achieved by treatment with\u0026nbsp;1 \u0026mu;M\u0026nbsp;CHIR99021\u0026nbsp;(Solarbio, 252917-06-9) and 3 \u0026mu;M\u0026nbsp;CHIR99021\u0026nbsp;for 48 h each.\u0026nbsp;Dimethylsulfoxide (0.1\u0026permil;) was used as\u0026nbsp;a control.\u0026nbsp;CHIR99021\u0026nbsp;was prepared according to manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;SPSS 22.0 software was used for statistical analysis, and quantification results are presented as mean \u0026plusmn; standard error of mean (SEM).\u0026nbsp;Student\u0026apos;s\u003cem\u003e\u0026nbsp;t-\u003c/em\u003etest was used to calculate statistical significance. Statistical significance was set at P \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eWnt signaling is downregulated in DS amniocytes\u003c/h2\u003e \u003cp\u003eAmniocytes from fetuses diagnosed with DS via chromosomal karyotype analysis during the second trimester were collected for the study, whereas amniocytes with normal chromosomal karyotypes were used as the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). After 7 d of primary culture, the number of DS amniocyte clones was markedly lower than that of the control amniocytes, and cell aging and shedding occurred early (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). Subsequently, we sub-cultured the amniocytes and found that the number of DS amniocytes was markedly lower than that of the control after 3 d (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). This led us to wonder whether the aberrant growth of DS amniocytes was abnormally regulated by signaling pathways.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs Wnt signaling plays an important regulatory role in embryonic development, we speculated that the growth of DS amniocytes may be associated with Wnt signaling. We sought to determine whether canonical Wnt signaling is dysregulated in DS amniocytes. β-catenin is a key protein in the canonical Wnt signaling pathway [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In this study, western blot was used to detect the expression of the β-catenin protein to reflect the activity levels of the Wnt signaling pathway. We found that β-catenin protein expression in DS amniocytes was significantly reduced compared with that in normal amniocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ef, h; P\u0026thinsp;=\u0026thinsp;0.0061). In addition, we verified via immunofluorescence that the expression level of β-catenin in the nuclei of DS amniocytes was lower than that of normal amniocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ec).\u003c/p\u003e \u003cp\u003eThe expression of \u003cem\u003eWnt1\u003c/em\u003e, \u003cem\u003eWnt2\u003c/em\u003e, \u003cem\u003eWnt3\u003c/em\u003e, \u003cem\u003eWnt4\u003c/em\u003e, and \u003cem\u003eWnt5\u003c/em\u003e in DS amniocytes was detected using real-time PCR. \u003cem\u003eWnt1\u003c/em\u003e (P\u0026thinsp;=\u0026thinsp;0.026), Wnt2 (P\u0026thinsp;=\u0026thinsp;0.002), and \u003cem\u003eWnt4\u003c/em\u003e (P\u0026thinsp;=\u0026thinsp;0.007) were downregulated compared with those in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003ee). This demonstrates that Wnt signaling pathway activity is dysregulated in DS amniocytes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eMolecular abnormalities in DS amniocytes\u003c/h2\u003e \u003cp\u003eStudies have shown that the occurrence of abnormal phenotypes in patients with DS is associated with increased oxidative stress [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. This prompted us to explore whether oxidative stress is already elevated in fetuses with DS during pregnancy. It is known that 8-hydroxydeoxyguanine (8-OHdG) is a common product of oxidative stress. Reactive oxygen species can directly attack DNA and oxidize the 8-position carbon atom of guanine, resulting in 8-OHdG [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In the current study, the expression of 8-OHdG in the amniocytes of fetuses in the DS and control groups was detected using immunofluorescence. The results showed that a small amount of 8-OHdG was expressed in the amniocytes of the control group, whereas a large amount of 8-OHdG was detected in DS amniocytes. This indicates that oxidative stress was increased in DS amniocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eExcessive oxidative stress can cause cell injury and apoptosis, resulting in an imbalance between cell proliferation and apoptosis, as well as a series of abnormal phenotypes [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. This necessitated an investigation into the proliferation and apoptosis of DS amniocytes. Caspase-3, the main terminal shear enzyme involved in apoptosis, was selected as an apoptosis marker. Ki67 is a nuclear protein that is expressed in all phases of cell proliferation (G1, S, G2, and M), although not in the quiescent phase (G0), and thus may be used as a marker of cell proliferation [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In the current study, western blotting and immunofluorescence were used to detect the expression of Caspase-3 and Ki67 in AF. The results showed that the expression of Caspase-3 in DS fetal amniocytes was higher than that in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, d; P\u0026thinsp;=\u0026thinsp;0.0088). This indicated that a large number of apoptotic cells were present in DS amniocytes. In addition, a large number of cells in the control group expressed Ki67, whereas only a small number of fetal AF cells with DS expressed Ki67 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, e; P\u0026thinsp;=\u0026thinsp;0.0047).\u003c/p\u003e \u003cp\u003eConsidered together, these data suggest that in DS amniocytes, the Wnt signaling pathway is dysregulated, oxidative stress is increased, and cell proliferation and apoptosis are unbalanced.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePharmacological rescue\u003c/h2\u003e \u003cp\u003eStudies have shown that dysregulation of the Wnt signaling pathway may affect cellular oxidative stress, cell proliferation, and apoptosis [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Next, we investigated whether increasing Wnt signaling activity would reduce the abnormal state of DS amniocytes. We used CHIR99021, a GSK-3 inhibitor that activates Wnt signaling in human iPSCs [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], to improve Wnt signaling pathway activity [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. DS amniocytes were collected and inoculated into culture bottles. A concentration gradient was treated with 1 \u0026micro;M and 3 \u0026micro;M CHIR99021 for 48 h, and the growth state of the cells was observed. The growth state of DS amniocytes treated with 1 \u0026micro;M CHIR99021 was substantially better than that of the DS amniocytes not treated with CHIR99021 or treated with 3 \u0026micro;M CHIR99021 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, b, e). In order to investigate whether the Wnt signaling pathway regulates oxidative stress levels, cell proliferation, and apoptosis, we selected 1 \u0026micro;M CHIR99021-treated DS amniocytes for further analyses.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e The expression levels of Caspase-3, Ki67, and 8-OhdG were detected via immunofluorescence and western blotting. The expression levels of Caspase-3 (P\u0026thinsp;=\u0026thinsp;0.003) and 8-OhdG in DS amniocytes treated with 1 \u0026micro;M CHIR99021 were downregulated, whereas the expression level of Ki67 was increased compared with that in DS amniocytes without CHIR99021 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e3\u003c/span\u003ec\u0026ndash;g; P\u0026thinsp;=\u0026thinsp;0.0148). This indicates that the upregulation of the Wnt signaling pathway decreases oxidative stress in DS amniocytes and maintains a balance between cell proliferation and apoptosis.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eDS is caused by the trisomy of chromosome 21, and most patients display a particular phenotype during development [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], indicating that it may be more meaningful to study the molecular mechanisms underlying DS during the fetal period. Owing to ethical restrictions, we were unable to obtain embryos with DS for research. AF cells, which are shed by the fetus, may reflect fetal development [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Therefore, we selected DS amniocytes to investigate the molecular mechanisms underlying DS during the fetal period. Our results indicated that Wnt/β-catenin signaling was dysregulated in amniocytes from fetuses diagnosed with DS during the second trimester. Furthermore, DS amniocytes showed increased oxidative stress and imbalanced cell proliferation and apoptosis, thereby providing further evidence that Wnt signaling may maintain DS amniocyte homeostasis by regulating oxidative stress and balancing cell proliferation and apoptosis. Thus, our findings may provide new insights into the occurrence of abnormal phenotypes in patients with DS.\u003c/p\u003e \u003cp\u003eWnt signaling, which is evolutionarily highly conserved, plays a complex role in development, health, and diseases [\u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. This signaling pathway is essential for neuronal, cardiovascular, musculoskeletal, and craniofacial development. The development of the neurological, cardiovascular, and musculoskeletal systems is particularly affected in patients with DS [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. We found that Wnt expression was downregulated in DS amniocytes. Dysregulation of this key developmental signal may explain some of the abnormal DS phenotypes that are observed. Chi et al. constructed a mouse DS model and found that Wnt signaling was downregulated in the entire DS embryo at E9.5, a result that substantiates our findings [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Most fetuses with DS exhibit a thickening of fetal nuchal translucency, heart defects, visceral abnormalities, and other phenotypes detected via ultrasound during the second trimester [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. These abnormalities may be related to the suppression of the Wnt pathway. Studies on DS have indicated that Wnt signaling acts as a driver of cardiac defects [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Therefore, we hypothesized that the abnormal development of DS fetal hearts may be related to the downregulation of Wnt signaling. Wnt signaling also has an important impact on the development of neurological disorders, especially those closely linked to Alzheimer's disease. Downregulation of Wnt signaling has been observed in the hippocampus of adult patients [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. This led us to suspect that the fetal nervous system in DS is abnormally regulated by Wnt signaling during the second trimester. Therefore, we propose that the abnormal development of multiple organs in fetuses with DS during the second trimester may be caused by the downregulation of Wnt signaling due to the tripling of chromosome 21.\u003c/p\u003e \u003cp\u003eWe found that 8-OHDG, a common product of oxidative stress, was highly expressed in DS amniocytes, indicating increased oxidative stress in DS amniocytes. Multiple studies have confirmed that oxidative stress is increased in individuals with DS. Oxidative stress is associated with the development of abnormal DS phenotypes caused by trisomy 21 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The gene encoding Cu/Zn superoxide dismutase (SOD) is present on chromosome 21, as a result of which a tripling of the gene dose may increase SOD activity, leading to an imbalance between oxidant and antioxidant activities [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Increased oxidative stress is known to induce DNA damage and defective DNA repair, cause mitochondrial dysfunction, and promote premature cell aging and apoptosis [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. This may also account for the excessive apoptosis seen in DS amniocytes. We further speculate that increased oxidative stress may explain the short life span and progeria syndrome of individuals with DS. In addition, increased oxidative stress affects the differentiation of nerve cells, impairs normal neuronal function, causes cognitive and neuronal dysfunction, and promotes neurodegenerative changes [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Weitzdoerfer et al. observed structural damage to dendritic spines and synaptosomes in fetuses with DS [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], and Milenkovic et al. reported functional tau disorders in DS brains during development [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Therefore, we strongly suspect that the development of neuropathology in patients with DS may be traced back to the fetal period and that the phenotypic features of the DS brain and cognitive performance may have originated during the early stages of development, with all of these features being linked to increased oxidative stress. This issue may need to be addressed in future studies.\u003c/p\u003e \u003cp\u003eAbnormal apoptosis of cells is thought to be one of the mechanisms leading to different DS phenotypes. Multiple studies have shown that apoptosis plays a prominent role in heart abnormalities, impaired retinal development, immune alterations, susceptibility to different types of cancers, and neurodegeneration in later life in patients with DS [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. A previous study has shown an increase in apoptosis in the brains of adult DS individuals with Alzheimer's disease pathology [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e], and the study of Guidi et al. showed an increase in the number of apoptotic cells in the hippocampal germy region, dentate gyrus, and subventricular region in fetuses with DS [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In the current study, excessive apoptosis and decreased cell proliferation of fetal AF cells were also found, suggesting that apoptosis begins to affect the development of DS phenotype in the fetal period.\u003c/p\u003e \u003cp\u003eWnt signaling may regulate oxidative stress, cell proliferation, and apoptosis [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Yang et al. reported the amelioration of Alzheimer's disease via regulation of apoptosis, oxidative stress, and neuroinflammation through increased Wnt signaling [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. We treated DS amniocytes with CHIR99021, a GSK-3 inhibitor that enhances the activity of canonical Wnt signaling, and detected a decrease in 8-OHDG and Caspase-3 expression and an increase in Ki67 expression in DS amniocytes. These results indicate that the Wnt pathway may reduce oxidative stress and oxidative damage in DS amniocytes, thereby reducing the excessive apoptosis of DS amniocytes. Concurrently, an increase in Wnt signaling promotes cell proliferation [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], thus maintaining a balance between cell proliferation and apoptosis, improving the growth state of DS amniocytes in normal cells. Therefore, a reduction in oxidative stress may help delay the progression of premature aging and neurodegeneration in patients with DS [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In addition, increased Wnt signaling reportedly promotes cardiac differentiation of DS/congenital heart disease iPSCs [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. This indicates that regulation of Wnt signaling may play a role in the development of potential multidimensional therapeutic endpoints for patients with DS.\u003c/p\u003e \u003cp\u003eThere are certain limitations in this study. The amniocytes in the study were shed fetal cells, which cannot specifically reflect the real state of various organs and systems. Whether upregulation of Wnt signaling can alleviate the occurrence and development of the DS phenotype will be studied in the future.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOverall, we attempted to understand the molecular pathogenesis of DS by studying DS amniocytes during the second trimester of development. Our data revealed that Wnt signaling was inhibited, and oxidative stress was increased in DS amniocytes. This suggests that the DS fetus may be abnormally regulated by Wnt signaling during the second trimester. Following the upregulation of Wnt signaling in DS amniocytes, oxidative stress was reduced, while cell proliferation and apoptosis were balanced, resulting in the growth state of DS amniocytes being improved. This suggests that Wnt signaling may regulate amniocyte homeostasis in DS and, most importantly, that Wnt signaling may be a potential target for DS therapy.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eDown syndrome (DS), amniotic fluid (AF), paraformaldehyde (PFA), room temperature (RT), nitrocellulose filter (NC), Tris-buffered saline, 0.1% Tween 20 (TBS-T), 8-hydroxydeoxyguanine (8-OHdG)\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics Approval\u003c/strong\u003e \u003cstrong\u003eand Consent to Participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Ethics Committee of Mindong Hospital affiliated to Fujian Medical University (0820-03) and conformed to the Declaration of Helsinki. Written consent has been obtained from the participants after a full explanation of the purpose and nature of all procedures used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe participants in the study agreed to publish the article. The participants provided their written informed consents.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAvailability of Data and Materials\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe data used to support the findings of this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003eCompeting Interests\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Youth Research Program of Fujian Province (2020QNA094) and the Natural Science of Foundation of Fujian Province (2023J011909).\u003c/p\u003e\n\u003cp\u003eAuthors\u0026rsquo; Contributions\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;JZ\u0026nbsp;conceived the study; JZ and\u0026nbsp;ZL contributed to\u0026nbsp;its design; XC\u0026nbsp;drafted the manuscript;\u0026nbsp;ML and SC\u0026nbsp;collected the samples; ZW collected\u0026nbsp;clinical data.\u0026nbsp;All authors have read and approved the final\u0026nbsp;manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLaboratory of Prenatal Diagnosis, Mindong Hospital Affiliated to Fujian Medical University, Ningde, Fujian, China\u003c/p\u003e\n\u003cp\u003eXC, ML, SC, ZL, JZ\u003c/p\u003e\n\u003cp\u003eCentral laboratory, Mindong Hospital Affiliated to Fujian Medical University, Ningde, China\u003c/p\u003e\n\u003cp\u003eML\u003c/p\u003e\n\u003cp\u003eThe Engineering Technological Center of Mushroom Industry, Minnan Normal University, Zhangzhou, Fujian, China\u003c/p\u003e\n\u003cp\u003eZW\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKazemi M, Salehi M, Kheirollahi M. Down syndrome: current status, challenges and future perspectives\u003cem\u003e.\u003c/em\u003e Int J Mol Cell Med. 2016;5:125-33.\u003c/li\u003e\n\u003cli\u003eRamalho C, Brand\u0026atilde;o O, Matias A, Montenegro N. Phenotypic variability in fetuses with down syndrome: a case-control pathological evaluation\u003cem\u003e.\u003c/em\u003e Fetal Diagn Ther. 2011;30:207-14.\u003c/li\u003e\n\u003cli\u003eHattori M, Fujiyama A, Taylor TD, Watanabe H, Yada T, Park HS, et al. The DNA sequence of human chromosome 21\u003cem\u003e.\u003c/em\u003e Nature. 2000;405:311-9.\u003c/li\u003e\n\u003cli\u003eCho CKJ, Drabovich AP, Karagiannis GS, Mart\u0026iacute;nez-Morillo E, Dason S, Dimitromanolakis A, et al. Quantitative proteomic analysis of amniocytes reveals potentially dysregulated molecular networks in Down syndrome\u003cem\u003e.\u003c/em\u003e Clin Proteomics. 2013;10:2.\u003c/li\u003e\n\u003cli\u003eReeves RH, Delabar J, Potier MC, Bhattacharyya A, Head E, Lemere C, et al. Paving the way for therapy: the second international conference of the trisomy 21 research society\u003cem\u003e.\u003c/em\u003e Mol Syndromol. 2019;9:279-86.\u003c/li\u003e\n\u003cli\u003eLagan N, Huggard D, Mc Grane F, Leahy TR, Franklin O, Roche E, et al. Multiorgan involvement and management in children with Down syndrome\u003cem\u003e.\u003c/em\u003e Acta Paediatr. 2020;109:1096-111.\u003c/li\u003e\n\u003cli\u003eHerault Y, Delabar JM, Fisher EMC, Tybulewicz VLJ, Yu E, Brault V. Rodent models in Down syndrome research: impact and future opportunities\u003cem\u003e.\u003c/em\u003e Dis Model Mech. 2017;10:1165-86.\u003c/li\u003e\n\u003cli\u003eLee JH, Lee AJ, Dang LH, Pang D, Kisselev S, Krinsky-McHale SJ, et al. Candidate gene analysis for Alzheimer\u0026apos;s disease in adults with Down syndrome\u003cem\u003e.\u003c/em\u003e Neurobiol Aging. 2017;56:150-8.\u003c/li\u003e\n\u003cli\u003eAntonarakis SE. Down syndrome and the complexity of genome dosage imbalance\u003cem\u003e.\u003c/em\u003e Nat Rev Genet. 2017;18:147-63.\u003c/li\u003e\n\u003cli\u003eAntonarakis SE, Skotko BG, Rafii MS, Strydom A, Pape SE, Bianchi DW, et al. Down syndrome\u003cem\u003e.\u003c/em\u003e Nat Rev Dis Primers. 2020;6:9.\u003c/li\u003e\n\u003cli\u003eHarrison-Uy SJ, Pleasure SJ. Wnt signaling and forebrain development\u003cem\u003e.\u003c/em\u003e Cold Spring Harb Perspect Biol. 2012;4:a008094.\u003c/li\u003e\n\u003cli\u003eSalinas PC. Wnt signaling in the vertebrate central nervous system: from axon guidance to synaptic function\u003cem\u003e.\u003c/em\u003e Cold Spring Harb Perspect Biol. 2012;4.\u003c/li\u003e\n\u003cli\u003eDupont P, Besson MT, Devaux J, Li\u0026eacute;vens JC. Reducing canonical Wingless/Wnt signaling pathway confers protection against mutant huntingtin toxicity in Drosophila\u003cem\u003e.\u003c/em\u003e Neurobiol Dis. 2012;47:237-47.\u003c/li\u003e\n\u003cli\u003eZhang L, Deng J, Pan Q, Zhan Y, Fan JB, Zhang K, et al. Targeted methylation sequencing reveals dysregulated Wnt signaling in Parkinson disease\u003cem\u003e.\u003c/em\u003e J Genet Genomics. 2016;43:587-92.\u003c/li\u003e\n\u003cli\u003eMiyazaki K, Fujita T, Ozaki T, Kato C, Kurose Y, Sakamoto M, et al. NEDL1, a novel ubiquitin-protein isopeptide ligase for dishevelled-1, targets mutant superoxide dismutase-1\u003cem\u003e.\u003c/em\u003e J Biol Chem. 2004;279:11327-35.\u003c/li\u003e\n\u003cli\u003eLibro R, Bramanti P, Mazzon E. The role of the Wnt canonical signaling in neurodegenerative diseases\u003cem\u003e.\u003c/em\u003e Life Sci. 2016;158:78-88.\u003c/li\u003e\n\u003cli\u003eVall\u0026eacute;e A, Lecarpentier Y. Alzheimer disease: crosstalk between the canonical Wnt/beta-catenin pathway and PPARs alpha and gamma\u003cem\u003e.\u003c/em\u003e Front Neurosci. 2016;10:459.\u003c/li\u003e\n\u003cli\u003eGranno S, Nixon-Abell J, Berwick DC, Tosh J, Heaton G, Almudimeegh S, et al. Downregulated Wnt/beta-catenin signalling in the Down syndrome hippocampus\u003cem\u003e.\u003c/em\u003e Sci Rep. 2019;9:7322.\u003c/li\u003e\n\u003cli\u003eLi D, Sun J, Zhong TP. Wnt signaling in heart development and regeneration\u003cem\u003e.\u003c/em\u003e Curr Cardiol Rep. 2022;24:1425-38.\u003c/li\u003e\n\u003cli\u003eAntonaros F, Zenatelli R, Guerri G, Bertelli M, Locatelli C, Vione B, et al. The transcriptome profile of human trisomy 21 blood cells\u003cem\u003e.\u003c/em\u003e Hum Genomics. 2021;15:25.\u003c/li\u003e\n\u003cli\u003eSobol M, Klar J, Laan L, Shahsavani M, Schuster J, Anner\u0026eacute;n G, et al. Transcriptome and proteome profiling of neural induced pluripotent stem cells from individuals with Down syndrome disclose dynamic dysregulations of key pathways and cellular functions\u003cem\u003e.\u003c/em\u003e Mol Neurobiol. 2019;56:7113-27.\u003c/li\u003e\n\u003cli\u003eSchmidt W. The amniotic fluid compartment: the fetal habitat\u003cem\u003e.\u003c/em\u003e Adv Anat Embryol Cell Biol. 1992;127:1-100.\u003c/li\u003e\n\u003cli\u003eTong X. Amniotic fluid may act as a transporting pathway for signaling molecules and stem cells during the embryonic development of amniotes\u003cem\u003e.\u003c/em\u003e J Chin Med Assoc. 2013;76:606\u0026ndash;10.\u003c/li\u003e\n\u003cli\u003eUnderwood MA, Gilbert WM, Sherman MP. Amniotic fluid: not just fetal urine anymore\u003cem\u003e.\u003c/em\u003e J Perinatol. 2005;25:341-8.\u003c/li\u003e\n\u003cli\u003eWang HY, Malbon CC. Wnt signaling, Ca2+, and cyclic GMP: visualizing Frizzled functions\u003cem\u003e.\u003c/em\u003e Science. 2003;300:1529-30.\u003c/li\u003e\n\u003cli\u003eMuchov\u0026aacute; J, Žitňanov\u0026aacute; I, Ďuračkov\u0026aacute; Z. Oxidative stress and Down syndrome. Do antioxidants play a role in therapy? Physiol Res. 2014;63:535-42.\u003c/li\u003e\n\u003cli\u003eMorawiec Z, Janik K, Kowalski M, Stetkiewicz T, Szaflik J, Morawiec-Bajda A, et al. DNA damage and repair in children with Down\u0026apos;s syndrome\u003cem\u003e.\u003c/em\u003e Mutat Res. 2008;637:118-23.\u003c/li\u003e\n\u003cli\u003eFischer BM, Voynow JA, Ghio AJ. COPD: balancing oxidants and antioxidants\u003cem\u003e.\u003c/em\u003e Int J Chron Obstruct Pulmon Dis. 2015;10:261-76.\u003c/li\u003e\n\u003cli\u003eNecchi D, Pinto A, Tillhon M, Dutto I, Serafini MM, Lanni C, et al. Defective DNA repair and increased chromatin binding of DNA repair factors in Down syndrome fibroblasts\u003cem\u003e.\u003c/em\u003e Mutat Res. 2015;780:15-23.\u003c/li\u003e\n\u003cli\u003eImai K, Mercer BA, Schulman LL, Sonett JR, D\u0026rsquo;Armiento JM. Correlation of lung surface area to apoptosis and proliferation in human emphysema\u003cem\u003e.\u003c/em\u003e Eur Respir J. 2005;25:250-8.\u003c/li\u003e\n\u003cli\u003eMa Q, Yu J, Zhang X, Wu X, Deng G. Wnt/beta-catenin signaling pathway-a versatile player in apoptosis and autophagy\u003cem\u003e.\u003c/em\u003e Biochimie. 2023;211:57-67.\u003c/li\u003e\n\u003cli\u003eLian X, Zhang J, Azarin SM, Zhu K, Hazeltine LB, Bao X, et al. Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt/beta-catenin signaling under fully defined conditions\u003cem\u003e.\u003c/em\u003e Nat Protoc. 2013;8:162-75.\u003c/li\u003e\n\u003cli\u003ePrutton KM, Marentette JO, Leifheit BA, Esquer H, LaBarbera DV, Anderson CC, et al. Oxidative stress as a candidate mechanism for accelerated neuroectodermal differentiation due to trisomy 21\u003cem\u003e.\u003c/em\u003e Free Radic Biol Med. 2022;186:32\u0026ndash;42.\u003c/li\u003e\n\u003cli\u003eTraisrisilp K, Sirichotiyakul S, Tongprasert F, Srisupundit K, Luewan S, Jatavan P, et al. First trimester genetic sonogram for screening fetal Down syndrome: A population-based study\u003cem\u003e.\u003c/em\u003e Taiwan J Obstet Gynecol. 2021;60:706-10.\u003c/li\u003e\n\u003cli\u003eFasoulakis Z, Theodora M, Tsirkas I, Tsirka T, Kalagasidou S, Inagamova L, et al. The role of microRNAs identified in the amniotic fluid\u003cem\u003e.\u003c/em\u003e MicroRNA. 2020;9:8-16.\u003c/li\u003e\n\u003cli\u003eDa Sacco S, De Filippo RE, Perin L. Amniotic fluid as a source of pluripotent and multipotent stem cells for organ regeneration\u003cem\u003e.\u003c/em\u003e Curr Opin Organ Transplant. 2011;16:101\u0026ndash;5.\u003c/li\u003e\n\u003cli\u003eNusse R, Varmus H. Three decades of Wnts: a personal perspective on how a scientific field developed\u003cem\u003e.\u003c/em\u003e EMBO J. 2012;31:2670-84.\u003c/li\u003e\n\u003cli\u003eReya T, Clevers H. Wnt signalling in stem cells and cancer\u003cem\u003e.\u003c/em\u003e Nature. 2005;434:843-50.\u003c/li\u003e\n\u003cli\u003eMcNeill H, Woodgett JR. When pathways collide: collaboration and connivance among signalling proteins in development\u003cem\u003e.\u003c/em\u003e Nat Rev Mol Cell Biol. 2010;11:404-13.\u003c/li\u003e\n\u003cli\u003eAntonarakis SE, Lyle R, Dermitzakis ET, Reymond A, Deutsch S. Chromosome 21 and down syndrome: from genomics to pathophysiology\u003cem\u003e.\u003c/em\u003e Nat Rev Genet. 2004;5:725-38.\u003c/li\u003e\n\u003cli\u003eChi C, Knight WE, Riching AS, Zhang Z, Tatavosian R, Zhuang Y, et al. Interferon hyperactivity impairs cardiogenesis in Down syndrome via downregulation of canonical Wnt signaling. iScience. 2023;26:107012.\u003c/li\u003e\n\u003cli\u003eBalatskyi VV, Sowka A, Dobrzyn P, Piven OO. WNT/beta-catenin pathway is a key regulator of cardiac function and energetic metabolism\u003cem\u003e.\u003c/em\u003e Acta Physiol (Oxf). 2023;237:e13912.\u003c/li\u003e\n\u003cli\u003eTan YH, Tischfield J, Ruddle FH. The linkage of genes for the human interferon-induced antiviral protein and indophenol oxidase-B traits to chromosome G-21\u003cem\u003e.\u003c/em\u003e J Exp Med. 1973;137:317-30.\u003c/li\u003e\n\u003cli\u003eSustrov\u0026aacute; M, Sar\u0026iacute;kov\u0026aacute; V. [Down\u0026apos;s syndrome--effect of increased gene expression in chromosome 21 on the function of the immune and nervous system]\u003cem\u003e.\u003c/em\u003e Bratisl Lek Listy. 1997;98:221-8.\u003c/li\u003e\n\u003cli\u003eTiano L, Padella L, Santoro L, Carnevali P, Principi F, Brug\u0026egrave; F, et al. Prolonged coenzyme Q10 treatment in Down syndrome patients: effect on DNA oxidation\u003cem\u003e.\u003c/em\u003e Neurobiol Aging. 2012;33:626.e1\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez-Cu\u0026eacute; C, Rueda N. Cellular senescence in neurodegenerative diseases\u003cem\u003e.\u003c/em\u003e Front Cell Neurosci. 2020;14:16.\u003c/li\u003e\n\u003cli\u003ePerluigi M, Butterfield DA. Oxidative stress and Down syndrome: A route toward alzheimer-like dementia\u003cem\u003e.\u003c/em\u003e Curr Gerontol Geriatr Res. 2012;2012:724904.\u003c/li\u003e\n\u003cli\u003eWeitzdoerfer R, Dierssen M, Fountoulakis M, Lubec G. Fetal life in Down syndrome starts with normal neuronal density but impaired dendritic spines and synaptosomal structure\u003cem\u003e.\u003c/em\u003e J Neural Transm Suppl. 2001;(61):59-70.\u003c/li\u003e\n\u003cli\u003eMilenkovic I, Jarc J, Dassler E, Aronica E, Iyer A, Adle-Biassette H, et al. The physiological phosphorylation of tau is critically changed in fetal brains of individuals with Down syndrome\u003cem\u003e.\u003c/em\u003e Neuropathol Appl Neurobiol. 2018;44:314-27.\u003c/li\u003e\n\u003cli\u003eRueda N, Fl\u0026oacute;rez J, Mart\u0026iacute;nez-Cu\u0026eacute; C. Apoptosis in Down\u0026apos;s syndrome: lessons from studies of human and mouse models\u003cem\u003e.\u003c/em\u003e Apoptosis. 2013;18:121-34.\u003c/li\u003e\n\u003cli\u003eStadelmann C, Deckwerth TL, Srinivasan A, Bancher C, Br\u0026uuml;ck W, Jellinger K, et al. Activation of caspase-3 in single neurons and autophagic granules of granulovacuolar degeneration in Alzheimer\u0026apos;s disease. Evidence for apoptotic cell death\u003cem\u003e.\u003c/em\u003e Am J Pathol. 1999;155:1459-66.\u003c/li\u003e\n\u003cli\u003eGuidi S, Bonasoni P, Ceccarelli C, Santini D, Gualtieri F, Ciani E, et al. Neurogenesis impairment and increased cell death reduce total neuron number in the hippocampal region of fetuses with Down syndrome\u003cem\u003e.\u003c/em\u003e Brain Pathol. 2008;18:180-97.\u003c/li\u003e\n\u003cli\u003eAli A, Ali A, Ahmad W, Ahmad N, Khan S, Nuruddin SM, et al. Deciphering the role of WNT signaling in metabolic syndrome-linked Alzheimer\u0026apos;s disease\u003cem\u003e.\u003c/em\u003e Mol Neurobiol. 2020;57:302-14.\u003c/li\u003e\n\u003cli\u003eYu B, Zhang J, Li H, Sun X. Silencing of aquaporin1 activates the Wnt signaling pathway to improve cognitive function in a mouse model of Alzheimer\u0026apos;s disease\u003cem\u003e.\u003c/em\u003e Gene. 2020;755:144904.\u003c/li\u003e\n\u003cli\u003eYang Y, Wang L, Zhang C, Guo Y, Li J, Wu C, et al. Ginsenoside Rg1 improves Alzheimer\u0026apos;s disease by regulating oxidative stress, apoptosis, and neuroinflammation through Wnt/GSK-3\u0026beta;/\u0026beta;-catenin signaling pathway\u003cem\u003e.\u003c/em\u003e Chem Biol Drug Des. 2022;99:884-96.\u003c/li\u003e\n\u003cli\u003eChidiac R, Angers S. Wnt signaling in stem cells during development and cell lineage specification\u003cem\u003e.\u003c/em\u003e Curr Top Dev Biol. 2023;153:121-43.\u003c/li\u003e\n\u003cli\u003eHabib SJ, Acebr\u0026oacute;n SP. Wnt signalling in cell division: from mechanisms to tissue engineering\u003cem\u003e.\u003c/em\u003e Trends Cell Biol. 2022;32:1035-48.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-molecular-and-cell-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cebi","sideBox":"Learn more about [BMC Molecular and Cell Biology](https://bmcmolcellbiol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cebi/default.aspx","title":"BMC Molecular and Cell Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Down syndrome, Wnt/β-catenin pathway, amniocyte, homeostasis, dysregulation","lastPublishedDoi":"10.21203/rs.3.rs-4461929/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4461929/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eDown syndrome (DS), which is caused by partial or complete triplication of chromosome 21, may cause a range of clinical features. Although most fetuses with DS exhibit typical characteristics, the molecular pathogenesis underlying DS remains unclear. Wnt signaling is known to play a crucial role in fetal growth and development. However, the link between Wnt signaling and the abnormal development of fetuses with DS remains poorly understood. In this study, our objective was to investigate the dysregulation of Wnt signaling in the amniocytes of fetuses diagnosed with DS. To this end, we determined β-catenin protein expression, oxidative stress, cell proliferation, and apoptosis in amniocytes from fetuses diagnosed with DS. Subsequently, we upregulated the Wnt/β-catenin pathway components in amniocytes from fetuses diagnosed with DS and detected the expression of related proteins.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eWe found that downregulating the Wnt/β-catenin pathway components decreased cell proliferation while increasing oxidative stress and apoptosis in the amniocytes derived from fetuses diagnosed with DS compared with those seen in normal fetal amniocytes. In contrast, upregulating the Wnt/β-catenin pathway components in DS amniocytes increased cell proliferation and decreased oxidative stress and apoptosis, resulting in improved cell growth.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe Wnt/β-catenin pathway may maintain homeostasis in DS amniocytes and normalize cell growth to levels similar to those in normal cells. These findings reveal a novel molecular mechanism underlying the abnormal regulation of Wnt/β-catenin signaling during the development of fetuses with DS, thereby suggesting potential targeted therapies for DS.\u003c/p\u003e","manuscriptTitle":"The Wnt/β-catenin pathway maintains homeostasis of amniocytes in Down syndrome","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-06-13 06:46:30","doi":"10.21203/rs.3.rs-4461929/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-06-13T09:19:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-03T10:09:06+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-31T09:04:44+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Molecular and Cell Biology","date":"2024-05-22T15:21:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-molecular-and-cell-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cebi","sideBox":"Learn more about [BMC Molecular and Cell Biology](https://bmcmolcellbiol.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/cebi/default.aspx","title":"BMC Molecular and Cell Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"18bca43e-be6b-452b-aaf3-3c01847c6be9","owner":[],"postedDate":"June 13th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-02-02T16:06:14+00:00","versionOfRecord":{"articleIdentity":"rs-4461929","link":"https://doi.org/10.1186/s12860-026-00569-9","journal":{"identity":"bmc-molecular-and-cell-biology","isVorOnly":false,"title":"BMC Molecular and Cell Biology"},"publishedOn":"2026-01-31 15:58:45","publishedOnDateReadable":"January 31st, 2026"},"versionCreatedAt":"2024-06-13 06:46:30","video":"","vorDoi":"10.1186/s12860-026-00569-9","vorDoiUrl":"https://doi.org/10.1186/s12860-026-00569-9","workflowStages":[]},"version":"v1","identity":"rs-4461929","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4461929","identity":"rs-4461929","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.