Efficacy of 14-day vonoprazan-amoxicillin dual therapy compared to esomeprazole-amoxicillin dual therapy for eradication of Helicobacter pylori in treatment-naïve patients

preprint OA: closed
Full text JSON View at publisher

Abstract

Objective: This study was a multicenter, randomized controlled trial that compared the therapeutic efficacies of vonoprazan-amoxicillin (VA) and esomeprazole-amoxicillin (EA) dual therapies for Helicobacter pylori infection in China. Methods: : A total of 236 patients were randomized to receive either VA dual therapy (vonoprazan 20 mg bid, amoxicillin 1 g tid, 14 days) or EA dual therapy (esomeprazole 20 mg qid, amoxicillin 750 mg qid, 14 days). The success of eradication was assessed using a 13C urea breath test after 4-6 weeks. The study assessed H. pylori eradication rates, incidence of adverse reactions, patient compliance, antibiotic resistance rates, and CYP2C19 gene polymorphisms. Results: : Both the intention-to-treat (ITT) analysis and the per-protocol (PP) analysis demonstrated that the eradication rate by the VA group (ITT:96.61%, 95%CI 93.34–99.88%; PP:98.26%, 95% CI 95.87–100.00%)was not inferior to that of the EA group (ITT:93.22%,88.68-97.76%; PP:93.10%, 95% CI 90.80-98.86%) with the one-sided P < 0.0001 for both. The incidence of adverse reactions was 11.30% and 13.79% for the two groups ( P =0.568), and compliance rates were 97.46% and 98.3% for the VA and EA groups, respectively, with both exceeding 95% ( P = 1.000). Compliance was identified as an independent risk factor for H. pylori eradication ( P = 0.002). Conclusions: : The 14-day VA and EA dual therapies have comparable efficacies and safeties, and both are recommended as first-line treatment for an H. pylori infection.
Full text 121,916 characters · extracted from preprint-html · click to expand
Efficacy of 14-day vonoprazan-amoxicillin dual therapy compared to esomeprazole-amoxicillin dual therapy for eradication of Helicobacter pylori in treatment-naïve patients | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Efficacy of 14-day vonoprazan-amoxicillin dual therapy compared to esomeprazole-amoxicillin dual therapy for eradication of Helicobacter pylori in treatment-naïve patients Rui Wang, Feng Xian, Jian-ru Zhu, Jian Peng, Ding-jian Wu, Feng Zhang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3345317/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective: This study was a multicenter, randomized controlled trial that compared the therapeutic efficacies of vonoprazan-amoxicillin (VA) and esomeprazole-amoxicillin (EA) dual therapies for Helicobacter pylori infection in China. Methods: A total of 236 patients were randomized to receive either VA dual therapy (vonoprazan 20 mg bid, amoxicillin 1 g tid, 14 days) or EA dual therapy (esomeprazole 20 mg qid, amoxicillin 750 mg qid, 14 days). The success of eradication was assessed using a 13C urea breath test after 4-6 weeks. The study assessed H. pylori eradication rates, incidence of adverse reactions, patient compliance, antibiotic resistance rates, and CYP2C19 gene polymorphisms. Results: Both the intention-to-treat (ITT) analysis and the per-protocol (PP) analysis demonstrated that the eradication rate by the VA group (ITT:96.61%, 95%CI 93.34–99.88%; PP:98.26%, 95% CI 95.87–100.00%)was not inferior to that of the EA group (ITT:93.22%,88.68-97.76%; PP:93.10%, 95% CI 90.80-98.86%) with the one-sided P < 0.0001 for both. The incidence of adverse reactions was 11.30% and 13.79% for the two groups ( P =0.568), and compliance rates were 97.46% and 98.3% for the VA and EA groups, respectively, with both exceeding 95% ( P = 1.000). Compliance was identified as an independent risk factor for H. pylori eradication ( P = 0.002). Conclusions: The 14-day VA and EA dual therapies have comparable efficacies and safeties, and both are recommended as first-line treatment for an H. pylori infection. Helicobacter pylori vonoprazan amoxicillin bacterial infection patient compliance breath tests Figures Figure 1 Introduction Approximately 50% of the world's population is infected with Helicobacter pylori , and in China the infected population is estimated to be around 768 million [ 1 ]. H. pylori infection is a major cause of various gastric diseases, including gastric cancer, and eradicating H. pylori is widely accepted as a crucial preventive approach for gastric cancer [ 2 – 4 ]. H. pylori treatments are facing challenges due to increasing antibiotic resistance and decreasing eradication rates. Triple therapy is no longer recommended as a first-line treatment. The Maastricht VI Consensus, Toronto Consensus, and the Sixth China Consensus on H. pylori Infections Management recommend 14-day bismuth quadruple therapy as the first-line treatment or empirical treatment for patients living in countries with a clarithromycin resistance rate above 15% [ 3 , 4 ]. However, bismuth quadruple therapy has limitations, including difficulties in accessing drugs such as bismuth, tetracycline, and furazolidone in certain regions, multiple medications for patients to take, and poor compliance. If quadruple therapy fails, it may lead to increased secondary antibiotic resistance, which limits the choice of antibiotics for rescue therapy. The high-dose proton pump inhibitor (PPI)-amoxicillin dual therapy has gained attention due to its simplicity, ease of accessibility, and low resistance rates. In this regimen, a PPI and amoxicillin are administered 3–4 times daily to ensure a gastric pH > 6 and a sufficient concentration of amoxicillin in the blood above the minimum inhibitory concentration (MIC) values to maximize its bactericidal effect. In recent years, several studies in Asia have demonstrated the effectiveness and safety of this regimen. For instance, Yang et al. achieved eradication rates of 95.3% (intention-to-treat; ITT) and 96.6% (per-protocol; PP) using a 14-day regimen of rabeprazole (20 mg, qid) and amoxicillin (750 mg, qid) [ 5 ]. Zhou et al. reported eradication rates of 87.1% (ITT) and 92.4% (PP) with a 14-day regimen of esomeprazole (20 mg, qid) and amoxicillin (750 mg, qid), which had a lower incidence of adverse reactions compared to bismuth therapy [ 6 ]. However, the efficacy of PPI-amoxicillin therapy in Western studies has not always been satisfactory. This may be attributed to the genotype of the predominant metabolic pathway for most PPIs, cytochrome P450 2C19 (CYP2C19). Approximately 70% of individuals in Western countries possess the CYP2C19 genotype associated with extensive metabolism (EM), which renders achieving an eradication rate of 90% challenging. As a new generation of acid-suppressing drugs, potassium-competitive acid blockers (P-CAB) overcome the limitations of PPIs. Vonoprazan (VPZ) is the first clinically available P-CAB [ 7 ]. Compared to PPIs, VPZ has a stronger and faster acid-inhibitory effect with a longer duration, and it is not affected by CYP2C19 gene polymorphisms [ 8 ]. As such, replacing the acid suppressant in eradication regimens with VPZ could provide a more sustained and stable intragastric pH for antibiotic efficacy. Recent meta-analyses have shown that VPZ-based triple therapy demonstrates higher efficacy in eradicating clarithromycin-resistant H. pylori compared to PPI-based triple therapy, with no significant differences in adverse effects or compliance [ 9 , 10 ]. These data also suggest a promising application of VPZ in dual therapy regimens. To provide evidence-based medicine for clinical management, the current multicenter, randomized controlled study was conducted to compare VPZ-amoxicillin (VA) dual therapy with esomeprazole-amoxicillin (EA) dual therapy as first-line treatments for H. pylori infection in treatment naïve patients. The study aimed to evaluate the efficacy, adverse reactions, and compliance of VA dual therapy, thereby contributing to the understanding of its clinical application. Methods Patient information and study design This study was designed as a non-inferiority trial. The sample size was assessed based on the results of previous randomized controlled trials with a reference eradication rate of 90% for PPI-based dual therapy. It was expected that the eradication rate for the VA regimen would also be 90%. The non-inferiority margin (delta, Δ) was set at -0.10 (-10%), with a power (1-β) of 80% and a one-sided alpha (α) of 0.025. Assuming the dropout rate would not exceed 10%, a total of 236 participants were included, with each group consisting of 118 participants. The trial was conducted from June 2022 to April 2023 in three hospitals: the No.945 Hospital of the Joint Logistics Support Force of Chinese PLA, Chongqing Daping Hospital, and the People's Hospital of Hanyuan County (Ya'an, Sichuan Province). The study protocol was reviewed and approved by the Ethics Committee of the No.945 Hospital of the Joint Logistics Support Force of Chinese PLA. This clinical trial was registered with the China Clinical Trials Registry (www.chictr.org.cn) under registration number ChiCTR2300069762. All participants provided written informed consent, and the study was conducted in accordance with the Declaration of Helsinki and other relevant regulations. The inclusion criteria consisted of: (1) age between 18 and 70 years; (2) confirmed chronic gastritis by gastroscopy, with or without healed gastric or duodenal ulcers; (3) positive results of the Rapid Urease Test, urea breath test (UBT), and H. pylori culture; and (4) no prior history of H. pylori eradication therapy. The exclusion criteria were: (1) allergy to any medications used in this study; (2) use of PPIs, histamine H2-receptor antagonists, antibiotics, bismuth compounds, or probiotics within 4 weeks prior to treatment; (3) concurrent use of corticosteroids, nonsteroidal anti-inflammatory drugs (NSAIDs), anticoagulants, or alcohol abuse; (4) presence of diseases that could potentially interfere with the evaluation of the study treatment, such as severe liver disease, cardiovascular disease, pulmonary disease, renal disease, mental illness, or malignancy; (5) pregnancy or breastfeeding, or planning to conceive during the study period; (6) history of esophageal or gastric surgery; (7) participation in other clinical studies within the past 3 months prior to participation in this study; and (8) able to provide signed informed consent. Detailed information regarding patient selection and study design was presented in Figure 1. Treatments and follow-up In this open-label study, 236 participants were randomly allocated at a 1:1 ratio into the trial group (VA group) and the control group (EA group), and received the following treatment regimens for 14 days: VA Group: VPZ (Takeda Pharmaceutical Co. Ltd., Tianjin, China) 20 mg bid, and amoxicillin (Kunming Beck Norton Pharmaceutical Co. Ltd., Kunming, China) 1g tid, both taken 30 minutes after meals. EZ Group: esomeprazole (AstraZeneca China, Shanghai, China) 20 mg qid, taken before three meals and 30 minutes before bedtime, and amoxicillin (Kunming Beck Norton Pharmaceutical Co. Ltd., Kunming, China) 750 mg qid, taken after meals and 30 minutes before bedtime. The randomization list was generated by a computer using a 1:1 ratio (SAS software). All participants received education on medication administration and potential adverse reactions before starting the treatment. Patients were provided with medication diaries and instructed to record their medication intake and any adverse reactions experienced. Adverse reactions were categorized as "mild" (discomfort without impacting daily life and work), "moderate" (discomfort partially interfering with daily life and work), and "severe " (discomfort severely interference with daily life and work). Good compliance was defined as taking more than 80% of the total medications prescribed. The primary outcome measured in this study was the H. pylori eradication rate in both groups, which was evaluated using the 13C-UBT. Patients returned to the gastroenterology outpatient departments of the participating hospitals 4–6 weeks after completing the treatment to assess the success of H. pylori eradication. During the 13C-UBT, each patient ingested a capsule containing 75 mg of 13C-urea (Beijing Boran Pharmaceutical Co. Ltd, Beijing, China). Breath samples were collected at baseline and 30 minutes after medication intake, and the samples were analyzed using a 13C infrared spectrometer (HY-IREXBplus, Guangzhou Richen-Frinse Electromechanical Science and Technology Co. Ltd, Guangzhou, China). The results were analyzed and generated using integrated software. H. pylori eradication was defined as a detection value below the cut-off of 4%. The secondary outcome measures included the incidence of adverse events, patient compliance, antibiotic resistance rates, and risk factors affecting the eradication rates in both groups. Drug susceptibility test Drug susceptibility testing of H. pylori isolates was performed using the agar dilution method as described previously [11]. Briefly, different concentrations of antibiotic solutions were selected and added to the agar medium. Growth of the H. pylori strain on the selected antibiotic indicated drug resistance, while no growth was considered drug susceptible. According to the US Clinical and Laboratory Standards Institute guidelines, the standard strain ATCC 43504 (NCTC11637 H. pylori strain) was used as a control. Minimum inhibitory concentrations (MICs) of antibiotics greater than 1 μg/mL for clarithromycin, 2 μg/mL for amoxicillin, 2 μg/mL for levofloxacin, 2 μg/mL for furazolidone, 2 μg/mL for tetracycline, and 8 μg/mL for metronidazole were defined as resistance. CYP2C19 gene polymorphism CYP2C19 gene polymorphisms were evaluated using the method provided previously [11]. In brief, DNA was extracted from the gastric mucosal tissue of participants using a TIANamp Genomic DNA kit (TIANGEN). Primers (listed in Table 1) were used to amplify products through a polymerase chain reaction (PCR) assay, and the products were subjected to CYP2C19 sequencing. Forward primers were used to sequence CYP2C19*2 amplification products and reverse primers for *3 sequencing. The Sequencing Analysis Software (Version 5.2) was used for CYP2C19 polymorphism analysis. Based on the CYP2C19 genotype, participants were classified into four groups: extensive metabolizers (UM, *17/*17, *1/*17), rapid metabolizers (RM, *1/*1), intermediate metabolizers (IM, *1/*2, *1/*3, *2/*17, *3/*17) or poor metabolizers (PM, *2/*2, *2/*3, *3/*3). Table 1. Sequences of CYP2C19 gene polymorphism primers Primer name Primer sequences (5’-3’) Amplification length CPY2C19*2F GCAGGTATAAGTCTAGGAAATG 381 CPY2C19*2R TAAAGTCCCGAGGGTTGTTG CPY2C19*3F CACCCTGTGATCCCACTTTC 375 CPY2C19*3R CTAATGGGCTTAGAAGCCTG Statistical analysis The ITT and PP analyses were used to assess eradication rates in both groups. The ITT analysis included all randomized participants, while those without follow-up results from the 13C-UBT test were considered treatment failures. Participants with poor compliance were excluded from the PP analysis. T-tests, chi-square tests, or Fisher's exact tests were used to assess differences between the two groups for continuous and categorical variables. Statistical differences were considered when P < 0.05 (two-sided). For H. pylori eradication rates, a non-inferiority test was conducted to compare the two groups. The non-inferiority was assessed by evaluating the hypothesis test (one-sided μ-test) and deriving the lower bound of the one-sided 95% confidence interval to compare non-inferiority between the groups. If P < 0.025 and the lower bound of the 95% confidence interval for the difference in eradication rates was higher than -10%, it could be concluded that non-inferiority was demonstrated. Logistic regression analysis was performed to assess the impact of relevant factors on the eradication rate. Statistical software packages such as SAS 9.4 (SAS Institute Inc.) and SPSS version 26.0 (IBM) were used for data analysis. Results Patient information and baselines Between June 2022 and April 2023, a total of 301 participants underwent eligibility assessment. Among them, 66 patients were excluded due to not meeting the inclusion criteria (n = 36) or refusal to participate (n = 30). Finally, 236 patients were randomly assigned to the VA and EA groups and were included in the ITT analysis. Amongst these patients, three in the VA group and two in the EA group had compliance rates less than 80% and were excluded. Therefore, a total of 231 participants were included in the PP analysis. Aside from gender and smoking, there were no statistically significant differences in other baseline characteristics between the two groups (Table 2 ). Table 2 Baseline demographics and clinical characteristics of the study subjects VA group (n = 118) EA group (n = 118) P value Sex 0.000 Male 60 (50.8) 105 (89.0) Female 58 (49.2) 13 (11.0) Age (x ± SD) 35.6 ± 12.4 35.9 ± 11.4 0.682 Age, n (%) 0.757 < 60 112 (94.9) 113 (95.8) ≥ 60 6 (5.1) 5 (4.2) BMI (x ± s, kg/m 2 ) 22.1 ± 2.3 22.4 ± 2.5 0.381 Cigarette smoking, n (%) 36 (30.5) 61 (51.7) 0.001 Alcohol drinking, n (%) 51 (43.2) 60 (50.9) 0.24 Education status, n (%) 0.193 High school or less 63 (54.2) 53 (45.8) College or more 54 (45.8) 64 (54.2) Housing size, n (%) 0.582 > 60 6 8 ≤ 60 112 110 Style of dining, n (%) 0.693 Gather dining 66 (56.0) 69 (58.5) Individual dining 52 (44.0) 49 (41.5) Family history of gastric carcinoma, n (%) 5 (4.2) 7 (5.9) 0.553 CYP2C19, n (%) 0.351 Poor metabolizer 11 (9.3) 8 (6.8) Intermediate met. 57 (48.3) 53 (44.9) Rapid met. 48 (40.7) 54 (45.7) Extensive met. 2 (1.7) 3 (2.5) Antibiotic resistance, n (%) Clarithromycin 30 (25.42) 30 (25.42) 1.000 Amoxicillin 0 0 NA Metronidazole 88 (75.58) 86 (72.88) 0.767 Furazolidone 0 0 NA Tetracycline 0 0 NA Levofloxacin 28 (23.73) 26 (22.03) 0.757 Abbreviations: VA, vonoprazan-amoxicillin; EA, esomeprazole-amoxicillin; BMI, body mass index; NA, not applicable. Comparing VA and EA dual therapy for H. pylori eradication ITT and PP were used to compare the eradication rates of the VA and EA groups. In the ITT analysis, the eradication rates for the VA and EA groups were 96.61% (114/118; 95% confidence interval [CI] 93.34–99.88%) and 93.22% (110/118; 95% CI 88.68–97.76%), respectively. In the PP analysis, the eradication rates for the VA and EA groups were 98.26% (113/115; 95% CI 95.87–100.00%) and 93.10% (108/116; 95% CI 90.80–98.86%), respectively. The difference in eradication rates between the two groups was not statistically significant (ITT, P = 0.236; and PP, P = 0.109). In both the ITT and PP analysis sets, the VA group met the non-inferiority criteria compared to the EA group. The null hypothesis that the VA group is inferior to the EA group was rejected (one-sided P < 0.0001 for both ITT and PP analyses). For the ITT and PP analysis sets, the 95% CIs for the differences in eradication rates between the two groups were 3.39% (-2.2%, 8.98%) and 5.16% (-1.22%, 8.27%), respectively, with the lower bounds of both intervals (-2.2%, -1.22%) being greater than the predefined non-inferiority margin. (See Table 3 ). Table 3 Eradication rates of VA dual therapy compared with EA dual therapy VA group EA group Difference from dual group (adjusted 95% CI for difference) P value for non-inferiority a P value for difference b ITT 96.61% (114/118) 93.22% (110/118) 3.39% < 0.0001 0.236 95%CI 93.34–99.88% 88.68–97.76% -2.2-8.98% PP 98.26% (113/115) 93.10% (108/116) 5.16% < 0.0001 0.109 95%CI 95.87–100.00% 90.80-98.86% -1.22-8.27% CI, confidence interval; ITT, intention-to-treat; PP, per-protocol. a The P values were obtained from one-sided test comparisons of noninferiority between the VA group and the EA group. b The P values were from two-sided comparisons of differences between the VA therapy group and the EA group. Adverse events and compliance rates in VA and EA groups The overall incidence of adverse events in the VA group was 11.3% (13/115), and in the EA groups was 13.79% (16/116), with no significant difference between the two groups (P = 0.568). The most common adverse events were nausea, vomiting, and diarrhea. Except for one participant in the EA group who received anti-allergy medication for a rash, no treatment was required for other adverse events, and no hospitalizations were reported. The compliance rates were 97.46% and 98.3% in the VA and EA groups, respectively, with no statistical difference between the two groups ( P = 1.000; Table 4 ). Table 4 Drug-induced adverse events and patient compliance to VA dual therapy compared with EA dual therapy Adverse events VA group EA group P value Total incidence 11.30% (13/115) 13.79% (16/116) 0.568 Nausea, vomiting 3.48% (4/115) 1.72% (2/116) 0.446 Diarrhea 1.74% (2/115) 4.31% (5/116) 0.446 Epigastric discomfort 0.87% (1/115) 0.86% (1/116) 1.000 Dizziness 2.61% (3/115) 0.86% (1/116) 0.370 Taste distortion 0% (0/115) 1.72% (2/116) 0.498 Skin rash 0% (0/115) 0.86% (1/116) 1.000 Darkened stool 0.87% (1/115) 0.86% (1/116) 1.000 Constipation 0% (0/115) 0.86% (1/116) 1.000 Reduced appetite 0% (0/115) 1.72% (2/116) 0.498 Others 1.74% (2/115) 0% (0/116) 0.247 Compliance a 97.46% (115/118) 98.3% (116/118) 1.000 a Compliance was indicative of patients who took at least 80% of total medications. Antibiotic resistance rates Among all participants, the resistance rates were 25.42% (60/236) for clarithromycin, 22.88% (54/236) for levofloxacin, and 73.72% (174/236) for metronidazole. The resistance rates for amoxicillin, furazolidone, and tetracycline were all 0%. The dual resistance results were 20.76% (49/239) for metronidazole-levofloxacin, 10.17% (24/236) for clarithromycin-levofloxacin, and 23.31% (55/236) for clarithromycin-metronidazole. The triple resistance rate of clarithromycin-metronidazole-levofloxacin was 9.32% (22/236). There was no statistically significant difference in antibiotic resistance rates between the two groups (Table 2 ). Factors affecting eradication rates Univariate analysis indicated that body mass index (BMI), compliance, atrophy, treatment regimen, gastric cancer, and family history of gastric cancer may be influencing factors for H. pylori eradication. Multivariate analysis using logistic regression with all variables identified compliance and family history of gastric cancer as independent risk factors for H. pylori eradication ( P = 0.002 and P = 0.003, respectively; Table 5 ). Table 5 Factors affecting eradication of H. pylori infection in VA dual therapy compared with EA dual therapy Single factor analysis OR value (95%CI) P value Multiple factor analysis OR value (95%CI) P value Sex 3.506 (0.685–17.943) 0.132 Male vs. Female Age, years 0.952 (0.184–4.930) 0.953 ≥ 45, < 45 BMI, kg/m 2 0.808 (0.644–1.014) 0.066 ≥ 23, < 23 Alcohol drinking 1.601 (0.325–7.879) 0.563 Yes vs. No Cigarette smoking 0.490 (0.078–3.088) 0.448 Yes vs. No Compliance 34.098 (3.555–327.031) 0.002 20.190 (2.898–140.664) 0.002 Good vs. Poor CYP2C19 0.734 (0.186–2.896) 0.658 Rapid & Extensive vs. Poor & Intermediate Atrophy 1.025 (0.134–7.831) 0.981 Yes vs No VA vs EA 4.898 (0.928–25.854) 0.061 Family history of gastric carcinoma 12.424 (2.291–67.385) 0.003 10.095 (0.234–45.609) 0.003 Yes vs No Discussion The results of this study showed that both VA and EA dual therapy regimens achieve eradication rates of over 93% in treatment-naïve H. pylori patients, with VA reaching excellent eradication rates of more than 95%. Additionally, both regimens have low incidences of adverse reactions, with rates of 11.3% and 13.79%, respectively, and compliance rates exceeding 97%. This indicates that dual therapy can be used as a first-line treatment of H. pylori in China. The difference between these two regimens lies in the choice of acid suppression drug, esomeprazole or VPZ. The former is a PPI and the latter is a P-CAB, but both target the H + -K + -ATPase [ 12 ]. PPIs have been used clinically for over 30 years. They are prodrugs that require acid activation, and therefore need to be taken before meals, which may affect compliance for some patients. Moreover, PPIs only inhibit activated proton pumps, and once the activated pumps are depleted, the reactivation of resting pumps is required for further acid suppression. They have a short half-life and take a relatively long time to be effective, typically 3–5 days of oral administration to achieve stable inhibition of gastric acid secretion [ 13 ]. Furthermore, PPIs are metabolized by CYP2C19, and due to genetic polymorphisms in the gene encoding this enzyme, there can be significant variations in individual responses [ 14 ]. A high percentage of Caucasians (72.6%) are CYP2C19 rapid metabolizers [ 15 ], so most are unable to achieve satisfactory acid suppressive effects, which affects the efficacy of H. pylori treatments. Graham et al . reported that the dual PPI-amoxicillin regimen in the United States had an eradication rate of only 72% (esomeprazole 40 mg, TID, and amoxicillin 750 mg, tid, for 14 days) [ 16 ], which was significantly lower than the > 90% eradication rates of primary H. pylori in Asia [ 11 , 17 ]. P-CAB was launched in Japan in 2015 and has the characteristics of strong acid inhibition, rapid onset of action, acts on both active and resting state proton pumps, long duration of action, and not affected by CYP2C19 gene polymorphisms [ 18 ]. Therefore, P-CAB is recommended by both the Maastricht VI/Florence consensus report and the Sixth Chinese Consensus on the Management of H. pylori Infections as an optional drug for H. pylori treatment [ 3 , 4 ]. The current study showed that a 14-day VA dual therapy could achieve eradication rates of 96.61% (ITT analysis) and 98.26% (PP analysis). In 2019, a retrospective study also showed that a 7-day VA dual therapy (vonoprazan 20 mg bid, amoxicillin 500 mg tid) could achieve an eradication rate of 94.4% (PP analysis) [ 18 ]. Moreover, recent evidence revealed an eradication rate > 90% with a 10-day VA regimen (vonoprazan 20 mg bid + amoxicillin 750 mg qid) [ 19 ]. However, it is important to note that all the aforementioned studies were conducted in Asia, and additional data are required to confirm whether VA dual therapy could achieve similarly high eradication rates in other regions. Failure to eradicate H. pylori is mainly associated with antibiotic resistance. The population in this study showed high resistance rates, including 83.33% for metronidazole, 25% for clarithromycin, and 33.33% for levofloxacin. However, there was no resistance to amoxicillin, tetracycline, or furazolidone, which is an important factor contributing to the high eradication rates achieved with both dual therapy regimens assessed in this study. Meanwhile, the incidence rates of adverse reactions in the VA and EA groups were 11.3% and 13.79%, respectively, which was lower than that of the quadruple regimen and consistent with domestic and international reports. Song et al . reported an adverse events rate of 17.6% in the PPI-amoxicillin dual regimen and 25.5% in the bismuth-containing quadruple regimen (PPI + bismuth + amoxicillin + clarithromycin, 14 days) [ 20 ]. Researchers in Taiwan reported that the incidence of adverse events with PPI-amoxicillin dual therapy was significantly lower than with non-bismuth quadruple therapy (PPI + amoxicillin + clarithromycin + metronidazole, 14 days) (9.6% vs. 22.8%) [ 6 ]. Our previous study also confirmed that the incidence of adverse events during treatment was significantly lower with vonoprazan dual therapy compared to bismuth-containing quadruple therapy (PPI + bismuth + amoxicillin + metronidazole, 14 days) (16.67% vs. 38.04%) [ 21 ]. It is important to note that this study has limitations, including a lack of comparison between VA dual therapy and EA dual therapy on the gut microbiota, and the need for further study on different treatment durations, as other trials have performed [ 20 , 22 ]. Therefore, studies using different courses of treatment are still needed. However, the current study demonstrates the equivalent efficacy and safety of 14-day VA dual therapy and EA therapy for the treatment of H. pylori . Based on its simpler administration and independence from CYP2C19 gene polymorphisms, VA dual therapy holds promise as a first-line clinical treatment for H. pylori . Declarations Funding Sources This work was supported by the National Science Foundation of China (No. 82072253) and the Key Project of Hospital Management of the 945th Hospital of the Joint Service Support Force of the PLA(No.2022945YG-A04-01). Declaration of interests The authors have declared that no competing interests exist. References Hooi JKY, Lai WY, Ng WK, Suen MMY, Underwood FE, Tanyingoh D, Malfertheiner P, Graham DY, Wong VWS, Wu JCY et al: Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis. Gastroenterology 2017, 153(2):420-429. Sugano K, Tack J, Kuipers EJ, Graham DY, El-Omar EM, Miura S, Haruma K, Asaka M, Uemura N, Malfertheiner P et al: Kyoto global consensus report on Helicobacter pylori gastritis. Gut 2015, 64(9):1353-1367. Malfertheiner P, Megraud F, Rokkas T, Gisbert JP, Liou JM, Schulz C, Gasbarrini A, Hunt RH, Leja M, O'Morain C et al: Management of Helicobacter pylori infection: the Maastricht VI/Florence consensus report. Gut 2022. Group HpS, Gastroenterology CSo, Association CM: Sixth Chinese National Consensus Report on the management of Helicobacter Pylori Infection (treatment excluded). Chin J Dig 2022, 42(5):15. Yang JC, Lin CJ, Wang HL, Chen JD, Kao JY, Shun CT, Lu CW, Lin BR, Shieh MJ, Chang MC et al: High-dose dual therapy is superior to standard first-line or rescue therapy for Helicobacter pylori infection. Clin Gastroenterol Hepatol 2015, 13(5):895-905 e895. Song Z, Zhou L, Xue Y, Suo B, Tian X, Niu Z: A comparative study of 14-day dual therapy (esomeprazole and amoxicillin four times daily) and triple plus bismuth therapy for first-line Helicobacter pylori infection eradication: A randomized trial. Helicobacter 2020, 25(6):e12762. Inatomi N, Matsukawa J, Sakurai Y, Otake K: Potassium-competitive acid blockers: Advanced therapeutic option for acid-related diseases. Pharmacol Ther 2016, 168:12-22. Hu Y, Zhu Y, Lu NH: Recent progress in Helicobacter pylori treatment. Chin Med J (Engl) 2020, 133(3):335-343. Jung YS, Kim EH, Park CH: Systematic review with meta-analysis: the efficacy of vonoprazan-based triple therapy on Helicobacter pylori eradication. Aliment Pharmacol Ther 2017, 46(2):106-114. Li M, Oshima T, Horikawa T, Tozawa K, Tomita T, Fukui H, Watari J, Miwa H: Systematic review with meta-analysis: Vonoprazan, a potent acid blocker, is superior to proton-pump inhibitors for eradication of clarithromycin-resistant strains of Helicobacter pylori. Helicobacter 2018, 23(4):e12495. Yang J, Zhang Y, Fan L, Zhu YJ, Wang TY, Wang XW, Chen DF, Lan CH: Eradication Efficacy of Modified Dual Therapy Compared with Bismuth-Containing Quadruple Therapy as a First-Line Treatment of Helicobacter pylori. Am J Gastroenterol 2019, 114(3):437-445. Sachs G, Shin JM, Hunt R: Novel approaches to inhibition of gastric acid secretion. Curr Gastroenterol Rep 2010, 12(6):437-447. Scarpignato C, Hongo M, Wu JCY, Lottrup C, Lazarescu A, Stein E, Hunt RH: Pharmacologic treatment of GERD: Where we are now, and where are we going? Ann N Y Acad Sci 2020, 1482(1):193-212. Huang CC, Chen YC, Leu HB, Chen TJ, Lin SJ, Chan WL, Chen JW: Risk of adverse outcomes in Taiwan associated with concomitant use of clopidogrel and proton pump inhibitors in patients who received percutaneous coronary intervention. Am J Cardiol 2010, 105(12):1705-1709. Bertilsson L, Lou YQ, Du YL, Liu Y, Kuang TY, Liao XM, Wang KY, Reviriego J, Iselius L, Sjoqvist F: Pronounced differences between native Chinese and Swedish populations in the polymorphic hydroxylations of debrisoquin and S-mephenytoin. Clin Pharmacol Ther 1992, 51(4):388-397. Graham DY, Javed SU, Keihanian S, Abudayyeh S, Opekun AR: Dual proton pump inhibitor plus amoxicillin as an empiric anti-H. pylori therapy: studies from the United States. J Gastroenterol 2010, 45(8):816-820. Tai WC, Liang CM, Kuo CM, Huang PY, Wu CK, Yang SC, Kuo YH, Lin MT, Lee CH, Hsu CN et al: A 14 day esomeprazole- and amoxicillin-containing high-dose dual therapy regimen achieves a high eradication rate as first-line anti-Helicobacter pylori treatment in Taiwan: a prospective randomized trial. J Antimicrob Chemother 2019, 74(6):1718-1724. Akazawa Y, Fukuda D, Fukuda Y: Vonoprazan-based therapy for Helicobacter pylori eradication: experience and clinical evidence. Therap Adv Gastroenterol 2016, 9(6):845-852. Furuta T, Yamade M, Kagami T, Uotani T, Suzuki T, Higuchi T, Tani S, Hamaya Y, Iwaizumi M, Miyajima H et al: Dual Therapy with Vonoprazan and Amoxicillin Is as Effective as Triple Therapy with Vonoprazan, Amoxicillin and Clarithromycin for Eradication of Helicobacter pylori. Digestion 2020, 101(6):743-751. Qian HS, Li WJ, Dang YN, Li LR, Xu XB, Yuan L, Zhang WF, Yang Z, Gao X, Zhang M et al: Ten-Day Vonoprazan-Amoxicillin Dual Therapy as a First-Line Treatment of Helicobacter pylori Infection Compared With Bismuth-Containing Quadruple Therapy. Am J Gastroenterol 2023, 118(4):627-634. Hu J, Mei H, Su NY, Sun WJ, Zhang DK, Fan LL, He P, Pan J, Wang XW, Zou PY et al: Eradication rates of Helicobacter pylori in treatment-naive patients following 14-day vonoprazan-amoxicillin dual therapy: A multicenter randomized controlled trial in China. Helicobacter 2023:e12970. Hu Y, Xu X, Ouyang YB, He C, Li NS, Xie C, Peng C, Zhu ZH, Xie Y, Shu X et al: Optimization of vonoprazan-amoxicillin dual therapy for eradicating Helicobacter pyloriinfection in China: A prospective, randomized clinical pilot study. Helicobacter 2022, 27(4):e12896. Additional Declarations Competing interest reported. The authors have declared that no competing interests exist. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3345317","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":232318249,"identity":"84beb600-080e-44e1-98a7-deaeef7e7696","order_by":0,"name":"Rui Wang","email":"","orcid":"","institution":"The 945th Hospital of the Joint Service Support Force of the PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Wang","suffix":""},{"id":232318250,"identity":"cf792bac-c30a-4ed9-a8f4-3349cd1a50e0","order_by":1,"name":"Feng Xian","email":"","orcid":"","institution":"The 945th Hospital of the Joint Service Support Force of the PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Xian","suffix":""},{"id":232318251,"identity":"399a2b1b-6011-4b66-a30b-cfd8b13998f2","order_by":2,"name":"Jian-ru Zhu","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jian-ru","middleName":"","lastName":"Zhu","suffix":""},{"id":232318252,"identity":"61699fe0-f2be-4614-8354-3c6748183746","order_by":3,"name":"Jian Peng","email":"","orcid":"","institution":"The 945th Hospital of the Joint Service Support Force of the PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Peng","suffix":""},{"id":232318253,"identity":"a15bea7d-87a3-4f3f-8dd2-66d508011e6e","order_by":4,"name":"Ding-jian Wu","email":"","orcid":"","institution":"The 945th Hospital of the Joint Service Support Force of the PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ding-jian","middleName":"","lastName":"Wu","suffix":""},{"id":232318254,"identity":"66aad1f6-fb95-4f43-81ed-43111822c57d","order_by":5,"name":"Feng Zhang","email":"","orcid":"","institution":"The 945th Hospital of the Joint Service Support Force of the PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Zhang","suffix":""},{"id":232318255,"identity":"d65be402-aaf2-46cf-b396-87b496ce2486","order_by":6,"name":"Xian-jin Bi","email":"","orcid":"","institution":"The 945th Hospital of the Joint Service Support Force of the PLA","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xian-jin","middleName":"","lastName":"Bi","suffix":""},{"id":232318256,"identity":"27318998-a3bc-4798-91a9-3e9637780ec1","order_by":7,"name":"Heng-qi Liu","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Heng-qi","middleName":"","lastName":"Liu","suffix":""},{"id":232318259,"identity":"f48ee2dc-25c0-46bd-88a0-4787e15f9204","order_by":8,"name":"Hao Liu","email":"","orcid":"","institution":"Rongchang District People's Hospital","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Liu","suffix":""},{"id":232318261,"identity":"927dff00-b665-48dd-8533-84175582dd08","order_by":9,"name":"Jie Hu","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Hu","suffix":""},{"id":232318263,"identity":"f2a4ae2e-77c2-4190-99e9-ffa28a89270f","order_by":10,"name":"Chun-hui Lan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYBACPiBmBuIEBmbmA1CxBPxa2BBa2BIbSNTCwGNIpBb2swc/F7bdyTM4zvP90c2cwwz87DkGDD934NHCk5csPbPtWbHBYd6NzbnbDjNI9rwxYOw9g89hOWbMvG2HEzfAtBjcyDFgZmzDo4X/DUwLz0OwFnuCWiTgtvAwQmyRIKjljbE0z7nDiTMPsxnOzt2WziNx5lnBwV48Wvj5cww/85QdTuw7f/jB59xt1nL87ckbH/zEowUD8ICIAyRoGAWjYBSMglGABQAA661PRAGvakUAAAAASUVORK5CYII=","orcid":"","institution":"Army Medical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Chun-hui","middleName":"","lastName":"Lan","suffix":""}],"badges":[],"createdAt":"2023-09-11 14:29:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3345317/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3345317/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":43151868,"identity":"d2b890c0-9b66-43af-999d-57637594dceb","added_by":"auto","created_at":"2023-09-14 18:10:32","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":27508,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of patient selection and study design.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-3345317/v1/5e0ced8f64648fc6316b01f5.png"},{"id":43154644,"identity":"97d31405-ec4c-43e0-b0eb-00021bc7551d","added_by":"auto","created_at":"2023-09-14 18:37:28","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":369846,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3345317/v1/d1048b67-24bd-4aac-8121-9110467adb1e.pdf"}],"financialInterests":"Competing interest reported. The authors have declared that no competing interests exist.","formattedTitle":"Efficacy of 14-day vonoprazan-amoxicillin dual therapy compared to esomeprazole-amoxicillin dual therapy for eradication of Helicobacter pylori in treatment-naïve patients","fulltext":[{"header":"Introduction","content":"\u003cp\u003eApproximately 50% of the world's population is infected with \u003cem\u003eHelicobacter pylori\u003c/em\u003e, and in China the infected population is estimated to be around 768\u0026nbsp;million [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. \u003cem\u003eH. pylori\u003c/em\u003e infection is a major cause of various gastric diseases, including gastric cancer, and eradicating \u003cem\u003eH. pylori\u003c/em\u003e is widely accepted as a crucial preventive approach for gastric cancer [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. \u003cem\u003eH. pylori\u003c/em\u003e treatments are facing challenges due to increasing antibiotic resistance and decreasing eradication rates. Triple therapy is no longer recommended as a first-line treatment. The Maastricht VI Consensus, Toronto Consensus, and the Sixth China Consensus on \u003cem\u003eH. pylori\u003c/em\u003e Infections Management recommend 14-day bismuth quadruple therapy as the first-line treatment or empirical treatment for patients living in countries with a clarithromycin resistance rate above 15% [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. However, bismuth quadruple therapy has limitations, including difficulties in accessing drugs such as bismuth, tetracycline, and furazolidone in certain regions, multiple medications for patients to take, and poor compliance. If quadruple therapy fails, it may lead to increased secondary antibiotic resistance, which limits the choice of antibiotics for rescue therapy.\u003c/p\u003e \u003cp\u003eThe high-dose proton pump inhibitor (PPI)-amoxicillin dual therapy has gained attention due to its simplicity, ease of accessibility, and low resistance rates. In this regimen, a PPI and amoxicillin are administered 3\u0026ndash;4 times daily to ensure a gastric pH\u0026thinsp;\u0026gt;\u0026thinsp;6 and a sufficient concentration of amoxicillin in the blood above the minimum inhibitory concentration (MIC) values to maximize its bactericidal effect. In recent years, several studies in Asia have demonstrated the effectiveness and safety of this regimen. For instance, Yang \u003cem\u003eet al.\u003c/em\u003e achieved eradication rates of 95.3% (intention-to-treat; ITT) and 96.6% (per-protocol; PP) using a 14-day regimen of rabeprazole (20 mg, qid) and amoxicillin (750 mg, qid) [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Zhou \u003cem\u003eet al.\u003c/em\u003e reported eradication rates of 87.1% (ITT) and 92.4% (PP) with a 14-day regimen of esomeprazole (20 mg, qid) and amoxicillin (750 mg, qid), which had a lower incidence of adverse reactions compared to bismuth therapy [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. However, the efficacy of PPI-amoxicillin therapy in Western studies has not always been satisfactory. This may be attributed to the genotype of the predominant metabolic pathway for most PPIs, cytochrome P450 2C19 (CYP2C19). Approximately 70% of individuals in Western countries possess the CYP2C19 genotype associated with extensive metabolism (EM), which renders achieving an eradication rate of 90% challenging.\u003c/p\u003e \u003cp\u003eAs a new generation of acid-suppressing drugs, potassium-competitive acid blockers (P-CAB) overcome the limitations of PPIs. Vonoprazan (VPZ) is the first clinically available P-CAB [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Compared to PPIs, VPZ has a stronger and faster acid-inhibitory effect with a longer duration, and it is not affected by CYP2C19 gene polymorphisms [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. As such, replacing the acid suppressant in eradication regimens with VPZ could provide a more sustained and stable intragastric pH for antibiotic efficacy. Recent meta-analyses have shown that VPZ-based triple therapy demonstrates higher efficacy in eradicating clarithromycin-resistant \u003cem\u003eH. pylori\u003c/em\u003e compared to PPI-based triple therapy, with no significant differences in adverse effects or compliance [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. These data also suggest a promising application of VPZ in dual therapy regimens.\u003c/p\u003e \u003cp\u003eTo provide evidence-based medicine for clinical management, the current multicenter, randomized controlled study was conducted to compare VPZ-amoxicillin (VA) dual therapy with esomeprazole-amoxicillin (EA) dual therapy as first-line treatments for \u003cem\u003eH. pylori\u003c/em\u003e infection in treatment na\u0026iuml;ve patients. The study aimed to evaluate the efficacy, adverse reactions, and compliance of VA dual therapy, thereby contributing to the understanding of its clinical application.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cem\u003ePatient information and study design\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThis study was designed as a non-inferiority trial. The sample size was assessed based on the results of previous randomized controlled trials with a reference eradication rate of 90% for PPI-based dual therapy. It was expected that the eradication rate for the VA regimen would also be 90%. The non-inferiority margin (delta, \u0026Delta;) was set at -0.10 (-10%), with a power (1-\u0026beta;) of 80% and a one-sided alpha (\u0026alpha;) of 0.025. Assuming the dropout rate would not exceed 10%, a total of 236 participants were included, with each group consisting of 118 participants.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe trial was conducted from June 2022 to April 2023 in three hospitals: the No.945 Hospital of the Joint Logistics Support Force of Chinese PLA, Chongqing Daping Hospital, and the People\u0026apos;s Hospital of Hanyuan County (Ya\u0026apos;an, Sichuan Province). The study protocol was reviewed and approved by the Ethics Committee of the No.945 Hospital of the Joint Logistics Support Force of Chinese PLA. This clinical trial was registered with the China Clinical Trials Registry (www.chictr.org.cn) under registration number ChiCTR2300069762. All participants provided written informed consent, and the study was conducted in accordance with the Declaration of Helsinki and other relevant regulations.\u003c/p\u003e\n\u003cp\u003eThe inclusion criteria consisted of:\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(1) age between 18 and 70 years; (2) confirmed chronic gastritis by gastroscopy, with or without healed gastric or duodenal ulcers; (3) positive results of the Rapid Urease Test, urea breath test (UBT), and \u003cem\u003eH. pylori\u003c/em\u003e culture; and (4) no prior history of \u003cem\u003eH. pylori\u003c/em\u003e eradication therapy.\u003c/p\u003e\n\u003cp\u003eThe exclusion criteria were:\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e(1) allergy to any medications used in this study; (2) use of PPIs, histamine H2-receptor antagonists, antibiotics, bismuth compounds, or probiotics within 4 weeks prior to treatment; (3) concurrent use of corticosteroids, nonsteroidal anti-inflammatory drugs (NSAIDs), anticoagulants, or alcohol abuse; (4) presence of diseases that could potentially interfere with the evaluation of the study treatment, such as severe liver disease, cardiovascular disease, pulmonary disease, renal disease, mental illness, or malignancy; (5) pregnancy or breastfeeding, or planning to conceive during the study period; (6) history of esophageal or gastric surgery; (7) participation in other clinical studies within the past 3 months prior to participation in this study; and (8) able to provide signed informed consent.\u003c/p\u003e\n\u003cp\u003eDetailed information regarding patient selection and study design was presented in Figure 1.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eTreatments and follow-up\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIn this open-label study, 236 participants were randomly allocated at a 1:1 ratio into the trial group (VA group) and the control group (EA group), and received the following treatment regimens for 14 days:\u003c/p\u003e\n\u003cp\u003eVA Group: VPZ (Takeda Pharmaceutical Co. Ltd., Tianjin, China) 20 mg bid, and amoxicillin (Kunming Beck Norton Pharmaceutical Co. Ltd., Kunming, China) 1g tid, both taken 30 minutes after meals.\u003c/p\u003e\n\u003cp\u003eEZ Group: esomeprazole (AstraZeneca China, Shanghai, China) 20 mg qid, taken before three meals and 30 minutes before bedtime, and amoxicillin (Kunming Beck Norton Pharmaceutical Co. Ltd., Kunming, China) 750 mg qid, taken after meals and 30 minutes before bedtime.\u003c/p\u003e\n\u003cp\u003eThe randomization list was generated by a computer using a 1:1 ratio (SAS software). All participants received education on medication administration and potential adverse reactions before starting the treatment. Patients were provided with medication diaries and instructed to record their medication intake and any adverse reactions experienced. Adverse reactions were categorized as \u0026quot;mild\u0026quot; (discomfort without impacting daily life and work), \u0026quot;moderate\u0026quot; (discomfort partially interfering with daily life and work), and \u0026quot;severe \u0026quot; (discomfort severely interference with daily life and work). Good compliance was defined as taking more than 80% of the total medications prescribed.\u003c/p\u003e\n\u003cp\u003eThe primary outcome measured in this study was the \u003cem\u003eH. pylori\u003c/em\u003e eradication rate in both groups, which was evaluated using the 13C-UBT. Patients returned to the gastroenterology outpatient departments of the participating hospitals 4\u0026ndash;6 weeks after completing the treatment to assess the success of \u003cem\u003eH. pylori\u0026nbsp;\u003c/em\u003eeradication. During the 13C-UBT, each patient ingested a capsule containing 75 mg of 13C-urea (Beijing Boran Pharmaceutical Co. Ltd, Beijing, China). Breath samples were collected at baseline and 30 minutes after medication intake, and the samples were analyzed using a 13C infrared spectrometer (HY-IREXBplus, Guangzhou Richen-Frinse Electromechanical Science and Technology Co. Ltd, Guangzhou, China). The results were analyzed and generated using integrated software. \u003cem\u003eH. pylori\u003c/em\u003e eradication was defined as a detection value below the cut-off of 4%.\u003c/p\u003e\n\u003cp\u003eThe secondary outcome measures included the incidence of adverse events, patient compliance, antibiotic resistance rates, and risk factors affecting the eradication rates in both groups.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDrug susceptibility test\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eDrug susceptibility testing of \u003cem\u003eH. pylori\u003c/em\u003e isolates was performed using the agar dilution method as described previously [11]. Briefly, different concentrations of antibiotic solutions were selected and added to the agar medium. Growth of the \u003cem\u003eH. pylori\u003c/em\u003e strain on the selected antibiotic indicated drug resistance, while no growth was considered drug susceptible. According to the US Clinical and Laboratory Standards Institute guidelines, the standard strain ATCC 43504 (NCTC11637 \u003cem\u003eH. pylori\u003c/em\u003e strain) was used as a control. Minimum inhibitory concentrations (MICs) of antibiotics greater than 1 \u0026mu;g/mL for clarithromycin, 2 \u0026mu;g/mL for amoxicillin, 2 \u0026mu;g/mL for levofloxacin, 2 \u0026mu;g/mL for furazolidone, 2 \u0026mu;g/mL for tetracycline, and 8 \u0026mu;g/mL for metronidazole were defined as resistance.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCYP2C19 gene polymorphism\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCYP2C19 gene polymorphisms were evaluated using the method provided previously [11]. In brief, DNA was extracted from the gastric mucosal tissue of participants using a TIANamp Genomic DNA kit (TIANGEN). Primers (listed in Table 1) were used to amplify products through a polymerase chain reaction (PCR) assay, and the products were subjected to CYP2C19 sequencing. Forward primers were used to sequence CYP2C19*2 amplification products and reverse primers for *3 sequencing. The Sequencing Analysis Software (Version 5.2) was used for CYP2C19 polymorphism analysis. Based on the CYP2C19 genotype, participants were classified into four groups: extensive metabolizers (UM, *17/*17, *1/*17), rapid metabolizers (RM, *1/*1), intermediate metabolizers (IM, *1/*2, *1/*3, *2/*17, *3/*17) or poor metabolizers (PM, *2/*2, *2/*3, *3/*3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1. Sequences of CYP2C19 gene polymorphism primers\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.86596119929453%\" valign=\"top\"\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.264550264550266%\" valign=\"top\"\u003e\n \u003cp\u003ePrimer sequences (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.869488536155202%\" valign=\"top\"\u003e\n \u003cp\u003eAmplification length\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.86596119929453%\" valign=\"top\"\u003e\n \u003cp\u003eCPY2C19*2F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.264550264550266%\" valign=\"top\"\u003e\n \u003cp\u003eGCAGGTATAAGTCTAGGAAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.869488536155202%\" rowspan=\"2\"\u003e\n \u003cp\u003e381\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.66591422121896%\" valign=\"top\"\u003e\n \u003cp\u003eCPY2C19*2R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.33408577878104%\" valign=\"top\"\u003e\n \u003cp\u003eTAAAGTCCCGAGGGTTGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"27.86596119929453%\" valign=\"top\"\u003e\n \u003cp\u003eCPY2C19*3F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.264550264550266%\" valign=\"top\"\u003e\n \u003cp\u003eCACCCTGTGATCCCACTTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"21.869488536155202%\" rowspan=\"2\"\u003e\n \u003cp\u003e375\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"35.66591422121896%\" valign=\"top\"\u003e\n \u003cp\u003eCPY2C19*3R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"64.33408577878104%\" valign=\"top\"\u003e\n \u003cp\u003eCTAATGGGCTTAGAAGCCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStatistical analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe ITT and PP analyses were used to assess eradication rates in both groups. The ITT analysis included all randomized participants, while those without follow-up results from the 13C-UBT test were considered treatment failures. Participants with poor compliance were excluded from the PP analysis. T-tests, chi-square tests, or Fisher\u0026apos;s exact tests were used to assess differences between the two groups for continuous and categorical variables. Statistical differences were considered when \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 (two-sided).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor \u003cem\u003eH. pylori\u003c/em\u003e eradication rates, a non-inferiority test was conducted to compare the two groups. The non-inferiority was assessed by evaluating the hypothesis test (one-sided \u0026mu;-test) and deriving the lower bound of the one-sided 95% confidence interval to compare non-inferiority between the groups. If \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.025 and the lower bound of the 95% confidence interval for the difference in eradication rates was higher than -10%, it could be concluded that non-inferiority was demonstrated. Logistic regression analysis was performed to assess the impact of relevant factors on the eradication rate. Statistical software packages such as SAS 9.4 (SAS Institute Inc.) and SPSS version 26.0 (IBM) were used for data analysis.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ePatient information and baselines\u003c/h2\u003e \u003cp\u003eBetween June 2022 and April 2023, a total of 301 participants underwent eligibility assessment. Among them, 66 patients were excluded due to not meeting the inclusion criteria (n\u0026thinsp;=\u0026thinsp;36) or refusal to participate (n\u0026thinsp;=\u0026thinsp;30). Finally, 236 patients were randomly assigned to the VA and EA groups and were included in the ITT analysis. Amongst these patients, three in the VA group and two in the EA group had compliance rates less than 80% and were excluded. Therefore, a total of 231 participants were included in the PP analysis. Aside from gender and smoking, there were no statistically significant differences in other baseline characteristics between the two groups (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBaseline demographics and clinical characteristics of the study subjects\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eVA group\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;118)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eEA group\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;118)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eSex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e \u003cp\u003e0.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e60 (50.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e105 (89.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e58 (49.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13 (11.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eAge (x\u0026thinsp;\u0026plusmn;\u0026thinsp;SD)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e35.6\u0026thinsp;\u0026plusmn;\u0026thinsp;12.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e35.9\u0026thinsp;\u0026plusmn;\u0026thinsp;11.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.682\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eAge, n (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.757\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u0026lt; 60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e112 (94.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e113 (95.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u0026ge; 60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6 (5.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5 (4.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eBMI (x\u0026thinsp;\u0026plusmn;\u0026thinsp;s, kg/m\u003csup\u003e2\u003c/sup\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e22.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e22.4\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.381\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eCigarette smoking, n (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e36 (30.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e61 (51.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eAlcohol drinking, n (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e51 (43.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60 (50.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eEducation status, n (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.193\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eHigh school or less\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e63 (54.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e53 (45.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eCollege or more\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e54 (45.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e64 (54.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eHousing size, n (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.582\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u0026gt;\u0026thinsp;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003e\u0026le;\u0026thinsp;60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e112\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e110\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eStyle of dining, n (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.693\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGather dining\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e66 (56.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e69 (58.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eIndividual dining\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52 (44.0)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e49 (41.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eFamily history of gastric carcinoma, n (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5 (4.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e7 (5.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.553\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eCYP2C19, n (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.351\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003ePoor metabolizer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11 (9.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8 (6.8)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eIntermediate met.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e57 (48.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e53 (44.9)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eRapid met.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e48 (40.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e54 (45.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eExtensive met.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 (1.7)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (2.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eAntibiotic resistance, n (%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eClarithromycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e30 (25.42)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e30 (25.42)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eAmoxicillin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eMetronidazole\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e88 (75.58)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e86 (72.88)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.767\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eFurazolidone\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTetracycline\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eLevofloxacin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28 (23.73)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e26 (22.03)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.757\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"7\"\u003eAbbreviations: VA, vonoprazan-amoxicillin; EA, esomeprazole-amoxicillin; BMI, body mass index; NA, not applicable.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eComparing VA and EA dual therapy for\u003c/em\u003e H. pylori \u003cem\u003eeradication\u003c/em\u003e\u003c/p\u003e \u003cp\u003eITT and PP were used to compare the eradication rates of the VA and EA groups. In the ITT analysis, the eradication rates for the VA and EA groups were 96.61% (114/118; 95% confidence interval [CI] 93.34\u0026ndash;99.88%) and 93.22% (110/118; 95% CI 88.68\u0026ndash;97.76%), respectively. In the PP analysis, the eradication rates for the VA and EA groups were 98.26% (113/115; 95% CI 95.87\u0026ndash;100.00%) and 93.10% (108/116; 95% CI 90.80\u0026ndash;98.86%), respectively. The difference in eradication rates between the two groups was not statistically significant (ITT, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.236; and PP, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.109). In both the ITT and PP analysis sets, the VA group met the non-inferiority criteria compared to the EA group. The null hypothesis that the VA group is inferior to the EA group was rejected (one-sided \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001 for both ITT and PP analyses). For the ITT and PP analysis sets, the 95% CIs for the differences in eradication rates between the two groups were 3.39% (-2.2%, 8.98%) and 5.16% (-1.22%, 8.27%), respectively, with the lower bounds of both intervals (-2.2%, -1.22%) being greater than the predefined non-inferiority margin. (See Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eEradication rates of VA dual therapy compared with EA dual therapy\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVA group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEA group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDifference from\u003c/p\u003e \u003cp\u003edual group\u003c/p\u003e \u003cp\u003e(adjusted 95% CI\u003c/p\u003e \u003cp\u003efor difference)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value for\u003c/p\u003e \u003cp\u003enon-inferiority\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value for\u003c/p\u003e \u003cp\u003edifference\u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eITT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e96.61% (114/118)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e93.22% (110/118)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3.39%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.236\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e95%CI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e93.34\u0026ndash;99.88%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e88.68\u0026ndash;97.76%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-2.2-8.98%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e98.26% (113/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e93.10% (108/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5.16%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.0001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.109\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e95%CI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e95.87\u0026ndash;100.00%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90.80-98.86%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-1.22-8.27%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003eCI, confidence interval; ITT, intention-to-treat; PP, per-protocol.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003csup\u003ea\u003c/sup\u003eThe \u003cem\u003eP\u003c/em\u003e values were obtained from one-sided test comparisons of noninferiority between the VA group and the EA group.\u003c/td\u003e\u003c/tr\u003e \u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003csup\u003eb\u003c/sup\u003eThe \u003cem\u003eP\u003c/em\u003e values were from two-sided comparisons of differences between the VA therapy group and the EA group.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eAdverse events and compliance rates in VA and EA groups\u003c/h2\u003e \u003cp\u003eThe overall incidence of adverse events in the VA group was 11.3% (13/115), and in the EA groups was 13.79% (16/116), with no significant difference between the two groups (P\u0026thinsp;=\u0026thinsp;0.568). The most common adverse events were nausea, vomiting, and diarrhea. Except for one participant in the EA group who received anti-allergy medication for a rash, no treatment was required for other adverse events, and no hospitalizations were reported.\u003c/p\u003e \u003cp\u003eThe compliance rates were 97.46% and 98.3% in the VA and EA groups, respectively, with no statistical difference between the two groups (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;1.000; Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDrug-induced adverse events and patient compliance to VA dual therapy compared with EA dual therapy\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAdverse events\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVA group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEA group\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal incidence\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11.30% (13/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e13.79% (16/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.568\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNausea, vomiting\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.48% (4/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.72% (2/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.446\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDiarrhea\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.74% (2/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.31% (5/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.446\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEpigastric discomfort\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.87% (1/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.86% (1/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDizziness\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2.61% (3/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.86% (1/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.370\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTaste distortion\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0% (0/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.72% (2/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.498\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSkin rash\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0% (0/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.86% (1/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDarkened stool\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.87% (1/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.86% (1/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eConstipation\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0% (0/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.86% (1/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReduced appetite\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0% (0/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.72% (2/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.498\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOthers\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.74% (2/115)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0% (0/116)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.247\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCompliance\u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e97.46% (115/118)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e98.3% (116/118)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003csup\u003ea\u003c/sup\u003eCompliance was indicative of patients who took at least 80% of total medications.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eAntibiotic resistance rates\u003c/h2\u003e \u003cp\u003eAmong all participants, the resistance rates were 25.42% (60/236) for clarithromycin, 22.88% (54/236) for levofloxacin, and 73.72% (174/236) for metronidazole. The resistance rates for amoxicillin, furazolidone, and tetracycline were all 0%. The dual resistance results were 20.76% (49/239) for metronidazole-levofloxacin, 10.17% (24/236) for clarithromycin-levofloxacin, and 23.31% (55/236) for clarithromycin-metronidazole. The triple resistance rate of clarithromycin-metronidazole-levofloxacin was 9.32% (22/236). There was no statistically significant difference in antibiotic resistance rates between the two groups (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eFactors affecting eradication rates\u003c/h2\u003e \u003cp\u003eUnivariate analysis indicated that body mass index (BMI), compliance, atrophy, treatment regimen, gastric cancer, and family history of gastric cancer may be influencing factors for \u003cem\u003eH. pylori\u003c/em\u003e eradication. Multivariate analysis using logistic regression with all variables identified compliance and family history of gastric cancer as independent risk factors for \u003cem\u003eH. pylori\u003c/em\u003e eradication (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.002 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.003, respectively; Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eFactors affecting eradication of \u003cem\u003eH. pylori\u003c/em\u003e infection in VA dual therapy compared with EA dual therapy\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSingle factor analysis\u003c/p\u003e \u003cp\u003eOR value (95%CI)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eP value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMultiple factor analysis\u003c/p\u003e \u003cp\u003eOR value (95%CI)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eP\u003c/em\u003e value\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSex\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.506 (0.685\u0026ndash;17.943)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.132\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMale vs. Female\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAge, years\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.952 (0.184\u0026ndash;4.930)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.953\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;45, \u0026lt;\u0026thinsp;45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBMI, kg/m\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.808 (0.644\u0026ndash;1.014)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.066\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u0026ge;\u0026thinsp;23, \u0026lt;\u0026thinsp;23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAlcohol drinking\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.601 (0.325\u0026ndash;7.879)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.563\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes vs. No\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCigarette smoking\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.490 (0.078\u0026ndash;3.088)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.448\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes vs. No\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCompliance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e34.098 (3.555\u0026ndash;327.031)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.002\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e20.190 (2.898\u0026ndash;140.664)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.002\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGood vs. Poor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCYP2C19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.734 (0.186\u0026ndash;2.896)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.658\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRapid \u0026amp; Extensive vs. Poor \u0026amp; Intermediate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAtrophy\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.025 (0.134\u0026ndash;7.831)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.981\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes vs No\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVA vs EA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4.898 (0.928\u0026ndash;25.854)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.061\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFamily history of gastric carcinoma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e12.424 (2.291\u0026ndash;67.385)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.003\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e10.095 (0.234\u0026ndash;45.609)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.003\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYes vs No\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe results of this study showed that both VA and EA dual therapy regimens achieve eradication rates of over 93% in treatment-na\u0026iuml;ve \u003cem\u003eH. pylori\u003c/em\u003e patients, with VA reaching excellent eradication rates of more than 95%. Additionally, both regimens have low incidences of adverse reactions, with rates of 11.3% and 13.79%, respectively, and compliance rates exceeding 97%. This indicates that dual therapy can be used as a first-line treatment of \u003cem\u003eH. pylori\u003c/em\u003e in China.\u003c/p\u003e \u003cp\u003eThe difference between these two regimens lies in the choice of acid suppression drug, esomeprazole or VPZ. The former is a PPI and the latter is a P-CAB, but both target the H\u003csup\u003e+\u003c/sup\u003e-K\u003csup\u003e+\u003c/sup\u003e-ATPase [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. PPIs have been used clinically for over 30 years. They are prodrugs that require acid activation, and therefore need to be taken before meals, which may affect compliance for some patients. Moreover, PPIs only inhibit activated proton pumps, and once the activated pumps are depleted, the reactivation of resting pumps is required for further acid suppression. They have a short half-life and take a relatively long time to be effective, typically 3\u0026ndash;5 days of oral administration to achieve stable inhibition of gastric acid secretion [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Furthermore, PPIs are metabolized by CYP2C19, and due to genetic polymorphisms in the gene encoding this enzyme, there can be significant variations in individual responses [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. A high percentage of Caucasians (72.6%) are CYP2C19 rapid metabolizers [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], so most are unable to achieve satisfactory acid suppressive effects, which affects the efficacy of \u003cem\u003eH. pylori\u003c/em\u003e treatments. Graham \u003cem\u003eet al\u003c/em\u003e. reported that the dual PPI-amoxicillin regimen in the United States had an eradication rate of only 72% (esomeprazole 40 mg, TID, and amoxicillin 750 mg, tid, for 14 days) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], which was significantly lower than the \u0026gt;\u0026thinsp;90% eradication rates of primary \u003cem\u003eH. pylori\u003c/em\u003e in Asia [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eP-CAB was launched in Japan in 2015 and has the characteristics of strong acid inhibition, rapid onset of action, acts on both active and resting state proton pumps, long duration of action, and not affected by CYP2C19 gene polymorphisms [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Therefore, P-CAB is recommended by both the Maastricht VI/Florence consensus report and the Sixth Chinese Consensus on the Management of \u003cem\u003eH. pylori\u003c/em\u003e Infections as an optional drug for \u003cem\u003eH. pylori\u003c/em\u003e treatment [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe current study showed that a 14-day VA dual therapy could achieve eradication rates of 96.61% (ITT analysis) and 98.26% (PP analysis). In 2019, a retrospective study also showed that a 7-day VA dual therapy (vonoprazan 20 mg bid, amoxicillin 500 mg tid) could achieve an eradication rate of 94.4% (PP analysis) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Moreover, recent evidence revealed an eradication rate\u0026thinsp;\u0026gt;\u0026thinsp;90% with a 10-day VA regimen (vonoprazan 20 mg bid\u0026thinsp;+\u0026thinsp;amoxicillin 750 mg qid) [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, it is important to note that all the aforementioned studies were conducted in Asia, and additional data are required to confirm whether VA dual therapy could achieve similarly high eradication rates in other regions.\u003c/p\u003e \u003cp\u003eFailure to eradicate \u003cem\u003eH. pylori\u003c/em\u003e is mainly associated with antibiotic resistance. The population in this study showed high resistance rates, including 83.33% for metronidazole, 25% for clarithromycin, and 33.33% for levofloxacin. However, there was no resistance to amoxicillin, tetracycline, or furazolidone, which is an important factor contributing to the high eradication rates achieved with both dual therapy regimens assessed in this study.\u003c/p\u003e \u003cp\u003eMeanwhile, the incidence rates of adverse reactions in the VA and EA groups were 11.3% and 13.79%, respectively, which was lower than that of the quadruple regimen and consistent with domestic and international reports. Song \u003cem\u003eet al\u003c/em\u003e. reported an adverse events rate of 17.6% in the PPI-amoxicillin dual regimen and 25.5% in the bismuth-containing quadruple regimen (PPI\u0026thinsp;+\u0026thinsp;bismuth\u0026thinsp;+\u0026thinsp;amoxicillin\u0026thinsp;+\u0026thinsp;clarithromycin, 14 days) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Researchers in Taiwan reported that the incidence of adverse events with PPI-amoxicillin dual therapy was significantly lower than with non-bismuth quadruple therapy (PPI\u0026thinsp;+\u0026thinsp;amoxicillin\u0026thinsp;+\u0026thinsp;clarithromycin\u0026thinsp;+\u0026thinsp;metronidazole, 14 days) (9.6% vs. 22.8%) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Our previous study also confirmed that the incidence of adverse events during treatment was significantly lower with vonoprazan dual therapy compared to bismuth-containing quadruple therapy (PPI\u0026thinsp;+\u0026thinsp;bismuth\u0026thinsp;+\u0026thinsp;amoxicillin\u0026thinsp;+\u0026thinsp;metronidazole, 14 days) (16.67% vs. 38.04%) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is important to note that this study has limitations, including a lack of comparison between VA dual therapy and EA dual therapy on the gut microbiota, and the need for further study on different treatment durations, as other trials have performed [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Therefore, studies using different courses of treatment are still needed. However, the current study demonstrates the equivalent efficacy and safety of 14-day VA dual therapy and EA therapy for the treatment of \u003cem\u003eH. pylori\u003c/em\u003e. Based on its simpler administration and independence from CYP2C19 gene polymorphisms, VA dual therapy holds promise as a first-line clinical treatment for \u003cem\u003eH. pylori\u003c/em\u003e.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding Sources\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Science Foundation of China (No. 82072253) and the Key Project of Hospital Management of the 945th Hospital of the Joint Service Support Force of the PLA(No.2022945YG-A04-01).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared that no competing interests exist.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHooi JKY, Lai WY, Ng WK, Suen MMY, Underwood FE, Tanyingoh D, Malfertheiner P, Graham DY, Wong VWS, Wu JCY et al: Global Prevalence of Helicobacter pylori Infection: Systematic Review and Meta-Analysis. Gastroenterology 2017, 153(2):420-429.\u003c/li\u003e\n\u003cli\u003eSugano K, Tack J, Kuipers EJ, Graham DY, El-Omar EM, Miura S, Haruma K, Asaka M, Uemura N, Malfertheiner P et al: Kyoto global consensus report on Helicobacter pylori gastritis. Gut 2015, 64(9):1353-1367.\u003c/li\u003e\n\u003cli\u003eMalfertheiner P, Megraud F, Rokkas T, Gisbert JP, Liou JM, Schulz C, Gasbarrini A, Hunt RH, Leja M, O\u0026apos;Morain C et al: Management of Helicobacter pylori infection: the Maastricht VI/Florence consensus report. Gut 2022.\u003c/li\u003e\n\u003cli\u003eGroup HpS, Gastroenterology CSo, Association CM: Sixth Chinese National Consensus Report on the management of Helicobacter Pylori Infection (treatment excluded). Chin J Dig 2022, 42(5):15.\u003c/li\u003e\n\u003cli\u003eYang JC, Lin CJ, Wang HL, Chen JD, Kao JY, Shun CT, Lu CW, Lin BR, Shieh MJ, Chang MC et al: High-dose dual therapy is superior to standard first-line or rescue therapy for Helicobacter pylori infection. Clin Gastroenterol Hepatol 2015, 13(5):895-905 e895.\u003c/li\u003e\n\u003cli\u003eSong Z, Zhou L, Xue Y, Suo B, Tian X, Niu Z: A comparative study of 14-day dual therapy (esomeprazole and amoxicillin four times daily) and triple plus bismuth therapy for first-line Helicobacter pylori infection eradication: A randomized trial. Helicobacter 2020, 25(6):e12762.\u003c/li\u003e\n\u003cli\u003eInatomi N, Matsukawa J, Sakurai Y, Otake K: Potassium-competitive acid blockers: Advanced therapeutic option for acid-related diseases. Pharmacol Ther 2016, 168:12-22.\u003c/li\u003e\n\u003cli\u003eHu Y, Zhu Y, Lu NH: Recent progress in Helicobacter pylori treatment. Chin Med J (Engl) 2020, 133(3):335-343.\u003c/li\u003e\n\u003cli\u003eJung YS, Kim EH, Park CH: Systematic review with meta-analysis: the efficacy of vonoprazan-based triple therapy on Helicobacter pylori eradication. Aliment Pharmacol Ther 2017, 46(2):106-114.\u003c/li\u003e\n\u003cli\u003eLi M, Oshima T, Horikawa T, Tozawa K, Tomita T, Fukui H, Watari J, Miwa H: Systematic review with meta-analysis: Vonoprazan, a potent acid blocker, is superior to proton-pump inhibitors for eradication of clarithromycin-resistant strains of Helicobacter pylori. Helicobacter 2018, 23(4):e12495.\u003c/li\u003e\n\u003cli\u003eYang J, Zhang Y, Fan L, Zhu YJ, Wang TY, Wang XW, Chen DF, Lan CH: Eradication Efficacy of Modified Dual Therapy Compared with Bismuth-Containing Quadruple Therapy as a First-Line Treatment of Helicobacter pylori. Am J Gastroenterol 2019, 114(3):437-445.\u003c/li\u003e\n\u003cli\u003eSachs G, Shin JM, Hunt R: Novel approaches to inhibition of gastric acid secretion. Curr Gastroenterol Rep 2010, 12(6):437-447.\u003c/li\u003e\n\u003cli\u003eScarpignato C, Hongo M, Wu JCY, Lottrup C, Lazarescu A, Stein E, Hunt RH: Pharmacologic treatment of GERD: Where we are now, and where are we going? Ann N Y Acad Sci 2020, 1482(1):193-212.\u003c/li\u003e\n\u003cli\u003eHuang CC, Chen YC, Leu HB, Chen TJ, Lin SJ, Chan WL, Chen JW: Risk of adverse outcomes in Taiwan associated with concomitant use of clopidogrel and proton pump inhibitors in patients who received percutaneous coronary intervention. Am J Cardiol 2010, 105(12):1705-1709.\u003c/li\u003e\n\u003cli\u003eBertilsson L, Lou YQ, Du YL, Liu Y, Kuang TY, Liao XM, Wang KY, Reviriego J, Iselius L, Sjoqvist F: Pronounced differences between native Chinese and Swedish populations in the polymorphic hydroxylations of debrisoquin and S-mephenytoin. Clin Pharmacol Ther 1992, 51(4):388-397.\u003c/li\u003e\n\u003cli\u003eGraham DY, Javed SU, Keihanian S, Abudayyeh S, Opekun AR: Dual proton pump inhibitor plus amoxicillin as an empiric anti-H. pylori therapy: studies from the United States. J Gastroenterol 2010, 45(8):816-820.\u003c/li\u003e\n\u003cli\u003eTai WC, Liang CM, Kuo CM, Huang PY, Wu CK, Yang SC, Kuo YH, Lin MT, Lee CH, Hsu CN et al: A 14 day esomeprazole- and amoxicillin-containing high-dose dual therapy regimen achieves a high eradication rate as first-line anti-Helicobacter pylori treatment in Taiwan: a prospective randomized trial. J Antimicrob Chemother 2019, 74(6):1718-1724.\u003c/li\u003e\n\u003cli\u003eAkazawa Y, Fukuda D, Fukuda Y: Vonoprazan-based therapy for Helicobacter pylori eradication: experience and clinical evidence. Therap Adv Gastroenterol 2016, 9(6):845-852.\u003c/li\u003e\n\u003cli\u003eFuruta T, Yamade M, Kagami T, Uotani T, Suzuki T, Higuchi T, Tani S, Hamaya Y, Iwaizumi M, Miyajima H et al: Dual Therapy with Vonoprazan and Amoxicillin Is as Effective as Triple Therapy with Vonoprazan, Amoxicillin and Clarithromycin for Eradication of Helicobacter pylori. Digestion 2020, 101(6):743-751.\u003c/li\u003e\n\u003cli\u003eQian HS, Li WJ, Dang YN, Li LR, Xu XB, Yuan L, Zhang WF, Yang Z, Gao X, Zhang M et al: Ten-Day Vonoprazan-Amoxicillin Dual Therapy as a First-Line Treatment of Helicobacter pylori Infection Compared With Bismuth-Containing Quadruple Therapy. Am J Gastroenterol 2023, 118(4):627-634.\u003c/li\u003e\n\u003cli\u003eHu J, Mei H, Su NY, Sun WJ, Zhang DK, Fan LL, He P, Pan J, Wang XW, Zou PY et al: Eradication rates of Helicobacter pylori in treatment-naive patients following 14-day vonoprazan-amoxicillin dual therapy: A multicenter randomized controlled trial in China. Helicobacter 2023:e12970.\u003c/li\u003e\n\u003cli\u003eHu Y, Xu X, Ouyang YB, He C, Li NS, Xie C, Peng C, Zhu ZH, Xie Y, Shu X et al: Optimization of vonoprazan-amoxicillin dual therapy for eradicating Helicobacter pyloriinfection in China: A prospective, randomized clinical pilot study. Helicobacter 2022, 27(4):e12896.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Helicobacter pylori, vonoprazan, amoxicillin, bacterial infection, patient compliance, breath tests","lastPublishedDoi":"10.21203/rs.3.rs-3345317/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3345317/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eObjective:\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eThis study was a multicenter, randomized controlled trial that compared the therapeutic efficacies of vonoprazan-amoxicillin (VA) and esomeprazole-amoxicillin (EA) dual therapies for \u003cem\u003eHelicobacter pylori\u003c/em\u003einfection in China.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eA total of 236 patients were randomized to receive either VA dual therapy (vonoprazan 20 mg bid, amoxicillin 1 g tid, 14 days) or EA dual therapy (esomeprazole 20 mg qid, amoxicillin 750 mg qid, 14 days). The success of eradication was assessed using a 13C urea breath test after 4-6 weeks. The study assessed \u003cem\u003eH. pylori\u003c/em\u003e eradication rates, incidence of adverse reactions, patient compliance, antibiotic resistance rates, and CYP2C19 gene polymorphisms.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eResults: \u003c/strong\u003e\u003c/em\u003eBoth the intention-to-treat (ITT) analysis and the per-protocol (PP) analysis demonstrated that the eradication rate by the VA group (ITT:96.61%, 95%CI 93.34–99.88%; PP:98.26%, 95% CI 95.87–100.00%)was not inferior to that of the EA group (ITT:93.22%,88.68-97.76%; PP:93.10%, 95% CI 90.80-98.86%) with the one-sided P \u0026lt; 0.0001 for both. The incidence of adverse reactions was 11.30% and 13.79% for the two groups (\u003cem\u003eP\u003c/em\u003e=0.568), and compliance rates were 97.46% and 98.3% for the VA and EA groups, respectively, with both exceeding 95% (\u003cem\u003eP\u003c/em\u003e = 1.000). Compliance was identified as an independent risk factor for \u003cem\u003eH. pylori\u003c/em\u003e eradication (\u003cem\u003eP\u003c/em\u003e= 0.002).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eThe 14-day VA and EA dual therapies have comparable efficacies and safeties, and both are recommended as first-line treatment for an \u003cem\u003eH. pylori\u003c/em\u003e infection.\u003c/p\u003e","manuscriptTitle":"Efficacy of 14-day vonoprazan-amoxicillin dual therapy compared to esomeprazole-amoxicillin dual therapy for eradication of Helicobacter pylori in treatment-naïve patients","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-09-14 18:10:27","doi":"10.21203/rs.3.rs-3345317/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8aa426e8-b2f0-4554-8f6b-e61dd099d4c9","owner":[],"postedDate":"September 14th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-09-14T18:29:21+00:00","versionOfRecord":[],"versionCreatedAt":"2023-09-14 18:10:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3345317","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3345317","identity":"rs-3345317","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00