Study on the mechanism of miR-361-5p regulation of androgen receptor in castration-resistant transformation of prostate cancer

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Prostate cancer has become one of the most common tumors endangering men's health. At present, the main clinical treatments for prostate tumors are surgery, radiotherapy, endocrine therapy, chemotherapy, etc. However, due to drug resistance, the treatment effect of prostate cancer is not good, and the expression of androgen receptor (AR) and its protein structure changes play a crucial role in the resistance of prostate cancer. The expression of androgen receptor (AR) and changes in its protein structure play a crucial role in prostate cancer drug resistance. Non-coding RNAs, especially miRNAs, are involved in post-transcriptional regulation of genes and play an important role in the development of tumor cells, and may be used as specific substances to assist in the treatment of cancer. Our previous study showed that miR-361-5p expression was down-regulated in prostate cancer and that overexpression of miR-361-5p inhibited the proliferation, migration and promoted apoptosis of castration-resistant prostate cancer cells, DU145 and PC3, however, the mechanism through which miR-361-5p affects the progression of prostate cancer is unknown. We found that miR-361-5p could target binding to androgen receptor (AR) and play a role in the transformation of hormone-sensitive prostate cancer cells (LNCAP) to castration-resistant prostate cancer cells (LNCAP-AI), which inhibited proliferation, migration and promoted apoptosis of prostate cancer cells. Therefore, we suggest that miR-361-5p can target AR and inhibit the rapid growth of AR in the early stage of transformation, thus inhibiting the transformation of prostate cancer cells to castration-resistant.
Full text 104,813 characters · extracted from preprint-html · click to expand
Study on the mechanism of miR-361-5p regulation of androgen receptor in castration-resistant transformation of prostate cancer | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Study on the mechanism of miR-361-5p regulation of androgen receptor in castration-resistant transformation of prostate cancer Peng Zhang, Xin Yin, Xinzhao Li, Mingyi Zang, Qing Liang, Zhiguo Zhang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4168315/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Prostate cancer has become one of the most common tumors endangering men's health. At present, the main clinical treatments for prostate tumors are surgery, radiotherapy, endocrine therapy, chemotherapy, etc. However, due to drug resistance, the treatment effect of prostate cancer is not good, and the expression of androgen receptor (AR) and its protein structure changes play a crucial role in the resistance of prostate cancer. The expression of androgen receptor (AR) and changes in its protein structure play a crucial role in prostate cancer drug resistance. Non-coding RNAs, especially miRNAs, are involved in post-transcriptional regulation of genes and play an important role in the development of tumor cells, and may be used as specific substances to assist in the treatment of cancer. Our previous study showed that miR-361-5p expression was down-regulated in prostate cancer and that overexpression of miR-361-5p inhibited the proliferation, migration and promoted apoptosis of castration-resistant prostate cancer cells, DU145 and PC3, however, the mechanism through which miR-361-5p affects the progression of prostate cancer is unknown. We found that miR-361-5p could target binding to androgen receptor (AR) and play a role in the transformation of hormone-sensitive prostate cancer cells (LNCAP) to castration-resistant prostate cancer cells (LNCAP-AI), which inhibited proliferation, migration and promoted apoptosis of prostate cancer cells. Therefore, we suggest that miR-361-5p can target AR and inhibit the rapid growth of AR in the early stage of transformation, thus inhibiting the transformation of prostate cancer cells to castration-resistant. Biological sciences/Cancer Biological sciences/Cell biology Health sciences/Oncology Health sciences/Urology miR-361-5p androgen receptor (AR) LNCAP LNCAP-AI prostate cancer castration-resistant Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Prostate cancer has become a serious threat to men's health,and its incidence is positively correlated with the level of human development [ 1 ]. Due to the insidious nature of prostate cancer, some patients have advanced prostate cancer at the time of diagnosis, and most of these patients will progress to incurable CRPC (castration-resistant prostate cancer) after 18 to 24 monthsof ADT (androgen deprivation therapy) [ 2 ]. A sufficient requisitefor transforming prostate cancer cell growth from a depot-sensitive phase to a castration-resistant phase has been reported to be a modest increase in androgen receptor (AR) expression [ 3 ]. Castration-resistant prostate cancer maintains its dependence on AR mainly through AR gene amplification, enabling mutations, AR mRNA splicing changes, overexpression of AR and AR cofactors, and alteration of androgen synthesis pathways within the tumor [ 4 , 5 ].AR is an important target for the treatment of advanced prostate cancer, and after binding of androgens to ligand AR, AR translocates into the nucleus and binds to specific genomes and regulates gene expression, thus promoting prostate growth. expression is regulated thereby promoting prostate cancer development [ 6 ]. Non-coding RNAs are molecules that do not get translated into proteins after transcription to work as RNAs themselves, which play important roles in cellular gene expression and signaling, and can be used as new tumor markers and targets for the prevention and treatment of human diseases [ 7 ]. MicroRNAs areendogenous non-coding RNAs, among which miR-361-5p has been found to down-regulate expression and play an oncostatic role in CRPC in our previous study, and it has been demonstrated that miR-361-5p inhibits CRPC cell proliferation and metabolism by directly targeting the Sp1/PKM2 signaling pathway [ 7 ]. CRPC with down-regulated expression and oncogenic effects, and miR-361-5p was demonstrated to inhibit CRPC cell proliferation, metabolism and autophagy by directly targeting the Sp1/PKM2 signaling pathway [ 8 , 9 ]. Therefore, in the present study, we would like to clarify the relationship between miR-361-5p and AR, and explore the important role of miR-361-5p in the process of castration-resistant in LNCAP prostate cancer cell lines, with a view to providing new theoretical basis and targets for CRPC treatment. 2. Materials and methods 2.1 Materials 2.1.1 Main reagents and instruments RPMI 1640 medium (Gibco, USA); fetal bovine serum (Wisent); penicillin-streptomycin dual antibiotic (Biyuntian Biotechnology Research Institute, China); 0.25% trypsin (Gibco, USA), FBS (BI 1407738); PBS (BBI PD0100-1 pk); oligo (genepharma); Trypsin-EDTA Solution (GIBCO 25200-072); Liposomal Lipofectamine 2000 (Invitrogen, USA); Trizol (Invitrogen, USA); Hairpin-itTM miRNAs RT-PCR Quantitation Kit (genepharma); CCK-8 Kit (BBI, China); Crystalline Violet Staining Solution (BBI PD0100-1 pk); Crystalline Violet Staining Solution (BBI PD0100-1 pk); Crystalline Violet Staining Solution (GIBCO 25200-072) (Biyuntian Biotechnology Institute, China); crystal violet staining solution (Biyuntian Biotechnology Institute, China); methanol (Xilong Chemical Factory, Shantou, Guangdong, China); annexin V-FITC/PI apoptosis kit (Transgen, FA101); cell culture well plates (Corning), BD FACS Arial II flow cytometer; protein lysate: M-PER, Mammalian Protein Extraction Reagent (Thermo); PVDF Transfer Membrane (Millipore); Protein pre-staining Marker: Fermantas SM0671 (Thermo); target primary antibody: Anti-AR androgen receptor polyclonal antibody (Source: Rabbit; Reactivity: Human; Proteintech, 22089 Reactivity: Human; Sigma-Aldrich, A5441), 1:5000; internal reference secondary antibody: HRP-conjugated Goat anti-Mouse IgG, JIR 115-035-003, 1:10000, PVDF Transfer Membrane (Millipore); ECL substrate: Pierce ECL Western Blotting Substrate (MDBio); electrophoresis tank (Shanghai Tannen); DY-B1 decolorizing shaker (Shanghai Husi Instruments); filter paper (Whatman 3MM); imager: Tanon 4200 automatic chemiluminescence image analysis system 2.1.2 Cells LNCAP cells were purchased from the Cell Bank of the Chinese Academy of Sciences( https://www.cellbank.org.cn/ ), and the LNCAP-AI cells were induced by the author under androgen depletion conditions for half a year to become LNCAP cells. 2.2 Methodology 2.2.1 LNCAP and LNCAP-AI cell culture Parent LNCAP cells were cultured in 10% (v/v) normal fetal bovine serum/phenol red-containing RPMI 1640 medium to establish a hormone-independent LNCAP-AI cell line, and after 2 generations, the cells were switched to serum-free RPMI 1640 medium for 2 days, and then switched to activated charcoal/dextran-treated fetal bovine serum RPMI 1640 for 6 months to establish a hormone-independent LNCAP-AI cell line. After 6 months of long-term passaging culture, the LNCAP cell subline, named LNCAP-AI cell subline, was screened and cultured for androgen-independent growth. During the culture process, the culture medium was replaced with fresh culture medium twice a week, and the cells were cultured in a CO2 incubator at an ambient temperature of 37℃ and a volume fraction of 5%. 2.2.2 miRNA selection and primer design The seed sequence of miR-361-5p was predicted to have strong binding complementarity with the 3’UTR region of AR mRNA by using the bioinformatics prediction software circBase ( http://circbase.org/ ) analysis, and the primers were designed using the AR-3’UTR sequence as a template. All primers used in this study were provided by Suzhou Gemma(Table 1 ). Table 1 Primer sequences of genes for RT-PCR Gene primer Sequence (5′–3′) PCR Amplification length AR H-AR-FO-6 GACGACCAGATGGCTGTCATT 106 H-AR-RE-6 GGGCGAAGTAGAGCATCCT HGAPDH HGAPDH-FO CATGAGAAGTATGACAACAGCCT 113 HGAPDH-RE AGTCCTTCCACGATACCAAAGT HmiR-361-5p HmiR-361-5p-FO CATCCACATTATCAGAATCTCCAG 79 HmiR-361-5p-RE TATGGTTGTTCACGACTCCTTCAC U6 U6-FO CGCTTCGGCAGCACATATAC 87 U6-RE TTCACGAATTTGCGTGTCATC 2.2.3 Transfection of miR-361-5p into LNCAP and verification of transfection effect LNCAP and LNCAP-AI cells were cultured according to the required conditions and collected in logarithmic growth phase, inoculated into 6-well plates at a density of 5 × 10 5 cells/well overnight, and then transfected with miR-361-5p according to the instructions of LipofectamineTM 2000, and the cells were collected 24 h after transfection. Total RNA was extracted by Trizol method, and the quality of total RNA was detected by agarose gel electrophoresis. Take 2ug of total RNA, reverse transcription to synthesize cDNA, and PCR amplification to measure the expression level of miR-361-5p. 2.2.4 Cell proliferation assay (CCK-8 assay) to detect the effect of miR-361-5p on LNCAP cell proliferation Collect LNCAP cells in logarithmic growth phase, set up experimental group, NC group and blank group, set up 6 replicate wells for each group, inoculate them into 96-well plates at a density of 5 × 10 3 cells/well overnight, add transfection mixture according to the instructions of transfection reagents, respectively, and then replace it with complete medium after 6 h. Cultivate the cells at 37 ℃ in 5% CO2 incubator, and then add the mixture with CCK-5p to each well under the conditions of light protection after transfection at 0, 24, 48, and 72, respectively. Under the condition of transfection, add CCK8 reagent to each well to measure the cell activity, incubate in the incubator for 1h and compare with the NC group and the blank group, the absorbance at 450 nm was measured by enzyme marker. 2.2.5 Cell migration assay (scratch assay) to detect the effect of miR-361-5p on LNCAP cell migration A marker pen was used to draw horizontal lines uniformly, one every 0.5 ~ 1 cm, across the wells on the back of a 6-well plate, compared with a straightedge. Collect LNCAP cells in logarithmic growth phase, set up experimental group, NC group and blank group, set up 6 replicate wells for each group, inoculate them into 6-well plates at a density of 5 × 10 5 cells/well and incubate them overnight, add transfection mixture according to the instructions of transfection reagents, and then replace the medium with complete medium after 6 h. Cultivate them at 37 ℃ in a 5% CO2 incubator, and then make scratches with a straightedge compared with the tip of the marker in the cell planes that have already been filled, so that the scratches hang down to the back as much as possible. The cells were washed 3 times with PBS. Wash the cells with PBS three times to remove the scratched cells and add serum-free medium. The plates were photographed under a microscope for 0 h, and then placed in a 37℃ 5% CO2 incubator for further incubation, and samples were taken at 24 h. The plates were then incubated at 37℃ for 0 h and then placed in a 37℃ 5% CO2 incubator for further incubation. Use Image-Pro Plus to measure the area and length of the scratches in each photo, and calculate the width of each scratch according to the value of scratch width = scratch area/scratch length. 2.2.6 Apoptosis assay (flow cytometry AnnexinV-FITC/PI double staining assay) to detect the effect of miR-361-5p on apoptosis of LNCAP cells Collect LNCAP cells in logarithmic growth phase, set up experimental group, NC group and blank group, set up 6 replicate wells for each group, inoculate into 6-well plates at a density of 5 × 10 5 cells/well overnight, add transfection mixture according to the instructions of transfection reagents, respectively, and replace it with complete medium after 6 h. Cultivate the cells at 37 ℃ in a 5% CO2 incubator, collect the cells after 48 h of transfection, and wash the cells with PBS 2 times, add 400 ul of Binding Buffer to suspend the cells, add 5 ul Annexin V-FITC to mix, room temperature, avoid light, react for 5–15 min, add 10 ul PI staining solution, mix; room temperature, avoid light, react for 5–15 min, in 1 h, the flow cytometry was performed. 2.2.7 Construction of wild-type and mutant AR-3’UTR luciferase reporter gene plasmid Using the above cDNA as template, the AR-3’UTR fragment containing miR-361-5p binding site was amplified. miR-361-5p corresponding to the AR-3’UTR target site and its nearby sequences were constructed into psiCHECKTM-2 vector as wild-type (WT) recombinant plasmid, and miR-361-5p corresponding to the AR-3’UTR target site was constructed into psiCHECKTM-2 vector as wild-type (WT) recombinant plasmid after base mutation. AR-3’UTR target site for miR-361-5p as wild-type (WT) recombinant plasmid, and miR-361-5p corresponding to AR-3’UTR target site was constructed into psiCHECKTM-2 vector as mutant (MUT) recombinant plasmid by base mutation. 2.2.8 Dual luciferase reporter system to detect miR-361-5p on AR mRNA 3’UTR The logarithmic growth phase 293T cells were collected and inoculated into 12-well plates at 5 × 10 5 cells/well and cultured overnight for plasmid transfection. Group 1 was co-transfected with pmiR-AR-3’UTR and NC mimics; Group 2 was co-transfected with pmiR-AR-3’UTR and miR-361-5p mimics. Three wells were set up in each group, and the transfection was performed according to the instructions of LipofectamineTM 2000. After 24 hours of transfection, the mimics were detected by Dual-Luciferase Reporter Gene Detection Kit. 2.1.9 qRT-PCR assay for AR mRNA expression in untransfected (LNCAP, LNCAP-AD7d, LNCAP-AI cells) and transfected groups (LNCAP + miR-361-5p,LNCAP-AD-7d + miR-361-5p,LNCAP-AI + miR-361-5p) Collect logarithmic growth phase LNCAP, LNCAP-AD7d (LNCAP cells on the seventh day of deandrogenization), LNCAP-AI cells were digested and resuspended, and appropriate amount of cells were inoculated into 6-well plates and incubated at 37℃ overnight, and transfected with miR-361-5p into the above three kinds of cells according to the previous method to obtain LNCAP + miR-361-5p, respectively, LNCAP-AD-7d + miR-361-5p, LNCAP-AI + miR-361-5p cells. Total RNA was extracted using Trizol lysate reagent, and total RNA (10 ng) was transcribed into cDNAs using MMLV reverse transcriptase. The qRT-PCR reaction was performed using SYBR Green PCR Master Mix of Hairpin-it™ miRNAs RT-PCR Quantification Kit (GenePharma, Suzhou, China) according to the manufacturer's protocol. The PCR conditions for detecting AR were as follows:94°C for 3 min, 94°C for 12 s, 62°C for 30 s, 72ºC for 30 s, and 40 cycles. HGAPDH expression was used as a control. All reactions were performed in 3 replicates and negative control reactions lacking cDNA were included. Relative gene expression was calculated using the2- −ΔΔCT method. 2.1.10 Western blot assay for AR protein expression in the untransfected group (LNCAP, LNCAP-AD7d, LNCAP-AI cells) and the transfected group (LNCAP + miR-361-5p, LNCAP-AD-7d + miR-361-5p, LNCAP-AI + miR-361-5p) Six types of cells were obtained according to the above method, and the cells were lysed with M-PER (Mammalian Protein Extraction Reagent) lysing solution for total protein lysis, and the protein concentration was determined by the Bradford method using a 4×SDS loading buffer to dissolve the proteins on a 10% SDS - PAGE gel using 4×SDS loading buffer, and electrotransferred to PVDF Transfer Membrane, and blocked the membrane with Blocking Buffer for 2 h. Diluted primary antibody was added and incubated at 4ºC overnight. Wash with 1×PBST 3 times, 10 min each time, add diluted secondary antibody and incubate at room temperature for 1h. Wash with 1×PBST 3 times, 10 min each time. Chemiluminescence detection was performed with ECL substrate, exposed by Tanon 4200 fully automated chemiluminescence image analysis system and quantified by gray scale analysis using Gel-Pro Analyzer software. 2.1.11 Statistical analysis Each group of experiments was repeated three times, and the data were processed using GraphPad Prism 8.0 software. Comparisons between groups were made using t-test, and P < 0.05 was considered statistically significant. 3. Results 3.1 Transfection efficiency detection of miR-361-5p The qRT-PCR assay suggested that the miR-361-5p content of NC group and Blank group was low with no significant difference ( P > 0.05), while the miR-361-5p content of miR-361-5p mimics group was significantly increased (** P < 0.01), suggesting that the experiment had a high transfection efficiency (Fig. 1 ). 3.2 Cell proliferation assay (CCK-8 experiment) The results showed that the cell proliferation ability of the experimental group was significantly decreased relative to the NC group and the Blank group, and the difference was statistically significant (Fig. 2 , * P < 0.05, ** P < 0.01). 3.3 Cell migration assay (scratch assay) The results showed that the experimental group showed a significant decrease in cell migration ability relative to the NC group and the Blank group, and the difference was statistically significant (Fig. 3 , * P < 0.05, ** P < 0.01). 3.4 Apoptosis flow assay The results showed that the proportion of cells undergoing apoptosis was significantly higher in the experimental group relative to the NC group and the Blank group, and the difference was statistically significant (Fig. 4 , ** P < 0.01) 3.5 Dual-luciferase reporter system for detecting the direct binding of miR-361-5p to the AR 3’UTR In the experimental group, co-transfection of hsa-miR-361-5p mimic with psiCHECKTM-2- AR wild-type plasmid for 24 h showed a significant difference in luciferase expression compared to the co-transfected mimics NC group (* P < 0.05). However, when the binding site of hsa-miR-361-5p in the 3’UTR sequence of AR was mutated and then co-transfected with hsa-miR-361-5p mimic, there was no significant difference in the expression of luciferase compared to the co-transfected mimics NC group ( P > 0.05). The above results indicated that miR-361-5p could target binding to the 3’UTR of AR (Fig. 5 ). 3.6 Expression levels of AR mRNA in the untransfected group (LNCAP, LNCAP-AD7d, LNCAP-AI cells) and the transfected group (LNCAP + miR-361-5p, LNCAP-AD-7d + miR-361-5p, LNCAP-AI + miR-361-5p) We transfected the cells of LNCAP, LNCAP-AD7d, and LNCAP-AI with miR-361-5p respectively, and qPCR was performed 48 hours after transfection to detect AR, and the experimental results showed that there was no statistically significant difference in the mRNA level of AR among the groups, whether or not the cells were transfected with miR-361-5p. It indicated that miR-361-5p had no significant effect on the mRNA stability of AR, and androgen deprivation had no significant effect on the mRNA level of AR (Fig. 6 , P > 0.05). 3.7 Expression level of AR protein in untransfected group (LNCAP, LNCAP-AD7d, LNCAP-AI cells) and transfected group (LNCAP + miR-361-5p, LNCAP-AD-7d + miR-361-5p, LNCAP-AI + miR-361-5p) We transfected cells of LNCAP, LNCAP-AD7d and LNCAP-AI with miR-361-5p respectively, and performed WB assay for AR 48 hours after transfection, and the experimental results showed that AR differed significantly among the groups in protein levels (Fig. 7 , * P < 0.05, ** P < 0.01).AR showed a tendency to increase and then decrease after androgen deprivation, which suggests that Short-term androgen deprivation promotes LNCAP to express high levels of AR through negative feedback to enhance its responsiveness to androgens, while long-term androgen deprivation promotes adaptive changes in LNCAP to gradually switch to androgen-independent growth. Our previous study also showed that LNCAP showed transient slow cell growth during induction, but the cell growth rate of LNCAP-AI was significantly higher than that of LNCAP after successful induction. we compared miR-361-5p transfected and untransfected groups, and the experimental results showed that the AR protein level was significantly reduced after miR-361-5p transfection, indicating that miR-361-5p had no significant effect on the mRNA stability of AR, but promoted the post-transcriptional regulation of AR, which may inhibit the translation of AR mRNA or promote its protein degradation. Comparing the LNCAP-AD7d as well as LNCAP-AD7d transfected with miR-361-5p groups, we found that the androgen deprivation-induced elevation of early AR protein levels was significantly reduced after transfection with miR-361-5p, suggesting that miR-361-5p could be used as an early diagnostic indicator of prostate cancer denervation resistance. 4 Discussion The level of miRNAs in tumor cells is different from that of healthy cells, and their up-regulated or down-regulated expression plays a key role in the activation of gene signaling pathways in cancer development [ 10 ]. Among them, dysregulation of miR-361-5p plays an important role in human cancers and its abnormal expression has been found in human lung, breast, colorectal, cervical, ovarian, gastric, and retinoblastoma cancers [ 11 – 17 ] and exists as a pro- or oncogenic factor. Our functional experiments demonstrated that miR-361-5p inhibited the proliferation and migration of LNCAP cells and promoted their apoptosis. lin, S et al [ 18 ] demonstrated that the combination of serum miR-361-5p with miR-34b-3p and miR-200c-3p assays had a good diagnostic value for the early screening of Pca, and that the miR-361-5p expression in expression level was significantly downregulated in serum samples of Pca. Wang YJ et al [ 19 ] showed that LncRNA LINC00308 is abnormally highly expressed in prostate cancer and has the function of acting as a competing endogenous RNA (ceRNA) that affects prostate cancer progression by inhibiting the expression of miR-361-5p. When LINC00308 is highly expressed, it decreases the level of miR-361-5p, which leads to the upregulation of TRIP13 expression, a protein that is closely related to the ability of cells to proliferate, invade, and migrate, and its upregulated expression further promotes the malignant behavior of prostate cancer cells. However, when the expression of miR-361-5p was artificially increased, this malignant effect could be effectively eliminated, demonstrating the potential value of miR-361-5p in prostate cancer therapy. Gu P et al [ 20 , 21 ] demonstrated that lncRNA HOXD-AS1 was highly expressed in CRPC cells, and in vivo and ex vivo experiments verified that knockdown of HOXD-AS1 inhibited the proliferation and chemoresistance of CRPC cells. miR-361-5p, one of the most highly enriched mircoRNAs in PCa, showed a negative correlation between its expression level and that of the exosomal HOXD-AS1 ( R = -0.21, P < 0.01), HOXD-AS1 was cells, HOXD-AS1 was directly internalized by PCa cells and acted as a competitive endogenous RNA (ceRNA) sponge adsorbed by miR-361-5p to upregulate the expression of FOXM1, which promoted distant metastasis in PCa cells. miR-361-5p also directly targeted SND1 and reduced its mRNA and protein expression, which in turn inhibited the growth-promoting effects of SND1 in prostate cancer [ 22 , 23 ]. In addition, miR-361-5p can bind to a conserved structural domain within the 3’UTR of CLDN8 and inhibit its post-transcriptional level, thus hindering the proliferation and migration of prostate cancer cells [ 17 , 24 ]. These results are consistent with our findings and again demonstrate that miR-361-5p acts as an oncogene to hinder prostate cancer progression. Furthermore, our study revealed that miR-361-5p has a targeting effect on AR. The luciferase reporter gene results showed that miR-361-5p could target the 3’UTR region of AR. In PCa, AR is the most miR-targeted oncogene, and its 3’UTR is 2.6 times longer than its coding region. It has been shown that shortening of the 3’UTR region results in the absence of miRNA binding sites leading to the amplification of AR and thus facilitates PCa progression [ 25 , 26 ]. Östling P et al [ 27 ] showed that miRNAs are important factors that interact with the 3’UTR of the AR to regulate AR protein levels, and 13 miRNAs were validated with this ability. In addition to this, it has been shown that the downstream target of miR-361-5p, MDM4 (mouse double minute 4), a nuclear protein homologous to MDM2, a negative regulator of p53, and co-overexpression of MDM4 and MDM2 at low MDM4 ratios reduces the ubiquitination of AR proteins to regulate AR [ 28 , 29 ]. Interestingly, Stegeman S et al [ 30 ] found the rs4245739 SNP "C" allele with MDM4 genotype in the PC3 prostate cancer cell line, and further showed that miR-191-5p and miR-887 in PC3 cells have specific Further studies showed that miR-191-5p and miR-887 had a specific affinity for this allele in PC3 cells and reduced the expression of MDM4 protein, thus inhibiting the proliferation of PC3 cells. Therefore, we hypothesized that miR-361-5p might also play an inhibitory role in PC3 cells by reducing the expression of MDM4 in a certain way and then regulating the AR protein. The above studies suggest that miR-361-5p may regulate AR through multiple pathways, and its mechanism is very complex and needs to be further explored. The expression of AR and changes in its protein structure play a crucial role in the process of PCa castration-resistant in the development of drug resistance [ 31 ]. Therefore, it is particularly crucial to investigate in depth how miRNAs affect the expression of AR, especially its role in the process of PCa castration-resistant transformation. We further clarified the expression of miR-361-5p in prostate cancer castration-resistant transformation, and found that during castration-resistant induction in LNCAP cells, there was no significant difference in the expression of AR at the mRNA level, regardless of whether miR-361-5p was transfected or not, whereas at the AR protein level, prior to transfection with miR-361-5p, the AR expression showed a transient elevation followed by a decrease, this change in AR mRNA not parallel to protein suggests that the effect of miR-361-5p on AR proteins acts at the post-transcriptional level. Östling P et al [ 27 ] validated using the LMA technique in LNCAP and 22Rv1 cells to show that the majority of miRNAs inhibit the translational level of the AR and rarely play a role at the function at the transcriptional level. In addition to this, Qu, F et al [ 32 ] showed that overexpression of miR-185 decreased the expression of AR protein in LNCAP cells but did not inhibit its expression at the mRNA level. These findings are consistent with our results. Fletcher, C E et al [ 33 ] showed that inhibitors of miR-361-3p and miR-197 play a significant role in the regulation of AR. These inhibitors were able to significantly reduce the transcriptional activity of AR and decrease the ability of AR to regulate in the process of gene expression. At the same time, they were also effective in reducing the mRNA and protein levels of the AR, meaning that the AR was significantly inhibited in both quantity and function within the cell. Further studies also revealed that this inhibitory effect was not only limited to the AR itself, but also extended to a series of key biological processes in PCa cells. Specifically, by inhibiting AR, these miRNA inhibitors significantly suppressed the proliferation, migration, and invasive ability of PCa cells and promoted their apoptosis, thereby slowing down the progression of PCa, showing a superimposed effect of AR inhibition by miR-361-3p and miR-197. Enzalutamide-treated CRPC cells had elevated expression levels of both miR-361-3p and miR-197, suggesting that miR-361-3p and miR-197 may contribute to the progression of PCa denervation resistance by promoting or maintaining enzalutamide resistance to AR-targeted therapies. Larne O et al [ 34 ] demonstrated that miR-145 mediates the inhibition of AR and its downstream targets, including prostate-specific antigen (PSA), Kinase-related peptidase 2 peptidase 2 and TMPRSS2, suggesting that exogenous miR-145 may reduce AR expression in PCa to delay the onset of castration-resistant. Liu C et al [ 35 ] demonstrated that miR-185 could inhibit PCa by inhibiting AR expression through direct targeting of the AR-3’UTR, and these results have similarities with miR-361-5p that we studied, both revealing the important role of miRNAs in regulating AR expression and prostate cancer development. To further explore the function of miR-361-5p in prostate cancer, we further investigated the role played by miR-361-5p on the AR pathway during the induction of LNCAP into LNCAP-AI. We first transfected miR-361-5p into LNCAP cells and detected the expression level of AR on the seventh day of induction. Compared with the control group, although the trend was the same, the elevation of AR on the seventh day was significantly lower in the transfected group than in the untransfected group. This result suggests that miR-361-5p inhibited the dramatic elevation of AR in the early stage of castration-resistant transformation of LNCAP cells, then slowing down the transformation of prostate cancer cells to castration-resistant. When LNCAP cells were successfully induced to become LNCAP-AI, we observed that the expression levels of AR all returned to a lower level state, suggesting that progression to the advanced tumor stage may be accompanied by mutation of AR, which allows the cancer cells to ultimately progress to become AR-independent CRPCs. Therefore, we believe that miR-361-5p plays an important role in the early stage of castration-resistant transformation of prostate cancer which slows down the malignant transformation of prostate cancer cells by inhibiting AR expression, but for AR-independent CRPC. it is still necessary for us to further explore the related mechanisms and more effective therapeutic strategies. In conclusion, our results suggest that miR-361-5p can act as an oncogenic factor in prostate cancer, which can target AR thereby inhibiting the proliferation, migration and promoting apoptosis of prostate cancer cells, and hindering the process of castration-resistant transformation. Declarations CONFLICTS OF INTEREST The authors declare that there are no conflicts of interest. Author Contribution Z.P. andZ.M.Y wrote the manuscript,Y.X.andH.J. provided experimental assistance,L.Q.andZ.Z.G. provides a platform for experimentation,H.C.HandL.L.provided financial support,L.X.ZandL.D.CProvided topic design ideas and reviewed manuscriptsIn addition this, Dear Editor, I hope you will understand that I have to make a separate note here because I could not recognize the project names of the three funded authors in the system. ACKNOWLEDGMENTS This project was supported by the Xuzhou Introducing Clinical Medical Experts Team Project, (No. 2018TD004); The Fifth Phase of Jiangsu Province "333 Project" Funding Program in 2016 (No.2-BRA2017294); 2020 Xuzhou Clinical Technical Backbone Training Program Project, (No. 2020GG020). We would like to acknowledge the helpful comments on this paper received from our reviewers. Data Availability Since this experiment was done by our team itself, the datasets generated and/or analyzed in this study are not publicly available, but are available from the corresponding author. References Wang L, Lu B, He M, et al. Prostate Cancer Incidence and Mortality: Global Status and Temporal Trends in 89 Countries From 2000 to 2019[J]. Front Public Health, 2022,10:811044. Hess-Busch Y, Hadaschik B, Hess J. M0CRPC overview of management options[J]. World J Urol, 2021,39(2):349–356. Chen C D, Welsbie D S, Tran C, et al. Molecular determinants of resistance to antiandrogen therapy[J]. Nat Med, 2004,10(1):33–39. Watson P A, Arora V K, Sawyers C L. Emerging mechanisms of resistance to androgen receptor inhibitors in prostate cancer[J]. Nat Rev Cancer, 2015,15(12):701–711. Makino T, Izumi K, Mizokami A. Undesirable Status of Prostate Cancer Cells after Intensive Inhibition of AR Signaling: Post-AR Era of CRPC Treatment[J]. Biomedicines, 2021,9(4):414. Jeon H Y, Pornour M, Ryu H, et al. SMAD3 promotes expression and activity of the androgen receptor in prostate cancer[J]. Nucleic Acids Res, 2023,51(6):2655–2670. Wang W T, Han C, Sun Y M, et al. Noncoding RNAs in cancer therapy resistance and targeted drug development[J]. J Hematol Oncol, 2019,12(1):55. Liu D, Tao T, Xu B, et al. MiR-361-5p acts as a tumor suppressor in prostate cancer by targeting signal transducer and activator of transcription-6(STAT6)[J]. Biochem Biophys Res Commun, 2014,445(1):151–156. Ling Z, Liu D, Zhang G, et al. miR-361-5p modulates metabolism and autophagy via the Sp1-mediated regulation of PKM2 in prostate cancer[J]. Oncol Rep, 2017,38(3):1621–1628. Menon A, Abd-Aziz N, Khalid K, et al. miRNA: A Promising Therapeutic Target in Cancer[J]. Int J Mol Sci, 2022,23(19):11502. Hou X W, Sun X, Yu Y, et al. miR-361-5p suppresses lung cancer cell lines progression by targeting FOXM1[J]. Neoplasma, 2017,64(4):526–534. Han J, Yu J, Dai Y, et al. Overexpression of miR-361-5p in triple-negative breast cancer (TNBC) inhibits migration and invasion by targeting RQCD1 and inhibiting the EGFR/PI3K/Akt pathway[J]. Bosn J Basic Med Sci, 2019,19(1):52–59. Ke C, Shen M, Wang P, et al. ALDH1A3-Linc00284 Axis Mediates the Invasion of Colorectal Cancer by Targeting TGFbeta Signaling via Sponging miR-361-5p[J]. Int J Genomics, 2022,2022:6561047. Yang W, Xie T. Hsa_circ_CSPP1/MiR-361-5p/ITGB1 Regulates Proliferation and Migration of Cervical Cancer (CC) by Modulating the PI3K-Akt Signaling Pathway[J]. Reprod Sci, 2020,27(1):132–144. Ling J, He P. miR-361-5p regulates ovarian cancer cell proliferation and apoptosis by targeting TRAF3[J]. Exp Ther Med, 2021,21(3):199. Qian B, Zhang D, Tao R, et al. MiR-361-5p exerts tumor-suppressing functions in gastric carcinoma by targeting syndecan-binding protein[J]. Anticancer Drugs, 2020,31(2):131–140. Liu B, Lu B, Wang X, et al. MiR-361-5p inhibits cell proliferation and induces cell apoptosis in retinoblastoma by negatively regulating CLDN8[J]. Childs Nerv Syst, 2019,35(8):1303–1311. Lin S, Sun C, Li R, et al. The value of a three-microRNA panel in serum for prostate cancer screening[J]. Int J Biol Markers, 2024,39(1):70–79. Baihetia Azati, Liu Q, Wang YJ. lncRNA LINC00308 acts as a ceRNA to promote the proliferation and invasion of prostate cancer PC3 cells by regulating the miR-361-5p/TRIP13 axis[J]. Chinese Journal of Tumor Biotherapy, 2020,27(09):968–977. Gu P, Chen X, Xie R, et al. lncRNA HOXD-AS1 Regulates Proliferation and Chemo-Resistance of Castration-Resistant Prostate Cancer via Recruiting WDR5[J]. Mol Ther, 2017,25(8):1959–1973. Jiang Y, Zhao H, Chen Y, et al. Exosomal long noncoding RNA HOXD-AS1 promotes prostate cancer metastasis via miR-361-5p/FOXM1 axis[J]. Cell Death Dis, 2021,12(12):1129. Liu J, Yang J, Yu L, et al. miR-361-5p inhibits glioma migration and invasion by targeting SND1[J]. Onco Targets Ther, 2018,11:5239–5252. Qin X, Zhong J, Wang L, et al. LncRNA LNC-565686 Promotes Proliferation of Prostate Cancer by Inhibiting Apoptosis through Stabilizing SND1[J]. Biomedicines, 2023,11(10). Ashikari D, Takayama K I, Obinata D, et al. CLDN8, an androgen-regulated gene, promotes prostate cancer cell proliferation and migration[J]. Cancer Sci, 2017,108(7):1386–1393. Di Leva G, Croce C M. Roles of small RNAs in tumor formation[J]. Trends Mol Med, 2010,16(6):257–267. Sikand K, Barik S, Shukla G C. MicroRNAs and Androgen Receptor 3' Untranslated Region: A Missing Link in Castration-resistant Prostate Cancer?[J]. Mol Cell Pharmacol, 2011,3(3):107–113. Ostling P, Leivonen S K, Aakula A, et al. Systematic analysis of microRNAs targeting the androgen receptor in prostate cancer cells[J]. Cancer Res, 2011,71(5):1956–1967. Martens-Uzunova E S, Kusuma G D, Crucitta S, et al. Androgens alter the heterogeneity of small extracellular vesicles and the small RNA cargo in prostate cancer[J]. J Extracell Vesicles, 2021,10(10):e12136. Chopra H, Khan Z, Contreras J, et al. Activation of p53 and destabilization of androgen receptor by combinatorial inhibition of MDM2 and MDMX in prostate cancer cells[J]. Oncotarget, 2018,9(5):6270–6281. Stegeman S, Moya L, Selth L A, et al. A genetic variant of MDM4 influences regulation by multiple microRNAs in prostate cancer[J]. Endocr Relat Cancer, 2015,22(2):265–276. Gao K, Li X, Ni J, et al. Non-coding RNAs in enzalutamide resistance of castration-resistant prostate cancer[J]. Cancer Lett, 2023,566:216247. Qu F, Cui X, Hong Y, et al. MicroRNA-185 suppresses proliferation, invasion, migration, and tumorigenicity of human prostate cancer cells through targeting androgen receptor[J]. Mol Cell Biochem, 2013,377(1–2):121–130. Fletcher C E, Sulpice E, Combe S, et al. Androgen receptor-modulatory microRNAs provide insight into therapy resistance and therapeutic targets in advanced prostate cancer[J]. Oncogene, 2019,38(28):5700–5724. Larne O, Hagman Z, Lilja H, et al. miR-145 suppress the androgen receptor in prostate cancer cells and correlates to prostate cancer prognosis[J]. Carcinogenesis, 2015,36(8):858–866. Liu C, Chen Z, Hu X, et al. MicroRNA-185 downregulates androgen receptor expression in the LNCAP prostate carcinoma cell line[J]. Mol Med Rep, 2015,11(6):4625–4632. Additional Declarations No competing interests reported. Supplementary Files Dataavailabilitystatement.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4168315","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":291793464,"identity":"73d2efc2-92ba-4d6c-9c20-fc40f457e431","order_by":0,"name":"Peng Zhang","email":"","orcid":"","institution":"Graduate School of Bengbu Medical University","correspondingAuthor":false,"prefix":"","firstName":"Peng","middleName":"","lastName":"Zhang","suffix":""},{"id":291793465,"identity":"77c71397-37ea-485f-a7b6-fda6b9d55d46","order_by":1,"name":"Xin Yin","email":"","orcid":"","institution":"Anhui Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Yin","suffix":""},{"id":291793466,"identity":"c02aa531-b7a9-4839-9746-5843c966075d","order_by":2,"name":"Xinzhao Li","email":"","orcid":"","institution":"Fuyang Cancer Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xinzhao","middleName":"","lastName":"Li","suffix":""},{"id":291793467,"identity":"05ae7d4c-9658-4084-b134-b4690807b963","order_by":3,"name":"Mingyi Zang","email":"","orcid":"","institution":"Xuzhou Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"Mingyi","middleName":"","lastName":"Zang","suffix":""},{"id":291793468,"identity":"506c2140-c614-4768-b1f7-63f8f0bc5a05","order_by":4,"name":"Qing Liang","email":"","orcid":"","institution":"Xuzhou Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"Qing","middleName":"","lastName":"Liang","suffix":""},{"id":291793469,"identity":"a6991bba-6ba8-41ed-8bd9-90dca377c724","order_by":5,"name":"Zhiguo Zhang","email":"","orcid":"","institution":"Xuzhou Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhiguo","middleName":"","lastName":"Zhang","suffix":""},{"id":291793470,"identity":"39ae9518-9253-400f-b6c8-b907e5e0562b","order_by":6,"name":"Lin Liu","email":"","orcid":"","institution":"Xuzhou Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lin","middleName":"","lastName":"Liu","suffix":""},{"id":291793471,"identity":"33248ef1-65ce-46aa-b77f-51936c14d46c","order_by":7,"name":"Conghui Han","email":"","orcid":"","institution":"Graduate School of Bengbu Medical University","correspondingAuthor":false,"prefix":"","firstName":"Conghui","middleName":"","lastName":"Han","suffix":""},{"id":291793472,"identity":"4e6327c1-7385-4e9d-8570-3e79bf15f364","order_by":8,"name":"Jie He","email":"","orcid":"","institution":"Xuzhou Central Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"He","suffix":""},{"id":291793473,"identity":"282acf60-bc58-4ae8-8566-09c4c545854e","order_by":9,"name":"Dachuang Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAzElEQVRIiWNgGAWjYBACeYbDBx//qbCxsz/eQKQWw8ZjyQY8Z9KSGc4cINaaw2fUJHjbDjE23EggUgdj2xlmAwm2A8yMMx9vvMFQYxNNUAs7z9mDDwx47vAxS6cVWzAcS8ttIGjLjHPJBgkSz5jZpHPMJBgbDhPWwnD/jZnEAYPDjD2SZ4jVcuCMmWRDwmHGGRI8RGoxbDiWbMxwIA0Y0kC/JBDjF3BUMv6zsTNgP7zxxocaGyIchgQMJBJIUQ7RQqqOUTAKRsEoGBkAAFVaQ74nT/9ZAAAAAElFTkSuQmCC","orcid":"","institution":"Graduate School of Bengbu Medical University","correspondingAuthor":true,"prefix":"","firstName":"Dachuang","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-03-26 08:36:57","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4168315/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4168315/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55008559,"identity":"a070d2dd-1ec2-48eb-a0bc-8a51be27b831","added_by":"auto","created_at":"2024-04-19 19:05:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":61778,"visible":true,"origin":"","legend":"\u003cp\u003eThe qRT-PCR assay suggested that the relative expression of miR-361-5p was significantly higher in the transfected miR-361-5p mimics group compared with the Blank and NC groups. ** P\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4168315/v1/fd892b8a17fb6d48fdc56590.png"},{"id":55008589,"identity":"4de6b831-654d-43d5-b76c-a3834b79f0e5","added_by":"auto","created_at":"2024-04-19 19:05:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":71808,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of miR-361-5p significantly inhibited the proliferation of LNCAP cells.\u003cstrong\u003e *\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eP \u0026lt; 0.05,\u003cstrong\u003e **\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eP \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4168315/v1/6ae5ff7b410154f7dc4075b1.png"},{"id":55008585,"identity":"e084ff3d-e700-44ad-a18b-122300c20aa9","added_by":"auto","created_at":"2024-04-19 19:05:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1304802,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of miR-361-5p significantly inhibited LNCAP cell migration. \u003cstrong\u003e*\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eP \u0026lt; 0.05,\u003cstrong\u003e **\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eP \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4168315/v1/85f4e30195c3be2b3908bfde.png"},{"id":55008584,"identity":"9ee4065a-7f2e-4dc5-be19-b13496e0eefa","added_by":"auto","created_at":"2024-04-19 19:05:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":177098,"visible":true,"origin":"","legend":"\u003cp\u003eOverexpression of miR-361-5p significantly promoted apoptosis in LNCAP cells, as shown by AnnexinV-FITC/PI double staining assay by flow cytometry.\u003cstrong\u003e **\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eP \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4168315/v1/4eefa49c7db56fcbaf3f0d71.png"},{"id":55008588,"identity":"5208d728-1186-458c-ab5a-f60a466d4302","added_by":"auto","created_at":"2024-04-19 19:05:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":197146,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of miR-361-5p binding site sequence to AR into luciferase vector, luciferase activity of Wt AR 3 ' -UTR and Mut AR 3 ' -UTR co-transfected with miR-361-5p mimics was assayed in 293T cells.\u003cstrong\u003e *\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eP \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4168315/v1/5be1ff53b20b2577767218b3.png"},{"id":55008579,"identity":"dbf88c7c-52ef-48d5-93fa-31107262a4fe","added_by":"auto","created_at":"2024-04-19 19:05:30","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":13205,"visible":true,"origin":"","legend":"\u003cp\u003eThe cells of LNCAP, LNCAP-AD7d (LNCAP cells were de-androgenized for 7 days), and LNCAP-AI were transfected with miR-361-5p respectively, and 48 hours after transfection, the six types of cells were subjected to qPCR experiments at the same time, and the relative expression of AR gene relative to that of HGAPDH (the internal reference) was detected, using LNCAP as the calibration. The results showed that there was no statistically significant difference in the mRNA levels of AR in the six cell types among the groups. P \u0026gt; 0.05.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4168315/v1/2e78366730c49c523f660cc4.png"},{"id":55008578,"identity":"37b291c8-8c5e-456c-a4c4-6258f10bf278","added_by":"auto","created_at":"2024-04-19 19:05:28","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":449741,"visible":true,"origin":"","legend":"\u003cp\u003eLNCAP, LNCAP-AD7d (LNCAP cells were deandrogenized for 7 days) and LNCAP-AI cells were transfected with miR-361-5p, and 48 hours after the transfection, six kinds of cells were subjected to WB experiments at the same time, and the results of the experiments showed that there were significant differences in the protein levels of AR among groups, and that AR showed a tendency of increasing and then decreasing after androgen deprivation. Comparing the miR-361-5p transfected group and the untransfected group, the AR protein level was significantly reduced after transfecting miR-361-5p; comparing the LNCAP-AD7d as well as the LNCAP-AD7d transfected miR-361-5p groups, the increase in AR protein level was significantly reduced. \u003cstrong\u003e*\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eP \u0026lt; 0.05,\u003cstrong\u003e **\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e \u003c/strong\u003e\u003c/em\u003eP \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4168315/v1/dde025ab8374712bde949813.png"},{"id":57591336,"identity":"86c37627-6967-493e-a48e-e4607ca790c5","added_by":"auto","created_at":"2024-06-03 05:24:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2880302,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4168315/v1/b90ee02e-5df3-4c48-be38-12f8e010d668.pdf"},{"id":55008581,"identity":"71292b4b-87f2-44e0-a074-9d8a709bb6c3","added_by":"auto","created_at":"2024-04-19 19:05:30","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":15082,"visible":true,"origin":"","legend":"","description":"","filename":"Dataavailabilitystatement.docx","url":"https://assets-eu.researchsquare.com/files/rs-4168315/v1/50acc63c2145859d76539381.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Study on the mechanism of miR-361-5p regulation of androgen receptor in castration-resistant transformation of prostate cancer","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eProstate cancer has become a serious threat to men's health,and its incidence is positively correlated with the level of human development [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Due to the insidious nature of prostate cancer, some patients have advanced prostate cancer at the time of diagnosis, and most of these patients will progress to incurable CRPC (castration-resistant prostate cancer) after 18 to 24 monthsof ADT (androgen deprivation therapy) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. A sufficient requisitefor transforming prostate cancer cell growth from a depot-sensitive phase to a castration-resistant phase has been reported to be a modest increase in androgen receptor (AR) expression [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Castration-resistant prostate cancer maintains its dependence on AR mainly through AR gene amplification, enabling mutations, AR mRNA splicing changes, overexpression of AR and AR cofactors, and alteration of androgen synthesis pathways within the tumor [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].AR is an important target for the treatment of advanced prostate cancer, and after binding of androgens to ligand AR, AR translocates into the nucleus and binds to specific genomes and regulates gene expression, thus promoting prostate growth. expression is regulated thereby promoting prostate cancer development [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNon-coding RNAs are molecules that do not get translated into proteins after transcription to work as RNAs themselves, which play important roles in cellular gene expression and signaling, and can be used as new tumor markers and targets for the prevention and treatment of human diseases [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. MicroRNAs areendogenous non-coding RNAs, among which miR-361-5p has been found to down-regulate expression and play an oncostatic role in CRPC in our previous study, and it has been demonstrated that miR-361-5p inhibits CRPC cell proliferation and metabolism by directly targeting the Sp1/PKM2 signaling pathway [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. CRPC with down-regulated expression and oncogenic effects, and miR-361-5p was demonstrated to inhibit CRPC cell proliferation, metabolism and autophagy by directly targeting the Sp1/PKM2 signaling pathway [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Therefore, in the present study, we would like to clarify the relationship between miR-361-5p and AR, and explore the important role of miR-361-5p in the process of castration-resistant in LNCAP prostate cancer cell lines, with a view to providing new theoretical basis and targets for CRPC treatment.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Materials\u003c/h2\u003e \u003cdiv id=\"Sec4\" class=\"Section3\"\u003e \u003ch2\u003e2.1.1 Main reagents and instruments\u003c/h2\u003e \u003cp\u003eRPMI 1640 medium (Gibco, USA); fetal bovine serum (Wisent); penicillin-streptomycin dual antibiotic (Biyuntian Biotechnology Research Institute, China); 0.25% trypsin (Gibco, USA), FBS (BI 1407738); PBS (BBI PD0100-1 pk); oligo (genepharma); Trypsin-EDTA Solution (GIBCO 25200-072); Liposomal Lipofectamine 2000 (Invitrogen, USA); Trizol (Invitrogen, USA); Hairpin-itTM miRNAs RT-PCR Quantitation Kit (genepharma); CCK-8 Kit (BBI, China); Crystalline Violet Staining Solution (BBI PD0100-1 pk); Crystalline Violet Staining Solution (BBI PD0100-1 pk); Crystalline Violet Staining Solution (GIBCO 25200-072) (Biyuntian Biotechnology Institute, China); crystal violet staining solution (Biyuntian Biotechnology Institute, China); methanol (Xilong Chemical Factory, Shantou, Guangdong, China); annexin V-FITC/PI apoptosis kit (Transgen, FA101); cell culture well plates (Corning), BD FACS Arial II flow cytometer; protein lysate: M-PER, Mammalian Protein Extraction Reagent (Thermo); PVDF Transfer Membrane (Millipore); Protein pre-staining Marker: Fermantas SM0671 (Thermo); target primary antibody: Anti-AR androgen receptor polyclonal antibody (Source: Rabbit; Reactivity: Human; Proteintech, 22089 Reactivity: Human; Sigma-Aldrich, A5441), 1:5000; internal reference secondary antibody: HRP-conjugated Goat anti-Mouse IgG, JIR 115-035-003, 1:10000, PVDF Transfer Membrane (Millipore); ECL substrate: Pierce ECL Western Blotting Substrate (MDBio); electrophoresis tank (Shanghai Tannen); DY-B1 decolorizing shaker (Shanghai Husi Instruments); filter paper (Whatman 3MM); imager: Tanon 4200 automatic chemiluminescence image analysis system\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e2.1.2 Cells\u003c/h2\u003e \u003cp\u003eLNCAP cells were purchased from the Cell Bank of the Chinese Academy of Sciences(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.cellbank.org.cn/\u003c/span\u003e\u003cspan address=\"https://www.cellbank.org.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the LNCAP-AI cells were induced by the author under androgen depletion conditions for half a year to become LNCAP cells.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Methodology\u003c/h2\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.2.1 LNCAP and LNCAP-AI cell culture\u003c/h2\u003e \u003cp\u003eParent LNCAP cells were cultured in 10% (v/v) normal fetal bovine serum/phenol red-containing RPMI 1640 medium to establish a hormone-independent LNCAP-AI cell line, and after 2 generations, the cells were switched to serum-free RPMI 1640 medium for 2 days, and then switched to activated charcoal/dextran-treated fetal bovine serum RPMI 1640 for 6 months to establish a hormone-independent LNCAP-AI cell line. After 6 months of long-term passaging culture, the LNCAP cell subline, named LNCAP-AI cell subline, was screened and cultured for androgen-independent growth. During the culture process, the culture medium was replaced with fresh culture medium twice a week, and the cells were cultured in a CO2 incubator at an ambient temperature of 37℃ and a volume fraction of 5%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.2.2 miRNA selection and primer design\u003c/h2\u003e \u003cp\u003eThe seed sequence of miR-361-5p was predicted to have strong binding complementarity with the 3\u0026rsquo;UTR region of AR mRNA by using the bioinformatics prediction software circBase (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://circbase.org/\u003c/span\u003e\u003cspan address=\"http://circbase.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) analysis, and the primers were designed using the AR-3\u0026rsquo;UTR sequence as a template. All primers used in this study were provided by Suzhou Gemma(Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences of genes for RT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eprimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026prime;\u0026ndash;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePCR\u003c/p\u003e \u003cp\u003eAmplification length\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH-AR-FO-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACGACCAGATGGCTGTCATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e106\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eH-AR-RE-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGCGAAGTAGAGCATCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHGAPDH-FO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATGAGAAGTATGACAACAGCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e113\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHGAPDH-RE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTCCTTCCACGATACCAAAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHmiR-361-5p\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHmiR-361-5p-FO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATCCACATTATCAGAATCTCCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e79\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHmiR-361-5p-RE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTATGGTTGTTCACGACTCCTTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eU6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eU6-FO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCTTCGGCAGCACATATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e87\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eU6-RE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCACGAATTTGCGTGTCATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.2.3 Transfection of miR-361-5p into LNCAP and verification of transfection effect\u003c/h2\u003e \u003cp\u003eLNCAP and LNCAP-AI cells were cultured according to the required conditions and collected in logarithmic growth phase, inoculated into 6-well plates at a density of 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/well overnight, and then transfected with miR-361-5p according to the instructions of LipofectamineTM 2000, and the cells were collected 24 h after transfection. Total RNA was extracted by Trizol method, and the quality of total RNA was detected by agarose gel electrophoresis. Take 2ug of total RNA, reverse transcription to synthesize cDNA, and PCR amplification to measure the expression level of miR-361-5p.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.2.4 Cell proliferation assay (CCK-8 assay) to detect the effect of miR-361-5p on LNCAP cell proliferation\u003c/h2\u003e \u003cp\u003eCollect LNCAP cells in logarithmic growth phase, set up experimental group, NC group and blank group, set up 6 replicate wells for each group, inoculate them into 96-well plates at a density of 5 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells/well overnight, add transfection mixture according to the instructions of transfection reagents, respectively, and then replace it with complete medium after 6 h. Cultivate the cells at 37 ℃ in 5% CO2 incubator, and then add the mixture with CCK-5p to each well under the conditions of light protection after transfection at 0, 24, 48, and 72, respectively. Under the condition of transfection, add CCK8 reagent to each well to measure the cell activity, incubate in the incubator for 1h and compare with the NC group and the blank group, the absorbance at 450 nm was measured by enzyme marker.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.2.5 Cell migration assay (scratch assay) to detect the effect of miR-361-5p on LNCAP cell migration\u003c/h2\u003e \u003cp\u003eA marker pen was used to draw horizontal lines uniformly, one every 0.5\u0026thinsp;~\u0026thinsp;1 cm, across the wells on the back of a 6-well plate, compared with a straightedge. Collect LNCAP cells in logarithmic growth phase, set up experimental group, NC group and blank group, set up 6 replicate wells for each group, inoculate them into 6-well plates at a density of 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/well and incubate them overnight, add transfection mixture according to the instructions of transfection reagents, and then replace the medium with complete medium after 6 h. Cultivate them at 37 ℃ in a 5% CO2 incubator, and then make scratches with a straightedge compared with the tip of the marker in the cell planes that have already been filled, so that the scratches hang down to the back as much as possible. The cells were washed 3 times with PBS. Wash the cells with PBS three times to remove the scratched cells and add serum-free medium. The plates were photographed under a microscope for 0 h, and then placed in a 37℃ 5% CO2 incubator for further incubation, and samples were taken at 24 h. The plates were then incubated at 37℃ for 0 h and then placed in a 37℃ 5% CO2 incubator for further incubation. Use Image-Pro Plus to measure the area and length of the scratches in each photo, and calculate the width of each scratch according to the value of scratch width\u0026thinsp;=\u0026thinsp;scratch area/scratch length.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.2.6 Apoptosis assay (flow cytometry AnnexinV-FITC/PI double staining assay) to detect the effect of miR-361-5p on apoptosis of LNCAP cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCollect LNCAP cells in logarithmic growth phase, set up experimental group, NC group and blank group, set up 6 replicate wells for each group, inoculate into 6-well plates at a density of 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/well overnight, add transfection mixture according to the instructions of transfection reagents, respectively, and replace it with complete medium after 6 h. Cultivate the cells at 37 ℃ in a 5% CO2 incubator, collect the cells after 48 h of transfection, and wash the cells with PBS 2 times, add 400 ul of Binding Buffer to suspend the cells, add 5 ul Annexin V-FITC to mix, room temperature, avoid light, react for 5\u0026ndash;15 min, add 10 ul PI staining solution, mix; room temperature, avoid light, react for 5\u0026ndash;15 min, in 1 h, the flow cytometry was performed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section3\"\u003e \u003ch2\u003e2.2.7 Construction of wild-type and mutant AR-3\u0026rsquo;UTR luciferase reporter gene plasmid\u003c/h2\u003e \u003cp\u003eUsing the above cDNA as template, the AR-3\u0026rsquo;UTR fragment containing miR-361-5p binding site was amplified. miR-361-5p corresponding to the AR-3\u0026rsquo;UTR target site and its nearby sequences were constructed into psiCHECKTM-2 vector as wild-type (WT) recombinant plasmid, and miR-361-5p corresponding to the AR-3\u0026rsquo;UTR target site was constructed into psiCHECKTM-2 vector as wild-type (WT) recombinant plasmid after base mutation. AR-3\u0026rsquo;UTR target site for miR-361-5p as wild-type (WT) recombinant plasmid, and miR-361-5p corresponding to AR-3\u0026rsquo;UTR target site was constructed into psiCHECKTM-2 vector as mutant (MUT) recombinant plasmid by base mutation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.2.8 Dual luciferase reporter system to detect miR-361-5p on AR mRNA 3\u0026rsquo;UTR\u003c/h2\u003e \u003cp\u003eThe logarithmic growth phase 293T cells were collected and inoculated into 12-well plates at 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/well and cultured overnight for plasmid transfection. Group 1 was co-transfected with pmiR-AR-3\u0026rsquo;UTR and NC mimics; Group 2 was co-transfected with pmiR-AR-3\u0026rsquo;UTR and miR-361-5p mimics. Three wells were set up in each group, and the transfection was performed according to the instructions of LipofectamineTM 2000. After 24 hours of transfection, the mimics were detected by Dual-Luciferase Reporter Gene Detection Kit.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.1.9 qRT-PCR assay for AR mRNA expression in untransfected (LNCAP, LNCAP-AD7d, LNCAP-AI cells) and transfected groups (LNCAP\u0026thinsp;+\u0026thinsp;miR-361-5p,LNCAP-AD-7d\u0026thinsp;+\u0026thinsp;miR-361-5p,LNCAP-AI\u0026thinsp;+\u0026thinsp;miR-361-5p)\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCollect logarithmic growth phase LNCAP, LNCAP-AD7d (LNCAP cells on the seventh day of deandrogenization), LNCAP-AI cells were digested and resuspended, and appropriate amount of cells were inoculated into 6-well plates and incubated at 37℃ overnight, and transfected with miR-361-5p into the above three kinds of cells according to the previous method to obtain LNCAP\u0026thinsp;+\u0026thinsp;miR-361-5p, respectively, LNCAP-AD-7d\u0026thinsp;+\u0026thinsp;miR-361-5p, LNCAP-AI\u0026thinsp;+\u0026thinsp;miR-361-5p cells. Total RNA was extracted using Trizol lysate reagent, and total RNA (10 ng) was transcribed into cDNAs using MMLV reverse transcriptase. The qRT-PCR reaction was performed using SYBR Green PCR Master Mix of Hairpin-it\u0026trade; miRNAs RT-PCR Quantification Kit (GenePharma, Suzhou, China) according to the manufacturer's protocol. The PCR conditions for detecting AR were as follows:94\u0026deg;C for 3 min, 94\u0026deg;C for 12 s, 62\u0026deg;C for 30 s, 72\u0026ordm;C for 30 s, and 40 cycles. HGAPDH expression was used as a control. All reactions were performed in 3 replicates and negative control reactions lacking cDNA were included. Relative gene expression was calculated using the2-\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.1.10 Western blot assay for AR protein expression in the untransfected group (LNCAP, LNCAP-AD7d, LNCAP-AI cells) and the transfected group (LNCAP\u0026thinsp;+\u0026thinsp;miR-361-5p, LNCAP-AD-7d\u0026thinsp;+\u0026thinsp;miR-361-5p, LNCAP-AI\u0026thinsp;+\u0026thinsp;miR-361-5p)\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSix types of cells were obtained according to the above method, and the cells were lysed with M-PER (Mammalian Protein Extraction Reagent) lysing solution for total protein lysis, and the protein concentration was determined by the Bradford method using a 4\u0026times;SDS loading buffer to dissolve the proteins on a 10% SDS - PAGE gel using 4\u0026times;SDS loading buffer, and electrotransferred to PVDF Transfer Membrane, and blocked the membrane with Blocking Buffer for 2 h. Diluted primary antibody was added and incubated at 4\u0026ordm;C overnight. Wash with 1\u0026times;PBST 3 times, 10 min each time, add diluted secondary antibody and incubate at room temperature for 1h. Wash with 1\u0026times;PBST 3 times, 10 min each time. Chemiluminescence detection was performed with ECL substrate, exposed by Tanon 4200 fully automated chemiluminescence image analysis system and quantified by gray scale analysis using Gel-Pro Analyzer software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e2.1.11 Statistical analysis\u003c/h2\u003e \u003cp\u003eEach group of experiments was repeated three times, and the data were processed using GraphPad Prism 8.0 software. Comparisons between groups were made using t-test, and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Transfection efficiency detection of miR-361-5p\u003c/h2\u003e \u003cp\u003eThe qRT-PCR assay suggested that the miR-361-5p content of NC group and Blank group was low with no significant difference (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), while the miR-361-5p content of miR-361-5p mimics group was significantly increased (** \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), suggesting that the experiment had a high transfection efficiency (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Cell proliferation assay (CCK-8 experiment)\u003c/h2\u003e \u003cp\u003eThe results showed that the cell proliferation ability of the experimental group was significantly decreased relative to the NC group and the Blank group, and the difference was statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, * \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Cell migration assay (scratch assay)\u003c/h2\u003e \u003cp\u003eThe results showed that the experimental group showed a significant decrease in cell migration ability relative to the NC group and the Blank group, and the difference was statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, * \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Apoptosis flow assay\u003c/h2\u003e \u003cp\u003eThe results showed that the proportion of cells undergoing apoptosis was significantly higher in the experimental group relative to the NC group and the Blank group, and the difference was statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, ** \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Dual-luciferase reporter system for detecting the direct binding of miR-361-5p to the AR 3\u0026rsquo;UTR\u003c/h2\u003e \u003cp\u003eIn the experimental group, co-transfection of hsa-miR-361-5p mimic with psiCHECKTM-2- AR wild-type plasmid for 24 h showed a significant difference in luciferase expression compared to the co-transfected mimics NC group (*\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, when the binding site of hsa-miR-361-5p in the 3\u0026rsquo;UTR sequence of AR was mutated and then co-transfected with hsa-miR-361-5p mimic, there was no significant difference in the expression of luciferase compared to the co-transfected mimics NC group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05). The above results indicated that miR-361-5p could target binding to the 3\u0026rsquo;UTR of AR (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.6 Expression levels of AR mRNA in the untransfected group (LNCAP, LNCAP-AD7d, LNCAP-AI cells) and the transfected group (LNCAP\u0026thinsp;+\u0026thinsp;miR-361-5p, LNCAP-AD-7d\u0026thinsp;+\u0026thinsp;miR-361-5p, LNCAP-AI\u0026thinsp;+\u0026thinsp;miR-361-5p)\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe transfected the cells of LNCAP, LNCAP-AD7d, and LNCAP-AI with miR-361-5p respectively, and qPCR was performed 48 hours after transfection to detect AR, and the experimental results showed that there was no statistically significant difference in the mRNA level of AR among the groups, whether or not the cells were transfected with miR-361-5p. It indicated that miR-361-5p had no significant effect on the mRNA stability of AR, and androgen deprivation had no significant effect on the mRNA level of AR (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3.7 Expression level of AR protein in untransfected group (LNCAP, LNCAP-AD7d, LNCAP-AI cells) and transfected group (LNCAP\u0026thinsp;+\u0026thinsp;miR-361-5p, LNCAP-AD-7d\u0026thinsp;+\u0026thinsp;miR-361-5p, LNCAP-AI\u0026thinsp;+\u0026thinsp;miR-361-5p)\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe transfected cells of LNCAP, LNCAP-AD7d and LNCAP-AI with miR-361-5p respectively, and performed WB assay for AR 48 hours after transfection, and the experimental results showed that AR differed significantly among the groups in protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, * \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, ** \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).AR showed a tendency to increase and then decrease after androgen deprivation, which suggests that Short-term androgen deprivation promotes LNCAP to express high levels of AR through negative feedback to enhance its responsiveness to androgens, while long-term androgen deprivation promotes adaptive changes in LNCAP to gradually switch to androgen-independent growth. Our previous study also showed that LNCAP showed transient slow cell growth during induction, but the cell growth rate of LNCAP-AI was significantly higher than that of LNCAP after successful induction. we compared miR-361-5p transfected and untransfected groups, and the experimental results showed that the AR protein level was significantly reduced after miR-361-5p transfection, indicating that miR-361-5p had no significant effect on the mRNA stability of AR, but promoted the post-transcriptional regulation of AR, which may inhibit the translation of AR mRNA or promote its protein degradation. Comparing the LNCAP-AD7d as well as LNCAP-AD7d transfected with miR-361-5p groups, we found that the androgen deprivation-induced elevation of early AR protein levels was significantly reduced after transfection with miR-361-5p, suggesting that miR-361-5p could be used as an early diagnostic indicator of prostate cancer denervation resistance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eThe level of miRNAs in tumor cells is different from that of healthy cells, and their up-regulated or down-regulated expression plays a key role in the activation of gene signaling pathways in cancer development [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Among them, dysregulation of miR-361-5p plays an important role in human cancers and its abnormal expression has been found in human lung, breast, colorectal, cervical, ovarian, gastric, and retinoblastoma cancers [\u003cspan additionalcitationids=\"CR12 CR13 CR14 CR15 CR16\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] and exists as a pro- or oncogenic factor. Our functional experiments demonstrated that miR-361-5p inhibited the proliferation and migration of LNCAP cells and promoted their apoptosis. lin, S et al [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e] demonstrated that the combination of serum miR-361-5p with miR-34b-3p and miR-200c-3p assays had a good diagnostic value for the early screening of Pca, and that the miR-361-5p expression in expression level was significantly downregulated in serum samples of Pca. Wang YJ et al [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] showed that LncRNA LINC00308 is abnormally highly expressed in prostate cancer and has the function of acting as a competing endogenous RNA (ceRNA) that affects prostate cancer progression by inhibiting the expression of miR-361-5p. When LINC00308 is highly expressed, it decreases the level of miR-361-5p, which leads to the upregulation of TRIP13 expression, a protein that is closely related to the ability of cells to proliferate, invade, and migrate, and its upregulated expression further promotes the malignant behavior of prostate cancer cells. However, when the expression of miR-361-5p was artificially increased, this malignant effect could be effectively eliminated, demonstrating the potential value of miR-361-5p in prostate cancer therapy. Gu P et al [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] demonstrated that lncRNA HOXD-AS1 was highly expressed in CRPC cells, and in vivo and ex vivo experiments verified that knockdown of HOXD-AS1 inhibited the proliferation and chemoresistance of CRPC cells. miR-361-5p, one of the most highly enriched mircoRNAs in PCa, showed a negative correlation between its expression level and that of the exosomal HOXD-AS1 (\u003cem\u003eR\u003c/em\u003e = -0.21, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), HOXD-AS1 was cells, HOXD-AS1 was directly internalized by PCa cells and acted as a competitive endogenous RNA (ceRNA) sponge adsorbed by miR-361-5p to upregulate the expression of FOXM1, which promoted distant metastasis in PCa cells. miR-361-5p also directly targeted SND1 and reduced its mRNA and protein expression, which in turn inhibited the growth-promoting effects of SND1 in prostate cancer [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In addition, miR-361-5p can bind to a conserved structural domain within the 3\u0026rsquo;UTR of CLDN8 and inhibit its post-transcriptional level, thus hindering the proliferation and migration of prostate cancer cells [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. These results are consistent with our findings and again demonstrate that miR-361-5p acts as an oncogene to hinder prostate cancer progression.\u003c/p\u003e \u003cp\u003eFurthermore, our study revealed that miR-361-5p has a targeting effect on AR. The luciferase reporter gene results showed that miR-361-5p could target the 3\u0026rsquo;UTR region of AR. In PCa, AR is the most miR-targeted oncogene, and its 3\u0026rsquo;UTR is 2.6 times longer than its coding region. It has been shown that shortening of the 3\u0026rsquo;UTR region results in the absence of miRNA binding sites leading to the amplification of AR and thus facilitates PCa progression [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. \u0026Ouml;stling P et al [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] showed that miRNAs are important factors that interact with the 3\u0026rsquo;UTR of the AR to regulate AR protein levels, and 13 miRNAs were validated with this ability. In addition to this, it has been shown that the downstream target of miR-361-5p, MDM4 (mouse double minute 4), a nuclear protein homologous to MDM2, a negative regulator of p53, and co-overexpression of MDM4 and MDM2 at low MDM4 ratios reduces the ubiquitination of AR proteins to regulate AR [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Interestingly, Stegeman S et al [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] found the rs4245739 SNP \"C\" allele with MDM4 genotype in the PC3 prostate cancer cell line, and further showed that miR-191-5p and miR-887 in PC3 cells have specific Further studies showed that miR-191-5p and miR-887 had a specific affinity for this allele in PC3 cells and reduced the expression of MDM4 protein, thus inhibiting the proliferation of PC3 cells. Therefore, we hypothesized that miR-361-5p might also play an inhibitory role in PC3 cells by reducing the expression of MDM4 in a certain way and then regulating the AR protein. The above studies suggest that miR-361-5p may regulate AR through multiple pathways, and its mechanism is very complex and needs to be further explored.\u003c/p\u003e \u003cp\u003eThe expression of AR and changes in its protein structure play a crucial role in the process of PCa castration-resistant in the development of drug resistance [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Therefore, it is particularly crucial to investigate in depth how miRNAs affect the expression of AR, especially its role in the process of PCa castration-resistant transformation. We further clarified the expression of miR-361-5p in prostate cancer castration-resistant transformation, and found that during castration-resistant induction in LNCAP cells, there was no significant difference in the expression of AR at the mRNA level, regardless of whether miR-361-5p was transfected or not, whereas at the AR protein level, prior to transfection with miR-361-5p, the AR expression showed a transient elevation followed by a decrease, this change in AR mRNA not parallel to protein suggests that the effect of miR-361-5p on AR proteins acts at the post-transcriptional level. \u0026Ouml;stling P et al [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] validated using the LMA technique in LNCAP and 22Rv1 cells to show that the majority of miRNAs inhibit the translational level of the AR and rarely play a role at the function at the transcriptional level. In addition to this, Qu, F et al [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] showed that overexpression of miR-185 decreased the expression of AR protein in LNCAP cells but did not inhibit its expression at the mRNA level. These findings are consistent with our results.\u003c/p\u003e \u003cp\u003eFletcher, C E et al [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] showed that inhibitors of miR-361-3p and miR-197 play a significant role in the regulation of AR. These inhibitors were able to significantly reduce the transcriptional activity of AR and decrease the ability of AR to regulate in the process of gene expression. At the same time, they were also effective in reducing the mRNA and protein levels of the AR, meaning that the AR was significantly inhibited in both quantity and function within the cell. Further studies also revealed that this inhibitory effect was not only limited to the AR itself, but also extended to a series of key biological processes in PCa cells. Specifically, by inhibiting AR, these miRNA inhibitors significantly suppressed the proliferation, migration, and invasive ability of PCa cells and promoted their apoptosis, thereby slowing down the progression of PCa, showing a superimposed effect of AR inhibition by miR-361-3p and miR-197. Enzalutamide-treated CRPC cells had elevated expression levels of both miR-361-3p and miR-197, suggesting that miR-361-3p and miR-197 may contribute to the progression of PCa denervation resistance by promoting or maintaining enzalutamide resistance to AR-targeted therapies. Larne O et al [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] demonstrated that miR-145 mediates the inhibition of AR and its downstream targets, including prostate-specific antigen (PSA), Kinase-related peptidase 2 peptidase 2 and TMPRSS2, suggesting that exogenous miR-145 may reduce AR expression in PCa to delay the onset of castration-resistant. Liu C et al [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] demonstrated that miR-185 could inhibit PCa by inhibiting AR expression through direct targeting of the AR-3\u0026rsquo;UTR, and these results have similarities with miR-361-5p that we studied, both revealing the important role of miRNAs in regulating AR expression and prostate cancer development. To further explore the function of miR-361-5p in prostate cancer, we further investigated the role played by miR-361-5p on the AR pathway during the induction of LNCAP into LNCAP-AI. We first transfected miR-361-5p into LNCAP cells and detected the expression level of AR on the seventh day of induction. Compared with the control group, although the trend was the same, the elevation of AR on the seventh day was significantly lower in the transfected group than in the untransfected group. This result suggests that miR-361-5p inhibited the dramatic elevation of AR in the early stage of castration-resistant transformation of LNCAP cells, then slowing down the transformation of prostate cancer cells to castration-resistant. When LNCAP cells were successfully induced to become LNCAP-AI, we observed that the expression levels of AR all returned to a lower level state, suggesting that progression to the advanced tumor stage may be accompanied by mutation of AR, which allows the cancer cells to ultimately progress to become AR-independent CRPCs. Therefore, we believe that miR-361-5p plays an important role in the early stage of castration-resistant transformation of prostate cancer which slows down the malignant transformation of prostate cancer cells by inhibiting AR expression, but for AR-independent CRPC. it is still necessary for us to further explore the related mechanisms and more effective therapeutic strategies.\u003c/p\u003e \u003cp\u003eIn conclusion, our results suggest that miR-361-5p can act as an oncogenic factor in prostate cancer, which can target AR thereby inhibiting the proliferation, migration and promoting apoptosis of prostate cancer cells, and hindering the process of castration-resistant transformation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCONFLICTS OF INTEREST\u003c/h2\u003e \u003cp\u003eThe authors declare that there are no conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eZ.P. andZ.M.Y wrote the manuscript,Y.X.andH.J. provided experimental assistance,L.Q.andZ.Z.G. provides a platform for experimentation,H.C.HandL.L.provided financial support,L.X.ZandL.D.CProvided topic design ideas and reviewed manuscriptsIn addition this, Dear Editor, I hope you will understand that I have to make a separate note here because I could not recognize the project names of the three funded authors in the system.\u003c/p\u003e\u003ch2\u003eACKNOWLEDGMENTS\u003c/h2\u003e \u003cp\u003eThis project was supported by the Xuzhou Introducing Clinical Medical Experts Team Project, (No. 2018TD004); The Fifth Phase of Jiangsu Province \"333 Project\" Funding Program in 2016 (No.2-BRA2017294); 2020 Xuzhou Clinical Technical Backbone Training Program Project, (No. 2020GG020). We would like to acknowledge the helpful comments on this paper received from our reviewers.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eSince this experiment was done by our team itself, the datasets generated and/or analyzed in this study are not publicly available, but are available from the corresponding author.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eWang L, Lu B, He M, et al. Prostate Cancer Incidence and Mortality: Global Status and Temporal Trends in 89 Countries From 2000 to 2019[J]. Front Public Health, 2022,10:811044.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHess-Busch Y, Hadaschik B, Hess J. M0CRPC overview of management options[J]. World J Urol, 2021,39(2):349\u0026ndash;356.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen C D, Welsbie D S, Tran C, et al. Molecular determinants of resistance to antiandrogen therapy[J]. Nat Med, 2004,10(1):33\u0026ndash;39.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatson P A, Arora V K, Sawyers C L. Emerging mechanisms of resistance to androgen receptor inhibitors in prostate cancer[J]. Nat Rev Cancer, 2015,15(12):701\u0026ndash;711.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMakino T, Izumi K, Mizokami A. Undesirable Status of Prostate Cancer Cells after Intensive Inhibition of AR Signaling: Post-AR Era of CRPC Treatment[J]. Biomedicines, 2021,9(4):414.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeon H Y, Pornour M, Ryu H, et al. SMAD3 promotes expression and activity of the androgen receptor in prostate cancer[J]. Nucleic Acids Res, 2023,51(6):2655\u0026ndash;2670.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W T, Han C, Sun Y M, et al. Noncoding RNAs in cancer therapy resistance and targeted drug development[J]. J Hematol Oncol, 2019,12(1):55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu D, Tao T, Xu B, et al. MiR-361-5p acts as a tumor suppressor in prostate cancer by targeting signal transducer and activator of transcription-6(STAT6)[J]. Biochem Biophys Res Commun, 2014,445(1):151\u0026ndash;156.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLing Z, Liu D, Zhang G, et al. miR-361-5p modulates metabolism and autophagy via the Sp1-mediated regulation of PKM2 in prostate cancer[J]. Oncol Rep, 2017,38(3):1621\u0026ndash;1628.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMenon A, Abd-Aziz N, Khalid K, et al. miRNA: A Promising Therapeutic Target in Cancer[J]. Int J Mol Sci, 2022,23(19):11502.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou X W, Sun X, Yu Y, et al. miR-361-5p suppresses lung cancer cell lines progression by targeting FOXM1[J]. Neoplasma, 2017,64(4):526\u0026ndash;534.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan J, Yu J, Dai Y, et al. Overexpression of miR-361-5p in triple-negative breast cancer (TNBC) inhibits migration and invasion by targeting RQCD1 and inhibiting the EGFR/PI3K/Akt pathway[J]. Bosn J Basic Med Sci, 2019,19(1):52\u0026ndash;59.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKe C, Shen M, Wang P, et al. ALDH1A3-Linc00284 Axis Mediates the Invasion of Colorectal Cancer by Targeting TGFbeta Signaling via Sponging miR-361-5p[J]. Int J Genomics, 2022,2022:6561047.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang W, Xie T. Hsa_circ_CSPP1/MiR-361-5p/ITGB1 Regulates Proliferation and Migration of Cervical Cancer (CC) by Modulating the PI3K-Akt Signaling Pathway[J]. Reprod Sci, 2020,27(1):132\u0026ndash;144.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLing J, He P. miR-361-5p regulates ovarian cancer cell proliferation and apoptosis by targeting TRAF3[J]. Exp Ther Med, 2021,21(3):199.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQian B, Zhang D, Tao R, et al. MiR-361-5p exerts tumor-suppressing functions in gastric carcinoma by targeting syndecan-binding protein[J]. Anticancer Drugs, 2020,31(2):131\u0026ndash;140.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu B, Lu B, Wang X, et al. MiR-361-5p inhibits cell proliferation and induces cell apoptosis in retinoblastoma by negatively regulating CLDN8[J]. Childs Nerv Syst, 2019,35(8):1303\u0026ndash;1311.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin S, Sun C, Li R, et al. The value of a three-microRNA panel in serum for prostate cancer screening[J]. Int J Biol Markers, 2024,39(1):70\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaihetia Azati, Liu Q, Wang YJ. lncRNA LINC00308 acts as a ceRNA to promote the proliferation and invasion of prostate cancer PC3 cells by regulating the miR-361-5p/TRIP13 axis[J]. Chinese Journal of Tumor Biotherapy, 2020,27(09):968\u0026ndash;977.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu P, Chen X, Xie R, et al. lncRNA HOXD-AS1 Regulates Proliferation and Chemo-Resistance of Castration-Resistant Prostate Cancer via Recruiting WDR5[J]. Mol Ther, 2017,25(8):1959\u0026ndash;1973.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Y, Zhao H, Chen Y, et al. Exosomal long noncoding RNA HOXD-AS1 promotes prostate cancer metastasis via miR-361-5p/FOXM1 axis[J]. Cell Death Dis, 2021,12(12):1129.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Yang J, Yu L, et al. miR-361-5p inhibits glioma migration and invasion by targeting SND1[J]. Onco Targets Ther, 2018,11:5239\u0026ndash;5252.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin X, Zhong J, Wang L, et al. LncRNA LNC-565686 Promotes Proliferation of Prostate Cancer by Inhibiting Apoptosis through Stabilizing SND1[J]. Biomedicines, 2023,11(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAshikari D, Takayama K I, Obinata D, et al. CLDN8, an androgen-regulated gene, promotes prostate cancer cell proliferation and migration[J]. Cancer Sci, 2017,108(7):1386\u0026ndash;1393.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Leva G, Croce C M. Roles of small RNAs in tumor formation[J]. Trends Mol Med, 2010,16(6):257\u0026ndash;267.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSikand K, Barik S, Shukla G C. MicroRNAs and Androgen Receptor 3' Untranslated Region: A Missing Link in Castration-resistant Prostate Cancer?[J]. Mol Cell Pharmacol, 2011,3(3):107\u0026ndash;113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOstling P, Leivonen S K, Aakula A, et al. Systematic analysis of microRNAs targeting the androgen receptor in prostate cancer cells[J]. Cancer Res, 2011,71(5):1956\u0026ndash;1967.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartens-Uzunova E S, Kusuma G D, Crucitta S, et al. Androgens alter the heterogeneity of small extracellular vesicles and the small RNA cargo in prostate cancer[J]. J Extracell Vesicles, 2021,10(10):e12136.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChopra H, Khan Z, Contreras J, et al. Activation of p53 and destabilization of androgen receptor by combinatorial inhibition of MDM2 and MDMX in prostate cancer cells[J]. Oncotarget, 2018,9(5):6270\u0026ndash;6281.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStegeman S, Moya L, Selth L A, et al. A genetic variant of MDM4 influences regulation by multiple microRNAs in prostate cancer[J]. Endocr Relat Cancer, 2015,22(2):265\u0026ndash;276.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao K, Li X, Ni J, et al. Non-coding RNAs in enzalutamide resistance of castration-resistant prostate cancer[J]. Cancer Lett, 2023,566:216247.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQu F, Cui X, Hong Y, et al. MicroRNA-185 suppresses proliferation, invasion, migration, and tumorigenicity of human prostate cancer cells through targeting androgen receptor[J]. Mol Cell Biochem, 2013,377(1\u0026ndash;2):121\u0026ndash;130.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFletcher C E, Sulpice E, Combe S, et al. Androgen receptor-modulatory microRNAs provide insight into therapy resistance and therapeutic targets in advanced prostate cancer[J]. Oncogene, 2019,38(28):5700\u0026ndash;5724.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLarne O, Hagman Z, Lilja H, et al. miR-145 suppress the androgen receptor in prostate cancer cells and correlates to prostate cancer prognosis[J]. Carcinogenesis, 2015,36(8):858\u0026ndash;866.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu C, Chen Z, Hu X, et al. MicroRNA-185 downregulates androgen receptor expression in the LNCAP prostate carcinoma cell line[J]. Mol Med Rep, 2015,11(6):4625\u0026ndash;4632.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"miR-361-5p, androgen receptor (AR), LNCAP, LNCAP-AI, prostate cancer, castration-resistant","lastPublishedDoi":"10.21203/rs.3.rs-4168315/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4168315/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eProstate cancer has become one of the most common tumors endangering men's health. At present, the main clinical treatments for prostate tumors are surgery, radiotherapy, endocrine therapy, chemotherapy, etc. However, due to drug resistance, the treatment effect of prostate cancer is not good, and the expression of androgen receptor (AR) and its protein structure changes play a crucial role in the resistance of prostate cancer. The expression of androgen receptor (AR) and changes in its protein structure play a crucial role in prostate cancer drug resistance. Non-coding RNAs, especially miRNAs, are involved in post-transcriptional regulation of genes and play an important role in the development of tumor cells, and may be used as specific substances to assist in the treatment of cancer. Our previous study showed that miR-361-5p expression was down-regulated in prostate cancer and that overexpression of miR-361-5p inhibited the proliferation, migration and promoted apoptosis of castration-resistant prostate cancer cells, DU145 and PC3, however, the mechanism through which miR-361-5p affects the progression of prostate cancer is unknown. We found that miR-361-5p could target binding to androgen receptor (AR) and play a role in the transformation of hormone-sensitive prostate cancer cells (LNCAP) to castration-resistant prostate cancer cells (LNCAP-AI), which inhibited proliferation, migration and promoted apoptosis of prostate cancer cells. Therefore, we suggest that miR-361-5p can target AR and inhibit the rapid growth of AR in the early stage of transformation, thus inhibiting the transformation of prostate cancer cells to castration-resistant.\u003c/p\u003e","manuscriptTitle":"Study on the mechanism of miR-361-5p regulation of androgen receptor in castration-resistant transformation of prostate cancer","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-19 19:05:20","doi":"10.21203/rs.3.rs-4168315/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d810c4fd-5e7f-4abb-979c-fe8647a745b1","owner":[],"postedDate":"April 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":30738999,"name":"Biological sciences/Cancer"},{"id":30739000,"name":"Biological sciences/Cell biology"},{"id":30739001,"name":"Health sciences/Oncology"},{"id":30739002,"name":"Health sciences/Urology"}],"tags":[],"updatedAt":"2024-06-03T04:59:57+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-19 19:05:20","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4168315","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4168315","identity":"rs-4168315","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00