LTCONS_00014107-miR-29b-2-3p-GPR37 axis promotes heat stimulation induced esophageal carcinogenesis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LTCONS_00014107-miR-29b-2-3p-GPR37 axis promotes heat stimulation induced esophageal carcinogenesis Wenting Liu, Jing Wang, Jiaping Qu, Dan Cheng, Jiaqiong Li, Yiu To Yeung, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5585853/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Esophageal cancer is a common malignant tumor of the digestive system, Esophageal squamous cell carcinoma (ESCC) is the major histological subtype of esophageal cancer. Multiple epidemiological evidence shows that consumption of hot temperature food and beverages is an important risk factor for developing ESCC, however, it is underlying mechanism remains unclear. Herein, for the first time, we constructed an animal model of esophageal precancerous lesions induced by heat stimulation in rats and simulated the human habit of eating hot food and drinks. Both LncRNA and miRNA expression of esophageal tissues were profiled by RNA-seq. We found LTCONS_00014107 was lowly expressed but miR-29b-2-3p was highly expressed in heat-induced ESCC and degradation of LTCONS_00014107 promoted the expression of miR-29b-2-3p since it is speculated that LTCONS_00014107 could be a precursor of miR-29b-2-3p. The functional study showed that knockdown miR-29b-2-3p could inhibit ESCC cell proliferation, whereas overexpression of miR-29b-2-3p could promote ESCC progression. Finally, through data analysis from the publicly available databases followed by verification using Dual-Luciferase assay, we found GPR37 could bind with miR-29b-2-3p and may be a potential target of miR-29b-2-3p. Overall, our research showed the function of LTCONS_00014107 in heat-induced ESCC and provided a theoretical and experimental basis of LTCONS_00014107-miR-29b-2-3p-GPR37 axis as the potential biomarkers and therapeutic targets in ESCC. esophageal squamous cell carcinoma heat induction LTCONS_00014107 miR-29b-2-3p GPR37 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Summary Our research showed the function of LTCONS_00014107 in heat-induced ESCC and provided a theoretical and experimental basis of the LTCONS_00014107-miR-29b-2-3p-GPR37 axis as the potential biomarkers and therapeutic targets in ESCC. Introduction Esophageal cancer is the sixth and seventh most common cancer in terms of incidence rate and mortality worldwide. In 2020, there were 604,000 new cases diagnosed with esophageal cancer and 544,000 died from esophageal cancer. About 70% of cases occur in men. It mainly occurs in Eastern Asia, Southern Africa, and Southern South America 1 . In China, the incidence and mortality rate of esophageal cancer ranks third and fourth among malignant tumors in the country respectively 2 , which seriously threaten people’s health. According to pathological types, esophageal carcinoma is divided into esophageal squamous carcinoma (ESCC) and esophageal adenocarcinoma (EAC). Although they occur in the same organ, they have different geographical distribution and risk factors 3 . With the progress of medical diagnosis and treatment technology, the treatment of esophageal cancer has achieved certain results but the overall survival rate of esophageal cancer in China is only about 30% 4 . The occurrence and development of esophageal cancer is related to many factors. There is sufficient epidemiological evidence to support the consumption of high-temperature foods and beverages as an important risk factor for ESCC. For example, high levels of high-temperature tea called “mate tea” have been linked to higher rates of esophageal cancer in Southern South America 5 . Iran has one of the highest rates of ESCC in the world and is one of the largest consumers of black tea, especially very hot black tea 6 , 7 . In the Chinese city of Linzhou, people are used to drinking very hot soups, which has led to one of the highest rates of esophageal cancer in the country 8 , 9 . These studies, conducted in areas with a high prevalence of ESCC, suggest that the consumption of hot food and drinks is associated with an increased risk of ESCC. The possible mechanism by which eating hot food and drinks promotes ESCC has long been speculated about. Studies have shown that about 75% of human genes produce corresponding transcription products, of which only 2% encode proteins, with most of the rest being non-coding RNA (ncRNA) 10 . It was once thought that only protein-coding genes had important functions, but a growing research suggests that ncRNA also play an important role in gene regulation. ncRNA is divided into two classes based on nucleotide(nts) length: ncRNA of less than 200nts, including transfer ribonucleic acidRNA (tRNA) and microRNA(miRNA), and LncRNA more than 200nts. Both have been found to play a key role in gene regulation 11 – 13 . Although LncRNA is the least well-known, it is crucial in transcriptional regulation, epigenetic gene regulation, and disease 14 . For example: involved in energy metabolism 15 , participating in transcription in cis or trans, nuclear tissue domains, and regulation of protein or RNA molecules 13 , etc. In addition, LncRNAs are associated with cell functions that require the interaction of one or more RNA-binding proteins (RBPs) 16 . It is closely related to the occurrence, development, and prevention of many human diseases, making them good prognostic biomarkers and therapeutic targets. microRNAs(miRNAs),as universal specific factors for post-transcriptional gene silencing, are small endogenous non-coding RNA 17 . Like protein-coding genes, miRNAs cluster which are regulated by genetics and epigenetics. These clusters may regulate various aspects of cellular function, for example, growth, proliferation, differentiation, cell death, DNA repair and self-renewal, etc 18 .miRNAs are crucial in regulating post-transcriptional gene expression levels by binding to the 3′untranslated region (3′-UTR) of mRNA. Abnormal miRNA expression contributes to excessively activating specific oncogenes and promotes the progression of cancer 19 , 20 . Therefore, miRNAs are key regulatory factors in biological processes and their dysregulation is associated with various diseases. However, there are few studies on the expression changes of LncRNAs and miRNAs in ESCC after heat treatment. In this study, we simulated the habits of drinking hot drinks in humans and generated the animal model of rat precancerous lesions induced by heat stimulation. The gene expression profile including LncRNAs and miRNAs, and then differentially expressed genes were analyzed by using transcriptome sequencing technology (RNA-seq). LTCONS_00014107 and miR-29b-2-3p were screened out, and then the mechanism of their occurrence in the process of esophageal carcinoma was studied. Materials and Methods Heat-stimulation rat experiment. Rats (4–5 weeks old, 190 ± 10 g) were purchased from Beijing Vital River (Beijing, China). Feed animals according to specific pathogen-free feeding standards. For the heat-stimulation study, rats were divided randomly into five groups of ten rats each: (A) intra-esophageal injection in room temperature (RT) water (RT group, n = 10); (B) intra-esophageal injection in hot water (HW, 65℃) (HW group, n = 10); (C) subcutaneous injections of N -nitrosomethylbenzylamine (NMBA) at 0.25 mg/kg and intra-esophageal injection in RT water (NMBA + RT group, n = 10); (D) subcutaneous injections of NMBA at 0.25 mg/kg and intra-esophageal injections in hot water (NMBA + HW group, n = 10); (E) subcutaneous injections of NMBA at 0.25 mg/kg and intra-esophageal injection in hot water and follow ice-cold water (IW, 0℃) (NMBA + HW + IW group, n = 10). NMBA was administered three times per week for 5 weeks and rats were fed 1ml water daily using a gavage needle (20 G, curved) throughout the whole study. The rats were euthanized after 25 weeks, and the esophagus was stripped. A part of the esophagus quickly froze, and the transcriptome sequencing work was completed by BGI (The Beijing Genomics Institute). The rest were divided longitudinally into two parts (upper, middle, and lower). One part of the tissue was stored in liquid nitrogen for RNA and protein extraction, and the other portion was fixed in 10% neutral buffered formalin for histological analysis. All animal protocols were approved by the Research Ethics Committee of Zhengzhou University (Zhengzhou, Henan, China). Screening LncRNA expression associated with heat-stimulation The rat esophageal tissue small RNA sequencing was implemented on the BGIseq500 platform (BGI, Wuhan, China). Using Illumina HiSeq (Illumina, San Diego, CA) conduct single end read sequence according to manufacturer’s instructions. Using RSEM to determine gene expression, find differentially expressed lncRNA associated with heat stimulation. The raw data were filtered using the critical value of Fold change > = 2 and FDR < 0.05. and differential genes expression for screening between different groups. LncRNA LTCON_00014107 qPCR primer LncRNA design philosophy: If the overlap of a part of LncRNA and other gene of exon, the other portion doesn’t overlap. We select the non-overlap. LTCONS 00014107 is positioned at chr13:113722967–113787345, design primer sequences on Primer-Blast and the rat skin fibroblast cell (RS1) to do qRT-PCR experiment. The product obtained by 1.5% agarose gel experiment to verify the specificity of the primer. Forward: TGACACCAGGCCCAGCTAGT Reverse: AAGCATGGTGGATTTGGCAG Histological grad of preneoplastic lesions According to the classification criteria of Philip R Taylor and Gray D. Stoner 21 , A histological grades of esophageal precancerous lesion in rat: normal epithelium, hyperplasia, mild dysplasia, moderate dysplasia and severe dysplasia. Patient samples Henan Cancer Hospital (Henan, China) provide nineteen pairs of esophageal cancer patient tissues and adjacent tissues. Esophageal cancer patients’ histological diagnosis was corroborated by eligible histopathologists. The protocol in this study was approved by the Ethics Committee of China-US (Henan) Hormel Cancer Institute (Henan, China). Cell culture and transfection Rat skin fibroblasts RS1 were purchased from Jiangsu KeyGEN BioTECH Corp.Ltd. The Shantou human embryonic esophageal (SHEE cell line was kindly provided by Professor Enmin Li (Medical College of Shantou University, Guangdong, China) 22 . The human embryonic kidney 293T (HEK293T) cell line, KYSE30, KYSE140, KYSE410, KYSE450, and KYSE510 human ESCC cell lines were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The cell line was tested and authenticated by STR. Cell precipitation of the above cell line was collected and then sent to Sangon company, and DNA was extracted and tested by STR. The last time the cell line was tested was in July 2024. No mycoplasma contamination was recently tested in all cell lines. The siRNA of LTCONS 00014107, the miR-29b-2-3p antisense, the miR-29b-2-3p mimics and negative control RNA duplex (NC) were purchased from GenePharma (Shanghai, China). For cell transfection, cells were seeded until reaching 70% confluency and transfected with x-fect according to the manufacturer’s instructions. Quantitative real-time PCR Total RNA was isolated from cell cultures and tissues using TRIzol reagent (Invitrogen, 94402), 1ug RNA samples was reverse transcribed into cDNA using a PrimeScript™ RT reagent kit (Takara, Japan). The miRNA sequence-specific primers for miR-29b-2-3p and endogenous control U6 snRNA were purchased from GenePharma (Shanghai, China) and primers of GPR37 were obtained from Shangya (Henna, China). Using a SYBR Premix Ex Taq™ II kit (Takara, Japan) and an ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) to detect the expression level of miR-29b-2-3p and GPR37 in cells or tissues according to the operating manual. The relative expression levels of miR-29b-2-3p and GPR37 were quantified by the 2 −ΔΔCt . Cell heat stimulation assay For the cell heat stimulation assay, cells were seeded into a 6-well plate until the next day reaching 80% confluency and changed medium. Adjust the cell incubator to 42°C in advance. Wash the 2 multiple-well cells of the 6-well plate twice with pre-chilled 1×PBS, add 300µl TRIzol to each well, repeatedly pipet and lyse with an RNase-free pipette tip, and transfer to the corresponding RNase-free EP Tube to collect RNA. Put the remaining cells in the 42°C incubator for heat stimulation (RS1 cells heat stimulation for 2 hours and SHEE cells for 1 hour) and collect RNA, then remove the remaining cells in a 37°C incubator for cells recovered themselves 1, 2, 4, 6 and 8 hours, collect RNA at the corresponding time points. After cells recovered 2 hours, quickly changed the medium containing actinomycin D (Act D) with a final concentration of 50µg/ml on part of the 6-well plates and put them in a 37°C incubator to continue culturing for 4, 6, and 8 hours, collect the Act D-added RNA at the corresponding time point. Finally, RNA and detected expression level of LTCONS_00014107 and miR-29b-2-3p by qRT-PCR. Cell proliferation and colony formation assays For cell proliferation assay, transfected KYSE30, KYSE510 cells were seeded at the density of 1500 cells per well and KYSE140 cells were 2000 cells and KYSE410 cells were 2500cells per well into 96-well plates and allowed to proliferate for 0 and 72 hours, RS1 cells proliferate at a density of 2500 cells per well for 0 and 48 hours, then added 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 3 mg/ml) and incubated for 2 hours at 37°C. Dimethyl sulfoxide (200ul) was added to stop the reaction. The absorbance values were measured at 570 nm using an ELX800 spectrophotometric plate reader (Bio-Tek, Winooski, VT, USA). For cell clone formation assay, the cell suspension (8×10 3 cells/well) was mixed with15% FBS-RPMI-1640 and seeded on 3 ml solidified RPMI-1640/10% FBS/0.5% agar in each well of 6-well cell culture plate. For the crystal violet assay, each well was seeded with 200 cells, but KYSE140 was 500 cells. The cell was maintained in a 37℃, 5% CO 2 incubator for 1–2 weeks, then fixed with 4% paraformaldehyde solution for 30 min and stained with 0.4% crystal violet solution for 5 min. Finally, the number of colonies in each well was counted using the Image-J software program. Construction of miRNA sponge plasmid The miRNA sponge method was introduced to create continuous miRNA loss of function in cell lines and transgenic organisms. Sponge RNAs contain complementary binding sites to a miRNA of interest and are produced from transgenes within cells. According to reference 23 , we designed the sponge sequence of miR-29b-2-3p. Set the mismatch base CGA- at the middle position UGAA of the mature miR-29b-2-3p sequence UAGCACCAUUUGAAAUCAGUGUU, and use 4 nucleotides CCGG as the linking sequence to connect 4 miR-29b-2-3p target sites, both ends set NheI-HF and BamHI-HF restriction sites. Finally, send the miR-29b-2-3p sponge oligonucleotide sequence to the company for synthesis. miR-29b-2-3p sponge forward (104nt) ctagAACACTGATCGAAATGGTGCTACCGGAACACTGATCGAAATGGTGCTACCGGAACACTGATCGAAATGGTGCTACCGGAACACTGATCGAAATGGTGCTA miR-29b-2-3p sponge reverse (104nt) gatcTAGCACCATTTCGATCAGTGTTCCGGTAGCACCATTTCGATCAGTGTTCCGGTAGCACCATTTCGATCAGTGTTCCGGTAGCACCATTTCGATCAGTGTT The construct was then subcloned into pcDNA3.1 vector. Cells were transfected with 2µg pcDNA3.1 or pcDNA3.1-miR-29b-2-3p sponge plasmid using Lipofectamine™ 2000 and screened by G418 to obtain a stable expression cell line of miR-29b-2-3p sponge. Target gene prediction for miR-29b-2-3p The target genes of miR-132-3p were predicted by the online tools including TargetScanHuman( http://www.targetscan.org/ ), miRWalk( http://mirwalk.umm.uniheidelberg.de/ ), microRNA.org( http://www.microrna.org/ ), starBase( http://www.starbase.sysu.edu.cn/ ). Using a Venn diagram for the intersection of miR-29b-2-3p predicted target genes were identified and the overlapped genes were used for next step analysis. Dual luciferase reporter assay The 3’-untranslated region (3’-UTR) sequence of the GPR37 gene was acquired from the NCBI website, and the binding site of miR-29b-2-3p with GPR37 was predicted by the TargetScan Human program. The plasmid pmirGLO and pmirGLO Dual-Luciferase miRNA Target Expression Vector (termed as pmirGLO-wt-GPR37) were purchased by Sunya.Henan. Based on the binding site of miR-29b-2-3p and GPR37 3'-UTR, a mutant plasmid (termed pmirGLO-mut-GPR37) was purchased by Shenggong Biotech, Shanghai. All constructs were confirmed by DNA sequencing. For dual luciferase reporter assay, HEK293T cells or KYSE30 cells were seeded into 24-well plates until reaching 70% confluency per well and transfected with 500ng reporter construction plasmid (pmirGLO, pmirGLO-wt-GPR37, pmirGLO-mut-GPR37) and 500ng small RNA (miR-29b-2-3p mimic or control) using X-fect as described previously. After transfection 48h, a Promega Glo Max fluorescence detector (set detection time 10s, time interval 2s) to detect Firefly luciferase activity and Renilla luciferase activity. Relative luciferase activity was denoted by the ratio of Firefly to Renilla luciferase activity. In situ hybridization (ISH) ISH was used for miR-29b-2-3p expression in preneoplastic lesions of human esophagus tissues by using an ISH kit (BOSTER, China). Follow the manufacturer’s instructions. Oligo (5′ Digoxin- AACACTGATTTCAAATGGTGCTA − 3′) was used as the miR-29b-2-3p ISH probe. The preneoplastic lesions of patient esophagus tissues and normal tissues were gained from Henan Cancer Hospital (Henan, China). The results analysis was used the Aperio ImageScope program. Immunofluorescence (IF) For immunofluorescence, KYSE510 cells into 24 wells were seeded in glass slides until reaching 70% confluency the next day, then transfect silencing of miR-29b-2-3p and over-regulation of miR-29b-2-3p. Two days later, precooled 4% paraformaldehyde was fixed for 20min after washing three times with PBS. Using fluorescein isothiocyanate (FITC)-conjugated primary antibodies against GPR37 antibody (proteintech,14820-1-AP,1:100) dilution containing 3%BSA and 1%goat serum and 0.3%Triton-X100 overnight at 4°C. Use PBST wash three times in a shake, and then incubate for 2 hours using a secondary antibody (Invitrogen,1:1000) to protect from light and then use PBST washing three times. The nuclei were stained with 4’6-diamidino-2-phenylindole (DAPI). Fluorescence microscopy was used to observe and photograph fluorescent sections. The results analysis used the ImageJ program. Immunohistochemistry (IHC) Immunohistochemistry was performed to detect GPR37 expression in the different grades of precancerous lesions and cancer of human esophagus tissues. The slides were incubated with the GPR37 (ThermoFisher, PA5-13412,1:100) antibody overnight at 4°C. After washing with PBS, samples were incubated with HRP-conjugated secondary antibody before analysis by microscopy. GPR37 positive cells were quantified using the Aperio ImageScope program. In vivo cell-derived xenograft mouse model This study was approved by the Ethics Committee of Zhengzhou University (Zhengzhou, Henan, China). The negative control (NC) and miR-29b-2-3p antisense were transfected into KYSE30 cells to construct stable miR-29b-2-3p knockdown KYSE30 cells. The NOD SCID mice (10 females, 6-weeks old) were used for the experiment. The NC-KYSE30 cells were injected into the left shoulder of mice, and the miR-29b-2-3p antisense-KYSE30 were injected into the right shoulder of mice. The mice’s weight and tumor volume were measured every two or three days after a one-week injection. Mice were sacrificed 16 days after injection, and the subcutaneous tumors were removed and weighed. Statistical analysis GraphPad Prism 8 software was used to analyze the data involved in this experiment. The results were expressed as mean ± standard deviation (SD). Comparison between the two groups was performed by Student’s t -test and using one-way analysis of variance (ANOVA) was used to analyze differences among the three groups. The results of each experiment were repeated three times and a P value less than 0.05 was considered statistically significant. Results NMBA-induced precancerous lesions of heat-stimulated rat esophageal mucosa NMBA is a well-known nitrosamine carcinogen, which can induce tumorigenesis of rat esophagus 24 . To evaluate whether heat stimulation (hot water at 65°C) can promote this process, F344 rats were randomly divided into 5 groups, some of them were injected with low-dose NMBA (0.25 mg/kg) into the rats, and human eating habits were simulated to allow water of different temperatures to flow slowly through the rat’s esophagus to stimulate it (Fig. 1 A, Supplementary Table 1). The results showed that F344 rats treated with hot water at 65℃ for up to 25 weeks developed hyperplasia. Tissue samples from different groups of rats at 25 weeks were sent to BGI for sequencing. The Illumina HiSeq research platform was used to detect LncRNAs from five different groups. Using a cut-off value of a two-fold change and an FDR less than 0.05, we identified 44 differentially expressed Known lncRNA and 52 Novel lncRNA respectively: 31 and 26 LncRNAs were up-regulated, whereas 13 and 26 LncRNAs were down-regulated (Fig. 1 B, Supplementary Table 2). We designed these lncRNA primers and verified RNA-seq results with the esophageal tissue of the rat heat stimulation experiment, and found that the expression of LTCONS_00014107 was consistent with the sequencing results (Fig. 1 C). Simulating the animal model of esophageal carcinogenesis induced by heat stimulation, RS1 cells was treated in a 42℃ incubator. qRT-PCR results showed that after heat stimulation, the expression of LTCONS_00014107 in RS1 cells was up-regulated, and reached the highest point at recovery 2 hours, which was inconsistent with the decrease of RNA-seq results, but with the extension of recovery time, LTCONS_00014107 gradually decreased, and at recovery 6 hours, LTCONS_00014107 is slightly reduced compared with the control (Fig. 1 D). We guessed that heat stimulation can temporarily increase LTCONS_00014107 expression, but after long-term chronic heat stimulation, the expression of LTCONS_00014107 was decreased, which was consistent with the decrease of LTCONS_00014107 expression after stimulation with 65℃ hot water for 25 weeks in our animal experiment. Overall, these results confirmed that long-term heat stimulation can promote precancerous lesions of esophageal mucosa in rats, whereas ice-cold water had a preventive effect on this process. Knockdown of LTCONS_00014107 inhibits cell growth and colony formation of RS1 cells To further explore the role of LTCONS_00014107 in RS1 cell proliferation and colony formation, we ordered 3 pairs of LTCONS_00014107 siRNA and Mock (Supplementary Table 3). The position of LTCONS_00014107 sequence where the 3 pairs of siRNA were located does not overlap with the LTCONS_00014107 specific primer and miR-29b-2-3p position (Fig. 2 A). We transfected into RS1 cells, and the results showed that the expression level of LTCONS_00014107 was significantly reduced in siRNA-1 group and siRNA-3 group compared with Mock group, while siRNA-2 group had no significant difference (Fig. 2 B), so choose siRNA-1 and siRNA-3 for further research. Figure 2 C-D showed that the knockdown of LTCONS_00014107 can significantly inhibit cell growth and colony formation of RS1 cells (Fig. 2 C-D). Therefore, we speculated that LTCONS_00014107 may play the role of oncogene in rat skin fibroblasts. Degradation of LTCONS_00014107 promotes the expression of miR-29b-2-3p Sorted out RNA-seq data, it was found that the sequence of lncRNA LTCONS_00014107 contained pre-mir-29b-2 and miR-29b-2-3p sequences (Fig. 2 A), which was located at the same chromosome position: 13q27. RNA-seq results showed that LTCONS_00014107 was down-regulated in rat esophageal cancerous tissue induced by heat stimulation, and miR-29b-2-3p was up-regulated, so we hypothesized that LTCONS_00014107 was the precursor of miR-29b-2-3p. To verify this hypothesis, first we used rat esophageal tissue and RS1 cells to detect the expression of miR-29b-2-3p. The results showed that the expression of miR-29b-2-3p in the NMBA + HW group was significantly higher than NMBA + RT group (Fig. 2 E), and heat stimulation-induced miR-29b-2-3p up-regulation in RS1 cells, which was consistent with the RNA-seq results. However, compared with LTCONS_00014107, the time to reach the highest point was moved to recovery 4 hours, suggesting that the up-regulation of miR-29b-2-3p may be caused by the degradation of LTCONS_00014107(Fig. 3 A). To further confirm that the degradation of LTCONS_00014107 leads to the up-regulation of miR-29b-2-3p, we added Act D at the highest point of LTCONS_00014107 expression to inhibit mRNA synthesis and eliminate the endogenous synthesis pathway of miR-29b-2-3p. The results showed that LTCONS_00014107 decreased rapidly after adding Act D, while the expression of miR-29b-2-3p gradually increased, and the highest point moved to recovery 6 hours (Fig. 3 B). At the same time, MTT results showed that there was no significant difference in the cell OD value after heat stimulation at 42°C for 2 hours, which ruled out the RNA changes caused by cell death (Fig. 3 C). Overall, these results indicated that heat stimulation promoted the expression of miR-29b-2-3p in rat esophageal tissues and cells, and the degradation of LTCONS_00014107 promoted the expression of miR-29b-2-3p. LTCONS_00014107 may be the precursor of miR-29b-2-3p. The expression of miR-29b-2-3p is induced by heat stimulation To investigate whether miR-29b-2-3p associated with heat stimulation is conserved in the genome, we compared the sequence homology of miR-29b-2-3p among human, mouse, rat, housefly, macaque, gorilla, chicken, and cattle species, it was found that the sequence was highly similar, especially in human, mouse and rat, the sequence identity was as high as 100% (Fig. 3 D). Therefore, we will explore the role and mechanism of miR-29b-2-3p in the process of human esophageal carcinogenesis induced by heat stimulation. To further determine whether miR-29b-2-3p had a similar expression pattern in human normal esophageal epithelial cells induced by heat stimulation as in rats, SHEE cells were heat stimulated in a 42°C incubator for 1 hour, and then recovery in a 37°C incubator for different time. The results showed that the expression of miR-29b-2-3p in SHEE cells induced by heat stimulation was significantly higher than control group, and at recovery 2 hours reached the highest point, with the extension of recovery time, miR-29b-2-3p gradually decreased (Fig. 3 E), similar to the expression pattern of rat RS1 cells, indicating that miR-29b-2-3p has an important role in the process of heat-induced carcinogenesis of the human esophagus. Since heat stimulation was a potential risk factor for ESCC, we further detected the expression of miR-29b-2-3p in ESCC cell lines by qRT-PCR and found that compared with human normal esophageal epithelial cells SHEE, miR-29b-2-3p was up-regulated in most ESCC cell lines (Fig. 3 F). According to website Kaplan-Meier Plotter, we had inquired the lifetime of miR-29b-2-3p in ESCC. We concluded that higher expression of miR-29b-2-3p was associated with lower survival (Fig. 3 G). To verify this hypothesis, we used human esophageal precancerous and cancerous tissues by ISH assay, we found miR-29b-2-3p high expression in high-grade precancerous lesions and cancerous tissues than low-grade and normal tissues (Fig. 3 H). miR-29b-2-3p Knockdown can suppress ESCC cell growth and colony formation To further explore the role of miR-29b-2-3p on cell proliferation and colony formation of ESCC. Transfection of miR-29b-2-3p sponge respectively in KYSE30, KYSE410 and KYSE510 cells. The miR-29b-2-3p knockdown stable cell lines were established by G418 selection. qRT-PCR was used to detect knockdown efficiency, and the results showed that the expression level of miR-29b-2-3p sponge groups was significantly lower than control groups (Fig. 4 A). Next, we evaluated whether miR-29b-2-3p influenced cell proliferation and cell growth of ESCC by cell proliferation assay and colony formation assay. Our results suggested that knocking down miR-29b-2-3p could alleviate cell growth and generate fewer and smaller colonies in KYSE30, KYSE410, and KYSE510 cells compared with control cells (Fig. 4 B-D). miR-29b-2-3p overexpression promotes cell growth and colony formation To prove that miR-29b-2-3p may positively take part in esophageal squamous cell carcinoma, we tested whether overexpression of miR-29b-2-3p could promote cell proliferation and colony formation in human ESCC cells. Firstly, we respectively transfected pLenti-miR-29b-2-3p and pLenti-Control in KYSE140 and KYSE510. The miR-29b-2-3p overexpression stable cell lines were built by puro selection. Then detecting the expression of miR-29b-2-3p by using qRT-PCR and the results indicated that the expression level of miR-29b-2-3p was significantly increased compared with control groups (Fig. 4 E). It’s exactly what we predicted, overexpression of miR-29b-2-3p could significantly promote cell proliferation and colony formation in KYSE140 and KYSE510 cells compared with control cells (Fig. 4 F-H), the suggested that miR-29b-2-3p may play a critical facilitation role in human ESCC progression. GPR37 is a direct target of miR-29b-2-3p To explore the molecular mechanism of miR-132-3p in ESCC, potential downstream regulatory targets of miR-29b-2-3p from several bioinformatics databases including TargetScanHuman, miRWalk, microRNA, and StarBase. Venny2.0 analysis tool was further used to superimpose the targets of miR-29b-2-3p, and we screened 33 potential target genes (Fig. 5 A, Supplementary Table 4). Next, to further identify the target genes regulated by miR-29b-2-3p, the expression of 33 genes in esophageal cancer was searched by the Oncomine ( http://www.oncomine.org/ ) database. Due to the negative regulation between miRNA and target genes, four genes including AMOT, EML5, GAS7, and GPR37 were initially screened out. To further determine which gene was the target of miR-29b-2-3p. We co-transfected miR-29b-2-3p mimics or NC mimics and pmirGLO-wt-AMOT, pmirGLO-wt-EML5, pmirGLO-wt-GAS7 or pmirGLO-wt-GPR37, respectively. Then we tested the ratio of Firefly to Renilla luciferase activity. It was found that GPR37 was most likely the downstream regulatory gene of miR-29b-2-3p (Fig. 5 B). To further determine whether GPR37 was a target for miR-29b-2-3p we used Targetscan software to predict the 3’-UTR of GPR37 that binds to miR-29b-2-3p. The result showed that the 235–242 nucleotide-binding region of GPR37 was probably miR-29b-2-3p binding region, then we mutate the binding site (Fig. 5 C). Following, the sequences containing the binding or mutation sites of miR-29b-2-3p were inserted into the pmirGLO dual-luciferase miRNA target expression vector (termed as pmirGLO-wt-GPR37 and pmirGLO-mut-GPR37). Finally, we respectively co-transfected miR-29b-2-3p mimics or NC mimics and pmirGLO, pmirGLO-wt-GPR37, or pmirGLO-mut-GPR37 in HEK293T. The result demonstrated that the luciferase activity was suppressed in the pmirGLO-wt-GPR37 group, whereas the pmirGLO-mut-GPR37 group had no such effect (Fig. 5 D). To verify if this effect occurs in ESCC and we transfected KYSE30 in the same way. Similar results were observed in KYSE 30 cells (Fig. 5 E). Overall, our findings further reinforce that GPR37 is the direct target gene of miR-29b-2-3p, the expression level of GPR37 was measured in miR-29b-2-3p knockdown and overexpression stable cell lines respectively. The results showed that GPR37 was upregulated in miR-29b-2-3p knockdown cells whereas downregulated in miR-29b-2-3p overexpression cells, which suggested that miR-29b-2-3p could negatively regulate the expression of GPR37(Fig. 5 F-G). According to the website Kaplan-Meier Plotter, we have inquired about the lifetime of GPR37 in ESCC (Fig. 5 H). We concluded that higher expression of GPR37 was associated with higher survival. To further verify that GPR37 was the target of miR-29b-2-3p. we up-regulate and down-regulate miR-29b-2-3p in KYSE510 to detect the expression of GPR37 by immunofluorescence, we observed that GPR37 down-regulate in high expression of miR-29b-2-3p. whereas in the low expression of miR-29b-2-3p, the result was reversed (Fig. 5 I). These results suggested that GPR37 was the downstream regulatory molecule of miR-29b-2-3p. Knockdown of miR-29b-2-3p suppresses ESCC cell growth in vivo To evaluate the role of miR-29b-2-3p on tumor growth in vivo , we established tumor xenografts in SCID mice. The results revealed that miR-29b-2-3p knockdown significantly slowed down the xenograft tumor growth, and the tumor weight also decreased significantly (Fig. 6 A-C). The ISH assay revealed that compared with the NC group, the expression of miR-29b-2-3p was significantly reduced in the miR-29b-2-3p antisense group (Fig. 6 D-E). These results indicated that miR-29b-3p is an important promoter of ESCC proliferation. Taken together, these data suggested that in heat-induced esophageal cancer, degradation of LTCONS_00014107 led to elevated miR-29b-2-3p, which in turn led to downregulation of the downstream target gene GPR37 via sponge adsorption, all of which ultimately led to the proliferation of esophageal cancer. Discussion In recent years, although many oncogenes, tumor suppressor genes and tumor-related signaling pathways have been identified and confirmed, the pathogenesis of esophageal cancer remains unclear. For decades, LncRNA was thought to be “noise” or “pseudogene” of transcription in the human genome, with no biological 25 , 26 . Thus, it was largely overlooked. LncRNA is a key component of the coding of nuclear tissue, allowing protein complexes, genes, and chromosomes to be transported to the correct places and to be properly activated and inactivated, and their dysregulation is the basis of human diseases 27 . They affect cell proliferation, migration, and invasion by regulating the expression of genes in the tumorigenic pathway 28 , 29 . With the rapidly developing second-generation sequencing technology (NGS), the study of LncRNA is more and more in-depth. Esophageal cancer contributes to the consumption of hot food and drinks, especially ESCC. It has long been suspected as a potentially modifiable factor 30 . Experimental research found that hot water temperatures above 65°C to 70°C may increase the incidence rate of nitrosamine-induced esophageal tumors in animal models 31 . In this study, the animal model of esophageal precancerous lesions induced by heat stimulation was established by intragastric injection of hot water at 65°C in rats, simulating the habits of drinking hot drinks in humans. The LncRNA and miRNA profiles of esophageal tissues are analyzed by RNA-seq. It was found that 57 LncRNAs were up-regulated and 39 LncRNAs were down-regulated after heat treatment. The down-regulated LTCONS_00014107 contained the sequence of up-regulated miR-29b-2-3p, and both were located at the same chromosomal position. Thus, we hypothesized that LTCONS_00014107 may be a precursor of miR-29b-2-3p, which both play a key role in heat-stimulation-induced precancerous lesions. LTCONS_00014107 is an unknown non-coding RNA with a length of 50652nt, which has not been reported yet. To verify the accuracy of the sequencing results, specific qRT-PCR primers were designed for the part of the LTCONS_00014107 sequence that did not overlap with the exons of other genes, in vivo thermal stimulation experiment showed that the expression of RS1 cells increased rapidly after thermal stimulation, which was inconsistent with the decrease of sequencing results. However, with the extension of repair time after heat stimulation, the expression of LTCONS_00014107 decreased gradually, and at 6 hours of repair, compared with the control group, LTCONS_00014107 expression decreased slightly. Therefore, we speculated that the expression of LTCONS_00014107 could be briefly increased by heat stimulation, but after long-term chronic thermal stimulation, the LTCONS_00014107 expression would decrease, which was consistent with the decrease of LTCONS_00014107 expression in our animal experiment after continuous 20 weeks of 65°C hot water stimulation. LncRNA has a wide range of functions and very complex mechanisms. LncRNA biogenesis occurs in the nucleus and reflects the synthesis of protein-coding transcripts 11 .LncRNA plays a role in chromatin modification, enhancer function, genomic imprinting, and DNA damage. It also regulates mRNA progression and post-transcriptional regulation 32 . In this study, we guessed that LTCONS_00014107 might be the precursor of miR-29b-2-3p. To verify our guess, we added ActD in the thermal stimulation experiment, which could interfere with cell transcription, thus eliminating the endogenous synthesis pathway of miR-29b-2-3p. The experimental results showed that after adding ActD, the LTCONS_00014107 expression decreased rapidly, while the time for miR-29b-2-3p to reach the highest expression level moved significantly later, indicating that the degradation of LTCONS_00014107 promoted the expression of miR-29b-2-3p, and LTCONS_00014107 may be the precursor of miR-29b-2-3p, which verified our conjecture. miR-29 family consists of miR-29a, miR-29b, miR29c, among which miR-29b has the highest expression. miR-29b-1 and miR-29b-2 are two numbers of the miR-29 family. The miR-29 family is encoded and transcribed in tandem by two genes on chromosomes 7q32.3 and 1q32.2. Thus, mature miR-29b is encoded by two different precursor stem sequences pre-miR-29b-1 and pre-miR-29b-2 on two chromosomes. Although the sequences of two pre-miR-29b are not the same, they produce the same mature miR-29b 33 . Increasingly studies have found that the miR-29b family is involved in the malignant behavior of tumors in multiple transcription processes, suggesting that it plays a crucial role in the development of tumors 34 . We found that miR-29b-2-3p sequences were highly similar among various species, especially among humans, mice, and rats, whose sequence consistency was as high as 100%. In general, homology can be inferred from sequence similarity, and the higher the similarity, the more similar the biological function 35 , 36 . Therefore, we will take miR-29b-2-3p as the research object to explore its role in the process of human esophageal cancer. According to our study, miR-29b-2-3p was significantly upregulated in SHEE cells induced by heat stimulation. The results were consistent with RNA-seq, suggesting that miR-29b-2-3p may be a potential molecular target of esophageal carcinoma induced by thermal stimulation. Recently, miR-29b is well known for its role as a tumor suppressor, but many studies have suggested that miR-29b may also express oncogenes. Many studies have proved that the expression of miR-29b is related to the pathological classification and prognosis of tumors. Richard F et al. confirmed that low expression of miR-29b can prolong the survival time of serous ovarian cancer patients 37 . Budhu A et al. showed that the high expression of miR-29b promotes the metastasis of hepatocellular carcinoma (HCC) and reduces the survival time of HCC patients. 38 Chen W et al. proved that miR-29b expression in tissues and cells of metastatic breast cancer was significantly higher than that low metastatic breast cancer, which could directly inhibit the expression of PTEN to enhance the expression of miR-29b and then promote cell invasion and migration. In addition, overexpression of miR-29b is associated with advanced tumor stage, lymph node metastasis, and poor prognosis, suggesting that miR-29b can be used as a marker of molecular prognosis 39 .miR-29b is also involved in cancer-mediated inflammation, interleukin-15 (IL-15) is a pro-inflammatory factor that can cause chromosomal instability and DNA hypermethylation by inhibiting miR-29b 40 . At present, the role of miR-29b-2-3p in ESCC is rarely reported. To further explore the mechanism of miR-29b-2-3p in ESCC, a series of cell biology experiments were conducted. Firstly, miR-29b-2-3p expression level in ESCC cell lines was detected by qRT-PCR, and it was found that miR-29b-2-3p expression in most ESCC was obviously higher than that in SHEE. Then miR-29b-2-3p sponge was used to inhibit miR-29b-2-3p expression, and cell proliferation and colony formation of KYSE30, KYSE410, and KYSE510 were distinctly inhibited compared with the control group. Reversely, overexpression of miR-29b-2-3p significantly promoted cell proliferation and colony formation of KYSE510, suggesting that miR-29b-2-3p plays an oncogene role in ESCC. To further study the regulatory mechanism of miR-29b-2-3p of developing ESCC, we predicted the target gene of miR-29b through four bioinformatics databases and further confirmed GPR37 as a potential target gene of miR-29b-2-3p by Dual-luciferase reporter assay. In conclusion, heat stimulation promotes the development of ESCC through the LTCONS_00014107-miR-29b-2-3p-GPR37 axis, offering a potential therapeutic target for the clinical prevention and treatment of esophageal cancer. Declarations Ethics approval and consent to participate(Not applicable) Consent for publication(Not applicable) Availability of data and materials: The data underlying this article are available in the article and in its online supplementary material. Competing Interests: The authors declare no competing financial interests. Funding: This work was supported by National Natural Science Foundation of China (No.82073075, 82172996); Major Science and Technology Projects in Henan Province (No. 221100310100); Training plan for young backbone teachers of Henan Province (No. 2020GGJS010); Basic research and Cultivation Fund for young teachers of Zhengzhou University (No. JC202035023); Science and technology innovation talents support plan of Henan Province (No.21HASTIT048); Innovation team support plan for outstanding young talents of Zhengzhou University. Authorship Contributions: Author contributions: Xiang Li designed and implemented the study. Wenting Liu and Jing Wang contributed equally to data gathering and the follow-up process. Jiaqiong Li, and Dan Cheng participated in the experimental process. Wenting Liu and Xiang Li drafted the manuscript with important contributions from Liting Zhou, Yiu To Yeung, Hui Huang, and Yunfeng Gao. Jiaping Qu participated in the supplement, submission of the manuscript and supplement of later experiments. All authors contributed to the interpretation of the study results and critical revision of the manuscript. All authors reviewed the manuscript and approved the final version to be published. Xiang Li and Zigang Dong are guarantors. Acknowledgments: Author names in bold designate shared co-first authorship. We thank the teachers from the Department of Pathophysiology and the China-US (Henan) Hormel Cancer Institute for their support and assistance and thank them provide the experimental platform and experimental equipment. Author information: Wenting Liu: [email protected] , Jing Wang: [email protected] , Jia ping Qu: [email protected] , Dan Cheng: [email protected] , Jiaqiong Li: [email protected] , Yiu To Yeung: [email protected] , Liting Zhou: [email protected] , Yunfeng Gao: [email protected] , Hui Huang: [email protected] Correspondence:Address correspondence to: Zigang Dong, PhD, Department of Pathophysiology, School of Basic Medical Sciences, Zhengzhou University, Zhengzhou, Henan, China. E-mail: [email protected] ; or Xiang Li, PhD, Department of Pathophysiology, School of Basic Medical Sciences, Zhengzhou University, Zhengzhou, Henan, China. E-mail: [email protected] . Statement: All experiments were performed according to the approved protocol from the ethics committee and other relevant guidelines and regulations. The maximal tumor size/burden in experiments permitted by the ethics committee was not exceeded. References Sung, H. et al. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71 , 209-249, doi:10.3322/caac.21660 (2021). Chen, W. et al. Cancer statistics in China, 2015. CA Cancer J Clin 66 , 115-132, doi:10.3322/caac.21338 (2016). Cancer Genome Atlas Research, N. et al. Integrated genomic characterization of oesophageal carcinoma. Nature 541 , 169-175, doi:10.1038/nature20805 (2017). Zeng, H. et al. Changing cancer survival in China during 2003-15: a pooled analysis of 17 population-based cancer registries. Lancet Glob Health 6 , e555-e567, doi:10.1016/S2214-109X(18)30127-X (2018). Lubin, J. H. et al. Mate drinking and esophageal squamous cell carcinoma in South America: pooled results from two large multicenter case-control studies. Cancer Epidemiol Biomarkers Prev 23 , 107-116, doi:10.1158/1055-9965.EPI-13-0796 (2014). Islami, F. et al. A prospective study of tea drinking temperature and risk of esophageal squamous cell carcinoma. Int J Cancer 146 , 18-25, doi:10.1002/ijc.32220 (2020). Islami, F. et al. Tea drinking habits and oesophageal cancer in a high risk area in northern Iran: population based case-control study. BMJ 338 , b929, doi:10.1136/bmj.b929 (2009). Tran, G. D. et al. Prospective study of risk factors for esophageal and gastric cancers in the Linxian general population trial cohort in China. Int J Cancer 113 , 456-463, doi:10.1002/ijc.20616 (2005). Taylor, P. R. et al. Prevention of esophageal cancer: the nutrition intervention trials in Linxian, China. Linxian Nutrition Intervention Trials Study Group. Cancer Res 54 , 2029s-2031s (1994). Consortium, E. P. An integrated encyclopedia of DNA elements in the human genome. Nature 489 , 57-74, doi:10.1038/nature11247 (2012). Guttman, M. & Rinn, J. L. Modular regulatory principles of large non-coding RNAs. Nature 482 , 339-346, doi:10.1038/nature10887 (2012). Cai, Y., Yu, X., Hu, S. & Yu, J. A brief review on the mechanisms of miRNA regulation. Genomics Proteomics Bioinformatics 7 , 147-154, doi:10.1016/S1672-0229(08)60044-3 (2009). Ulitsky, I. & Bartel, D. P. lincRNAs: genomics, evolution, and mechanisms. Cell 154 , 26-46, doi:10.1016/j.cell.2013.06.020 (2013). Ponting, C. P., Oliver, P. L. & Reik, W. Evolution and functions of long noncoding RNAs. Cell 136 , 629-641, doi:10.1016/j.cell.2009.02.006 (2009). Tan, Y. T. et al. LncRNA-mediated posttranslational modifications and reprogramming of energy metabolism in cancer. Cancer Commun (Lond) 41 , 109-120, doi:10.1002/cac2.12108 (2021). Ferre, F., Colantoni, A. & Helmer-Citterich, M. Revealing protein-lncRNA interaction. Brief Bioinform 17 , 106-116, doi:10.1093/bib/bbv031 (2016). Liu, B., Li, J. & Cairns, M. J. Identifying miRNAs, targets and functions. Brief Bioinform 15 , 1-19, doi:10.1093/bib/bbs075 (2014). Kabekkodu, S. P. et al. Clustered miRNAs and their role in biological functions and diseases. Biol Rev Camb Philos Soc 93 , 1955-1986, doi:10.1111/brv.12428 (2018). Van Roosbroeck, K. & Calin, G. A. Cancer Hallmarks and MicroRNAs: The Therapeutic Connection. Adv Cancer Res 135 , 119-149, doi:10.1016/bs.acr.2017.06.002 (2017). Hayes, J., Peruzzi, P. P. & Lawler, S. MicroRNAs in cancer: biomarkers, functions and therapy. Trends Mol Med 20 , 460-469, doi:10.1016/j.molmed.2014.06.005 (2014). Taylor, P. R., Abnet, C. C. & Dawsey, S. M. Squamous dysplasia--the precursor lesion for esophageal squamous cell carcinoma. Cancer Epidemiol Biomarkers Prev 22 , 540-552, doi:10.1158/1055-9965.EPI-12-1347 (2013). Shen, Z.-Y. et al. The genetic events of HPV-immortalized esophageal epithelium cells. International journal of molecular medicine 8 , 537-542 (2001). Ebert, M. S. & Sharp, P. A. MicroRNA sponges: progress and possibilities. RNA 16 , 2043-2050, doi:10.1261/rna.2414110 (2010). Stoner, G. D. et al. Inhibitory effects of phenethyl isothiocyanate on N-nitrosobenzylmethylamine carcinogenesis in the rat esophagus. Cancer Res 51 , 2063-2068 (1991). He, H. T. et al. Biomarker and competing endogenous RNA potential of tumor-specific long noncoding RNA in chromophobe renal cell carcinoma. Onco Targets Ther 9 , 6399-6406, doi:10.2147/OTT.S116392 (2016). She, K. et al. lncRNA-SNHG7 promotes the proliferation, migration and invasion and inhibits apoptosis of lung cancer cells by enhancing the FAIM2 expression. Oncol Rep 36 , 2673-2680, doi:10.3892/or.2016.5105 (2016). Batista, P. J. & Chang, H. Y. Long noncoding RNAs: cellular address codes in development and disease. Cell 152 , 1298-1307, doi:10.1016/j.cell.2013.02.012 (2013). Zhang, H. et al. Long non-coding RNA: a new player in cancer. J Hematol Oncol 6 , 37, doi:10.1186/1756-8722-6-37 (2013). Ling, H. et al. Junk DNA and the long non-coding RNA twist in cancer genetics. Oncogene 34 , 5003-5011, doi:10.1038/onc.2014.456 (2015). Andrici, J. & Eslick, G. D. Hot Food and Beverage Consumption and the Risk of Esophageal Cancer: A Meta-Analysis. Am J Prev Med 49 , 952-960, doi:10.1016/j.amepre.2015.07.023 (2015). Kamangar, F. & Freedman, N. D. Hot Tea and Esophageal Cancer. Ann Intern Med 168 , 519-520, doi:10.7326/M17-3370 (2018). Beermann, J., Piccoli, M. T., Viereck, J. & Thum, T. Non-coding RNAs in Development and Disease: Background, Mechanisms, and Therapeutic Approaches. Physiol Rev 96 , 1297-1325, doi:10.1152/physrev.00041.2015 (2016). Kole, A. J., Swahari, V., Hammond, S. M. & Deshmukh, M. miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. Genes Dev 25 , 125-130, doi:10.1101/gad.1975411 (2011). Xiong, Y. et al. Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis of hepatocellular carcinoma. Hepatology 51 , 836-845, doi:10.1002/hep.23380 (2010). Li, S. C., Pan, C. Y. & Lin, W. C. Bioinformatic discovery of microRNA precursors from human ESTs and introns. BMC Genomics 7 , 164, doi:10.1186/1471-2164-7-164 (2006). Friedman, R. C., Farh, K. K., Burge, C. B. & Bartel, D. P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res 19 , 92-105, doi:10.1101/gr.082701.108 (2009). Flavin, R. et al. miR-29b expression is associated with disease-free survival in patients with ovarian serous carcinoma. Int J Gynecol Cancer 19 , 641-647, doi:10.1111/IGC.0b013e3181a48cf9 (2009). Budhu, A. et al. Identification of metastasis-related microRNAs in hepatocellular carcinoma. Hepatology 47 , 897-907, doi:10.1002/hep.22160 (2008). Wang, C., Bian, Z., Wei, D. & Zhang, J. G. miR-29b regulates migration of human breast cancer cells. Mol Cell Biochem 352 , 197-207, doi:10.1007/s11010-011-0755-z (2011). Mishra, A. et al. Aberrant overexpression of IL-15 initiates large granular lymphocyte leukemia through chromosomal instability and DNA hypermethylation. Cancer Cell 22 , 645-655, doi:10.1016/j.ccr.2012.09.009 (2012). Additional Declarations No competing interests reported. Supplementary Files 14107SupplementaryTable.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5585853","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":409854722,"identity":"595f6d42-a779-44c7-8979-ee205b9de1f4","order_by":0,"name":"Wenting Liu","email":"","orcid":"","institution":"Zhengzhou Orthopaedic Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wenting","middleName":"","lastName":"Liu","suffix":""},{"id":409854723,"identity":"c4d2d79e-2d08-45de-9486-d49012a23c60","order_by":1,"name":"Jing Wang","email":"","orcid":"","institution":"Armed Police Hospital of Henan","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Wang","suffix":""},{"id":409854724,"identity":"a34e8e2b-fec7-4225-9d1f-b56b030cd746","order_by":2,"name":"Jiaping Qu","email":"","orcid":"","institution":"Zhengzhou University","correspondingAuthor":false,"prefix":"","firstName":"Jiaping","middleName":"","lastName":"Qu","suffix":""},{"id":409854725,"identity":"eda66ac2-a1c3-4d7b-9459-038f39bc19ea","order_by":3,"name":"Dan Cheng","email":"","orcid":"","institution":"Zhengzhou University","correspondingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Cheng","suffix":""},{"id":409854726,"identity":"79d105a4-1843-493c-8ba2-819432a5772d","order_by":4,"name":"Jiaqiong Li","email":"","orcid":"","institution":"The New Area People's Hospital of Luoyang","correspondingAuthor":false,"prefix":"","firstName":"Jiaqiong","middleName":"","lastName":"Li","suffix":""},{"id":409854727,"identity":"65bc45dd-7426-40b3-96ed-bf6aac59686f","order_by":5,"name":"Yiu To Yeung","email":"","orcid":"","institution":"China-US (Henan) Hormel Cancer Institute","correspondingAuthor":false,"prefix":"","firstName":"Yiu","middleName":"To","lastName":"Yeung","suffix":""},{"id":409854728,"identity":"0d141340-270d-4420-a26a-c6876a32693e","order_by":6,"name":"Liting Zhou","email":"","orcid":"","institution":"China-US (Henan) Hormel Cancer Institute","correspondingAuthor":false,"prefix":"","firstName":"Liting","middleName":"","lastName":"Zhou","suffix":""},{"id":409854729,"identity":"6e610faa-00bb-45e1-bff2-7e318565ef82","order_by":7,"name":"Yunfeng Gao","email":"","orcid":"","institution":"China-US (Henan) Hormel Cancer Institute","correspondingAuthor":false,"prefix":"","firstName":"Yunfeng","middleName":"","lastName":"Gao","suffix":""},{"id":409854730,"identity":"55504712-60d1-4230-bfa6-cb2fa334793b","order_by":8,"name":"Hui Huang","email":"","orcid":"","institution":"Zhengzhou University","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Huang","suffix":""},{"id":409854731,"identity":"ada13e28-8e4f-4e20-88b4-db4bd393c3a5","order_by":9,"name":"Zigang Dong","email":"","orcid":"","institution":"Zhengzhou University","correspondingAuthor":false,"prefix":"","firstName":"Zigang","middleName":"","lastName":"Dong","suffix":""},{"id":409854732,"identity":"c50887a3-f045-4b28-b9df-86c024b6a8dc","order_by":10,"name":"Xing Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYBACPmYGhgNAWg7CZSNCCxtUizEJWqB0YgPxWth5DA/83FGbPr//jAHDh7LDDPyzGwg5jC3hYO+Z47mNDWcMGGecO8wgcecAIS3MBw7wth3LbWbsMWDmbTvMYCCRQEgLY8PBv23H0tmYeQyY/xKnhfnAYd62mgQeNqAWRuK0sCUclm07YDiDh63gYM+5dB6JGwS08POfMf74tq1OXr7/8MYHP8qs5fhnENACBYfB5AEg5iFKPRDUEatwFIyCUTAKRiIAAIr7PFc/YxOJAAAAAElFTkSuQmCC","orcid":"","institution":"Zhengzhou University","correspondingAuthor":true,"prefix":"","firstName":"Xing","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2024-12-05 09:53:47","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5585853/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5585853/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":75886178,"identity":"451dcf90-c968-4a78-a7e9-1b3e9692d832","added_by":"auto","created_at":"2025-02-10 09:13:07","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":885218,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLTCONS_00014107 downregulation was screened from NMBA-induced precancerous lesions of heat-stimulated rat esophageal mucosa.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) \u0026nbsp;Schematic diagram of animal experiment protocol. (B) The number of differentially expressed lncRNA induced by heat stimulation. Known LncRNA is what has been reported; Novel LncRNA is unknown LncRNA. (C) The expression level of LncRNAs in NMBA+RT group and NMBA+HW group were showed in heat map. (D) The numer of differently expressed LncRNA in five groups. (E) The expression level of LTCONS_00014107 was detected in rat esophageal tissues. (F) qRT-PCR was used to verify the expression level of LTCONS_00014107 in heat-stimulated RS1 cells. **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"Figure1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5585853/v1/f139b7c71e4094963368faa8.jpg"},{"id":75886841,"identity":"93e96a35-89fd-4119-90a9-85af6542863a","added_by":"auto","created_at":"2025-02-10 09:21:07","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":652365,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown LTCONS_00014107 can inhibit cell growth in RS1 cells and miR-29b-2-3p is up-regulated in rat tissues.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The position of LTCONS_00014107sequence where the 3 pairs of siRNA are positioned. (B) MTT assay (C) soft agar colony formation assay were used to detect the effect of LTCONS_00014107 knockdown in RS1 cell proliferation. (D) qRT-PCR was used to verify the knockdown efficiency of LTCONS_00014107 in RS1 cells.(E) The expression level of miR-29b-2-3pwas detected in rat esophageal tissues. *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5585853/v1/22bfa6da0427bf62444ca953.jpg"},{"id":75886176,"identity":"2bd893eb-6c13-46ef-9496-a9597aa5601d","added_by":"auto","created_at":"2025-02-10 09:13:07","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1219587,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLTCONS_00014107 may be the precursor of miR-29b-2-3p and miR-29b-2-3p is up-regulated in ESCC.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) qRT-PCR was used to verify the expression level of miR-29b-2-3p in heat-stimulated RS1 cells. (B)Degradation of LTCONS_00014107 leads to upregulation of miR-29b-2-3p.(C) RS1 cell activity was detected by MTT assay. (D) miR-29b-2-3phas sequence homology among different species. (E) miR-29b-2-3pexpression levels were checked in SHEE cells, which were treated at 42℃ water for 1h and then cultured at 37℃ for1h,2h,4h or 6h. (F) The expression of miR-29b-2-3p in ESCC cell lines. (G) Higher expression of miR-29b-2-3p was associated with lower survival. \u0026nbsp;(H) The expression of miR-29b-2-3p was detected by ISH in normal and preneoplastic lesions of human esophagus tissues. The positive staining was counted. Data are all shown as mean ± S.D. from three independent experiments. *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5585853/v1/498bcaf0c78b9bbe3cf2cd5a.jpg"},{"id":75886187,"identity":"f25fc877-9ee7-47e3-bc05-083a43b4cc23","added_by":"auto","created_at":"2025-02-10 09:13:07","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1280995,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-29b-2-3p knockdown or overexpression suppresses or promotes ESCC cell growth and colony formation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) qRT-PCR was used to verify the miR-29b-2-3p knockdown efficiency in KYSE30, KYSE410 and KYSE510 cell lines. (B) The cell proliferation, (C) anchorage-independent cell growth, and (D) colony formation of KYSE30, KYSE410, and KYSE510 of miR-29b-2-3p knockdown cell lines and control cells were detected by MTT assay, Foci-formation, and Soft Agar assay.(E) qRT-PCR was used to verify the miR-29b-2-3p overexpression efficiency in KYSE140 and KYSE510 cell lines. (F-H) The cell proliferation, anchorage-independent cell growth, and colony formation of KYSE140 and KYSE510 of miR-29b-2-3p up-regulated cell lines and control cells were detected by MTT assay, Foci-formation, and Soft Agar assay. Data are all shown as mean ± S.D. from three independent experiments. *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5585853/v1/a8be7ef7e368848b63570a23.jpg"},{"id":75886179,"identity":"8b388f91-9d9c-4f9b-8942-10af579bd956","added_by":"auto","created_at":"2025-02-10 09:13:07","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":957598,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-29b-2-3p promotes the proliferation of ESCC by targeting GPR37.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Four miRNAs bioinformatics databases were used to predict potential target genes that may be regulated by miR-29b-2-3p. (B) The four most likely target genes were selected. 293T cells or KYSE30 cells were transfected with pmirGLO-wt-GPR37 or pmirGLO-mut-GPR37 respectively, and the luciferase activity was measured at 48h after transfection. (C) Schematic diagram of the binding region of miR-29b-2-3p and GPR37 3’-UTR, and the fragments containing the binding region or mutated sequence were designed and inserted into the pmirGLO dual luciferase miRNA target expression vector (named as pmirGLO-wt-GPR37 and pmirGLO-mut-GPR37). (D-G) Knock down miR-29b-2-3p to detect the efficiency of GPR37 by qRT-PCR and Overexpression of miR-29b-2-3p was used to detect the efficiency of GPR37. (H) Higher expression of GPR37 was associated with higher survival. (I) The expression of GPR37 was detected by knockdown or overexpression of miR-29b-2-3p in KYSE510 cell, using immunofluorescence. Data are shown as mean ± S.D. from three independent experiments. (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"Figure5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5585853/v1/d3bd2501f721cac642155a1c.jpg"},{"id":75886863,"identity":"00cacee4-9ded-4b0b-9caf-0623456d357c","added_by":"auto","created_at":"2025-02-10 09:21:08","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":888430,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnockdown of miR-29b-2-3p can suppress ESCC cell growth in vivo.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A)KYSE30 cells stably transfected with negative control or miR-29b-2-3p antisense were injected into the sides of each mouse. When tumors were palpable, tumor sizes were measured every 2-3 days. Photographs of mice are shown. Left tumors were negative control, right tumors were miR-132-3p antisense. Left tumors were negative control, right tumors were miR-29b-2-3p antisense. Tumors were removed and photographs of tumors were shown. (B-C) miR-29b-2-3p antisense grew more slowly than negative control in tumor volume and tumor weight. (D-E) The expression level of miR-29b-2-3p was detected by ISH in tumor tissues, and the positive staining was calculated (n = 6). Data are all shown as mean ± S.D. from three independent experiments. *\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure6.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5585853/v1/00892f6ccfb40d9a96587574.jpg"},{"id":98623622,"identity":"06be4eeb-fe02-4121-a1f9-dad1ece0b553","added_by":"auto","created_at":"2025-12-19 17:07:05","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7187810,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5585853/v1/0fa35870-c9c5-490f-a1ac-90577a1a544c.pdf"},{"id":75886842,"identity":"f7a9b2b4-aad5-4152-bc27-d7e569e63c13","added_by":"auto","created_at":"2025-02-10 09:21:07","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":21496,"visible":true,"origin":"","legend":"","description":"","filename":"14107SupplementaryTable.docx","url":"https://assets-eu.researchsquare.com/files/rs-5585853/v1/e73b536efa91889957d7e968.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"LTCONS_00014107-miR-29b-2-3p-GPR37 axis promotes heat stimulation induced esophageal carcinogenesis","fulltext":[{"header":"Summary","content":"\u003cp\u003eOur research showed the function of LTCONS_00014107 in heat-induced ESCC and provided a theoretical and experimental basis of the LTCONS_00014107-miR-29b-2-3p-GPR37 axis as the potential biomarkers and therapeutic targets in ESCC.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eEsophageal cancer is the sixth and seventh most common cancer in terms of incidence rate and mortality worldwide. In 2020, there were 604,000 new cases diagnosed with esophageal cancer and 544,000 died from esophageal cancer. About 70% of cases occur in men. It mainly occurs in Eastern Asia, Southern Africa, and Southern South America \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. In China, the incidence and mortality rate of esophageal cancer ranks third and fourth among malignant tumors in the country respectively\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e, which seriously threaten people\u0026rsquo;s health. According to pathological types, esophageal carcinoma is divided into esophageal squamous carcinoma (ESCC) and esophageal adenocarcinoma (EAC). Although they occur in the same organ, they have different geographical distribution and risk factors\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. With the progress of medical diagnosis and treatment technology, the treatment of esophageal cancer has achieved certain results but the overall survival rate of esophageal cancer in China is only about 30%\u003csup\u003e4\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe occurrence and development of esophageal cancer is related to many factors. There is sufficient epidemiological evidence to support the consumption of high-temperature foods and beverages as an important risk factor for ESCC. For example, high levels of high-temperature tea called \u0026ldquo;mate tea\u0026rdquo; have been linked to higher rates of esophageal cancer in Southern South America\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Iran has one of the highest rates of ESCC in the world and is one of the largest consumers of black tea, especially very hot black tea\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. In the Chinese city of Linzhou, people are used to drinking very hot soups, which has led to one of the highest rates of esophageal cancer in the country\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. These studies, conducted in areas with a high prevalence of ESCC, suggest that the consumption of hot food and drinks is associated with an increased risk of ESCC. The possible mechanism by which eating hot food and drinks promotes ESCC has long been speculated about.\u003c/p\u003e \u003cp\u003eStudies have shown that about 75% of human genes produce corresponding transcription products, of which only 2% encode proteins, with most of the rest being non-coding RNA (ncRNA)\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. It was once thought that only protein-coding genes had important functions, but a growing research suggests that ncRNA also play an important role in gene regulation. ncRNA is divided into two classes based on nucleotide(nts) length: ncRNA of less than 200nts, including transfer ribonucleic acidRNA (tRNA) and microRNA(miRNA), and LncRNA more than 200nts. Both have been found to play a key role in gene regulation\u003csup\u003e\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAlthough LncRNA is the least well-known, it is crucial in transcriptional regulation, epigenetic gene regulation, and disease\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. For example: involved in energy metabolism\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e, participating in transcription in cis or trans, nuclear tissue domains, and regulation of protein or RNA molecules\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e, etc. In addition, LncRNAs are associated with cell functions that require the interaction of one or more RNA-binding proteins (RBPs)\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. It is closely related to the occurrence, development, and prevention of many human diseases, making them good prognostic biomarkers and therapeutic targets.\u003c/p\u003e \u003cp\u003emicroRNAs(miRNAs),as universal specific factors for post-transcriptional gene silencing, are small endogenous non-coding RNA\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Like protein-coding genes, miRNAs cluster which are regulated by genetics and epigenetics. These clusters may regulate various aspects of cellular function, for example, growth, proliferation, differentiation, cell death, DNA repair and self-renewal, \u003cem\u003eetc\u003c/em\u003e\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e.miRNAs are crucial in regulating post-transcriptional gene expression levels by binding to the 3\u0026prime;untranslated region (3\u0026prime;-UTR) of mRNA. Abnormal miRNA expression contributes to excessively activating specific oncogenes and promotes the progression of cancer\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Therefore, miRNAs are key regulatory factors in biological processes and their dysregulation is associated with various diseases.\u003c/p\u003e \u003cp\u003eHowever, there are few studies on the expression changes of LncRNAs and miRNAs in ESCC after heat treatment. In this study, we simulated the habits of drinking hot drinks in humans and generated the animal model of rat precancerous lesions induced by heat stimulation. The gene expression profile including LncRNAs and miRNAs, and then differentially expressed genes were analyzed by using transcriptome sequencing technology (RNA-seq). LTCONS_00014107 and miR-29b-2-3p were screened out, and then the mechanism of their occurrence in the process of esophageal carcinoma was studied.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e \u003cem\u003eHeat-stimulation rat experiment.\u003c/em\u003e \u003c/p\u003e \u003cp\u003eRats (4\u0026ndash;5 weeks old, 190\u0026thinsp;\u0026plusmn;\u0026thinsp;10 g) were purchased from Beijing Vital River (Beijing, China). Feed animals according to specific pathogen-free feeding standards. For the heat-stimulation study, rats were divided randomly into five groups of ten rats each: (A) intra-esophageal injection in room temperature (RT) water (RT group, n\u0026thinsp;=\u0026thinsp;10); (B) intra-esophageal injection in hot water (HW, 65℃) (HW group, n\u0026thinsp;=\u0026thinsp;10); (C) subcutaneous injections of \u003cem\u003eN\u003c/em\u003e-nitrosomethylbenzylamine (NMBA) at 0.25 mg/kg and intra-esophageal injection in RT water (NMBA\u0026thinsp;+\u0026thinsp;RT group, n\u0026thinsp;=\u0026thinsp;10); (D) subcutaneous injections of NMBA at 0.25 mg/kg and intra-esophageal injections in hot water (NMBA\u0026thinsp;+\u0026thinsp;HW group, n\u0026thinsp;=\u0026thinsp;10); (E) subcutaneous injections of NMBA at 0.25 mg/kg and intra-esophageal injection in hot water and follow ice-cold water (IW, 0℃) (NMBA\u0026thinsp;+\u0026thinsp;HW\u0026thinsp;+\u0026thinsp;IW group, n\u0026thinsp;=\u0026thinsp;10). NMBA was administered three times per week for 5 weeks and rats were fed 1ml water daily using a gavage needle (20 G, curved) throughout the whole study. The rats were euthanized after 25 weeks, and the esophagus was stripped. A part of the esophagus quickly froze, and the transcriptome sequencing work was completed by BGI (The Beijing Genomics Institute). The rest were divided longitudinally into two parts (upper, middle, and lower). One part of the tissue was stored in liquid nitrogen for RNA and protein extraction, and the other portion was fixed in 10% neutral buffered formalin for histological analysis. All animal protocols were approved by the Research Ethics Committee of Zhengzhou University (Zhengzhou, Henan, China).\u003c/p\u003e \u003cp\u003eScreening LncRNA \u003cem\u003eexpression associated with heat-stimulation\u003c/em\u003e\u003c/p\u003e \u003cp\u003eThe rat esophageal tissue small RNA sequencing was implemented on the BGIseq500 platform (BGI, Wuhan, China). Using Illumina HiSeq (Illumina, San Diego, CA) conduct single end read sequence according to manufacturer\u0026rsquo;s instructions. Using RSEM to determine gene expression, find differentially expressed lncRNA associated with heat stimulation. The raw data were filtered using the critical value of Fold change\u0026thinsp;\u0026gt;\u0026thinsp;=\u0026thinsp;2 and FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05. and differential genes expression for screening between different groups.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eLncRNA LTCON_00014107 qPCR primer\u003c/h2\u003e \u003cp\u003eLncRNA design philosophy: If the overlap of a part of LncRNA and other gene of exon, the other portion doesn\u0026rsquo;t overlap. We select the non-overlap. LTCONS 00014107 is positioned at chr13:113722967\u0026ndash;113787345, design primer sequences on Primer-Blast and the rat skin fibroblast cell (RS1) to do qRT-PCR experiment. The product obtained by 1.5% agarose gel experiment to verify the specificity of the primer.\u003c/p\u003e \u003cp\u003eForward: TGACACCAGGCCCAGCTAGT\u003c/p\u003e \u003cp\u003eReverse: AAGCATGGTGGATTTGGCAG\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eHistological grad of preneoplastic lesions\u003c/h3\u003e\n\u003cp\u003eAccording to the classification criteria of Philip R Taylor and Gray D. Stoner\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, A histological grades of esophageal precancerous lesion in rat: normal epithelium, hyperplasia, mild dysplasia, moderate dysplasia and severe dysplasia.\u003c/p\u003e\n\u003ch3\u003ePatient samples\u003c/h3\u003e\n\u003cp\u003eHenan Cancer Hospital (Henan, China) provide nineteen pairs of esophageal cancer patient tissues and adjacent tissues. Esophageal cancer patients\u0026rsquo; histological diagnosis was corroborated by eligible histopathologists. The protocol in this study was approved by the Ethics Committee of China-US (Henan) Hormel Cancer Institute (Henan, China).\u003c/p\u003e\n\u003ch3\u003eCell culture and transfection\u003c/h3\u003e\n\u003cp\u003eRat skin fibroblasts RS1 were purchased from Jiangsu KeyGEN BioTECH Corp.Ltd. The Shantou human embryonic esophageal (SHEE cell line was kindly provided by Professor Enmin Li (Medical College of Shantou University, Guangdong, China)\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. The human embryonic kidney 293T (HEK293T) cell line, KYSE30, KYSE140, KYSE410, KYSE450, and KYSE510 human ESCC cell lines were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The cell line was tested and authenticated by STR. Cell precipitation of the above cell line was collected and then sent to Sangon company, and DNA was extracted and tested by STR. The last time the cell line was tested was in July 2024. No mycoplasma contamination was recently tested in all cell lines. The siRNA of LTCONS 00014107, the miR-29b-2-3p antisense, the miR-29b-2-3p mimics and negative control RNA duplex (NC) were purchased from GenePharma (Shanghai, China). For cell transfection, cells were seeded until reaching 70% confluency and transfected with x-fect according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003ch3\u003eQuantitative real-time PCR\u003c/h3\u003e\n\u003cp\u003eTotal RNA was isolated from cell cultures and tissues using TRIzol reagent (Invitrogen, 94402), 1ug RNA samples was reverse transcribed into cDNA using a PrimeScript\u0026trade; RT reagent kit (Takara, Japan). The miRNA sequence-specific primers for miR-29b-2-3p and endogenous control U6 snRNA were purchased from GenePharma (Shanghai, China) and primers of GPR37 were obtained from Shangya (Henna, China). Using a SYBR Premix Ex Taq\u0026trade; II kit (Takara, Japan) and an ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) to detect the expression level of miR-29b-2-3p and GPR37 in cells or tissues according to the operating manual. The relative expression levels of miR-29b-2-3p and GPR37 were quantified by the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCell heat stimulation assay\u003c/h2\u003e \u003cp\u003eFor the cell heat stimulation assay, cells were seeded into a 6-well plate until the next day reaching 80% confluency and changed medium. Adjust the cell incubator to 42\u0026deg;C in advance. Wash the 2 multiple-well cells of the 6-well plate twice with pre-chilled 1\u0026times;PBS, add 300\u0026micro;l TRIzol to each well, repeatedly pipet and lyse with an RNase-free pipette tip, and transfer to the corresponding RNase-free EP Tube to collect RNA. Put the remaining cells in the 42\u0026deg;C incubator for heat stimulation (RS1 cells heat stimulation for 2 hours and SHEE cells for 1 hour) and collect RNA, then remove the remaining cells in a 37\u0026deg;C incubator for cells recovered themselves 1, 2, 4, 6 and 8 hours, collect RNA at the corresponding time points. After cells recovered 2 hours, quickly changed the medium containing actinomycin D (Act D) with a final concentration of 50\u0026micro;g/ml on part of the 6-well plates and put them in a 37\u0026deg;C incubator to continue culturing for 4, 6, and 8 hours, collect the Act D-added RNA at the corresponding time point. Finally, RNA and detected expression level of LTCONS_00014107 and miR-29b-2-3p by qRT-PCR.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCell proliferation and colony formation assays\u003c/h3\u003e\n\u003cp\u003eFor cell proliferation assay, transfected KYSE30, KYSE510 cells were seeded at the density of 1500 cells per well and KYSE140 cells were 2000 cells and KYSE410 cells were 2500cells per well into 96-well plates and allowed to proliferate for 0 and 72 hours, RS1 cells proliferate at a density of 2500 cells per well for 0 and 48 hours, then added 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 3 mg/ml) and incubated for 2 hours at 37\u0026deg;C. Dimethyl sulfoxide (200ul) was added to stop the reaction. The absorbance values were measured at 570 nm using an ELX800 spectrophotometric plate reader (Bio-Tek, Winooski, VT, USA). For cell clone formation assay, the cell suspension (8\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells/well) was mixed with15% FBS-RPMI-1640 and seeded on 3 ml solidified RPMI-1640/10% FBS/0.5% agar in each well of 6-well cell culture plate. For the crystal violet assay, each well was seeded with 200 cells, but KYSE140 was 500 cells. The cell was maintained in a 37℃, 5% CO\u003csub\u003e2\u003c/sub\u003e incubator for 1\u0026ndash;2 weeks, then fixed with 4% paraformaldehyde solution for 30 min and stained with 0.4% crystal violet solution for 5 min. Finally, the number of colonies in each well was counted using the Image-J software program.\u003c/p\u003e\n\u003ch3\u003eConstruction of miRNA sponge plasmid\u003c/h3\u003e\n\u003cp\u003eThe miRNA sponge method was introduced to create continuous miRNA loss of function in cell lines and transgenic organisms. Sponge RNAs contain complementary binding sites to a miRNA of interest and are produced from transgenes within cells. According to reference\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, we designed the sponge sequence of miR-29b-2-3p. Set the mismatch base CGA- at the middle position UGAA of the mature miR-29b-2-3p sequence UAGCACCAUUUGAAAUCAGUGUU, and use 4 nucleotides CCGG as the linking sequence to connect 4 miR-29b-2-3p target sites, both ends set NheI-HF and BamHI-HF restriction sites. Finally, send the miR-29b-2-3p sponge oligonucleotide sequence to the company for synthesis.\u003c/p\u003e \u003cp\u003emiR-29b-2-3p sponge forward (104nt)\u003c/p\u003e \u003cp\u003ectagAACACTGATCGAAATGGTGCTACCGGAACACTGATCGAAATGGTGCTACCGGAACACTGATCGAAATGGTGCTACCGGAACACTGATCGAAATGGTGCTA\u003c/p\u003e \u003cp\u003emiR-29b-2-3p sponge reverse (104nt)\u003c/p\u003e \u003cp\u003egatcTAGCACCATTTCGATCAGTGTTCCGGTAGCACCATTTCGATCAGTGTTCCGGTAGCACCATTTCGATCAGTGTTCCGGTAGCACCATTTCGATCAGTGTT\u003c/p\u003e \u003cp\u003eThe construct was then subcloned into pcDNA3.1 vector. Cells were transfected with 2\u0026micro;g pcDNA3.1 or pcDNA3.1-miR-29b-2-3p sponge plasmid using Lipofectamine\u0026trade; 2000 and screened by G418 to obtain a stable expression cell line of miR-29b-2-3p sponge.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTarget gene prediction for miR-29b-2-3p\u003c/h2\u003e \u003cp\u003eThe target genes of miR-132-3p were predicted by the online tools including TargetScanHuman(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.targetscan.org/\u003c/span\u003e\u003cspan address=\"http://www.targetscan.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), miRWalk(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://mirwalk.umm.uniheidelberg.de/\u003c/span\u003e\u003cspan address=\"http://mirwalk.umm.uniheidelberg.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), microRNA.org(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.microrna.org/\u003c/span\u003e\u003cspan address=\"http://www.microrna.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), starBase(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.starbase.sysu.edu.cn/\u003c/span\u003e\u003cspan address=\"http://www.starbase.sysu.edu.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Using a Venn diagram for the intersection of miR-29b-2-3p predicted target genes were identified and the overlapped genes were used for next step analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eDual luciferase reporter assay\u003c/h2\u003e \u003cp\u003eThe 3\u0026rsquo;-untranslated region (3\u0026rsquo;-UTR) sequence of the \u003cem\u003eGPR37\u003c/em\u003e gene was acquired from the NCBI website, and the binding site of miR-29b-2-3p with \u003cem\u003eGPR37\u003c/em\u003e was predicted by the TargetScan Human program. The plasmid pmirGLO and pmirGLO Dual-Luciferase miRNA Target Expression Vector (termed as pmirGLO-wt-GPR37) were purchased by Sunya.Henan. Based on the binding site of miR-29b-2-3p and GPR37 3'-UTR, a mutant plasmid (termed pmirGLO-mut-GPR37) was purchased by Shenggong Biotech, Shanghai. All constructs were confirmed by DNA sequencing.\u003c/p\u003e \u003cp\u003eFor dual luciferase reporter assay, HEK293T cells or KYSE30 cells were seeded into 24-well plates until reaching 70% confluency per well and transfected with 500ng reporter construction plasmid (pmirGLO, pmirGLO-wt-GPR37, pmirGLO-mut-GPR37) and 500ng small RNA (miR-29b-2-3p mimic or control) using X-fect as described previously. After transfection 48h, a Promega Glo Max fluorescence detector (set detection time 10s, time interval 2s) to detect Firefly luciferase activity and Renilla luciferase activity. Relative luciferase activity was denoted by the ratio of Firefly to Renilla luciferase activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eIn situ hybridization (ISH)\u003c/h2\u003e \u003cp\u003eISH was used for miR-29b-2-3p expression in preneoplastic lesions of human esophagus tissues by using an ISH kit (BOSTER, China). Follow the manufacturer\u0026rsquo;s instructions. Oligo (5\u0026prime; Digoxin- AACACTGATTTCAAATGGTGCTA \u0026minus;\u0026thinsp;3\u0026prime;) was used as the miR-29b-2-3p ISH probe. The preneoplastic lesions of patient esophagus tissues and normal tissues were gained from Henan Cancer Hospital (Henan, China). The results analysis was used the Aperio ImageScope program.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence (IF)\u003c/h2\u003e \u003cp\u003eFor immunofluorescence, KYSE510 cells into 24 wells were seeded in glass slides until reaching 70% confluency the next day, then transfect silencing of miR-29b-2-3p and over-regulation of miR-29b-2-3p. Two days later, precooled 4% paraformaldehyde was fixed for 20min after washing three times with PBS. Using fluorescein isothiocyanate (FITC)-conjugated primary antibodies against GPR37 antibody (proteintech,14820-1-AP,1:100) dilution containing 3%BSA and 1%goat serum and 0.3%Triton-X100 overnight at 4\u0026deg;C. Use PBST wash three times in a shake, and then incubate for 2 hours using a secondary antibody (Invitrogen,1:1000) to protect from light and then use PBST washing three times. The nuclei were stained with 4\u0026rsquo;6-diamidino-2-phenylindole (DAPI). Fluorescence microscopy was used to observe and photograph fluorescent sections. The results analysis used the ImageJ program.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry (IHC)\u003c/h2\u003e \u003cp\u003eImmunohistochemistry was performed to detect GPR37 expression in the different grades of precancerous lesions and cancer of human esophagus tissues. The slides were incubated with the GPR37 (ThermoFisher, PA5-13412,1:100) antibody overnight at 4\u0026deg;C. After washing with PBS, samples were incubated with HRP-conjugated secondary antibody before analysis by microscopy. GPR37 positive cells were quantified using the Aperio ImageScope program.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eIn vivo cell-derived xenograft mouse model\u003c/h2\u003e \u003cp\u003e This study was approved by the Ethics Committee of Zhengzhou University (Zhengzhou, Henan, China). The negative control (NC) and miR-29b-2-3p antisense were transfected into KYSE30 cells to construct stable miR-29b-2-3p knockdown KYSE30 cells. The NOD SCID mice (10 females, 6-weeks old) were used for the experiment. The NC-KYSE30 cells were injected into the left shoulder of mice, and the miR-29b-2-3p antisense-KYSE30 were injected into the right shoulder of mice. The mice\u0026rsquo;s weight and tumor volume were measured every two or three days after a one-week injection. Mice were sacrificed 16 days after injection, and the subcutaneous tumors were removed and weighed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eGraphPad Prism 8 software was used to analyze the data involved in this experiment. The results were expressed as mean \u0026plusmn; standard deviation (SD). Comparison between the two groups was performed by Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test and using one-way analysis of variance (ANOVA) was used to analyze differences among the three groups. The results of each experiment were repeated three times and a \u003cem\u003eP\u003c/em\u003e value less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eNMBA-induced precancerous lesions of heat-stimulated rat esophageal mucosa\u003c/h2\u003e \u003cp\u003eNMBA is a well-known nitrosamine carcinogen, which can induce tumorigenesis of rat esophagus\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. To evaluate whether heat stimulation (hot water at 65\u0026deg;C) can promote this process, F344 rats were randomly divided into 5 groups, some of them were injected with low-dose NMBA (0.25 mg/kg) into the rats, and human eating habits were simulated to allow water of different temperatures to flow slowly through the rat\u0026rsquo;s esophagus to stimulate it (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, Supplementary Table\u0026nbsp;1). The results showed that F344 rats treated with hot water at 65℃ for up to 25 weeks developed hyperplasia. Tissue samples from different groups of rats at 25 weeks were sent to BGI for sequencing. The Illumina HiSeq research platform was used to detect LncRNAs from five different groups. Using a cut-off value of a two-fold change and an FDR less than 0.05, we identified 44 differentially expressed Known lncRNA and 52 Novel lncRNA respectively: 31 and 26 LncRNAs were up-regulated, whereas 13 and 26 LncRNAs were down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, Supplementary Table\u0026nbsp;2). We designed these lncRNA primers and verified RNA-seq results with the esophageal tissue of the rat heat stimulation experiment, and found that the expression of LTCONS_00014107 was consistent with the sequencing results (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Simulating the animal model of esophageal carcinogenesis induced by heat stimulation, RS1 cells was treated in a 42℃ incubator. qRT-PCR results showed that after heat stimulation, the expression of LTCONS_00014107 in RS1 cells was up-regulated, and reached the highest point at recovery 2 hours, which was inconsistent with the decrease of RNA-seq results, but with the extension of recovery time, LTCONS_00014107 gradually decreased, and at recovery 6 hours, LTCONS_00014107 is slightly reduced compared with the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). We guessed that heat stimulation can temporarily increase LTCONS_00014107 expression, but after long-term chronic heat stimulation, the expression of LTCONS_00014107 was decreased, which was consistent with the decrease of LTCONS_00014107 expression after stimulation with 65℃ hot water for 25 weeks in our animal experiment. Overall, these results confirmed that long-term heat stimulation can promote precancerous lesions of esophageal mucosa in rats, whereas ice-cold water had a preventive effect on this process.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eKnockdown of LTCONS_00014107 inhibits cell growth and colony formation of RS1 cells\u003c/h2\u003e \u003cp\u003eTo further explore the role of LTCONS_00014107 in RS1 cell proliferation and colony formation, we ordered 3 pairs of LTCONS_00014107 siRNA and Mock (Supplementary Table\u0026nbsp;3). The position of LTCONS_00014107 sequence where the 3 pairs of siRNA were located does not overlap with the LTCONS_00014107 specific primer and miR-29b-2-3p position (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). We transfected into RS1 cells, and the results showed that the expression level of LTCONS_00014107 was significantly reduced in siRNA-1 group and siRNA-3 group compared with Mock group, while siRNA-2 group had no significant difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), so choose siRNA-1 and siRNA-3 for further research. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D showed that the knockdown of LTCONS_00014107 can significantly inhibit cell growth and colony formation of RS1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D). Therefore, we speculated that LTCONS_00014107 may play the role of oncogene in rat skin fibroblasts.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eDegradation of LTCONS_00014107 promotes the expression of miR-29b-2-3p\u003c/h2\u003e \u003cp\u003eSorted out RNA-seq data, it was found that the sequence of lncRNA LTCONS_00014107 contained pre-mir-29b-2 and miR-29b-2-3p sequences (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), which was located at the same chromosome position: 13q27. RNA-seq results showed that LTCONS_00014107 was down-regulated in rat esophageal cancerous tissue induced by heat stimulation, and miR-29b-2-3p was up-regulated, so we hypothesized that LTCONS_00014107 was the precursor of miR-29b-2-3p. To verify this hypothesis, first we used rat esophageal tissue and RS1 cells to detect the expression of miR-29b-2-3p. The results showed that the expression of miR-29b-2-3p in the NMBA\u0026thinsp;+\u0026thinsp;HW group was significantly higher than NMBA\u0026thinsp;+\u0026thinsp;RT group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), and heat stimulation-induced miR-29b-2-3p up-regulation in RS1 cells, which was consistent with the RNA-seq results. However, compared with LTCONS_00014107, the time to reach the highest point was moved to recovery 4 hours, suggesting that the up-regulation of miR-29b-2-3p may be caused by the degradation of LTCONS_00014107(Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eTo further confirm that the degradation of LTCONS_00014107 leads to the up-regulation of miR-29b-2-3p, we added Act D at the highest point of LTCONS_00014107 expression to inhibit mRNA synthesis and eliminate the endogenous synthesis pathway of miR-29b-2-3p. The results showed that LTCONS_00014107 decreased rapidly after adding Act D, while the expression of miR-29b-2-3p gradually increased, and the highest point moved to recovery 6 hours (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). At the same time, MTT results showed that there was no significant difference in the cell OD value after heat stimulation at 42\u0026deg;C for 2 hours, which ruled out the RNA changes caused by cell death (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Overall, these results indicated that heat stimulation promoted the expression of miR-29b-2-3p in rat esophageal tissues and cells, and the degradation of LTCONS_00014107 promoted the expression of miR-29b-2-3p. LTCONS_00014107 may be the precursor of miR-29b-2-3p.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eThe expression of miR-29b-2-3p is induced by heat stimulation\u003c/h2\u003e \u003cp\u003eTo investigate whether miR-29b-2-3p associated with heat stimulation is conserved in the genome, we compared the sequence homology of miR-29b-2-3p among human, mouse, rat, housefly, macaque, gorilla, chicken, and cattle species, it was found that the sequence was highly similar, especially in human, mouse and rat, the sequence identity was as high as 100% (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Therefore, we will explore the role and mechanism of miR-29b-2-3p in the process of human esophageal carcinogenesis induced by heat stimulation. To further determine whether miR-29b-2-3p had a similar expression pattern in human normal esophageal epithelial cells induced by heat stimulation as in rats, SHEE cells were heat stimulated in a 42\u0026deg;C incubator for 1 hour, and then recovery in a 37\u0026deg;C incubator for different time. The results showed that the expression of miR-29b-2-3p in SHEE cells induced by heat stimulation was significantly higher than control group, and at recovery 2 hours reached the highest point, with the extension of recovery time, miR-29b-2-3p gradually decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE), similar to the expression pattern of rat RS1 cells, indicating that miR-29b-2-3p has an important role in the process of heat-induced carcinogenesis of the human esophagus. Since heat stimulation was a potential risk factor for ESCC, we further detected the expression of miR-29b-2-3p in ESCC cell lines by qRT-PCR and found that compared with human normal esophageal epithelial cells SHEE, miR-29b-2-3p was up-regulated in most ESCC cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). According to website Kaplan-Meier Plotter, we had inquired the lifetime of miR-29b-2-3p in ESCC. We concluded that higher expression of miR-29b-2-3p was associated with lower survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). To verify this hypothesis, we used human esophageal precancerous and cancerous tissues by ISH assay, we found miR-29b-2-3p high expression in high-grade precancerous lesions and cancerous tissues than low-grade and normal tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH).\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003emiR-29b-2-3p Knockdown can suppress ESCC cell growth and colony formation\u003c/h2\u003e \u003cp\u003eTo further explore the role of miR-29b-2-3p on cell proliferation and colony formation of ESCC. Transfection of miR-29b-2-3p sponge respectively in KYSE30, KYSE410 and KYSE510 cells. The miR-29b-2-3p knockdown stable cell lines were established by G418 selection. qRT-PCR was used to detect knockdown efficiency, and the results showed that the expression level of miR-29b-2-3p sponge groups was significantly lower than control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Next, we evaluated whether miR-29b-2-3p influenced cell proliferation and cell growth of ESCC by cell proliferation assay and colony formation assay. Our results suggested that knocking down miR-29b-2-3p could alleviate cell growth and generate fewer and smaller colonies in KYSE30, KYSE410, and KYSE510 cells compared with control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-D).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003emiR-29b-2-3p overexpression promotes cell growth and colony formation\u003c/h2\u003e \u003cp\u003eTo prove that miR-29b-2-3p may positively take part in esophageal squamous cell carcinoma, we tested whether overexpression of miR-29b-2-3p could promote cell proliferation and colony formation in human ESCC cells. Firstly, we respectively transfected pLenti-miR-29b-2-3p and pLenti-Control in KYSE140 and KYSE510. The miR-29b-2-3p overexpression stable cell lines were built by puro selection. Then detecting the expression of miR-29b-2-3p by using qRT-PCR and the results indicated that the expression level of miR-29b-2-3p was significantly increased compared with control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). It\u0026rsquo;s exactly what we predicted, overexpression of miR-29b-2-3p could significantly promote cell proliferation and colony formation in KYSE140 and KYSE510 cells compared with control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-H), the suggested that miR-29b-2-3p may play a critical facilitation role in human ESCC progression.\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eGPR37 is a direct target of miR-29b-2-3p\u003c/h2\u003e \u003cp\u003eTo explore the molecular mechanism of miR-132-3p in ESCC, potential downstream regulatory targets of miR-29b-2-3p from several bioinformatics databases including TargetScanHuman, miRWalk, microRNA, and StarBase. Venny2.0 analysis tool was further used to superimpose the targets of miR-29b-2-3p, and we screened 33 potential target genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, Supplementary Table\u0026nbsp;4). Next, to further identify the target genes regulated by miR-29b-2-3p, the expression of 33 genes in esophageal cancer was searched by the Oncomine (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.oncomine.org/\u003c/span\u003e\u003cspan address=\"http://www.oncomine.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) database. Due to the negative regulation between miRNA and target genes, four genes including AMOT, EML5, GAS7, and GPR37 were initially screened out.\u003c/p\u003e \u003cp\u003eTo further determine which gene was the target of miR-29b-2-3p. We co-transfected miR-29b-2-3p mimics or NC mimics and pmirGLO-wt-AMOT, pmirGLO-wt-EML5, pmirGLO-wt-GAS7 or pmirGLO-wt-GPR37, respectively. Then we tested the ratio of Firefly to Renilla luciferase activity. It was found that GPR37 was most likely the downstream regulatory gene of miR-29b-2-3p (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). To further determine whether GPR37 was a target for miR-29b-2-3p we used Targetscan software to predict the 3\u0026rsquo;-UTR of GPR37 that binds to miR-29b-2-3p. The result showed that the 235\u0026ndash;242 nucleotide-binding region of GPR37 was probably miR-29b-2-3p binding region, then we mutate the binding site (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Following, the sequences containing the binding or mutation sites of miR-29b-2-3p were inserted into the pmirGLO dual-luciferase miRNA target expression vector (termed as pmirGLO-wt-GPR37 and pmirGLO-mut-GPR37). Finally, we respectively co-transfected miR-29b-2-3p mimics or NC mimics and pmirGLO, pmirGLO-wt-GPR37, or pmirGLO-mut-GPR37 in HEK293T. The result demonstrated that the luciferase activity was suppressed in the pmirGLO-wt-GPR37 group, whereas the pmirGLO-mut-GPR37 group had no such effect (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). To verify if this effect occurs in ESCC and we transfected KYSE30 in the same way. Similar results were observed in KYSE 30 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Overall, our findings further reinforce that GPR37 is the direct target gene of miR-29b-2-3p, the expression level of GPR37 was measured in miR-29b-2-3p knockdown and overexpression stable cell lines respectively. The results showed that GPR37 was upregulated in miR-29b-2-3p knockdown cells whereas downregulated in miR-29b-2-3p overexpression cells, which suggested that miR-29b-2-3p could negatively regulate the expression of GPR37(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF-G). According to the website Kaplan-Meier Plotter, we have inquired about the lifetime of GPR37 in ESCC (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). We concluded that higher expression of GPR37 was associated with higher survival. To further verify that GPR37 was the target of miR-29b-2-3p. we up-regulate and down-regulate miR-29b-2-3p in KYSE510 to detect the expression of GPR37 by immunofluorescence, we observed that GPR37 down-regulate in high expression of miR-29b-2-3p. whereas in the low expression of miR-29b-2-3p, the result was reversed (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI). These results suggested that GPR37 was the downstream regulatory molecule of miR-29b-2-3p.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eKnockdown of miR-29b-2-3p suppresses ESCC cell growth in vivo\u003c/h2\u003e \u003cp\u003eTo evaluate the role of miR-29b-2-3p on tumor growth \u003cem\u003ein vivo\u003c/em\u003e, we established tumor xenografts in SCID mice. The results revealed that miR-29b-2-3p knockdown significantly slowed down the xenograft tumor growth, and the tumor weight also decreased significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-C). The ISH assay revealed that compared with the NC group, the expression of miR-29b-2-3p was significantly reduced in the miR-29b-2-3p antisense group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-E). These results indicated that miR-29b-3p is an important promoter of ESCC proliferation. Taken together, these data suggested that in heat-induced esophageal cancer, degradation of LTCONS_00014107 led to elevated miR-29b-2-3p, which in turn led to downregulation of the downstream target gene GPR37 via sponge adsorption, all of which ultimately led to the proliferation of esophageal cancer.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn recent years, although many oncogenes, tumor suppressor genes and tumor-related signaling pathways have been identified and confirmed, the pathogenesis of esophageal cancer remains unclear. For decades, LncRNA was thought to be \u0026ldquo;noise\u0026rdquo; or \u0026ldquo;pseudogene\u0026rdquo; of transcription in the human genome, with no biological\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e,\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Thus, it was largely overlooked. LncRNA is a key component of the coding of nuclear tissue, allowing protein complexes, genes, and chromosomes to be transported to the correct places and to be properly activated and inactivated, and their dysregulation is the basis of human diseases\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. They affect cell proliferation, migration, and invasion by regulating the expression of genes in the tumorigenic pathway\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. With the rapidly developing second-generation sequencing technology (NGS), the study of LncRNA is more and more in-depth. Esophageal cancer contributes to the consumption of hot food and drinks, especially ESCC. It has long been suspected as a potentially modifiable factor\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Experimental research found that hot water temperatures above 65\u0026deg;C to 70\u0026deg;C may increase the incidence rate of nitrosamine-induced esophageal tumors in animal models\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. In this study, the animal model of esophageal precancerous lesions induced by heat stimulation was established by intragastric injection of hot water at 65\u0026deg;C in rats, simulating the habits of drinking hot drinks in humans. The LncRNA and miRNA profiles of esophageal tissues are analyzed by RNA-seq.\u0026nbsp;It was found that 57 LncRNAs were up-regulated and 39 LncRNAs were down-regulated after heat treatment. The down-regulated LTCONS_00014107 contained the sequence of up-regulated miR-29b-2-3p, and both were located at the same chromosomal position. Thus, we hypothesized that LTCONS_00014107 may be a precursor of miR-29b-2-3p, which both play a key role in heat-stimulation-induced precancerous lesions.\u003c/p\u003e \u003cp\u003eLTCONS_00014107 is an unknown non-coding RNA with a length of 50652nt, which has not been reported yet. To verify the accuracy of the sequencing results, specific qRT-PCR primers were designed for the part of the LTCONS_00014107 sequence that did not overlap with the exons of other genes, \u003cem\u003ein vivo\u003c/em\u003e thermal stimulation experiment showed that the expression of RS1 cells increased rapidly after thermal stimulation, which was inconsistent with the decrease of sequencing results. However, with the extension of repair time after heat stimulation, the expression of LTCONS_00014107 decreased gradually, and at 6 hours of repair, compared with the control group, LTCONS_00014107 expression decreased slightly. Therefore, we speculated that the expression of LTCONS_00014107 could be briefly increased by heat stimulation, but after long-term chronic thermal stimulation, the LTCONS_00014107 expression would decrease, which was consistent with the decrease of LTCONS_00014107 expression in our animal experiment after continuous 20 weeks of 65\u0026deg;C hot water stimulation.\u003c/p\u003e \u003cp\u003eLncRNA has a wide range of functions and very complex mechanisms. LncRNA biogenesis occurs in the nucleus and reflects the synthesis of protein-coding transcripts\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e.LncRNA plays a role in chromatin modification, enhancer function, genomic imprinting, and DNA damage. It also regulates mRNA progression and post-transcriptional regulation\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. In this study, we guessed that LTCONS_00014107 might be the precursor of miR-29b-2-3p. To verify our guess, we added ActD in the thermal stimulation experiment, which could interfere with cell transcription, thus eliminating the endogenous synthesis pathway of miR-29b-2-3p. The experimental results showed that after adding ActD, the LTCONS_00014107 expression decreased rapidly, while the time for miR-29b-2-3p to reach the highest expression level moved significantly later, indicating that the degradation of LTCONS_00014107 promoted the expression of miR-29b-2-3p, and LTCONS_00014107 may be the precursor of miR-29b-2-3p, which verified our conjecture.\u003c/p\u003e \u003cp\u003emiR-29 family consists of miR-29a, miR-29b, miR29c, among which miR-29b has the highest expression. miR-29b-1 and miR-29b-2 are two numbers of the miR-29 family. The miR-29 family is encoded and transcribed in tandem by two genes on chromosomes 7q32.3 and 1q32.2. Thus, mature miR-29b is encoded by two different precursor stem sequences pre-miR-29b-1 and pre-miR-29b-2 on two chromosomes. Although the sequences of two pre-miR-29b are not the same, they produce the same mature miR-29b\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Increasingly studies have found that the miR-29b family is involved in the malignant behavior of tumors in multiple transcription processes, suggesting that it plays a crucial role in the development of tumors\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. We found that miR-29b-2-3p sequences were highly similar among various species, especially among humans, mice, and rats, whose sequence consistency was as high as 100%. In general, homology can be inferred from sequence similarity, and the higher the similarity, the more similar the biological function\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e,\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Therefore, we will take miR-29b-2-3p as the research object to explore its role in the process of human esophageal cancer. According to our study, miR-29b-2-3p was significantly upregulated in SHEE cells induced by heat stimulation. The results were consistent with RNA-seq, suggesting that miR-29b-2-3p may be a potential molecular target of esophageal carcinoma induced by thermal stimulation.\u003c/p\u003e \u003cp\u003eRecently, miR-29b is well known for its role as a tumor suppressor, but many studies have suggested that miR-29b may also express oncogenes. Many studies have proved that the expression of miR-29b is related to the pathological classification and prognosis of tumors. Richard F et al. confirmed that low expression of miR-29b can prolong the survival time of serous ovarian cancer patients\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Budhu A \u003cem\u003eet al.\u003c/em\u003e showed that the high expression of miR-29b promotes the metastasis of hepatocellular carcinoma (HCC) and reduces the survival time of HCC patients.\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003eChen W \u003cem\u003eet al.\u003c/em\u003e proved that miR-29b expression in tissues and cells of metastatic breast cancer was significantly higher than that low metastatic breast cancer, which could directly inhibit the expression of PTEN to enhance the expression of miR-29b and then promote cell invasion and migration. In addition, overexpression of miR-29b is associated with advanced tumor stage, lymph node metastasis, and poor prognosis, suggesting that miR-29b can be used as a marker of molecular prognosis\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e.miR-29b is also involved in cancer-mediated inflammation, interleukin-15 (IL-15) is a pro-inflammatory factor that can cause chromosomal instability and DNA hypermethylation by inhibiting miR-29b\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAt present, the role of miR-29b-2-3p in ESCC is rarely reported. To further explore the mechanism of miR-29b-2-3p in ESCC, a series of cell biology experiments were conducted. Firstly, miR-29b-2-3p expression level in ESCC cell lines was detected by qRT-PCR, and it was found that miR-29b-2-3p expression in most ESCC was obviously higher than that in SHEE. Then miR-29b-2-3p sponge was used to inhibit miR-29b-2-3p expression, and cell proliferation and colony formation of KYSE30, KYSE410, and KYSE510 were distinctly inhibited compared with the control group. Reversely, overexpression of miR-29b-2-3p significantly promoted cell proliferation and colony formation of KYSE510, suggesting that miR-29b-2-3p plays an oncogene role in ESCC. To further study the regulatory mechanism of miR-29b-2-3p of developing ESCC, we predicted the target gene of miR-29b through four bioinformatics databases and further confirmed GPR37 as a potential target gene of miR-29b-2-3p by Dual-luciferase reporter assay.\u003c/p\u003e \u003cp\u003eIn conclusion, heat stimulation promotes the development of ESCC through the LTCONS_00014107-miR-29b-2-3p-GPR37 axis, offering a potential therapeutic target for the clinical prevention and treatment of esophageal cancer.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eEthics approval and consent to participate(Not applicable)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication(Not applicable)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials: \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data underlying this article are available in the article and in its online supplementary material.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests: \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing financial interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding: \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by National Natural Science Foundation of China (No.82073075, 82172996); Major Science and Technology Projects in Henan Province (No. 221100310100); Training plan for young backbone teachers of Henan Province (No. 2020GGJS010); Basic research and Cultivation Fund for young teachers of Zhengzhou University (No. JC202035023); Science and technology innovation talents support plan of Henan Province (No.21HASTIT048); Innovation team support plan for outstanding young talents of Zhengzhou University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthorship Contributions:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthor contributions: Xiang Li designed and implemented the study. Wenting Liu and Jing Wang contributed equally to data gathering and the follow-up process. Jiaqiong Li, and Dan Cheng participated in the experimental process. Wenting Liu and Xiang Li drafted the manuscript with important contributions from Liting Zhou, Yiu To Yeung, Hui Huang, and Yunfeng Gao. Jiaping Qu participated in the supplement, submission of the manuscript and supplement of later experiments. All authors contributed to the interpretation of the study results and critical revision of the manuscript. All authors reviewed the manuscript and approved the final version to be published. Xiang Li and Zigang Dong are guarantors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e Author names in bold designate shared co-first authorship. We thank the teachers from the Department of Pathophysiology and the China-US (Henan) Hormel Cancer Institute for their support and assistance and thank them provide the experimental platform and experimental equipment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWenting Liu: \u003cem\
[email protected]\u003c/em\u003e, Jing Wang:\u003cem\
[email protected]\u003c/em\u003e, Jia ping Qu: \u003cem\
[email protected]\u003c/em\u003e, Dan Cheng: \u003cem\
[email protected]\u003c/em\u003e, Jiaqiong Li:\u003cem\
[email protected]\u003c/em\u003e, Yiu To Yeung:\u003cem\
[email protected]\u003c/em\u003e, Liting Zhou:\u003cem\
[email protected]\u003c/em\u003e, Yunfeng Gao:\u003cem\
[email protected]\u003c/em\u003e, Hui Huang:\u003cem\
[email protected]\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence:Address correspondence to: Zigang Dong, PhD, Department of Pathophysiology, School of Basic Medical Sciences, Zhengzhou University, Zhengzhou, Henan, China. E-mail: \u003cem\
[email protected]\u003c/em\u003e; or Xiang Li, PhD, Department of Pathophysiology, School of Basic Medical Sciences, Zhengzhou University, Zhengzhou, Henan, China. E-mail: \u003cem\
[email protected]\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatement: \u003c/strong\u003eAll experiments were performed according to the approved protocol from the ethics committee and other relevant guidelines and regulations. The maximal tumor size/burden in experiments permitted by the ethics committee was not exceeded.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSung, H.\u003cem\u003e et al.\u003c/em\u003e Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e \u003cstrong\u003e71\u003c/strong\u003e, 209-249, doi:10.3322/caac.21660 (2021).\u003c/li\u003e\n\u003cli\u003eChen, W.\u003cem\u003e et al.\u003c/em\u003e Cancer statistics in China, 2015. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e \u003cstrong\u003e66\u003c/strong\u003e, 115-132, doi:10.3322/caac.21338 (2016).\u003c/li\u003e\n\u003cli\u003eCancer Genome Atlas Research, N.\u003cem\u003e et al.\u003c/em\u003e Integrated genomic characterization of oesophageal carcinoma. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e541\u003c/strong\u003e, 169-175, doi:10.1038/nature20805 (2017).\u003c/li\u003e\n\u003cli\u003eZeng, H.\u003cem\u003e et al.\u003c/em\u003e Changing cancer survival in China during 2003-15: a pooled analysis of 17 population-based cancer registries. \u003cem\u003eLancet Glob Health\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, e555-e567, doi:10.1016/S2214-109X(18)30127-X (2018).\u003c/li\u003e\n\u003cli\u003eLubin, J. H.\u003cem\u003e et al.\u003c/em\u003e Mate drinking and esophageal squamous cell carcinoma in South America: pooled results from two large multicenter case-control studies. \u003cem\u003eCancer Epidemiol Biomarkers Prev\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 107-116, doi:10.1158/1055-9965.EPI-13-0796 (2014).\u003c/li\u003e\n\u003cli\u003eIslami, F.\u003cem\u003e et al.\u003c/em\u003e A prospective study of tea drinking temperature and risk of esophageal squamous cell carcinoma. \u003cem\u003eInt J Cancer\u003c/em\u003e \u003cstrong\u003e146\u003c/strong\u003e, 18-25, doi:10.1002/ijc.32220 (2020).\u003c/li\u003e\n\u003cli\u003eIslami, F.\u003cem\u003e et al.\u003c/em\u003e Tea drinking habits and oesophageal cancer in a high risk area in northern Iran: population based case-control study. \u003cem\u003eBMJ\u003c/em\u003e \u003cstrong\u003e338\u003c/strong\u003e, b929, doi:10.1136/bmj.b929 (2009).\u003c/li\u003e\n\u003cli\u003eTran, G. D.\u003cem\u003e et al.\u003c/em\u003e Prospective study of risk factors for esophageal and gastric cancers in the Linxian general population trial cohort in China. \u003cem\u003eInt J Cancer\u003c/em\u003e \u003cstrong\u003e113\u003c/strong\u003e, 456-463, doi:10.1002/ijc.20616 (2005).\u003c/li\u003e\n\u003cli\u003eTaylor, P. R.\u003cem\u003e et al.\u003c/em\u003e Prevention of esophageal cancer: the nutrition intervention trials in Linxian, China. Linxian Nutrition Intervention Trials Study Group. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 2029s-2031s (1994).\u003c/li\u003e\n\u003cli\u003eConsortium, E. P. An integrated encyclopedia of DNA elements in the human genome. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e489\u003c/strong\u003e, 57-74, doi:10.1038/nature11247 (2012).\u003c/li\u003e\n\u003cli\u003eGuttman, M. \u0026amp; Rinn, J. L. Modular regulatory principles of large non-coding RNAs. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e482\u003c/strong\u003e, 339-346, doi:10.1038/nature10887 (2012).\u003c/li\u003e\n\u003cli\u003eCai, Y., Yu, X., Hu, S. \u0026amp; Yu, J. A brief review on the mechanisms of miRNA regulation. \u003cem\u003eGenomics Proteomics Bioinformatics\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 147-154, doi:10.1016/S1672-0229(08)60044-3 (2009).\u003c/li\u003e\n\u003cli\u003eUlitsky, I. \u0026amp; Bartel, D. P. lincRNAs: genomics, evolution, and mechanisms. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e154\u003c/strong\u003e, 26-46, doi:10.1016/j.cell.2013.06.020 (2013).\u003c/li\u003e\n\u003cli\u003ePonting, C. P., Oliver, P. L. \u0026amp; Reik, W. Evolution and functions of long noncoding RNAs. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e136\u003c/strong\u003e, 629-641, doi:10.1016/j.cell.2009.02.006 (2009).\u003c/li\u003e\n\u003cli\u003eTan, Y. T.\u003cem\u003e et al.\u003c/em\u003e LncRNA-mediated posttranslational modifications and reprogramming of energy metabolism in cancer. \u003cem\u003eCancer Commun (Lond)\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 109-120, doi:10.1002/cac2.12108 (2021).\u003c/li\u003e\n\u003cli\u003eFerre, F., Colantoni, A. \u0026amp; Helmer-Citterich, M. Revealing protein-lncRNA interaction. \u003cem\u003eBrief Bioinform\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 106-116, doi:10.1093/bib/bbv031 (2016).\u003c/li\u003e\n\u003cli\u003eLiu, B., Li, J. \u0026amp; Cairns, M. J. Identifying miRNAs, targets and functions. \u003cem\u003eBrief Bioinform\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1-19, doi:10.1093/bib/bbs075 (2014).\u003c/li\u003e\n\u003cli\u003eKabekkodu, S. P.\u003cem\u003e et al.\u003c/em\u003e Clustered miRNAs and their role in biological functions and diseases. \u003cem\u003eBiol Rev Camb Philos Soc\u003c/em\u003e \u003cstrong\u003e93\u003c/strong\u003e, 1955-1986, doi:10.1111/brv.12428 (2018).\u003c/li\u003e\n\u003cli\u003eVan Roosbroeck, K. \u0026amp; Calin, G. A. Cancer Hallmarks and MicroRNAs: The Therapeutic Connection. \u003cem\u003eAdv Cancer Res\u003c/em\u003e \u003cstrong\u003e135\u003c/strong\u003e, 119-149, doi:10.1016/bs.acr.2017.06.002 (2017).\u003c/li\u003e\n\u003cli\u003eHayes, J., Peruzzi, P. P. \u0026amp; Lawler, S. MicroRNAs in cancer: biomarkers, functions and therapy. \u003cem\u003eTrends Mol Med\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 460-469, doi:10.1016/j.molmed.2014.06.005 (2014).\u003c/li\u003e\n\u003cli\u003eTaylor, P. R., Abnet, C. C. \u0026amp; Dawsey, S. M. Squamous dysplasia--the precursor lesion for esophageal squamous cell carcinoma. \u003cem\u003eCancer Epidemiol Biomarkers Prev\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 540-552, doi:10.1158/1055-9965.EPI-12-1347 (2013).\u003c/li\u003e\n\u003cli\u003eShen, Z.-Y.\u003cem\u003e et al.\u003c/em\u003e The genetic events of HPV-immortalized esophageal epithelium cells. \u003cem\u003eInternational journal of molecular medicine\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 537-542 (2001).\u003c/li\u003e\n\u003cli\u003eEbert, M. S. \u0026amp; Sharp, P. A. MicroRNA sponges: progress and possibilities. \u003cem\u003eRNA\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 2043-2050, doi:10.1261/rna.2414110 (2010).\u003c/li\u003e\n\u003cli\u003eStoner, G. D.\u003cem\u003e et al.\u003c/em\u003e Inhibitory effects of phenethyl isothiocyanate on N-nitrosobenzylmethylamine carcinogenesis in the rat esophagus. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e, 2063-2068 (1991).\u003c/li\u003e\n\u003cli\u003eHe, H. T.\u003cem\u003e et al.\u003c/em\u003e Biomarker and competing endogenous RNA potential of tumor-specific long noncoding RNA in chromophobe renal cell carcinoma. \u003cem\u003eOnco Targets Ther\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 6399-6406, doi:10.2147/OTT.S116392 (2016).\u003c/li\u003e\n\u003cli\u003eShe, K.\u003cem\u003e et al.\u003c/em\u003e lncRNA-SNHG7 promotes the proliferation, migration and invasion and inhibits apoptosis of lung cancer cells by enhancing the FAIM2 expression. \u003cem\u003eOncol Rep\u003c/em\u003e \u003cstrong\u003e36\u003c/strong\u003e, 2673-2680, doi:10.3892/or.2016.5105 (2016).\u003c/li\u003e\n\u003cli\u003eBatista, P. J. \u0026amp; Chang, H. Y. Long noncoding RNAs: cellular address codes in development and disease. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e152\u003c/strong\u003e, 1298-1307, doi:10.1016/j.cell.2013.02.012 (2013).\u003c/li\u003e\n\u003cli\u003eZhang, H.\u003cem\u003e et al.\u003c/em\u003e Long non-coding RNA: a new player in cancer. \u003cem\u003eJ Hematol Oncol\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 37, doi:10.1186/1756-8722-6-37 (2013).\u003c/li\u003e\n\u003cli\u003eLing, H.\u003cem\u003e et al.\u003c/em\u003e Junk DNA and the long non-coding RNA twist in cancer genetics. \u003cem\u003eOncogene\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 5003-5011, doi:10.1038/onc.2014.456 (2015).\u003c/li\u003e\n\u003cli\u003eAndrici, J. \u0026amp; Eslick, G. D. Hot Food and Beverage Consumption and the Risk of Esophageal Cancer: A Meta-Analysis. \u003cem\u003eAm J Prev Med\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 952-960, doi:10.1016/j.amepre.2015.07.023 (2015).\u003c/li\u003e\n\u003cli\u003eKamangar, F. \u0026amp; Freedman, N. D. Hot Tea and Esophageal Cancer. \u003cem\u003eAnn Intern Med\u003c/em\u003e \u003cstrong\u003e168\u003c/strong\u003e, 519-520, doi:10.7326/M17-3370 (2018).\u003c/li\u003e\n\u003cli\u003eBeermann, J., Piccoli, M. T., Viereck, J. \u0026amp; Thum, T. Non-coding RNAs in Development and Disease: Background, Mechanisms, and Therapeutic Approaches. \u003cem\u003ePhysiol Rev\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 1297-1325, doi:10.1152/physrev.00041.2015 (2016).\u003c/li\u003e\n\u003cli\u003eKole, A. J., Swahari, V., Hammond, S. M. \u0026amp; Deshmukh, M. miR-29b is activated during neuronal maturation and targets BH3-only genes to restrict apoptosis. \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 125-130, doi:10.1101/gad.1975411 (2011).\u003c/li\u003e\n\u003cli\u003eXiong, Y.\u003cem\u003e et al.\u003c/em\u003e Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis of hepatocellular carcinoma. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e, 836-845, doi:10.1002/hep.23380 (2010).\u003c/li\u003e\n\u003cli\u003eLi, S. C., Pan, C. Y. \u0026amp; Lin, W. C. Bioinformatic discovery of microRNA precursors from human ESTs and introns. \u003cem\u003eBMC Genomics\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 164, doi:10.1186/1471-2164-7-164 (2006).\u003c/li\u003e\n\u003cli\u003eFriedman, R. C., Farh, K. K., Burge, C. B. \u0026amp; Bartel, D. P. Most mammalian mRNAs are conserved targets of microRNAs. \u003cem\u003eGenome Res\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 92-105, doi:10.1101/gr.082701.108 (2009).\u003c/li\u003e\n\u003cli\u003eFlavin, R.\u003cem\u003e et al.\u003c/em\u003e miR-29b expression is associated with disease-free survival in patients with ovarian serous carcinoma. \u003cem\u003eInt J Gynecol Cancer\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 641-647, doi:10.1111/IGC.0b013e3181a48cf9 (2009).\u003c/li\u003e\n\u003cli\u003eBudhu, A.\u003cem\u003e et al.\u003c/em\u003e Identification of metastasis-related microRNAs in hepatocellular carcinoma. \u003cem\u003eHepatology\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e, 897-907, doi:10.1002/hep.22160 (2008).\u003c/li\u003e\n\u003cli\u003eWang, C., Bian, Z., Wei, D. \u0026amp; Zhang, J. G. miR-29b regulates migration of human breast cancer cells. \u003cem\u003eMol Cell Biochem\u003c/em\u003e \u003cstrong\u003e352\u003c/strong\u003e, 197-207, doi:10.1007/s11010-011-0755-z (2011).\u003c/li\u003e\n\u003cli\u003eMishra, A.\u003cem\u003e et al.\u003c/em\u003e Aberrant overexpression of IL-15 initiates large granular lymphocyte leukemia through chromosomal instability and DNA hypermethylation. \u003cem\u003eCancer Cell\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 645-655, doi:10.1016/j.ccr.2012.09.009 (2012).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"esophageal squamous cell carcinoma, heat induction, LTCONS_00014107, miR-29b-2-3p, GPR37","lastPublishedDoi":"10.21203/rs.3.rs-5585853/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5585853/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEsophageal cancer is a common malignant tumor of the digestive system, Esophageal squamous cell carcinoma (ESCC) is the major histological subtype of esophageal cancer. Multiple epidemiological evidence shows that consumption of hot temperature food and beverages is an important risk factor for developing ESCC, however, it is underlying mechanism remains unclear. Herein, for the first time, we constructed an animal model of esophageal precancerous lesions induced by heat stimulation in rats and simulated the human habit of eating hot food and drinks. Both LncRNA and miRNA expression of esophageal tissues were profiled by RNA-seq.\u0026nbsp;We found LTCONS_00014107 was lowly expressed but miR-29b-2-3p was highly expressed in heat-induced ESCC and degradation of LTCONS_00014107 promoted the expression of miR-29b-2-3p since it is speculated that LTCONS_00014107 could be a precursor of miR-29b-2-3p. The functional study showed that knockdown miR-29b-2-3p could inhibit ESCC cell proliferation, whereas overexpression of miR-29b-2-3p could promote ESCC progression. Finally, through data analysis from the publicly available databases followed by verification using Dual-Luciferase assay, we found GPR37 could bind with miR-29b-2-3p and may be a potential target of miR-29b-2-3p. Overall, our research showed the function of LTCONS_00014107 in heat-induced ESCC and provided a theoretical and experimental basis of LTCONS_00014107-miR-29b-2-3p-GPR37 axis as the potential biomarkers and therapeutic targets in ESCC.\u003c/p\u003e","manuscriptTitle":"LTCONS_00014107-miR-29b-2-3p-GPR37 axis promotes heat stimulation induced esophageal carcinogenesis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-10 09:13:02","doi":"10.21203/rs.3.rs-5585853/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e7057a86-1f9d-4f8e-82fd-7e1b0e637c3f","owner":[],"postedDate":"February 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-17T15:24:47+00:00","versionOfRecord":[],"versionCreatedAt":"2025-02-10 09:13:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5585853","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5585853","identity":"rs-5585853","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.