The Homeodomain-interacting protein kinase Hipk promotes apoptosis by stabilizing the active form of Dronc

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Members of the evolutionarily conserved homeodomain-interacting protein kinase (Hipk) family play a critical role in regulating essential signalling pathways involved in growth, differentiation, and apoptosis. While vertebrates have multiple hipk genes, Drosophila contains a single hipk ortholog, what facilitates functional analysis. We find that hipk is necessary for the stabilization of the initiator caspase Dronc, thus enhancing the two Dronc activities in apoptotic scenarios: the induction of the caspase cascade, and the reinforcement of JNK signalling pathway. Conversely, our data suggest that Dronc also raises the expression levels of Hipk, thereby reinforcing the apoptotic response. These findings significantly enhance our understanding of caspase regulation and position Hipk as a promising target for modulating caspase activity in a variety of biological contexts.
Full text 158,630 characters · extracted from preprint-html · click to expand
The Homeodomain-interacting protein kinase Hipk promotes apoptosis by stabilizing the active form of Dronc | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article The Homeodomain-interacting protein kinase Hipk promotes apoptosis by stabilizing the active form of Dronc Ernesto Sánchez-Herrero, Juan Manuel García-Arias, Rafael Alejandro Juárez-Uribe, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6955925/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Dec, 2025 Read the published version in Cell Death Discovery → Version 1 posted 10 You are reading this latest preprint version Abstract Members of the evolutionarily conserved homeodomain-interacting protein kinase (Hipk) family play a critical role in regulating essential signalling pathways involved in growth, differentiation, and apoptosis. While vertebrates have multiple hipk genes, Drosophila contains a single hipk ortholog, what facilitates functional analysis. We find that hipk is necessary for the stabilization of the initiator caspase Dronc, thus enhancing the two Dronc activities in apoptotic scenarios: the induction of the caspase cascade, and the reinforcement of JNK signalling pathway. Conversely, our data suggest that Dronc also raises the expression levels of Hipk, thereby reinforcing the apoptotic response. These findings significantly enhance our understanding of caspase regulation and position Hipk as a promising target for modulating caspase activity in a variety of biological contexts. Biological sciences/Genetics/Development Biological sciences/Cell biology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Apoptosis, one of the most prevalent forms of programmed cell death, is a conserved phenomenon by which cells are eliminated through an evolutionary conserved group of cysteine proteases, termed caspases, that dismantle the protein substrates and cause cell death (1). Apoptosis can take place during normal development, like in the sculpting of Drosophila embryonic cephalic structures (2) or the elimination of the interdigital membranes in vertebrates (3), or be triggered by stress or tissue damage (4). Because of the simplicity of its genetic system and its sophisticated genetic technology, Drosophila is a useful model to analyse the regulation of apoptosis. Within Drosophila , the wing imaginal disc is especially convenient for this analysis, since little developmentally programmed apoptosis exists, but still shows a robust apoptosis induction in response to stressors like ionizing radiation (IR), heat shock, and others (5, 6). Moreover, apoptosis can experimentally be manipulated by driving the expression of members of the apoptotic cascade, including the pro-apoptotic genes (7–11). As in mammals, the apoptotic pathway in Drosophila engages pro-apoptotic genes, initiator and effector caspases and natural inhibitors of apoptosis such as Diap1 (1). An important feature of the Drosophila apoptotic pathway is that it includes a feedback amplification loop (Supplementary Fig. 1), necessary for the full apoptotic response (12). This loop involves the Jun N-Terminal Kinase (JNK) pathway, a versatile signalling pathway implicated in a number of biological processes (13) including apoptosis in response to stress (14, 15). Upon irradiation there is an initial apoptotic stage, triggered by the DNA damage response pathway, which induces the function of the initiator caspase Dronc and the effector caspases Drice and Dcp1 (4). A second phase, consolidating the apoptotic response, appears to rely on a Dronc-dependent stimulation of the JNK signalling pathway (12, 16–18). Despite intensive research, the molecular crosstalk between major signalling pathways, such as the JNK pathway, and the core apoptotic machinery, remains poorly understood. A group of factors involved in the regulation of JNK signalling are members of the conserved Homeodomain-interacting protein kinase family, encoded by the hipk genes (19). While vertebrates possess four hipk members ( hipk1-4 ), Drosophila only contains one, what facilitates the experimental analysis of Hipk function. The Drosophila hipk gene shows the highest homology with the vertebrate hipk2 (20), which encodes a protein known to interact with many transcription factors and to regulate a variety of processes, including transcriptional regulation, chromatin remodelling, cell proliferation and apoptosis (21). The hipk gene of Drosophila is also involved in regulating major pathways like Notch (22), Wg (23), Hippo (24), JAK/STAT (25), and JNK (26). Nevertheless, the molecular bases of these interactions are largely unknown, particularly in the context of apoptosis and JNK signalling regulation. In this work we present evidence that the apoptotic activities of Dronc and the JNK signalling amplification are critically influenced by hipk . Specifically, our results indicate that to a large extent these effects stem from the mutual ability of Hipk and Dronc to regulate each other’s activities in vivo. Results Developmentally programmed apoptosis requires hipk function Previous data indicated that hipk is required for the implementation of apoptosis in developmentally regulated scenarios in Drosophila . such as the removal of embryonic neurons and epithelial wing cells after adult hatching from the puparium (27). To further characterize the role of hipk during apoptosis, we have analysed the consequences of compromising hipk function in two developmental contexts showing intrinsic apoptosis: the fusion of the adult abdominal hemi-segments, and the rotation of the male genitalia. During pupal development, polytene Larval Epidermal Cells (LECs) undergo cell death and are extruded from the epithelium. The elimination of LECs is tightly coupled with the proliferation of histoblasts that ultimately form the adult abdominal cuticle (28, 29). The dorsal histoblasts from the left and right sides meet at the midline to form a continuum epithelium in each abdominal segment (Fig. 1 A). This process depends on apoptosis-mediated elimination of the LECs, as blocking apoptosis execution by overexpressing p35 (30) under control of the LEC-specific Eip71CD-Gal4 driver (31) results in lack or aberrant abdominal fusion at the midline (32; Fig. 1 B). Since JNK is an apoptosis inducer (14, 15,18), we also examined whether this pathway was necessary for the fusion of the adult hemi-segments. As shown in Fig. 1 C, inactivation of the JNK pathway in LECs compromised the fusion between abdominal hemi-segments. Interestingly, reducing hipk expression in these same cells caused a weaker but comparable fusion defects to those observed blocking apoptosis or the JNK pathway (Fig. 1 D). Next, we examined the requirement of hipk function for the 360º rotation of the genital plate during early pupa (33, 34). This process locates the genitalia in the upper and the analia in the lower position of the terminalia (Fig. 1 E). This arrangement requires apoptosis in the eighth abdominal segment (A8) of the male genital disc before the genital plate starts to rotate, since there is impaired or absent rotation without apoptotic cell death (35–38). To prevent cell death in the A8 we used an A8-specific Gal4 line ( Abd-B LDN ) to force P35 expression or to suppress JNK activity. In contrast to control flies expressing the fluorescent protein Cherry (Fig. 1 E), the overexpression of p35 or of a dominant negative form of basket (a key transducer of the JNK pathway) caused analia and genitalia rotation defects (Fig. 1 F, G). Intriguingly, the expression of the hipkRNAi construct with the same driver also triggered similar abnormal phenotypes (Fig. 1 H). Taken together, these results establish that both the fusion of abdominal nests of histoblasts and the rotation of the male genitalia, require normal hipk function, likely by contributing to reach the apoptosis levels necessary to complete those processes. Experimentally induced apoptosis triggered by pro-apoptotic genes requires hipk activity Next, we examined hipk role after induction of cell death by the pro-apoptotic gene reaper ( rpr ) (9, 11). Rpr binds to the BIR domain of Diap1 facilitating its proteasomal degradation (39). This molecular interaction between Rpr and Diap-1 secondarily licenses for activation initiator and effector caspases, Dronc (40) and Drice (41), therefore inducing cell death (42) (see Supplementary Fig. 1). To analyse the response to rpr induction of cells in which hipk function is compromised, we combined the transcriptional bipartite gene expression systems Gal4/UAS and LexA/LexO (43, 44; see Material and Methods and drawings in Fig. 2 A). In control wing discs, forced expression of rpr in nubbin-expressing cells (in the wing pouch) induced strong cleaved Dcp-1 immunoreactivity and JNK activation—both established markers of apoptosis (Fig. 2 B, B’, E-E’, H-H’). However, a reduction of hipk expression yielded a potent rescue of these features (Fig. 2 C-C’, D, F-F’, G, I-I’, J). These results suggested that hipk is key for both rpr -induced JNK signalling and apoptosis. The requirement of hipk function in the maintenance of JNK activity was further investigated in an experiment in which apoptosis was induced by IR but the execution of the apoptosis programmed was prevented overexpressing the effector caspase inhibitor p35 . In this experimental setting, previous work (18) demonstrated that dronc -dependent activation of JNK and persistent proliferative signalling emanating from these cells induces wing imaginal discs overgrowth after irradiation. In line with these observations, irradiated discs expressing p35 in wing disc posterior cells (P compartment) show a significant increase in size and ectopic activity of JNK, as indicated by the Mmp1 marker (45), compared to non-irradiated control discs (Supplementary Fig. 2A, A’, B, B’, D, E). However, there was no overgrowth and limited JNK activation upon irradiation of P35 cells without hipk expression (Supplementary Fig. 2C, C’, D, E). hipk does not primarily exert its effect through Diap1 In addition to its effect on apoptosis and JNK activity, we found that the suppression of hipk function in rp r-expressing cells caused accumulation of the Diap1 protein (Fig. 3 A, A’, B, B’, C), suggesting a role of hipk in the rpr -mediated degradation of Diap1 (42). This result also suggested that the diminution of the apoptosis levels observed in the absence of hipk function could be due to maintenance of high levels of Diap1; the Diap1 protein has a key role in preventing the cleavage and subsequent activation of caspases (46), thereby the lack of Diap1 results in massive apoptosis (39, 42, 47–49). To test this, we compromised diap1 expression in the P compartment by using an effective RNAi construct (50). In control discs, in which we reduced diap1 levels, we detected consistent elevation of apoptotic marker (Fig. 3 D, D’, F). In contrast, a significant downregulation of apoptosis markers was observed by concomitantly reducing diap1 and hipk (Fig. 3 E, E’, F). These important result rule out the hypothesis that hipk downregulates apoptosis by increasing Diap1 levels, and indicate that Hipk acts downstream of diap1 , possibly facilitating the activation of the caspase pathway. hipk promotes apoptosis mainly by stabilizing the active form of Dronc To explore the hypothesis of a functional interaction between Hipk and the caspase cascade, we have analysed the effect of the lack of hipk on the apoptosis induced by the direct activation of caspases. We first checked that, as expected, the lack of hipk function does not affect the normal very low levels of apoptosis in the wing disc (Fig. 4 A-B’, I). We then conducted three experiments that overexpressed dronc , drice , or both together. To overexpress dronc and drice together we capitalized on a UAS construct in which dronc and drice cDNAs were concomitantly overexpressed (see Methods). This combined overexpression induced prominent apoptosis in the P compartment of wing discs (Fig. 4 C, C, I’). However, such apoptotic response was drastically rescued by downregulating hipk (Fig. 4 D, D’ I). The single overexpression of either dronc or drice also induced apoptosis, though to a lesser scale (Fig. 4 E, E’, G, G’, J, K). Interestingly, in these experiments Dronc-induced apoptosis, but not Drice-induced apoptosis, was rescued by limiting hipk expression (Fig. 4 F, F’, J, H, H’, K). Altogether, these data indicated that hipk sustains the apoptotic response by likely acting at the level of the initiator caspase Dronc. Our previous experiments took advantage of newly generated transgenic lines expressing tagged versions of Dronc and Drice (see Methods) suitable to assess their protein stability upon modulating Hipk expression levels. Specifically, Dronc is fused in-frame with a Myc tag and a modified GFP that only fluoresces upon Dronc-mediated cleavage (see Methods and relevant references). This dual-tagging system enables simultaneous detection of both total Dronc protein via anti-Myc immunolabelling and its activation via GFP cleavage. Drice, in turn, was tagged at the C-terminus with a Flag epitope. Remarkably, posterior cells overexpressing Dronc and Drice displayed strong Myc immunolabelling and GFP signal, indicating robust Dronc activation (Fig. 5 A, A’, A’’, C, D). However, a dramatic reduction of both Dronc protein levels and activation was detected in Hipk-deficient cells (Fig. 5 B, B’, B’’, C, D). A similar, albeit milder, reduction was observed in cells overexpressing Dronc with limited Hipk levels (Fig. 5 E-F’’, G, H). In contrast, the detection of Drice through Flag immunostaining remained unaltered in cells with reduced Hipk (Fig. 5 I-J’, K). Together, these results strongly support the notion that Hipk preferentially and intrinsically enhances the stability of Dronc in its active conformation. Reinforcing this conclusion, lack of hipk activity effectively rescues the tissue overgrowth caused by p35 -expressing cells upon irradiation, which, despite lacking effector caspase activity, still activate Dronc (Supplementary Fig. 2B-D). Further support for the interaction between hipk and Dronc comes from experiments of hipk overexpression. As previously reported (24, 51, 52), the excess of Hipk caused mild tissue overgrowths (Fig. 6 A-B’, E) that were enhanced by the concomitant overexpression of the pro-apoptotic gene hid (Fig. 6 C, C’, E). However, this phenotype was critically linked to Dronc activity, as it was rescued in a mutant background null for dronc (Fig. 6 D, D’, E). Similarly, forced expression of hipk is sufficient to activate Dronc and cleaved Dcp-1 immunoreactivity, but the absence of dronc drastically reduces Dcp1 levels (Supplementary Fig. 3A-E). Active Dronc also promotes Hipk protein stability The observations above strongly suggest a determinant role of hipk to ensure the correct levels of apoptosis in either developmentally regulated or induced apoptosis. More specifically, our previous observations suggested that the Hipk protein preferentially affects the stability of Dronc in its active form. Since previous studies have shown that caspases can enhance Hipk2 activity in mammals (53), we sought to investigate whether Hipk might, in turn, be regulated by Dronc. To his end, we first evaluated the Hipk levels in cells expressing p35 , which cannot complete apoptosis but still activate Dronc after irradiation. Interestingly, in this experimental setting we found groups of p35 -expressing cells showing significantly elevated levels of Hipk. A closer examination revealed that these cells also activated JNK signalling, as indicated by the Mmp1 upregulation (Fig. 7 A-C’, E). This result suggested that ionising radiation could raise the amount of Hipk in Dronc-activating cells that fail to die. Notably, such upregulation of Hipk did not occur in irradiated discs in which the expression of pro-apoptotic genes was potently targeted by overexpressing a micro RNA against the proapoptotic genes Rpr, Hid and Grim (mirRHG) (54) (Fig. 7 D, D’, F), despite the fact that the JNK pathway was still upregulated by apoptosis-independent JNK activation (55) (Fig. 7 D, D’, F). These results argue for a role of the apoptotic program in elevating Hipk levels, but do not discriminate if this is a transcriptional or post-transcriptional effect, and do not single out Dronc as the key protein in this regulation. To solve these issues, we forced expression of a hipk-HA construct and quantified total Hipk and HA levels in p35 -expressing cells with either normal or reduced Dronc expression. Intriguingly, absolute levels of Hipk-HA, detected using both anti-HA and a Hipk-specific antiserum were significantly reduced in Dronc-deficient cells with respect to controls (Fig. 7 G-J)). Consistently, these findings were correlated with a limited ability of Hipk overexpression to induce tissue overgrowth in cells without Dronc (Fig. 6 C-E; 7 K). To address whether Hipk upregulation was a consequence of impeding the completion of apoptosis via P35 or an effect connected to Dronc, we expressed the UAS- hipk-HA construct (along with hid but without p35 ) in either wild type or Dronc-deficient cells. The experiment revealed a significant upregulation of HA levels upon hid and hipk-HA co-expression and a strong reduction of HA levels when dronc was absent (Fig, 7L-O). Collectively, these findings support a reciprocal regulatory relationship: Hipk enhances the stability of Dronc, while active Dronc promotes the accumulation of Hipk. Discussion In this report we provide compelling evidence that the Hipk plays a key role during the execution of apoptosis by stabilizing the active form of Dronc. Given the limited understanding of caspase regulation upon activation, our findings open a new avenue of research with significant implications for caspase biology. Conversely, we also show that Dronc promotes an increase in Hipk expression levels, further amplifying the apoptotic cascade and JNK activation. This intriguing observation likely reflects a positive feedback loop previously described between Dronc and the JNK pathway (12). Hipk is a pro-apoptotic factor that stabilizes active Dronc Hipk proteins are evolutionarily conserved serine/threonine kinases traditionally associated with fine-tuning transcriptional responses that affect various biological functions, such as cell proliferation, cell fate decisions, and apoptosis (19, 21). Our results strongly suggest that Drosophila Hipk acts as a proapoptotic factor, as its reduced expression significantly diminishes apoptosis in either developmentally regulated or experimentally induced apoptotic contexts. The implication of hipk in developmentally regulated apoptosis has been reported previously (27) and we have confirmed this requirement in the left-right fusion of the abdominal hemisegments and the rotation of the male genitalia. In addition, we show that the activity of JNK is also necessary in both processes, thus pointing to a relevant role of JNK in developmental regulated apoptosis. We have also demonstrated the involvement of hipk in the response to various pro-apoptotic stimuli. Our epistasis experiments show that the loss of Hipk function robustly suppresses apoptosis triggered by either overexpression of pro-apoptotic factors, the loss of cell death inhibitors such as Diap-1, the combined overexpression of initiator and effector caspases, or by initiator caspase Dronc alone. In contrast, cell death driven solely by effector caspase overexpression (e.g., Drice) remains largely unaffected by Hipk deficiency. All these experiments position Hipk activity at the level of the initiator caspase Dronc. In parallel, we found in our experiments that Hipk deficiency also compromises JNK activation in apoptosis-induced scenarios, thereby suggesting a Hipk-mediated control of the two Dronc activities: the induction of apoptosis through Dcp1 and Drice, and the amplification of apoptosis and JNK activity through the apoptotic loop (12). In mammalian systems, Hipk2 also mediates apoptosis, but by direct phosphorylation of P53 (56–58) and/or by facilitating the degradation of its inhibitor, MDM2 (59). In parallel, members of the Hipk family have been shown to potentiate JNK pathway activation (56) and apoptosis (60, 61) by antagonizing transcriptional repressors of the CtBP family. Thus, in Drosophila and mammals Hipk members regulate apoptosis and JNK signalling, although the molecules involved in such regulation may be distinct. Our experiments indicate that Hipk plays a critical role in stabilizing Dronc, most notably, the active form of Dronc. Whereas Hipk moderately alter Dronc protein levels under basal, non-apoptotic conditions, in cells exposed to apoptotic stimuli Hipk is substantially required to sustain Dronc stability. The finding that loss of hipk causes a diminution of Dronc product may suggest that a primary cause of hipk phenotypes is precisely a reduction in the amount of active Dronc protein available to fulfil those roles, what results in partial suppression of Dronc function. Importantly, this regulatory mechanism may differ from those previously described. Thus, protein–protein interactions with Dark (62), and Tango7 (63) have been shown to promote the assembly of protein complexes that enable efficient Dronc activation, while interaction with MyoID localizes Dronc to specific subcellular compartments (64). Moreover, Hipk probably does not exert its pro-apoptotic function through its canonical role in modulating transcriptional regulation. Furthermore, our data raise the possibility that Hipk modulates the stability of active Dronc through phosphorylation—either directly or by influencing upstream regulators involved in its turnover. Such post-translational regulation would not be unexpected, as phosphorylation-based control of caspases has been reported in mammals (65–68), and Dronc in Drosophila (69). Regardless of the ultimate molecular mechanism by which Hipk acts on Dronc, our findings clearly establish that Hipk enhances Dronc function and promotes apoptosis, reveal a novel regulatory pathway that modulates Dronc function, and broaden our current understanding of caspase biology. Hipk, JNK pathway and Dronc key players forming a positive apoptotic feedback loop The Hipk protein interacts with different transcription factors and other molecules implicated in distinct biological operations (19). The levels of Drosophila Hipk must be tightly regulated since both overexpression or loss of function of hipk can induce apoptosis (24). We have found that pro-apoptotic stimuli like IR cause an elevation of the amount of the Hipk protein, and this increment requires normal function of the apoptotic cascade. This process would ensure that there is a surplus of active Hipk necessary for activation of Dronc. More specifically, our results show Dronc is needed to maintain Hipk levels, which suggests a mutual interaction between Dronc and Hipk to reciprocally sustain their stability. Interestingly, in mammalian cells, it has been reported that stress-induced activation of Caspase-6 leads to the proteolytic processing of Hipk2 (53, 61). Notably, this cleavage event removes an inhibitory C-terminal domain, generating a hyperactive kinase that further amplifies apoptosis. These and our own findings suggest that caspases could be evolutionarily conserved regulators of Hipk, capable of modulating either its protein abundance or activity. This mutual regulation between caspases and Hipk may be critical for amplifying the apoptotic response in diverse cellular contexts across evolution and could represent a targetable axis for future therapeutic interventions. This mutual Dronc-Hipk interaction also impinges on activation of JNK signalling, a central, evolutionarily conserved regulator of apoptosis (70). In Drosophila , Hipk acts as a positive regulator of the JNK pathway in wing imaginal discs. Its activity is tightly regulated by SUMOylation, and upon loss of SUMO modification (e.g., through Smt3 knockdown), Hipk accumulates in the cytoplasm, enhancing JNK pathway activation and apoptosis (26). In vertebrates, Hipk proteins appear to function as key positive regulators of JNK signalling and c-Jun phosphorylation, through both direct and indirect mechanisms that are highly context-dependent (56, 60). Given Hipk’s known role in modulating diverse cellular processes, it is also tempting to speculate that, in addition to JNK signalling, Hipk may also regulate other non-apoptotic functions of Dronc, but further work is needed to validate this hypothesis. In summary, we have provided evidence that Hipk and caspases engage in a bidirectional positive regulatory relationship that amplifies apoptotic signalling and JNK activation. This molecular crosstalk provides mechanistic insight into a previously reported positive feedback loop between caspase activity and JNK signalling that reinforces the apoptotic fate in Drosophila cells (12). Taken together, prior studies and our current findings delineate a self-reinforcing molecular circuit involving Hipk, JNK signalling, and caspase activation that ensures robust commitment to apoptosis. Materials and Methods Drosophila strains All the Drosophila strains used in this study were raised and maintained on standard medium at 25°C (see below for the temperature shift experiments). The following Drosophila lines were used: Gal4/UAS and LexA/lexO systems : We have used the Gal4/UAS (43) and lexA/lexO (44) systems to express or inactivate different genes in particular locations, in some cases combining the two systems so that two adjacent cell populations with distinct genotypes could be compared. Gal4 lines : hh-Gal4 (71), tub-Gal80 ts (72), en-Gal4 (BDSC#30564), Abd-B LDN ( Abd-B -Gal4 LDN ) (73), Eip71CD -Gal4 (31). lexO line : lexO-rpr (74) UAS lines : UAS -miRHG (54), UAS -GFP (BDSC#5130), UAS- hid (75), UAS- HA-Hipk2M (23), UAS- HA-Hipk3M (23), UAS- hipkRNAi (VDRC KK107857) (24), UAS- p35 (BDSC#8651), UAS- cherry (BDSC#35787), UAS- lacZ (BDSC#8529), UAS- Dronc-GFP-Myc , MVz- Drice-Flag-VN , UAS- Dronc-GFP-Myc /MVz- Drice-Flag-VN (see below), UAS- Diap1RNAi (76), UAS- droncRNAi (VDRC #23035). Mutants : dronc i24 (BDSC#91594), dronc i29 (BDSC#91595). Reporter lines : TRE-red (BDSC#59011). Construction of the nub-lexA transgene . To generate the nub -LexA driver line for nubbin , we first amplified 3.8 kb of nubbin genomic regulatory DNA (77) using Taq high-fidelity polymerase. The primers used to perform the PCR were: FP:CACCCTTCAACTTGTAACTGCTGGCTGCA RP:GGGGATTGGTCCGAAAAGAGGATAC PCR products were initially subcloned into the TOPO-TA vector and then transferred as EcoRI fragments into the pBPLexA::GADfluw plasmid (Addgene Plasmid #26232; Ref. 78). Correct insertion and sequence fidelity were confirmed by Sanger sequencing. Transgenic flies carrying the construct were generated via PhiC31-mediated integration at the attP40 landing site located at cytological position 22F on the second chromosome. Temperature shift experiments We made use of the Gal4/Gal80 ts system (72) to control the time of expression of different genetics constructs. After an egg lay of 1 day at 25ºC, larvae including the genetic combinations hh-Gal4, tub-Gal80 ts or en -Gal4 tub -Gal80 ts were raised at 17°C and then transferred to a restrictive temperature of 29ºC or 31ºC for 2 or 3 days before dissection. The combined expression of a Gal4 line, hh -Gal4 or en -Gal4, and tub -Gal80 ts is represented, for simplicity, as hh Gal80 and en Gal80 , respectively. Generation of MVz-Drice-Flag-VN Plasmid We synthesized a wild-type Drice cDNA fused at its C-terminus to a Flag tag and the N-terminal half of a split Venus fluorescent protein, using gene synthesis services provided by Twist Bioscience. The resulting fragment was delivered in a pUC51 plasmid backbone. The Drice -Flag-VN construct was then excised from pUC51 as a PmeI–KpnI fragment and subcloned into the corresponding sites of the MVz plasmid (79). Please refer to the plasmid map (Supplementary Fig. 4) for additional details; the full plasmid sequence is available upon request. Transgenic flies carrying the construct were generated via PhiC31-mediated site-specific integration. The construct was inserted at the attP40 site, located at cytological position 25C6. Construction of the UAS-Dronc-GFP-Myc A wild-type Dronc cDNA was synthesized (GeneWizz) and fused in-frame to the Suntag and HA-tag peptides at the C-terminal end. To facilitate downstream cloning, additional restriction sites were introduced at both the 5ʹ and 3ʹ ends of the construct, as well as upstream of the tag peptide. The full-length construct was initially subcloned into the pUC57 vector as a NotI-KpnI fragment. Subsequently, the vector was digested with SmaI and NheI , resulting in the removal of the C-terminal Suntag-HA tagging from the wild-type Dronc sequence. A modified version of GFP, containing a Myc tag at its C-terminal end, was generated by PCR using the primers listed below. This GFP variant includes a TETDG caspase cleavage site, which, upon Dronc -dependent cleavage, restores GFP to a conformational state compatible with fluorescence emission. The template for the GFP-Myc sequence was described previously (80). The GFP-Myc PCR product was subsequently cloned in-frame at the C-terminal end of wild-type Dronc as a SmaI-NheI fragment. Primers used for GFP-Myc amplification: Forward primer: 5ʹ GCTTTAATAAGAAACTCTACTTCAATcccgggtttttcaacgaagggggcATGATCAAGATCGCCACCAGGAAGTACC 3ʹ Reverse primer: 5ʹ GATAAAATGTCCAGTGGCGGCAAGCTAGCttacaggtcctcctcgctgatcagcttctgctcGTTAGGCAGGTTGTCCACCCTCATCAGG 3ʹ The complete construct was then subcloned as a NotI-XhoI fragment into a UAS-attB w + vector previously linearized with NotI-PspXI . Please refer to the plasmid map in Supplementary Fig. 4 for further details; full sequence of the plasmid can be distributed upon request. Transgenic Drosophila melanogaster carrying the UAS-Dronc-GFP-TETDG-Myc construct were generated via PhiC31-mediated site-specific integration. The construct was inserted into the attP site located at the 22A3 locus (Bloomington Drosophila Stock Center, stock #9752). Construction of the UAS-Dronc-GFP-Myc/MVz-Drice-Flag-VN Dual Plasmid In parallel with the subcloning of the Dronc -GFP-Myc fragment into the standard UAS-attB-white⁺ plasmid, we also inserted this construct into a modified version of UAS-attB-white⁺ in which the loxP site upstream of the UAS repeats had been removed by NheI digestion followed by re-ligation. The Dronc -GFP-Myc fragment was then subcloned as a NotI–XhoI fragment into this modified plasmid, which had been linearized with NotI–PspXI. From the resulting intermediate plasmid, an NsiI–Dronc-GFP-Myc–NsiI fragment was excised and subcloned into the MVz-Drice-Flag-VN plasmid using the same restriction sites. The resulting dual-expression plasmid enables simultaneous expression of Dronc -GFP-Myc and Drice -Flag-VN under UAS control. A plasmid map is shown in Supplementary Fig. 4, and the full sequence is available upon request. Transgenic flies carrying the construct were generated via PhiC31-mediated integration at the attP40 landing site, located at cytological position 25C6. Imaginal discs staining Third instar larvae were dissected in PBS and fixed with 4% paraformaldehyde, 0.1% deoxycholate (DOC) and 0.3% Triton X-100 in PBS for 27 min at room temperature. They were blocked in PBS, 1% BSA, and 0.3% Triton, incubated with the primary antibody overnight at 4°C, washed in PBS, 0.3% Triton and incubated with the corresponding fluorescent secondary antibodies for at least 2 h at room temperature in the dark. They were then washed and mounted in Vectashield mounting medium (Vector Laboratories). The following primary antibodies were used: rat anti-Ci (DSHB 2A1) 1:50; mouse anti-Mmp1 (DSHB, a combination, 1:1:1, of 3B8D12, 3A6B4 and 5H7B11) 1:50; rabbit anti-Hipk (a gift from E. Verheyen) 1:100, rabbit anti-Dcp1 (Cell Signaling, antibody #9578) 1:200, rabbit anti-Diap1 (a gift from H. Steller) 1:2000. Fluorescently labelled secondary antibodies (Molecular Probes Alexa-488, Alexa-555, Alexa-647, ThermoFisher Scientific) were used in a 1:200 dilution. DAPI (MERCK) and TO-PRO3 (Invitrogen) were used in a 1:1000 dilution to label nuclei. Fluorescently labelled secondary antibodies (Molecular Probes Alexa-488, Alexa-555, Alexa-647, ThermoFisher Scientific) were used in a 1:200 dilution and DAPI (MERCK) was used in a 1:500 dilution to label the nuclei. IR treatments For irradiation experiments, larvae were raised at 17°C for 3–4 days and then transferred to 31°C 1 day before irradiation. Then, irradiated larvae were grown at 31ºC for 3 days before imaginal disc dissection. Larvae were irradiated in an X-ray machine Phillips MG102 at the standard dose of 4000Rads (R). Analysis of adult cuticles Photographs of adult flies were taken with a Leica MZ12 stereomicroscope and a Leica DFC5000 camera, and images were acquired using Leica LAS software (3.7). Theimages were edited and assembled using Photoshop. Image acquisition, quantifications and statistical analysis Stack images were captured with a Leica (Solms, Germany) LSM510, LSM710, DB550 B vertical confocal microscope and a Nikon A1R. Multiple focal planes were obtained for each imaginal disc. Quantifications and image processing were performed using the Fiji/ImageJ ( https://fiji.sc ) and Adobe Photoshop software. To measure the percentage of positive area of different markers (%Dcp1, %TREred, %pJNK, %GFP, %Myc), the corresponding positive area was obtained using the “Threshold” tool in ImageJ and then normalized by the area of the compartment (labelled with positive GFP or negative Ci staining). Diap1 ratio (P/A compartment) was calculated as the proportion between the percentage of Diap1 positive areas in the posterior compartment and the anterior compartment. To quantify the percentage of the posterior compartment, a Z-maximal intensity projection was made for each image. Then, the area of the posterior compartment (labelled with positive GFP or HA staining) was measured by using the “Area” tool and normalized dividing by the total disc area (labelled by TOPRO-3 or DAPI staining). Flag, Hipk and HA integrated density (ID) were calculated by multiplying the mean intensity (obtained using the “Threshold” tool in ImageJ) and the area of the posterior compartment (labelled by positive Flag, Hipk or HA staining. ID data were normalized by the total disc area (labelled by DAPI or TOPRO staining). Statistical analysis was performed using the GraphPad Prism v8 software ( https://www.graphpad.com ). When comparing between two groups, a non-parametric Student’s t -test (Mann-Whitney’s test) was used. To compare between more than two groups, a non-parametric, one-way ANOVA test (Kruskal-Wallis test) was used. Sample size was indicated in each graph. Error bars in the graphs represent the standard deviation (SD). p-values obtained in each statistical analysis were represented in the graphs according to the following nomenclature: *p < 0,05; **p < 0,01; ***p < 0,001 and ****p < 0,001. Declarations Data availability All data are available from the corresponding authors upon reasonable request. Acknowledgments We thank Raquel Martín for the construction of the nub -LexA driver, Esther Verheyen for the anti-Hipk antibody and stocks and Andreas Bergmann for the dronc mutants. We thank the Confocal Microscopy Service at CBMSO, Eva Caminero and Mar Casado for fly injections, the Bloomington Stock Center, the Vienna Drosophila Resource Center, and the Developmental Studies Hybridoma Bank for fly stocks and reagents. Funding This study was supported by grants from FEDER/Ministerio de Ciencia e Innovación-Agencia Estatal de Investigación-Consejo Superior de Investigaciones Científicas [No. PGC2018-095151-B-I00, PID2021-125377NB-100, and PIE Intramural (CSIC) 202020E255 to GM, BFU2017-86244-P and PID2020-113318GB-I00 to ES, and PID2023-150773NB-100 to LAB). J.M. G. was a recipient of a Formación del Personal Investigador (FPI) fellowship (PRE 2019_090108) from the Spanish Government and R.A. J. was a recipient of a CONACyT Fellowship. Institutional support from the Ramón Areces Foundation is acknowledged. Author information These authors contributed equally: Juan Manuel García-Arias, Rafael Alejandro Juárez-Uribe Authors and Affiliations Centro de Biología Molecular Severo Ochoa (CBM), CSIC-UAM, Nicolás Cabrera 1, Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain Juan Manuel García-Arias, Rafael Alejandro Juárez-Uribe, Luis Alberto Baena-López, Ginés Morata and Ernesto Sánchez-Herrero Present address of Rafael Alejandro Juárez-Uribe: Department of Pathology and Laboratory Medicine, University of Rochester Medical Center, Rochester, New York, U.S.A. Authors Contributions Conceptualization: GM, ESH, LAB; methodology: JMG, RAJ, ES, LAB; investigation: JMG, RAJ, ES, LAB; data analysis: JMG, RAJ, LAB, GM, ES; writing—original draft: GM; writing—review and editing: GM, ES, LAB; funding acquisition: GM, ES, LAB supervision: GM, ES, LAB Competing interests The authors declare no competing interests Ethical approval All methods in this study were carried out in strict accordance with relevant ethical guidelines and institutional regulations Supplementary information is available at Cell Death and Differentiation’s website References 1. Fuchs Y, Steller H. Programmed cell death in animal development and disease. Cell. 2011 Nov 11;147(4):742 − 58. doi: 10.1016/j.cell.2011.10.033. 2. Lohmann I, McGinnis N, Bodmer M, McGinnis W. “The Drosophila Hox gene deformed sculpts head morphology via direct regulation of the apoptosis activator reaper Cell . 110 , 457 − 66 (2002) doi: 10.1016/s0092-8674(02)00871-1. 3. Jacobsen MD, Weil M, Raff MC. Role of Ced-3/ICE-family proteases in staurosporine-induced programmed cell death. J Cell Biol. 1996;133(5):1041–51). 4. Baonza, A., Tur-Gracia, S., Pérez-Aguilera, M., Estella, C. Regulation and coordination of the different DNA damage responses in Drosophila Front. Cell Dev. Biol. 10:993257. doi: 10.3389/fcell.2022.993257. 5. Pérez-Garijo A, Martín FA, Morata G. Caspase inhibition during apoptosis causes abnormal signalling and developmental aberrations in Drosophila. Development. 2004 Nov;131(22):5591-8. doi: 10.1242/dev.01432. 6. Verghese S, Su TT. Drosophila Wnt and STAT Define Apoptosis-Resistant Epithelial Cells for Tissue Regeneration after Irradiation. PLoS Biol. 2016 Sep 1;14(9):e1002536. doi: 10.1371/journal.pbio.1002536. 7. Grether ME, Abrams JM, Agapite J, White K, Steller H. The head involution defective gene of Drosophila melanogaster functions in programmed cell death. Genes Dev. 1995 Jul 15;9(14):1694 − 708. doi: 10.1101/gad.9.14.1694. 8. Chen P, Nordstrom W, Gish B, Abrams JM. grim, a novel cell death gene in Drosophila. Genes Dev. 1996 Jul 15;10(14):1773-82. doi: 10.1101/gad.10.14.1773. 9. White K, Tahaoglu E, Steller H. Science. Cell killing by the Drosophila gene reaper. 1996 Feb 9;271(5250):805-7. doi: 10.1126/science.271.5250.805. 10. Smith-Bolton RK, Worley MI, Kanda H, Hariharan IK. Regenerative growth in Drosophila imaginal discs is regulated by Wingless and Myc. Dev Cell. 2009 Jun;16(6):797–809. doi: 10.1016/j.devcel.2009.04.015. 11. Martín R, Pinal N, Morata G. Distinct regenerative potential of trunk and appendages of Drosophila mediated by JNK signalling. Development. 2017 Nov 1;144(21):3946–3956. doi: 10.1242/dev.155507. 12. Shlevkov E, Morata G. A dp53/JNK-dependant feedback amplification loop is essential for the apoptotic response to stress in Drosophila. Cell Death Differ. 2012 Mar;19(3):451 − 60. doi: 10.1038/cdd.2011.113. 13. Weston CR, Davis RJ. The JNK signal transduction pathway. Curr Opin Cell Biol. 2007 Apr;19(2):142-9. doi: 10.1016/j.ceb.2007.02.001. 14. McEwen DG, Peifer M. Puckered, a Drosophila MAPK phosphatase, ensures cell viability by antagonizing JNK-induced apoptosis. 2005 Sep;132(17):3935-46. doi: 10.1242/dev.01949. Development 132: 3935–3946. 15. McNamee, L., Brodsky, M. p53-Independent Apoptosis Limits DNA Damage-Induced Aneuploidy. Genetics. 2009 Jun;182(2):423 − 35. doi: 10.1534/genetics.109.102327. 16. Wells BS, Yoshida E, Johnston LA. Compensatory proliferation in Drosophila imaginal discs requires Dronc-dependent p53 activity. Curr Biol. 2006 Aug 22;16(16):1606-15. doi: 10.1016/j.cub.2006.07.046. 17. Fogarty CE, Diwanji N, Lindblad JL, Tare M, Amcheslavsky A, Makhijani K, Brückner K, Fan Y, Bergmann A. Extracellular Reactive Oxygen Species drive Apoptosis-induced Proliferation via Drosophila Macrophages. Curr Biol. 2016 Mar 7;26(5):575 − 84. doi: 10.1016/j.cub.2015.12.064. 18. Pinal N, Calleja M, Morata G. Pro-apoptotic and pro-proliferation functions of the JNK pathway of Drosophila: roles in cell competition, tumorigenesis and regeneration Open Biol. 2019 Mar 29;9(3):180256. doi: 10.1098/rsob.180256. 19. Blaquiere JA, Verheyen EM. Homeodomain-Interacting Protein Kinases: Diverse and Complex Roles in Development and Disease. Curr Top Dev Biol. 2017;123:73–103. doi: 10.1016/bs.ctdb.2016.10.002. 20. Choi CY, Kim YH, Kim YO, Park SJ, Kim EA, Riemenschneider W, Gajewski K, Schulz RA, Kim Y. Phosphorylation by the DHIPK2 protein kinase modulates the corepressor activity of Groucho. J Biol Chem. 2005 Jun 3;280(22):21427-36. doi: 10.1074/jbc.M500496200. 21. Rinaldo C, Prodosmo A, Siepi F, Soddu S. HIPK2: a multitalented partner for transcription factors in DNA damage response and development. Biochem Cell Biol. 2007 Aug;85(4):411-8. doi: 10.1139/O07-071. 22. Lee W, Andrews BC, Faust M, Walldorf U, Verheyen EM. Hipk is an essential protein that promotes Notch signal transduction in the Drosophila eye by inhibition of the global co-repressor Groucho. Dev Biol. 2009 Jan 1;325(1):263 − 72. doi: 10.1016/j.ydbio.2008.10.029. 23. Lee, W., Swarup, S., Chen, J., Ishitani, T., & Verheyen, E. M. Homeodomain interacting protein kinases (Hipks) promote Wnt/Wg signaling through stabilization of -catenin/Arm and stimulation of target gene expression. Development.2009. 136(2), 241–251. doi: 10.1016/j.ydbio.2008.10.029. 24. Chen J, Verheyen EM. Homeodomain-interacting protein kinase regulates Yorkie activity to promote tissue growth. Curr Biol. 2012 Sep 11;22(17):1582-6. doi: 10.1016/j.cub.2012.06.074. 25. Tettweiler G, Blaquiere JA, Wray NB, Verheyen EM. Hipk is required for JAK/STAT activity during development and tumorigenesis. PLoS One. 2019 Dec 31;14(12):e0226856. doi: 10.1371/journal.pone.0226856. 26. Huang H, Du G, Chen H, Liang X, Li C, Zhu N, Xue L, Ma J, Jiao R. Drosophila Smt3 negatively regulates JNK signaling through sequestering Hipk in the nucleus. Development. 2011 Jun;138(12):2477-85. doi: 10.1242/dev.061770. 27. Link N, Chen P, Lu WJ, Pogue K, Chuong A, Mata M, Checketts J, Abrams JM. A collective form of cell death requires homeodomain interacting protein kinase. J Cell Biol. 2007 Aug 13;178(4):567 − 74. doi: 10.1083/jcb.200702125. 28. Madhavan MM, Madhavan K. Morphogenesis of the epidermis of adult abdomen of Drosophila. J Embryol Exp Morphol. 1980 Dec;60:1–31. 29. Ninov N, Chiarelli DA, Martín-Blanco E. Extrinsic and intrinsic mechanisms directing epithelial cell sheet replacement during Drosophila metamorphosis. Development. 2007 Jan;134(2):367 − 79. doi: 10.1242/dev.02728 30. Hay BA, Wolff T, Rubin GM. Expression of baculovirus P35 prevents cell death in Drosophila. Development. 1994 Aug;120(8):2121-9. doi: 10.1242/dev.120.8.2121. 31. Cherbas L, Hu X, Zhimulev I, Belyaeva E, Cherbas P. EcR isoforms in Drosophila: testing tissue-specific requirements by targeted blockade and rescue. Development. 2003 Jan;130(2):271 − 84. doi: 10.1242/dev.00205. 32. Kester RS, Nambu JR. Targeted expression of p35 reveals a role for caspases in formation of the adult abdominal cuticle in Drosophila. Int J Dev Biol. 2011;55(1):109 − 19. doi: 10.1387/ijdb.103109rk. 33. Spéder P, Adám G, Noselli S. Type ID unconventional myosin controls left-right asymmetry in Drosophila. Nature. 2006 Apr 6;440(7085):803-7. doi: 10.1038/nature04623. 34. Hozumi S, Maeda R, Taniguchi K, Kanai M, Shirakabe S, Sasamura T, Spéder P, Noselli S, Aigaki T, Murakami R, Matsuno K. An unconventional myosin in Drosophila reverses the default handedness in visceral Organs. Nature. 2006 Apr 6;440(7085):798–802. doi: 10.1038/nature04625. 35. Abbott MK, Lengyel JA. Embryonic head involution and rotation of male terminalia require the Drosophila locus head involution defective. Genetics. 1991 Nov;129(3):783-9. doi: 10.1093/genetics/129.3.783. 36. Macías A, Romero NM, Martín F, Suárez L, Rosa AL, Morata G. PVF1/PVR signaling and apoptosis promotes the rotation and dorsal closure of the Drosophila male terminalia. Int J Dev Biol. 2004 Dec;48(10):1087-94. doi: 10.1387/ijdb.041859am. 37. Suzanne M., Pedtzoldt A.G., Spéder P., Coutelis J.B., Steller H., Noselli S. Coupling of apoptosis and L/R patterning controls stepwise organ looping. Current Biology 2010; 20, 1773-78. 38. Kuranaga E., Matsunuma T., Kanuka H., Takemoto K., Koto A., Kimura K., Miura M. Apoptosis controls the speed of looping morphogenesis in Drosophila male terminalia. Development 2011; 138, 1493-99. 39. Ryoo HD, Bergmann A, Gonen H, Ciechanover A, Steller H. Regulation of Drosophila IAP1 degradation and apoptosis by reaper and ubcD1. Nat Cell Biol. 2002 Jun; 4(6):432-8. doi: 10.1038/ncb795. 40. Dorstyn L, Colussi PA, Quinn LM, Richardson H, Kumar S. Proc Natl Acad Sci U S A. DRONC, an ecdysone-inducible Drosophila caspase. 1999 Apr 13;96(8):4307-12. doi: 10.1073/pnas.96.8.4307. 41. Fraser AG, Evan GI. Identification of a Drosophila melanogaster ICE/CED-3-related protease, drICE. EMBO J. 1997 May 15;16(10):2805-13. doi: 10.1093/emboj/16.10.2805. 42. Goyal L, McCall K, Agapite J, Hartwieg E, Steller H. Induction of apoptosis by Drosophila reaper, hid and grim through inhibition of IAP function. EMBO J 2000; 19 : 589–597. doi: 10.1093/emboj/19.4.589. 43. Brand AH, Perrimon N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993 Jun;118(2):401 − 15. doi: 10.1242/dev.118.2.401. 44. Lai SL, Lee T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nat Neurosci. 2006;9:703–709. doi: 10.1038/nn1681. 45. Uhlirova M, Bohmann D. JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila. EMBO J. 2006 Nov 15;25(22):5294 − 304. doi: 10.1038/sj.emboj.7601401. 46. Meier P, Silke J, Leevers SJ, Evan GI. The Drosophila caspase DRONC is regulated by DIAP1. EMBO J. 2000 Feb 15;19(4):598–611. doi: 10.1093/emboj/19.4.598. 47. Hay BA, Wassarman DA, Rubin GM. Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death. Cell. 1995 Dec 29;83(7):1253-62. doi: 10.1016/0092-8674(95)90150-7. 48. Wang SL, Hawkins CJ, Yoo SJ, Müller HA, Hay BA. The Drosophila caspase inhibitor DIAP1 is essential for cell survival and is negatively regulated by HID. Cell. 1999 Aug 20;98(4):453 − 63. doi: 10.1016/s0092-8674(00)81974-1. 49. Lisi S, Mazzon I, White K. Diverse domains of THREAD/DIAP1 are required to inhibit apoptosis induced by REAPER and HID in Drosophila. Genetics. 2000 Feb;154(2):669 − 78. doi: 10.1093/genetics/154.2.669. 50. Ryoo HD, Gorenc T, Steller. Apoptotic cells can induce compensatory cell proliferation through the JNK and the Wingless signaling pathways. Dev Cell. 2004 Oct;7(4):491–501. doi: 10.1016/j.devcel.2004.08.019. 51. Poon CL, Zhang X, Lin JI, Manning SA, Harvey KF. Homeodomain-interacting protein kinase regulates Hippo pathway-dependent tissue growth. Curr Biol. 2012 Sep 11;22(17):1587-94. doi: 10.1016/j.cub.2012.06.075. 52. Blaquiere JA, Wong KKL, Kinsey SD, Wu J, Verheyen EM. Homeodomain-interacting protein kinase promotes tumorigenesis and metastatic cell behavior. Dis Model Mech. 2018 Jan 17;11(1): dmm031146. doi: 10.1242/dmm.031146. 53. Gresko E, Roscic A, Ritterhoff S, Vichalkovski A, del Sal G, Schmitz ML. Autoregulatory control of the p53 response by caspase-mediated processing of HIPK2. EMBO J. 2006 May 3;25(9):1883-94. doi: 10.1038/sj.emboj.7601077. 54. Siegrist, SE.,Haque, NS, Chen, CH, Hay BA, Hariharan IK. Inactivation of both Foxo and 975 reaper promotes long-term adult neurogenesis in Drosophila. Curr. Biol. 2010 Apr 13;20(7):643-8. doi: 10.1016/j.cub.2010.01.060. 55. Pinal N, Martín M, Medina I, Morata G. Short-term activation of the Jun N-terminal kinase pathway in apoptosis-deficient cells of Drosophila induces tumorigenesis Nat Commun. 2018 Apr 18;9(1):1541. doi: 10.1038/s41467-018-04000-6. 56. Hofmann TG, Stollberg N, Schmitz ML, Will H. HIPK2 regulates transforming growth factor-beta-induced c-Jun NH(2)-terminal kinase activation and apoptosis in human hepatoma cells. Cancer Res. 2003 Dec 1;63(23):8271-7. 57. D'Orazi G, Cecchinelli B, Bruno T, Manni I, Higashimoto Y, Saito S, Gostissa M, Coen S, Marchetti A, Del Sal G, Piaggio G, Fanciulli M, Appella E, Soddu S. Homeodomain-interacting protein kinase-2 phosphorylates p53 at Ser 46 and mediates apoptosis. Nat Cell Biol. 2002 Jan;4(1):11 − 9. doi: 10.1038/ncb714. 58. Di Stefano V, Rinaldo C, Sacchi A, Soddu S, D'Orazi G. Homeodomain-interacting protein kinase-2 activity and p53 phosphorylation are critical events for cisplatin-mediated apoptosis. Exp Cell Res. 2004 Feb 15;293(2):311 − 20. doi: 10.1016/j.yexcr.2003.09.032. 59. Wang Y, Debatin KM, Hug H. HIPK2 overexpression leads to stabilization of p53 protein and increased p53 transcriptional activity by decreasing Mdm2 protein levels. BMC Mol Biol. 2001;2:8. doi: 10.1186/1471-2199-2-8. 60. Zhang Q, Yoshimatsu Y, Hildebrand J, Frisch SM, Goodman RH. Homeodomain interacting protein kinase 2 promotes apoptosis by downregulating the transcriptional corepressor CtBP. <cell. 2003 Oct 17;115(2):177 − 86. doi: 10.1016/s0092-8674(03)00802-x. 61. Sombroek D, Hofmann TG. How cells switch HIPK2 on and off. Cell Death Differ. 2009 Feb;16(2):187 − 94. doi: 10.1038/cdd.2008.154. 62. Rodriguez A, Oliver H, Zou H, Chen P, Wang X, Abrams JM. Dark is a Drosophila homologue of Apaf-1/CED-4 and functions in an evolutionarily conserved death pathway Nat Cell Biol. 1999 Sep;1(5):272-9. doi: 10.1038/12984. 63. D'Brot A, Chen P, Vaishnav M, Yuan S, Akey CW, Abrams JM. Tango7 directs cellular remodeling by the Drosophila apoptosome. Genes Dev. 2013 Aug 1;27(15):1650-5. doi: 10.1101/gad.219287.113. 64. Amcheslavsky A, Wang S, Fogarty CE, Lindblad JL, Fan Y, Bergmann A. Plasma Membrane Localization of Apoptotic Caspases for Non-apoptotic Functions Dev Cell. 2018 May 21;45(4):450–464.e3. doi: 10.1016/j.devcel.2018.04.020. 65. Brady SC, Allan LA, Clarke PR. Regulation of caspase 9 through phosphorylation by protein kinase C zeta in response to hyperosmotic stress. Mol Cell Biol. 2005 Dec;25(23):10543-55. doi: 10.1128/MCB.25.23.10543-10555.2005. 66. Martin MC, Allan LA, Lickrish M, Sampson C, Morrice N, Clarke PR. Protein kinase A regulates caspase-9 activation by Apaf-1 downstream of cytochrome c. J Biol Chem. 2005 Apr 15;280(15):15449-55. doi: 10.1074/jbc.M414325200. 67. Allan LA, Clarke PR. Apoptosis and autophagy: Regulation of caspase-9 by phosphorylation. FEBS J. 2009 Nov;276(21):6063-73. doi: 10.1111/j.1742-4658.2009.07330.x. 68. Ge J, Wang Y, Li X, Lu Q, Yu H, Liu H, Ma K, Deng X, Luo ZQ, Liu X, Qiu J. Phosphorylation of caspases by a bacterial kinase inhibits host programmed cell death Nat Commun. 2024 Sep 30;15(1):8464. doi: 10.1038/s41467-024-52817-1. 69. Yang CS, Thomenius MJ, Gan EC, Tang W, Freel CD, Merritt TJ, Nutt LK, Kornbluth S. Metabolic regulation of Drosophila apoptosis through inhibitory phosphorylation of Dronc EMBO J. 2010 Sep 15;29(18):3196 − 207. doi: 10.1038/emboj.2010.191. 70. Liu J, Lin A. Role of JNK activation in apoptosis: a double-edged sword. Cell Res. 2005;15:36–42. doi: 10.1038/sj.cr.7290262. 71. Tanimoto H, Itoh S, ten Dijke P, Tabata T. Hedgehog creates a gradient of DPP activity in Drosophila wing imaginal discs. Mol cell. 2000;5:59–71. doi: 10.1016/S1097-2765(00)80403-7. 72. McGuire SE, Le PT, Osborn AJ, Matsumoto K, Davis RL. Spatiotemporal rescue of memory dysfunction in Drosophila. Science. 2003;302:1765–8. doi: 10.1126/science.1089035. 73. de Navas L, Foronda D, Suzanne M, Sánchez-Herrero E. A simple and efficient method to identify replacements of P-lacZ by P-Gal4 lines allows obtaining Gal4 insertions in the bithorax complex of Drosophila. Mech Dev. 2006 Nov;123(11):860-7. doi: 10.1016/j.mod.2006.07.010. 74. Santabárbara-Ruiz P, López-Santillán M, Martínez-Rodríguez I, Binagui-Casas A, Pérez L, Milán M, Corominas M, Serras F. ROS-Induced JNK and p38 Signaling Is Required for Unpaired Cytokine Activation during Drosophila Regeneration. PLoS Genet. 2015 Oct 23;11(10):e1005595. doi: 10.1371/journal.pgen.1005595. 75. Igaki, T., Kanuka, H., Inohara, N., Sawamoto, K., Nunez, G., Okano, H., & Miura, M. Drob-1, a Drosophila member of the Bcl-2/CED-9 family that promotes cell death. doi: 10.1073/pnas.97.2.662. 76. Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P. Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery. Cell Death Differ. 2006 Oct;13(10):1663-74. doi: 10.1038/sj.cdd.4401868. 77. Jenett A, Rubin GM, Ngo TT, Shepherd D, Murphy C, Dionne H, Pfeiffer BD, Cavallaro A, Hall D, Jeter J, Iyer N, Fetter D, Hausenfluck JH, Peng H, Trautman ET, Svirskas RR, Myers EW, Iwinski ZR, Aso Y, DePasquale GM, Enos A, Hulamm P, Lam SC, Li HH, Laverty TR, Long F, Qu L, Murphy SD, Rokicki K, Safford T, Shaw K, Simpson JH, Sowell A, Tae S, Yu Y, Zugates CT. A GAL4-driver line resource for Drosophila neurobiology. Cell Rep. 2012 Oct 25;2(4):991–1001. doi: 10.1016/j.celrep.2012.09.011. 78. Pfeiffer et al., 2010. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Refinement of tools for targeted gene expression in Drosophila. Genetics. 2010 Oct;186(2):735 − 55. doi: 10.1534/genetics.110.119917. 79. Wendler F, Park S, Hill C, Galasso A, Chang KR, Awan I, Sudarikova Y, Bustamante-Sequeiros M, Liu S, Sung EY, Aisa-Bonoko G, Kim SK, Baena-Lopez LA. A LexAop > UAS > QUAS trimeric plasmid to generate inducible and interconvertible Drosophila overexpression transgenes. Sci Rep. 2022 Mar 9;12(1):3835. doi: 10.1038/s41598-022-07852-7. 80. Arthurton L, Nahotko DA, Alonso J, Wendler F, Baena-Lopez LA. Non-apoptotic caspase activation preserves Drosophila intestinal progenitor cells in quiescence EMBO Rep. 2020 Dec 3;21(12):e48892. doi: 10.15252/embr.201948892. Additional Declarations There is no duality of interest Supplementary Files SupplementaryFigures.pdf Supplementary Figures Cite Share Download PDF Status: Published Journal Publication published 16 Dec, 2025 Read the published version in Cell Death Discovery → Version 1 posted Unknown event 23 Jul, 2025 Editorial decision: Reject after peer review 10 Jul, 2025 Review # 1 received at journal 06 Jul, 2025 Review # 2 received at journal 03 Jul, 2025 Reviewer # 2 agreed at journal 27 Jun, 2025 Reviewer # 1 agreed at journal 26 Jun, 2025 Reviewers invited by journal 26 Jun, 2025 Submission checks completed at journal 24 Jun, 2025 First submitted to journal 23 Jun, 2025 Editor assigned by journal 23 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6955925","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":477084515,"identity":"a5bd918a-d4e5-4d78-968d-609300b94f8e","order_by":0,"name":"Ernesto Sánchez-Herrero","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4ElEQVRIie2PMQuCQBSAT4JzObpVcegvvBCUIPSvGELTUWttB4EtQWvRX2m4cDVajaYS3NtyqlPaisO2hvuWt7yP9z2ENJq/hLynyXEzcXuFiJ8VK2qxXEPp8VDM98MptYvylqMg7JrCuD4Uir2ZxP2sHA+2u7HvMhSPEhJ1XKJQICeezUUKcGHYYUhE2ELYUYWFp8yvuHgCnLNGCaViVqowQMwzuBAgzzWKkcgrSBVm5cyVYTHYq/oXqH8ZLRyVQtdZ/85FANRMy4LNgrC3TA93VdhHp8Tg7QWNRqPRfOUFzYdCrLk+EtcAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-5688-2303","institution":"Centro de Biología Molecular Severo Ochoa (CBM), CSIC-UAM","correspondingAuthor":true,"prefix":"","firstName":"Ernesto","middleName":"","lastName":"Sánchez-Herrero","suffix":""},{"id":477084516,"identity":"a12594de-b3e4-4c21-aae9-7d823eba9b48","order_by":1,"name":"Juan Manuel García-Arias","email":"","orcid":"https://orcid.org/0009-0003-3889-0555","institution":"CSIC","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"Manuel","lastName":"García-Arias","suffix":""},{"id":477084517,"identity":"882d04fe-c71c-4eb2-95d6-5f6cedcbf987","order_by":2,"name":"Rafael Alejandro Juárez-Uribe","email":"","orcid":"","institution":"Centro de Biología Molecular Severo Ochoa (CBM), CSIC-UAM","correspondingAuthor":false,"prefix":"","firstName":"Rafael","middleName":"Alejandro","lastName":"Juárez-Uribe","suffix":""},{"id":477084518,"identity":"c49686d2-1d48-44bf-a824-7dfce900e002","order_by":3,"name":"Luis Alberto Baena-López","email":"","orcid":"https://orcid.org/0000-0002-8663-3794","institution":"Centro de Biología Molecular Severo Ochoa","correspondingAuthor":false,"prefix":"","firstName":"Luis","middleName":"Alberto","lastName":"Baena-López","suffix":""},{"id":477084519,"identity":"49d8bb6a-7f9b-4054-af6b-276e0b87ddec","order_by":4,"name":"Gines Morata","email":"","orcid":"https://orcid.org/0000-0003-3274-5173","institution":"CSIC","correspondingAuthor":false,"prefix":"","firstName":"Gines","middleName":"","lastName":"Morata","suffix":""}],"badges":[],"createdAt":"2025-06-23 10:51:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6955925/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6955925/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41420-025-02916-9","type":"published","date":"2025-12-16T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":85762149,"identity":"afd99da1-5674-4309-a2c9-60829669450b","added_by":"auto","created_at":"2025-07-01 11:51:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":773825,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe function of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ehipk\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e is required for developmentally programmed apoptosis in the abdomen and terminalia\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Control \u003cem\u003eEip71CD\u003c/em\u003e-Gal4 UAS-\u003cem\u003echerry\u003c/em\u003e female dorsal abdomen showing continuous epithelium between left and right sides of each segment. (B\u003cstrong\u003e) \u003c/strong\u003eWhen the caspase inhibitor \u003cem\u003ep35\u003c/em\u003e is expressed in the LECs (\u003cem\u003eEip71CD-Gal4 UAS-p35\u003c/em\u003e flies), some left and right dorsal tergites do not meet properly at the midline (arrow). (C) Suppression of JNK activity in the larval epidermal cells causes a similar phenotype. (D) When \u003cem\u003ehipk\u003c/em\u003e expression is reduced in LECs (\u003cem\u003eEip71CD-Gal4 UAS-hipk\u003c/em\u003e\u003csup\u003e\u003cem\u003eRNAi\u003c/em\u003e\u003c/sup\u003e flies) the phenotype is also similar, though weaker. 8-10 females were studied for each genotype, all showing a uniform phenotype. (E) Male genitalia and analia of a control \u003cem\u003eAbd-B\u003c/em\u003e\u003csup\u003e\u003cem\u003eLDN\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e UAS-cherry\u003c/em\u003e fly, showing the wildtype disposition, genitalia (G) in the upper location and analia (A) in the lower one, as indicated by the arrow from genitalia to analia. (F, G)\u003cstrong\u003e \u003c/strong\u003ein \u003cem\u003eAbd-B\u003c/em\u003e\u003csup\u003e\u003cem\u003eLDN\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e UAS-p35\u003c/em\u003e (F) o \u003cem\u003eAbd-B\u003c/em\u003e\u003csup\u003e\u003cem\u003eLDN\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e UAS-bsk\u003c/em\u003e\u003csup\u003e\u003cem\u003eDN\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e \u003c/em\u003e(G) males the normal disposition of the analia and genitalia is reversed or abnormal, the analia now being in an anterior or lateral location with respect to the genitalia, arrows. (H) In an\u003cem\u003e Abd-B\u003c/em\u003e\u003csup\u003e\u003cem\u003eLDN\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e UAS-hipk\u003c/em\u003e\u003csup\u003e\u003cem\u003eRNAI\u003c/em\u003e\u003c/sup\u003e male a similar abnormal phenotype is observed.\u0026nbsp; 7-11 males were observed for each genotype, all with similar phenotypes. All the crosses were made at 25ºC and the larvae transferred to 31ºC to complete development\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6955925/v1/f61c9e55d8476fb75d40dd80.png"},{"id":85762151,"identity":"052fb99f-d181-46bb-93ba-70ae95188681","added_by":"auto","created_at":"2025-07-01 11:51:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":728707,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe pro-apoptotic gene \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003erpr\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e requires the contribution of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ehipk\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e for full apoptotic response and stimulus of JNK activity\u003c/strong\u003e.\u003c/p\u003e\n\u003cp\u003eGenotypes on top of the panels. (A) Drawings illustrating the experiments.\u0026nbsp; We have made use of the binary systems Gal4/UAS and LexA/LexO. The \u003cem\u003een\u003c/em\u003e-Gal4 driver directs GFP expression and reduces \u003cem\u003ehipk\u003c/em\u003e levels only in the Posterior (P) compartment, thus discriminating between the Anterior (A) and the P compartments. The \u003cem\u003enub\u003c/em\u003e-LexA driver directs \u003cem\u003erpr\u003c/em\u003e expression (in red) in the wing pouch, which contains anterior and posterior regions. The combination of the two drivers permits to differentiate regions that contain only \u003cem\u003erpr\u003c/em\u003e expression (red), only \u003cem\u003ehipk\u003c/em\u003e expression (green) or both (yellow). (B, B’, D) In \u003cem\u003een\u003c/em\u003e\u003csup\u003e\u003cem\u003eGal80 \u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;GFP\u003c/em\u003e;\u003cem\u003e nub-LexA\u0026gt;rpr \u003c/em\u003ediscs the entire P compartment is labelled with GFP, and \u003cem\u003erpr\u003c/em\u003e is expressed in the Nubbin domain. Staining with the marker Dcp1 (red) shows high apoptotic levels in the entire Nubbin domain, A and P compartments. (C, C’, D) In contrast, in \u003cem\u003een\u003c/em\u003e\u003csup\u003e\u003cem\u003eGal80 \u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;GFP hipk\u003c/em\u003e\u003csup\u003e\u003cem\u003eRNAi\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e nub-LexA\u0026gt;rpr \u003c/em\u003ediscs\u003cem\u003e \u003c/em\u003ethere is a marked reduction of Dcp1 in the posterior Nubbin region. The images in E-F’, G and H-I’, J illustrate similar experiments demonstrating the effect of the loss of \u003cem\u003ehipk\u003c/em\u003e function on JNK activity, monitored by the expression of the phosphorylated form of Jun (E-G) or by the TRE-red marker (H-J). Date are shown as the means ± SD, the significant level was identified by \u003cem\u003e*p\u003c/em\u003e\u0026lt;0,05; \u003cem\u003e**p\u003c/em\u003e\u0026lt;0,01; \u003cem\u003e***p\u003c/em\u003e\u0026lt;0,001 and \u003cem\u003e****p\u003c/em\u003e\u0026lt;0,001.; ns: no significant.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6955925/v1/920e1a1719dcc431fbeba180.png"},{"id":85762925,"identity":"c6ff7d93-a67d-4ff9-85c3-f07b2e0bae91","added_by":"auto","created_at":"2025-07-01 11:59:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":620252,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFunctional interactions between \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ehipk\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ediap1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenotypes on top of the panels. (A-B’, C) Reduction of \u003cem\u003ehipk\u003c/em\u003e function in the posterior region of the Nubbin domain of discs of genotype \u003cem\u003een\u003c/em\u003e\u003csup\u003e\u003cem\u003eGal80 \u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;GFP hipk\u003c/em\u003e\u003csup\u003e\u003cem\u003eRNA\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e nub-LexA\u0026gt;rpr\u003c/em\u003e (B, B’) causes an increase in the amount of Diap1 protein in the P compartment, something not observed in control discs (\u003cem\u003een\u003c/em\u003e\u003csup\u003e\u003cem\u003eGal80 \u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;GFP nub-LexA\u0026gt;rpr\u003c/em\u003e) (A, A’), as indicated by the levels of anti-Diap1 antibody. \u0026nbsp;Quantification in C. (D, D’) Suppression of \u003cem\u003ediap1\u003c/em\u003e in the P compartment of \u003cem\u003ehh\u003c/em\u003e\u003csup\u003e\u003cem\u003eGal80\u003c/em\u003e\u003c/sup\u003e \u0026gt;\u003cem\u003ediap1\u003c/em\u003e\u003csup\u003e\u003cem\u003eRNAi\u003c/em\u003e\u003c/sup\u003e \u003cem\u003elacZ\u003c/em\u003e discs causes a strong apoptotic response, as indicated by the accumulation of the Dcp1 caspase (red). The A/P boundary is delineated by the expression of Ci, an A compartment marker. (E, E’) Compromising \u003cem\u003ehipk\u003c/em\u003e function by RNA interference in the P compartment of \u003cem\u003ehh\u003c/em\u003e\u003csup\u003e\u003cem\u003eGal80\u003c/em\u003e\u003c/sup\u003e \u0026gt;\u003cem\u003ediap1\u003c/em\u003e\u003csup\u003e\u003cem\u003eRNAi \u003c/em\u003e\u003c/sup\u003e\u003cem\u003ehipk\u003c/em\u003e\u003csup\u003e\u003cem\u003eRNAi\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003elarvae\u003csup\u003e \u003c/sup\u003eresults in a significant decrease of Dcp1 levels. Quantification in F. \u0026nbsp;Date are shown as the means ± SD, the significant level was identified by \u003cem\u003e*p\u003c/em\u003e\u0026lt;0,05; \u003cem\u003e**p\u003c/em\u003e\u0026lt;0,01; \u003cem\u003e***p\u003c/em\u003e\u0026lt;0,001 and \u003cem\u003e****p\u003c/em\u003e\u0026lt;0,001.; ns: no significant.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6955925/v1/aa4d26a8db4ec127d8e99bb3.png"},{"id":85762153,"identity":"ef0eb022-47d9-4073-ac87-8797389c6cb6","added_by":"auto","created_at":"2025-07-01 11:51:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":645488,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ehipk\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e down-regulation on apoptotic levels induced by Dronc and Drice overexpression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenotypes on top of the panels. (A-B’) The amount of apoptosis (Dcp1, red) in control \u003cem\u003ehh\u0026gt;lacZ\u003c/em\u003e (A, A’) and \u003cem\u003ehh\u0026gt;hipk\u003c/em\u003e\u003csup\u003e\u003cem\u003eRNAi\u003c/em\u003e\u003c/sup\u003e\u003csup\u003e \u003c/sup\u003e(B, B’) discs is similarly low. The Ci antibody marks the anterior compartment. Quantification in I. (C-D’) The joint overexpression of \u003cem\u003edronc\u003c/em\u003e and \u003cem\u003edrice\u003c/em\u003e in the P compartment results in high levels of apoptosis (C, C’), as indicated by Dcp1 staining, but these are drastically reduced by compromising \u003cem\u003ehipk\u003c/em\u003e function (D, D’). The Ci antibody marks the anterior compartment. Quantification in I. (E-F’) Overexpression of \u003cem\u003edronc\u003c/em\u003e in the P compartment (marked my antibody against the Myc tag) shows a moderate increase of apoptosis (E, E’), which is suppressed by compromising \u003cem\u003ehipk\u003c/em\u003e function (F, F’). Quantification in J. (G-H’) Overexpression of \u003cem\u003edrice\u003c/em\u003e (marked by an antibody against the Flag tag) causes a slight increase of apoptosis (G, G’), which is not affected by reducing \u003cem\u003ehipk\u003c/em\u003e activity (H, H’). Quantification in K. \u0026nbsp;Date are shown as the means ± SD, the significant level was identified by \u003cem\u003e*p\u003c/em\u003e\u0026lt;0,05; \u003cem\u003e**p\u003c/em\u003e\u0026lt;0,01; \u003cem\u003e***p\u003c/em\u003e\u0026lt;0,001 and \u003cem\u003e****p\u003c/em\u003e\u0026lt;0,001.; ns: no significant.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6955925/v1/6e0704f1acdfcf3bc4767108.png"},{"id":85763486,"identity":"47798237-be0a-4c2b-99e8-69771585faa8","added_by":"auto","created_at":"2025-07-01 12:07:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":650733,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRole of Hipk in the stabilization of the Dronc protein.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenotypes on top of the panels. (A-B’’) Joint overexpression of \u003cem\u003edronc\u003c/em\u003e and \u003cem\u003edrice \u003c/em\u003ecause an accumulation of total Dronc protein (A, A’) in the P compartment, as indicated by anti-Myc, as well as of active Dronc protein (A, A’’), as shown by GFP staining, but the lack of \u003cem\u003ehipk\u003c/em\u003efunction substantially reduces both (B-B”). Quantifications in C, D. (E-F’’) After overexpression of \u003cem\u003edronc\u003c/em\u003e in the P compartment, there is also an accumulation of both types of proteins (E-E’’), whose levels are reduced (more clearly for the active one) when \u003cem\u003ehipk\u003c/em\u003e activity is reduced (F-F”). Quantifications in G, H. (I-J’’) Overexpression of \u003cem\u003edrice\u003c/em\u003e in the P compartment results in high levels of Drice protein (labelled with Flag) (I, I’), which are not altered by compromising \u003cem\u003ehipk\u003c/em\u003e activity (J, J’). Quantification in K. \u0026nbsp;Date are shown as the means ± SD, the significant level was identified by \u003cem\u003e*p\u003c/em\u003e\u0026lt;0,05; \u003cem\u003e**p\u003c/em\u003e\u0026lt;0,01; \u003cem\u003e***p\u003c/em\u003e\u0026lt;0,001 and \u003cem\u003e****p\u003c/em\u003e\u0026lt;0,001.; ns: no significant.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6955925/v1/f33888a9e9c1929dd3bb0aad.png"},{"id":85762173,"identity":"9b4c4fc6-f529-46ee-b1c8-0edcf13acde1","added_by":"auto","created_at":"2025-07-01 11:51:37","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":600399,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe overgrowth caused by \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ehipk\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e is dependent on \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003edronc\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e function\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGenotypes on top of the panels. (A, A’) Control \u003cem\u003ehh\u003c/em\u003e\u003csup\u003e\u003cem\u003eGal80\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e\u0026gt;GFP\u003c/em\u003e wing disc in which the P compartment is labelled with GPP. (B, B’) Overexpression of \u003cem\u003ehipk\u003c/em\u003e, using a UAS-\u003cem\u003ehipk-HA\u003c/em\u003e construct expressed in the P compartment, causes a modest overgrowth of the compartment. (C, C’) The concomitant expression of \u003cem\u003ehid\u003c/em\u003e and \u003cem\u003ehipk-HA\u003c/em\u003e produces a larger increase in size of the compartment. (D, D’) When both \u003cem\u003ehid\u003c/em\u003e and \u003cem\u003ehipk-HA\u003c/em\u003e are expressed but in a \u003cem\u003edronc\u003c/em\u003e mutant background (\u003cem\u003edronc\u003c/em\u003e\u003csup\u003e\u003cem\u003ei24\u003c/em\u003e\u003c/sup\u003e/\u003cem\u003edronc\u003c/em\u003e\u003csup\u003e\u003cem\u003ei29\u003c/em\u003e\u003c/sup\u003e), the P compartment size is drastically reduced. Quantifications in E. Date are shown as the means ± SD, the significant level was identified by \u003cem\u003e*p\u003c/em\u003e\u0026lt;0,05; \u003cem\u003e**p\u003c/em\u003e\u0026lt;0,01; \u003cem\u003e***p\u003c/em\u003e\u0026lt;0,001 and \u003cem\u003e****p\u003c/em\u003e\u0026lt;0,001.; ns: no significant.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-6955925/v1/e8f239cc250e77d381021d89.png"},{"id":85762927,"identity":"74e07dda-f534-4ce3-983b-5154365a3bdb","added_by":"auto","created_at":"2025-07-01 11:59:36","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1063042,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRegulation of Hipk function and levels by pro-apoptotic genes and by \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003edronc\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eGenotypes on top of the panels. (A, A’) In non-irradiated discs Hipk antibody expression is uniform in the wing disc (red); GFP expression (green) labels the posterior (P) compartment. (B, B’) After IR of \u003cem\u003ep35\u003c/em\u003e-expressing wing discs, patches of higher Hipk expression are observed (inset). (C, C’) Magnification of the inset shown in B. The delineated area shows JNK activity, as indicated by expression of the Mmp1 marker (red), and increased levels of anti-Hipk signal. (D, D’) Portion of the P compartment of an irradiated disc in which activity of pro-apoptotic genes is suppressed by the presence of the \u003cem\u003emirRHG\u003c/em\u003e construct (Siegrist et al., 2010). The delineated patch shows JNK activity (TRE-red signal) but Hipk levels are not increased. Quantifications in E, F. (G-G’’) The overexpression of the \u003cem\u003ehipk\u003c/em\u003egene (\u003cem\u003ehipk-HA\u003c/em\u003e construct) in the P compartment gives rise to an accumulation of the Hipk protein, as measured with the anti-Hipk and anti-HA antibodies. (H-H’’) If \u003cem\u003edronc\u003c/em\u003e expression is reduced in this genetic background, the amount of both anti-Hipk and anti-HA signals, as well as the size of the compartment, are clearly reduced. Quantifications in I, J, K. (L, L’) Forced expression of \u003cem\u003ehipk-HA\u003c/em\u003e in the P compartment, showing anti-HA signal. (M, M’) The joint overexpression of \u003cem\u003ehipk-HA\u003c/em\u003e and \u003cem\u003ehid\u003c/em\u003e strongly increases anti-HA levels in this compartment, but the amount of this signal is drastically reduced in a \u003cem\u003edronc\u003c/em\u003e mutant background (N, N’). Quantifications in O. Date are shown as the means ± SD, the significant level was identified by \u003cem\u003e*p\u003c/em\u003e\u0026lt;0,05; \u003cem\u003e**p\u003c/em\u003e\u0026lt;0,01; \u003cem\u003e***p\u003c/em\u003e\u0026lt;0,001 and \u003cem\u003e****p\u003c/em\u003e\u0026lt;0,001.; ns: no significant.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-6955925/v1/f4f82cc2825f67cb17447b74.png"},{"id":101390613,"identity":"ec81cca5-24e3-4caa-bfb4-9d6d055e5078","added_by":"auto","created_at":"2026-01-29 08:21:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5773220,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6955925/v1/aa8e810a-7641-45c8-8f19-73cbf5f187d2.pdf"},{"id":85762156,"identity":"7d3f3c7a-d89c-4ffd-8fc3-6aa3475c16d9","added_by":"auto","created_at":"2025-07-01 11:51:36","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":5728399,"visible":true,"origin":"","legend":"Supplementary Figures","description":"","filename":"SupplementaryFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6955925/v1/a555d627a37acdfeb395398a.pdf"}],"financialInterests":"There is no duality of interest","formattedTitle":"The Homeodomain-interacting protein kinase Hipk promotes apoptosis by stabilizing the active form of Dronc","fulltext":[{"header":"Introduction","content":"\u003cp\u003eApoptosis, one of the most prevalent forms of programmed cell death, is a conserved phenomenon by which cells are eliminated through an evolutionary conserved group of cysteine proteases, termed caspases, that dismantle the protein substrates and cause cell death (1). Apoptosis can take place during normal development, like in the sculpting of Drosophila embryonic cephalic structures (2) or the elimination of the interdigital membranes in vertebrates (3), or be triggered by stress or tissue damage (4).\u003c/p\u003e \u003cp\u003eBecause of the simplicity of its genetic system and its sophisticated genetic technology, \u003cem\u003eDrosophila\u003c/em\u003e is a useful model to analyse the regulation of apoptosis. Within \u003cem\u003eDrosophila\u003c/em\u003e, the wing imaginal disc is especially convenient for this analysis, since little developmentally programmed apoptosis exists, but still shows a robust apoptosis induction in response to stressors like ionizing radiation (IR), heat shock, and others (5, 6). Moreover, apoptosis can experimentally be manipulated by driving the expression of members of the apoptotic cascade, including the pro-apoptotic genes (7\u0026ndash;11).\u003c/p\u003e \u003cp\u003eAs in mammals, the apoptotic pathway in \u003cem\u003eDrosophila\u003c/em\u003e engages pro-apoptotic genes, initiator and effector caspases and natural inhibitors of apoptosis such as Diap1 (1). An important feature of the \u003cem\u003eDrosophila\u003c/em\u003e apoptotic pathway is that it includes a feedback amplification loop (Supplementary Fig.\u0026nbsp;1), necessary for the full apoptotic response (12). This loop involves the Jun N-Terminal Kinase (JNK) pathway, a versatile signalling pathway implicated in a number of biological processes (13) including apoptosis in response to stress (14, 15). Upon irradiation there is an initial apoptotic stage, triggered by the DNA damage response pathway, which induces the function of the initiator caspase Dronc and the effector caspases Drice and Dcp1 (4). A second phase, consolidating the apoptotic response, appears to rely on a Dronc-dependent stimulation of the JNK signalling pathway (12, 16\u0026ndash;18). Despite intensive research, the molecular crosstalk between major signalling pathways, such as the JNK pathway, and the core apoptotic machinery, remains poorly understood.\u003c/p\u003e \u003cp\u003eA group of factors involved in the regulation of JNK signalling are members of the conserved Homeodomain-interacting protein kinase family, encoded by the \u003cem\u003ehipk\u003c/em\u003e genes (19). While vertebrates possess four \u003cem\u003ehipk\u003c/em\u003e members (\u003cem\u003ehipk1-4\u003c/em\u003e), \u003cem\u003eDrosophila\u003c/em\u003e only contains one, what facilitates the experimental analysis of Hipk function. The \u003cem\u003eDrosophila hipk\u003c/em\u003e gene shows the highest homology with the vertebrate \u003cem\u003ehipk2\u003c/em\u003e (20), which encodes a protein known to interact with many transcription factors and to regulate a variety of processes, including transcriptional regulation, chromatin remodelling, cell proliferation and apoptosis (21). The \u003cem\u003ehipk\u003c/em\u003e gene of \u003cem\u003eDrosophila\u003c/em\u003e is also involved in regulating major pathways like Notch (22), Wg (23), Hippo (24), JAK/STAT (25), and JNK (26). Nevertheless, the molecular bases of these interactions are largely unknown, particularly in the context of apoptosis and JNK signalling regulation.\u003c/p\u003e \u003cp\u003eIn this work we present evidence that the apoptotic activities of Dronc and the JNK signalling amplification are critically influenced by \u003cem\u003ehipk\u003c/em\u003e. Specifically, our results indicate that to a large extent these effects stem from the mutual ability of Hipk and Dronc to regulate each other\u0026rsquo;s activities in vivo.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eDevelopmentally programmed apoptosis requires\u003c/b\u003e \u003cb\u003ehipk\u003c/b\u003e \u003cb\u003efunction\u003c/b\u003e\u003c/p\u003e \u003cp\u003ePrevious data indicated that \u003cem\u003ehipk\u003c/em\u003e is required for the implementation of apoptosis in developmentally regulated scenarios in \u003cem\u003eDrosophila\u003c/em\u003e. such as the removal of embryonic neurons and epithelial wing cells after adult hatching from the puparium (27). To further characterize the role of \u003cem\u003ehipk\u003c/em\u003e during apoptosis, we have analysed the consequences of compromising \u003cem\u003ehipk\u003c/em\u003e function in two developmental contexts showing intrinsic apoptosis: the fusion of the adult abdominal hemi-segments, and the rotation of the male genitalia.\u003c/p\u003e \u003cp\u003eDuring pupal development, polytene Larval Epidermal Cells (LECs) undergo cell death and are extruded from the epithelium. The elimination of LECs is tightly coupled with the proliferation of histoblasts that ultimately form the adult abdominal cuticle (28, 29). The dorsal histoblasts from the left and right sides meet at the midline to form a continuum epithelium in each abdominal segment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). This process depends on apoptosis-mediated elimination of the LECs, as blocking apoptosis execution by overexpressing \u003cem\u003ep35\u003c/em\u003e (30) under control of the LEC-specific \u003cem\u003eEip71CD-Gal4\u003c/em\u003e driver (31) results in lack or aberrant abdominal fusion at the midline (32; Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Since JNK is an apoptosis inducer (14, 15,18), we also examined whether this pathway was necessary for the fusion of the adult hemi-segments. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, inactivation of the JNK pathway in LECs compromised the fusion between abdominal hemi-segments. Interestingly, reducing \u003cem\u003ehipk\u003c/em\u003e expression in these same cells caused a weaker but comparable fusion defects to those observed blocking apoptosis or the JNK pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we examined the requirement of \u003cem\u003ehipk\u003c/em\u003e function for the 360\u0026ordm; rotation of the genital plate during early pupa (33, 34). This process locates the genitalia in the upper and the analia in the lower position of the terminalia (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). This arrangement requires apoptosis in the eighth abdominal segment (A8) of the male genital disc before the genital plate starts to rotate, since there is impaired or absent rotation without apoptotic cell death (35\u0026ndash;38). To prevent cell death in the A8 we used an A8-specific Gal4 line (\u003cem\u003eAbd-B\u003c/em\u003e\u003csup\u003e\u003cem\u003eLDN\u003c/em\u003e\u003c/sup\u003e) to force P35 expression or to suppress JNK activity. In contrast to control flies expressing the fluorescent protein Cherry (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), the overexpression of \u003cem\u003ep35\u003c/em\u003e or of a dominant negative form of \u003cem\u003ebasket\u003c/em\u003e (a key transducer of the JNK pathway) caused analia and genitalia rotation defects (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, G). Intriguingly, the expression of the \u003cem\u003ehipkRNAi\u003c/em\u003e construct with the same driver also triggered similar abnormal phenotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eTaken together, these results establish that both the fusion of abdominal nests of histoblasts and the rotation of the male genitalia, require normal \u003cem\u003ehipk\u003c/em\u003e function, likely by contributing to reach the apoptosis levels necessary to complete those processes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExperimentally induced apoptosis triggered by pro-apoptotic genes requires\u003c/b\u003e \u003cb\u003ehipk\u003c/b\u003e \u003cb\u003eactivity\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNext, we examined \u003cem\u003ehipk\u003c/em\u003e role after induction of cell death by the pro-apoptotic gene \u003cem\u003ereaper\u003c/em\u003e (\u003cem\u003erpr\u003c/em\u003e) (9, 11). Rpr binds to the BIR domain of Diap1 facilitating its proteasomal degradation (39). This molecular interaction between Rpr and Diap-1 secondarily licenses for activation initiator and effector caspases, Dronc (40) and Drice (41), therefore inducing cell death (42) (see Supplementary Fig.\u0026nbsp;1). To analyse the response to \u003cem\u003erpr\u003c/em\u003e induction of cells in which \u003cem\u003ehipk\u003c/em\u003e function is compromised, we combined the transcriptional bipartite gene expression systems Gal4/UAS and LexA/LexO (43, 44; see Material and Methods and drawings in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn control wing discs, forced expression of \u003cem\u003erpr\u003c/em\u003e in nubbin-expressing cells (in the wing pouch) induced strong cleaved Dcp-1 immunoreactivity and JNK activation\u0026mdash;both established markers of apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, B\u0026rsquo;, E-E\u0026rsquo;, H-H\u0026rsquo;). However, a reduction of \u003cem\u003ehipk\u003c/em\u003e expression yielded a potent rescue of these features (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-C\u0026rsquo;, D, F-F\u0026rsquo;, G, I-I\u0026rsquo;, J). These results suggested that \u003cem\u003ehipk\u003c/em\u003e is key for both \u003cem\u003erpr\u003c/em\u003e-induced JNK signalling and apoptosis.\u003c/p\u003e \u003cp\u003eThe requirement of \u003cem\u003ehipk\u003c/em\u003e function in the maintenance of JNK activity was further investigated in an experiment in which apoptosis was induced by IR but the execution of the apoptosis programmed was prevented overexpressing the effector caspase inhibitor \u003cem\u003ep35\u003c/em\u003e. In this experimental setting, previous work (18) demonstrated that \u003cem\u003edronc\u003c/em\u003e-dependent activation of JNK and persistent proliferative signalling emanating from these cells induces wing imaginal discs overgrowth after irradiation. In line with these observations, irradiated discs expressing \u003cem\u003ep35\u003c/em\u003e in wing disc posterior cells (P compartment) show a significant increase in size and ectopic activity of JNK, as indicated by the Mmp1 marker (45), compared to non-irradiated control discs (Supplementary Fig.\u0026nbsp;2A, A\u0026rsquo;, B, B\u0026rsquo;, D, E). However, there was no overgrowth and limited JNK activation upon irradiation of P35 cells without \u003cem\u003ehipk\u003c/em\u003e expression (Supplementary Fig.\u0026nbsp;2C, C\u0026rsquo;, D, E).\u003c/p\u003e \u003cp\u003e \u003cb\u003ehipk\u003c/b\u003e \u003cb\u003edoes not primarily exert its effect through\u003c/b\u003e \u003cb\u003eDiap1\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn addition to its effect on apoptosis and JNK activity, we found that the suppression of \u003cem\u003ehipk\u003c/em\u003e function in \u003cem\u003erp\u003c/em\u003er-expressing cells caused accumulation of the Diap1 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, A\u0026rsquo;, B, B\u0026rsquo;, C), suggesting a role of \u003cem\u003ehipk\u003c/em\u003e in the \u003cem\u003erpr\u003c/em\u003e-mediated degradation of Diap1 (42). This result also suggested that the diminution of the apoptosis levels observed in the absence of \u003cem\u003ehipk\u003c/em\u003e function could be due to maintenance of high levels of Diap1; the Diap1 protein has a key role in preventing the cleavage and subsequent activation of caspases (46), thereby the lack of Diap1 results in massive apoptosis (39, 42, 47\u0026ndash;49). To test this, we compromised \u003cem\u003ediap1\u003c/em\u003e expression in the P compartment by using an effective RNAi construct (50). In control discs, in which we reduced \u003cem\u003ediap1\u003c/em\u003e levels, we detected consistent elevation of apoptotic marker (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, D\u0026rsquo;, F). In contrast, a significant downregulation of apoptosis markers was observed by concomitantly reducing \u003cem\u003ediap1\u003c/em\u003e and \u003cem\u003ehipk\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, E\u0026rsquo;, F). These important result rule out the hypothesis that \u003cem\u003ehipk\u003c/em\u003e downregulates apoptosis by increasing Diap1 levels, and indicate that Hipk acts downstream of \u003cem\u003ediap1\u003c/em\u003e, possibly facilitating the activation of the caspase pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ehipk\u003c/b\u003e \u003cb\u003epromotes apoptosis mainly by stabilizing the active form of Dronc\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo explore the hypothesis of a functional interaction between Hipk and the caspase cascade, we have analysed the effect of the lack of \u003cem\u003ehipk\u003c/em\u003e on the apoptosis induced by the direct activation of caspases. We first checked that, as expected, the lack of \u003cem\u003ehipk\u003c/em\u003e function does not affect the normal very low levels of apoptosis in the wing disc (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B\u0026rsquo;, I). We then conducted three experiments that overexpressed \u003cem\u003edronc\u003c/em\u003e, \u003cem\u003edrice\u003c/em\u003e, or both together. To overexpress \u003cem\u003edronc\u003c/em\u003e and \u003cem\u003edrice\u003c/em\u003e together we capitalized on a UAS construct in which \u003cem\u003edronc\u003c/em\u003e and \u003cem\u003edrice\u003c/em\u003e cDNAs were concomitantly overexpressed (see Methods). This combined overexpression induced prominent apoptosis in the P compartment of wing discs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, C, I\u0026rsquo;). However, such apoptotic response was drastically rescued by downregulating \u003cem\u003ehipk\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, D\u0026rsquo; I). The single overexpression of either \u003cem\u003edronc\u003c/em\u003e or \u003cem\u003edrice\u003c/em\u003e also induced apoptosis, though to a lesser scale (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, E\u0026rsquo;, G, G\u0026rsquo;, J, K). Interestingly, in these experiments Dronc-induced apoptosis, but not Drice-induced apoptosis, was rescued by limiting \u003cem\u003ehipk\u003c/em\u003e expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, F\u0026rsquo;, J, H, H\u0026rsquo;, K). Altogether, these data indicated that \u003cem\u003ehipk\u003c/em\u003e sustains the apoptotic response by likely acting at the level of the initiator caspase Dronc.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOur previous experiments took advantage of newly generated transgenic lines expressing tagged versions of Dronc and Drice (see Methods) suitable to assess their protein stability upon modulating Hipk expression levels. Specifically, Dronc is fused in-frame with a Myc tag and a modified GFP that only fluoresces upon Dronc-mediated cleavage (see Methods and relevant references). This dual-tagging system enables simultaneous detection of both total Dronc protein via anti-Myc immunolabelling and its activation via GFP cleavage. Drice, in turn, was tagged at the C-terminus with a Flag epitope. Remarkably, posterior cells overexpressing Dronc and Drice displayed strong Myc immunolabelling and GFP signal, indicating robust Dronc activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, A\u0026rsquo;, A\u0026rsquo;\u0026rsquo;, C, D). However, a dramatic reduction of both Dronc protein levels and activation was detected in Hipk-deficient cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, B\u0026rsquo;, B\u0026rsquo;\u0026rsquo;, C, D). A similar, albeit milder, reduction was observed in cells overexpressing Dronc with limited Hipk levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE-F\u0026rsquo;\u0026rsquo;, G, H). In contrast, the detection of Drice through Flag immunostaining remained unaltered in cells with reduced Hipk (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI-J\u0026rsquo;, K).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTogether, these results strongly support the notion that Hipk preferentially and intrinsically enhances the stability of Dronc in its active conformation. Reinforcing this conclusion, lack of \u003cem\u003ehipk\u003c/em\u003e activity effectively rescues the tissue overgrowth caused by \u003cem\u003ep35\u003c/em\u003e-expressing cells upon irradiation, which, despite lacking effector caspase activity, still activate Dronc (Supplementary Fig.\u0026nbsp;2B-D).\u003c/p\u003e \u003cp\u003eFurther support for the interaction between \u003cem\u003ehipk\u003c/em\u003e and \u003cem\u003eDronc\u003c/em\u003e comes from experiments of \u003cem\u003ehipk\u003c/em\u003e overexpression. As previously reported (24, 51, 52), the excess of Hipk caused mild tissue overgrowths (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-B\u0026rsquo;, E) that were enhanced by the concomitant overexpression of the pro-apoptotic gene \u003cem\u003ehid\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, C\u0026rsquo;, E). However, this phenotype was critically linked to Dronc activity, as it was rescued in a mutant background null for \u003cem\u003edronc\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, D\u0026rsquo;, E). Similarly, forced expression of \u003cem\u003ehipk\u003c/em\u003e is sufficient to activate Dronc and cleaved Dcp-1 immunoreactivity, but the absence of \u003cem\u003edronc\u003c/em\u003e drastically reduces Dcp1 levels (Supplementary Fig.\u0026nbsp;3A-E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eActive Dronc also promotes Hipk protein stability\u003c/h2\u003e \u003cp\u003eThe observations above strongly suggest a determinant role of \u003cem\u003ehipk\u003c/em\u003e to ensure the correct levels of apoptosis in either developmentally regulated or induced apoptosis. More specifically, our previous observations suggested that the Hipk protein preferentially affects the stability of Dronc in its active form. Since previous studies have shown that caspases can enhance Hipk2 activity in mammals (53), we sought to investigate whether \u003cem\u003eHipk\u003c/em\u003e might, in turn, be regulated by Dronc. To his end, we first evaluated the Hipk levels in cells expressing \u003cem\u003ep35\u003c/em\u003e, which cannot complete apoptosis but still activate Dronc after irradiation. Interestingly, in this experimental setting we found groups of \u003cem\u003ep35\u003c/em\u003e-expressing cells showing significantly elevated levels of Hipk. A closer examination revealed that these cells also activated JNK signalling, as indicated by the Mmp1 upregulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-C\u0026rsquo;, E). This result suggested that ionising radiation could raise the amount of Hipk in Dronc-activating cells that fail to die. Notably, such upregulation of Hipk did not occur in irradiated discs in which the expression of pro-apoptotic genes was potently targeted by overexpressing a micro RNA against the proapoptotic genes Rpr, Hid and Grim (mirRHG) (54) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, D\u0026rsquo;, F), despite the fact that the JNK pathway was still upregulated by apoptosis-independent JNK activation (55) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, D\u0026rsquo;, F).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese results argue for a role of the apoptotic program in elevating Hipk levels, but do not discriminate if this is a transcriptional or post-transcriptional effect, and do not single out Dronc as the key protein in this regulation. To solve these issues, we forced expression of a \u003cem\u003ehipk-HA\u003c/em\u003e construct and quantified total Hipk and HA levels in \u003cem\u003ep35\u003c/em\u003e-expressing cells with either normal or reduced Dronc expression. Intriguingly, absolute levels of Hipk-HA, detected using both anti-HA and a Hipk-specific antiserum were significantly reduced in Dronc-deficient cells with respect to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG-J)). Consistently, these findings were correlated with a limited ability of Hipk overexpression to induce tissue overgrowth in cells without Dronc (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-E; \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eK). To address whether Hipk upregulation was a consequence of impeding the completion of apoptosis via P35 or an effect connected to Dronc, we expressed the UAS-\u003cem\u003ehipk-HA\u003c/em\u003e construct (along with \u003cem\u003ehid\u003c/em\u003e but without \u003cem\u003ep35\u003c/em\u003e) in either wild type or Dronc-deficient cells. The experiment revealed a significant upregulation of HA levels upon \u003cem\u003ehid\u003c/em\u003e and \u003cem\u003ehipk-HA\u003c/em\u003e co-expression and a strong reduction of HA levels when \u003cem\u003edronc\u003c/em\u003e was absent (Fig, 7L-O). Collectively, these findings support a reciprocal regulatory relationship: Hipk enhances the stability of Dronc, while active Dronc promotes the accumulation of Hipk.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this report we provide compelling evidence that the Hipk plays a key role during the execution of apoptosis by stabilizing the active form of Dronc. Given the limited understanding of caspase regulation upon activation, our findings open a new avenue of research with significant implications for caspase biology. Conversely, we also show that Dronc promotes an increase in Hipk expression levels, further amplifying the apoptotic cascade and JNK activation. This intriguing observation likely reflects a positive feedback loop previously described between Dronc and the JNK pathway (12).\u003c/p\u003e\n\u003ch3\u003eHipk is a pro-apoptotic factor that stabilizes active Dronc\u003c/h3\u003e\n\u003cp\u003eHipk proteins are evolutionarily conserved serine/threonine kinases traditionally associated with fine-tuning transcriptional responses that affect various biological functions, such as cell proliferation, cell fate decisions, and apoptosis (19, 21). Our results strongly suggest that \u003cem\u003eDrosophila\u003c/em\u003e Hipk acts as a proapoptotic factor, as its reduced expression significantly diminishes apoptosis in either developmentally regulated or experimentally induced apoptotic contexts. The implication of \u003cem\u003ehipk\u003c/em\u003e in developmentally regulated apoptosis has been reported previously (27) and we have confirmed this requirement in the left-right fusion of the abdominal hemisegments and the rotation of the male genitalia. In addition, we show that the activity of JNK is also necessary in both processes, thus pointing to a relevant role of JNK in developmental regulated apoptosis.\u003c/p\u003e \u003cp\u003eWe have also demonstrated the involvement of \u003cem\u003ehipk\u003c/em\u003e in the response to various pro-apoptotic stimuli. Our epistasis experiments show that the loss of Hipk function robustly suppresses apoptosis triggered by either overexpression of pro-apoptotic factors, the loss of cell death inhibitors such as Diap-1, the combined overexpression of initiator and effector caspases, or by initiator caspase Dronc alone. In contrast, cell death driven solely by effector caspase overexpression (e.g., Drice) remains largely unaffected by Hipk deficiency. All these experiments position Hipk activity at the level of the initiator caspase Dronc. In parallel, we found in our experiments that Hipk deficiency also compromises JNK activation in apoptosis-induced scenarios, thereby suggesting a Hipk-mediated control of the two Dronc activities: the induction of apoptosis through Dcp1 and Drice, and the amplification of apoptosis and JNK activity through the apoptotic loop (12).\u003c/p\u003e \u003cp\u003eIn mammalian systems, Hipk2 also mediates apoptosis, but by direct phosphorylation of P53 (56\u0026ndash;58) and/or by facilitating the degradation of its inhibitor, MDM2 (59). In parallel, members of the Hipk family have been shown to potentiate JNK pathway activation (56) and apoptosis (60, 61) by antagonizing transcriptional repressors of the CtBP family. Thus, in Drosophila and mammals Hipk members regulate apoptosis and JNK signalling, although the molecules involved in such regulation may be distinct.\u003c/p\u003e \u003cp\u003eOur experiments indicate that Hipk plays a critical role in stabilizing Dronc, most notably, the active form of Dronc. Whereas Hipk moderately alter Dronc protein levels under basal, non-apoptotic conditions, in cells exposed to apoptotic stimuli Hipk is substantially required to sustain Dronc stability. The finding that loss of \u003cem\u003ehipk\u003c/em\u003e causes a diminution of Dronc product may suggest that a primary cause of \u003cem\u003ehipk\u003c/em\u003e phenotypes is precisely a reduction in the amount of active Dronc protein available to fulfil those roles, what results in partial suppression of Dronc function. Importantly, this regulatory mechanism may differ from those previously described. Thus, protein\u0026ndash;protein interactions with Dark (62), and Tango7 (63) have been shown to promote the assembly of protein complexes that enable efficient Dronc activation, while interaction with MyoID localizes Dronc to specific subcellular compartments (64). Moreover, Hipk probably does not exert its pro-apoptotic function through its canonical role in modulating transcriptional regulation. Furthermore, our data raise the possibility that Hipk modulates the stability of active Dronc through phosphorylation\u0026mdash;either directly or by influencing upstream regulators involved in its turnover. Such post-translational regulation would not be unexpected, as phosphorylation-based control of caspases has been reported in mammals (65\u0026ndash;68), and Dronc in \u003cem\u003eDrosophila\u003c/em\u003e (69). Regardless of the ultimate molecular mechanism by which Hipk acts on Dronc, our findings clearly establish that Hipk enhances Dronc function and promotes apoptosis, reveal a novel regulatory pathway that modulates Dronc function, and broaden our current understanding of caspase biology.\u003c/p\u003e\n\u003ch3\u003eHipk, JNK pathway and Dronc key players forming a positive apoptotic feedback loop\u003c/h3\u003e\n\u003cp\u003eThe Hipk protein interacts with different transcription factors and other molecules implicated in distinct biological operations (19). The levels of \u003cem\u003eDrosophila\u003c/em\u003e Hipk must be tightly regulated since both overexpression or loss of function of \u003cem\u003ehipk\u003c/em\u003e can induce apoptosis (24). We have found that pro-apoptotic stimuli like IR cause an elevation of the amount of the Hipk protein, and this increment requires normal function of the apoptotic cascade. This process would ensure that there is a surplus of active Hipk necessary for activation of Dronc. More specifically, our results show Dronc is needed to maintain Hipk levels, which suggests a mutual interaction between Dronc and Hipk to reciprocally sustain their stability.\u003c/p\u003e \u003cp\u003eInterestingly, in mammalian cells, it has been reported that stress-induced activation of Caspase-6 leads to the proteolytic processing of Hipk2 (53, 61). Notably, this cleavage event removes an inhibitory C-terminal domain, generating a hyperactive kinase that further amplifies apoptosis. These and our own findings suggest that caspases could be evolutionarily conserved regulators of Hipk, capable of modulating either its protein abundance or activity. This mutual regulation between caspases and Hipk may be critical for amplifying the apoptotic response in diverse cellular contexts across evolution and could represent a targetable axis for future therapeutic interventions.\u003c/p\u003e \u003cp\u003eThis mutual Dronc-Hipk interaction also impinges on activation of JNK signalling, a central, evolutionarily conserved regulator of apoptosis (70). In \u003cem\u003eDrosophila\u003c/em\u003e, Hipk acts as a positive regulator of the JNK pathway in wing imaginal discs. Its activity is tightly regulated by SUMOylation, and upon loss of SUMO modification (e.g., through Smt3 knockdown), Hipk accumulates in the cytoplasm, enhancing JNK pathway activation and apoptosis (26). In vertebrates, Hipk proteins appear to function as key positive regulators of JNK signalling and c-Jun phosphorylation, through both direct and indirect mechanisms that are highly context-dependent (56, 60). Given Hipk\u0026rsquo;s known role in modulating diverse cellular processes, it is also tempting to speculate that, in addition to JNK signalling, Hipk may also regulate other non-apoptotic functions of Dronc, but further work is needed to validate this hypothesis.\u003c/p\u003e \u003cp\u003eIn summary, we have provided evidence that Hipk and caspases engage in a bidirectional positive regulatory relationship that amplifies apoptotic signalling and JNK activation. This molecular crosstalk provides mechanistic insight into a previously reported positive feedback loop between caspase activity and JNK signalling that reinforces the apoptotic fate in \u003cem\u003eDrosophila\u003c/em\u003e cells (12). Taken together, prior studies and our current findings delineate a self-reinforcing molecular circuit involving Hipk, JNK signalling, and caspase activation that ensures robust commitment to apoptosis.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDrosophila strains\u003c/h2\u003e \u003cp\u003eAll the \u003cem\u003eDrosophila\u003c/em\u003e strains used in this study were raised and maintained on standard medium at 25\u0026deg;C (see below for the temperature shift experiments). The following \u003cem\u003eDrosophila\u003c/em\u003e lines were used:\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGal4/UAS and LexA/lexO systems\u003c/span\u003e: We have used the Gal4/UAS (43) and lexA/lexO (44) systems to express or inactivate different genes in particular locations, in some cases combining the two systems so that two adjacent cell populations with distinct genotypes could be compared.\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGal4 lines\u003c/span\u003e: \u003cem\u003ehh-Gal4\u003c/em\u003e (71), \u003cem\u003etub-Gal80\u003c/em\u003e\u003csup\u003e\u003cem\u003ets\u003c/em\u003e\u003c/sup\u003e (72), \u003cem\u003een-Gal4\u003c/em\u003e (BDSC#30564), \u003cem\u003eAbd-B\u003c/em\u003e\u003csup\u003e\u003cem\u003eLDN\u003c/em\u003e\u003c/sup\u003e (\u003cem\u003eAbd-B\u003c/em\u003e-Gal4\u003csup\u003eLDN\u003c/sup\u003e) (73), \u003cem\u003eEip71CD\u003c/em\u003e-Gal4 (31).\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003elexO line\u003c/span\u003e: \u003cem\u003elexO-rpr\u003c/em\u003e (74)\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eUAS lines\u003c/span\u003e: UAS\u003cem\u003e-miRHG\u003c/em\u003e (54), UAS\u003cem\u003e-GFP\u003c/em\u003e (BDSC#5130), UAS-\u003cem\u003ehid\u003c/em\u003e (75), UAS-\u003cem\u003eHA-Hipk2M\u003c/em\u003e (23), UAS-\u003cem\u003eHA-Hipk3M\u003c/em\u003e (23), UAS-\u003cem\u003ehipkRNAi\u003c/em\u003e (VDRC KK107857) (24), UAS-\u003cem\u003ep35\u003c/em\u003e (BDSC#8651), UAS-\u003cem\u003echerry\u003c/em\u003e (BDSC#35787), UAS-\u003cem\u003elacZ\u003c/em\u003e (BDSC#8529), UAS-\u003cem\u003eDronc-GFP-Myc\u003c/em\u003e, MVz-\u003cem\u003eDrice-Flag-VN\u003c/em\u003e, UAS-\u003cem\u003eDronc-GFP-Myc\u003c/em\u003e/MVz-\u003cem\u003eDrice-Flag-VN\u003c/em\u003e (see below), UAS-\u003cem\u003eDiap1RNAi\u003c/em\u003e (76), UAS-\u003cem\u003edroncRNAi\u003c/em\u003e (VDRC #23035).\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eMutants\u003c/span\u003e: \u003cem\u003edronc\u003c/em\u003e\u003csup\u003e\u003cem\u003ei24\u003c/em\u003e\u003c/sup\u003e (BDSC#91594), \u003cem\u003edronc\u003c/em\u003e\u003csup\u003e\u003cem\u003ei29\u003c/em\u003e\u003c/sup\u003e (BDSC#91595).\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eReporter lines\u003c/span\u003e: \u003cem\u003eTRE-red\u003c/em\u003e (BDSC#59011).\u003c/p\u003e \u003cp\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eConstruction of the\u003c/span\u003e \u003cspan type=\"ItalicUnderline\" class=\"ItalicUnderline\" name=\"Emphasis\"\u003enub-lexA\u003c/span\u003e \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003etransgene\u003c/span\u003e. To generate the \u003cem\u003enub\u003c/em\u003e-LexA driver line for \u003cem\u003enubbin\u003c/em\u003e, we first amplified 3.8 kb of nubbin genomic regulatory DNA (77) using Taq high-fidelity polymerase. The primers used to perform the PCR were:\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eFP:CACCCTTCAACTTGTAACTGCTGGCTGCA\u003c/h3\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eRP:GGGGATTGGTCCGAAAAGAGGATAC\u003c/h2\u003e \u003cp\u003ePCR products were initially subcloned into the TOPO-TA vector and then transferred as EcoRI fragments into the pBPLexA::GADfluw plasmid (Addgene Plasmid #26232; Ref. 78). Correct insertion and sequence fidelity were confirmed by Sanger sequencing. Transgenic flies carrying the construct were generated via PhiC31-mediated integration at the attP40 landing site located at cytological position 22F on the second chromosome.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTemperature shift experiments\u003c/h2\u003e \u003cp\u003eWe made use of the Gal4/Gal80\u003csup\u003ets\u003c/sup\u003e system (72) to control the time of expression of different genetics constructs. After an egg lay of 1 day at 25\u0026ordm;C, larvae including the genetic combinations \u003cem\u003ehh-Gal4, tub-Gal80\u003c/em\u003e\u003csup\u003e\u003cem\u003ets\u003c/em\u003e\u003c/sup\u003e or \u003cem\u003een\u003c/em\u003e-Gal4 \u003cem\u003etub\u003c/em\u003e-Gal80\u003csup\u003ets\u003c/sup\u003e were raised at 17\u0026deg;C and then transferred to a restrictive temperature of 29\u0026ordm;C or 31\u0026ordm;C for 2 or 3 days before dissection. The combined expression of a Gal4 line, \u003cem\u003ehh\u003c/em\u003e-Gal4 or \u003cem\u003een\u003c/em\u003e-Gal4, and \u003cem\u003etub\u003c/em\u003e-Gal80\u003csup\u003ets\u003c/sup\u003e is represented, for simplicity, as \u003cem\u003ehh\u003c/em\u003e\u003csup\u003e\u003cem\u003eGal80\u003c/em\u003e\u003c/sup\u003e and \u003cem\u003een\u003c/em\u003e\u003csup\u003e\u003cem\u003eGal80\u003c/em\u003e\u003c/sup\u003e, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of MVz-Drice-Flag-VN Plasmid\u003c/h2\u003e \u003cp\u003eWe synthesized a wild-type \u003cem\u003eDrice\u003c/em\u003e cDNA fused at its C-terminus to a Flag tag and the N-terminal half of a split Venus fluorescent protein, using gene synthesis services provided by Twist Bioscience. The resulting fragment was delivered in a pUC51 plasmid backbone. The \u003cem\u003eDrice\u003c/em\u003e-Flag-VN construct was then excised from pUC51 as a PmeI\u0026ndash;KpnI fragment and subcloned into the corresponding sites of the MVz plasmid (79). Please refer to the plasmid map (Supplementary Fig.\u0026nbsp;4) for additional details; the full plasmid sequence is available upon request. Transgenic flies carrying the construct were generated via PhiC31-mediated site-specific integration. The construct was inserted at the attP40 site, located at cytological position 25C6.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of the UAS-Dronc-GFP-Myc\u003c/h2\u003e \u003cp\u003eA wild-type \u003cem\u003eDronc\u003c/em\u003e cDNA was synthesized (GeneWizz) and fused in-frame to the Suntag and HA-tag peptides at the C-terminal end. To facilitate downstream cloning, additional restriction sites were introduced at both the 5ʹ and 3ʹ ends of the construct, as well as upstream of the tag peptide. The full-length construct was initially subcloned into the pUC57 vector as a \u003cem\u003eNotI-KpnI\u003c/em\u003e fragment. Subsequently, the vector was digested with \u003cem\u003eSmaI\u003c/em\u003e and \u003cem\u003eNheI\u003c/em\u003e, resulting in the removal of the C-terminal Suntag-HA tagging from the wild-type \u003cem\u003eDronc\u003c/em\u003e sequence. A modified version of GFP, containing a Myc tag at its C-terminal end, was generated by PCR using the primers listed below. This GFP variant includes a TETDG caspase cleavage site, which, upon \u003cem\u003eDronc\u003c/em\u003e-dependent cleavage, restores GFP to a conformational state compatible with fluorescence emission. The template for the GFP-Myc sequence was described previously (80). The GFP-Myc PCR product was subsequently cloned in-frame at the C-terminal end of wild-type \u003cem\u003eDronc\u003c/em\u003e as a \u003cem\u003eSmaI-NheI\u003c/em\u003e fragment.\u003c/p\u003e \u003cp\u003ePrimers used for GFP-Myc amplification:\u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003eForward primer: 5ʹ GCTTTAATAAGAAACTCTACTTCAATcccgggtttttcaacgaagggggcATGATCAAGATCGCCACCAGGAAGTACC 3ʹ\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003eReverse primer: 5ʹ GATAAAATGTCCAGTGGCGGCAAGCTAGCttacaggtcctcctcgctgatcagcttctgctcGTTAGGCAGGTTGTCCACCCTCATCAGG 3ʹ\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003cp\u003eThe complete construct was then subcloned as a \u003cem\u003eNotI-XhoI\u003c/em\u003e fragment into a UAS-attB \u003cem\u003ew\u0026thinsp;+\u003c/em\u003e\u0026thinsp;vector previously linearized with \u003cem\u003eNotI-PspXI\u003c/em\u003e. Please refer to the plasmid map in Supplementary Fig.\u0026nbsp;4 for further details; full sequence of the plasmid can be distributed upon request.\u003c/p\u003e \u003cp\u003eTransgenic \u003cem\u003eDrosophila melanogaster\u003c/em\u003e carrying the UAS-Dronc-GFP-TETDG-Myc construct were generated via PhiC31-mediated site-specific integration. The construct was inserted into the attP site located at the 22A3 locus (Bloomington Drosophila Stock Center, stock #9752).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of the UAS-Dronc-GFP-Myc/MVz-Drice-Flag-VN Dual Plasmid\u003c/h2\u003e \u003cp\u003eIn parallel with the subcloning of the \u003cem\u003eDronc\u003c/em\u003e-GFP-Myc fragment into the standard UAS-attB-white⁺ plasmid, we also inserted this construct into a modified version of UAS-attB-white⁺ in which the loxP site upstream of the UAS repeats had been removed by NheI digestion followed by re-ligation. The \u003cem\u003eDronc\u003c/em\u003e-GFP-Myc fragment was then subcloned as a NotI\u0026ndash;XhoI fragment into this modified plasmid, which had been linearized with NotI\u0026ndash;PspXI. From the resulting intermediate plasmid, an NsiI\u0026ndash;Dronc-GFP-Myc\u0026ndash;NsiI fragment was excised and subcloned into the MVz-Drice-Flag-VN plasmid using the same restriction sites. The resulting dual-expression plasmid enables simultaneous expression of \u003cem\u003eDronc\u003c/em\u003e-GFP-Myc and \u003cem\u003eDrice\u003c/em\u003e-Flag-VN under UAS control. A plasmid map is shown in Supplementary Fig.\u0026nbsp;4, and the full sequence is available upon request. Transgenic flies carrying the construct were generated via PhiC31-mediated integration at the attP40 landing site, located at cytological position 25C6.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eImaginal discs staining\u003c/h2\u003e \u003cp\u003eThird instar larvae were dissected in PBS and fixed with 4% paraformaldehyde, 0.1% deoxycholate (DOC) and 0.3% Triton X-100 in PBS for 27 min at room temperature. They were blocked in PBS, 1% BSA, and 0.3% Triton, incubated with the primary antibody overnight at 4\u0026deg;C, washed in PBS, 0.3% Triton and incubated with the corresponding fluorescent secondary antibodies for at least 2 h at room temperature in the dark. They were then washed and mounted in Vectashield mounting medium (Vector Laboratories).\u003c/p\u003e \u003cp\u003eThe following primary antibodies were used: rat anti-Ci (DSHB 2A1) 1:50; mouse anti-Mmp1 (DSHB, a combination, 1:1:1, of 3B8D12, 3A6B4 and 5H7B11) 1:50; rabbit anti-Hipk (a gift from E. Verheyen) 1:100, rabbit anti-Dcp1 (Cell Signaling, antibody #9578) 1:200, rabbit anti-Diap1 (a gift from H. Steller) 1:2000.\u003c/p\u003e \u003cp\u003eFluorescently labelled secondary antibodies (Molecular Probes Alexa-488, Alexa-555, Alexa-647, ThermoFisher Scientific) were used in a 1:200 dilution. DAPI (MERCK) and TO-PRO3 (Invitrogen) were used in a 1:1000 dilution to label nuclei. Fluorescently labelled secondary antibodies (Molecular Probes Alexa-488, Alexa-555, Alexa-647, ThermoFisher Scientific) were used in a 1:200 dilution and DAPI (MERCK) was used in a 1:500 dilution to label the nuclei.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eIR treatments\u003c/h2\u003e \u003cp\u003eFor irradiation experiments, larvae were raised at 17\u0026deg;C for 3\u0026ndash;4 days and then transferred to 31\u0026deg;C 1 day before irradiation. Then, irradiated larvae were grown at 31\u0026ordm;C for 3 days before imaginal disc dissection. Larvae were irradiated in an X-ray machine Phillips MG102 at the standard dose of 4000Rads (R).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eAnalysis of adult cuticles\u003c/h2\u003e \u003cp\u003ePhotographs of adult flies were taken with a Leica MZ12 stereomicroscope and a Leica DFC5000 camera, and images were acquired using Leica LAS software (3.7). Theimages were edited and assembled using Photoshop.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eImage acquisition, quantifications and statistical analysis\u003c/h2\u003e \u003cp\u003eStack images were captured with a Leica (Solms, Germany) LSM510, LSM710, DB550 B vertical confocal microscope and a Nikon A1R. Multiple focal planes were obtained for each imaginal disc. Quantifications and image processing were performed using the Fiji/ImageJ (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://fiji.sc\u003c/span\u003e\u003cspan address=\"https://fiji.sc\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and Adobe Photoshop software.\u003c/p\u003e \u003cp\u003eTo measure the percentage of positive area of different markers (%Dcp1, %TREred, %pJNK, %GFP, %Myc), the corresponding positive area was obtained using the \u0026ldquo;Threshold\u0026rdquo; tool in ImageJ and then normalized by the area of the compartment (labelled with positive GFP or negative Ci staining). Diap1 ratio (P/A compartment) was calculated as the proportion between the percentage of Diap1 positive areas in the posterior compartment and the anterior compartment.\u003c/p\u003e \u003cp\u003eTo quantify the percentage of the posterior compartment, a Z-maximal intensity projection was made for each image. Then, the area of the posterior compartment (labelled with positive GFP or HA staining) was measured by using the \u0026ldquo;Area\u0026rdquo; tool and normalized dividing by the total disc area (labelled by TOPRO-3 or DAPI staining).\u003c/p\u003e \u003cp\u003eFlag, Hipk and HA integrated density (ID) were calculated by multiplying the mean intensity (obtained using the \u0026ldquo;Threshold\u0026rdquo; tool in ImageJ) and the area of the posterior compartment (labelled by positive Flag, Hipk or HA staining. ID data were normalized by the total disc area (labelled by DAPI or TOPRO staining).\u003c/p\u003e \u003cp\u003eStatistical analysis was performed using the GraphPad Prism v8 software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.graphpad.com\u003c/span\u003e\u003cspan address=\"https://www.graphpad.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). When comparing between two groups, a non-parametric Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test (Mann-Whitney\u0026rsquo;s test) was used. To compare between more than two groups, a non-parametric, one-way ANOVA test (Kruskal-Wallis test) was used. Sample size was indicated in each graph. Error bars in the graphs represent the standard deviation (SD). p-values obtained in each statistical analysis were represented in the graphs according to the following nomenclature: *p\u0026thinsp;\u0026lt;\u0026thinsp;0,05; **p\u0026thinsp;\u0026lt;\u0026thinsp;0,01; ***p\u0026thinsp;\u0026lt;\u0026thinsp;0,001 and ****p\u0026thinsp;\u0026lt;\u0026thinsp;0,001.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data are available from the corresponding authors upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Raquel Mart\u0026iacute;n for the construction of the \u003cem\u003enub\u003c/em\u003e-LexA driver, Esther Verheyen for the anti-Hipk antibody and stocks and Andreas Bergmann for the \u003cem\u003edronc\u003c/em\u003e mutants. We thank the Confocal Microscopy Service at CBMSO, Eva Caminero and Mar Casado for fly injections, the Bloomington Stock Center, the Vienna Drosophila Resource Center, and the Developmental Studies Hybridoma Bank for fly stocks and reagents.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by grants from FEDER/Ministerio de Ciencia e Innovaci\u0026oacute;n-Agencia Estatal de Investigaci\u0026oacute;n-Consejo Superior de Investigaciones Cient\u0026iacute;ficas [No. PGC2018-095151-B-I00, PID2021-125377NB-100, and PIE Intramural (CSIC) 202020E255 to GM, BFU2017-86244-P and PID2020-113318GB-I00 to ES, and PID2023-150773NB-100 to LAB). \u0026nbsp;J.M. G. was a recipient of a Formaci\u0026oacute;n del Personal Investigador (FPI) fellowship (PRE 2019_090108) from the Spanish Government and R.A. J. was a recipient of a CONACyT Fellowship. Institutional support from the Ram\u0026oacute;n Areces Foundation is acknowledged.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThese authors contributed equally: Juan Manuel Garc\u0026iacute;a-Arias, Rafael Alejandro Ju\u0026aacute;rez-Uribe\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCentro de Biolog\u0026iacute;a Molecular Severo Ochoa (CBM), CSIC-UAM,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNicol\u0026aacute;s Cabrera 1, Universidad Aut\u0026oacute;noma de Madrid, Cantoblanco, 28049 Madrid, Spain\u003c/p\u003e\n\u003cp\u003eJuan Manuel Garc\u0026iacute;a-Arias, Rafael Alejandro Ju\u0026aacute;rez-Uribe, Luis Alberto Baena-L\u0026oacute;pez, Gin\u0026eacute;s Morata and Ernesto S\u0026aacute;nchez-Herrero\u003c/p\u003e\n\u003cp\u003ePresent address of Rafael Alejandro Ju\u0026aacute;rez-Uribe: Department of Pathology and Laboratory Medicine, University of Rochester Medical Center, Rochester, New York, U.S.A.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: GM, ESH, LAB; methodology: JMG, RAJ, ES, LAB; investigation: JMG, RAJ, ES, LAB; data analysis: JMG, RAJ, LAB, GM, ES; writing\u0026mdash;original draft: GM; writing\u0026mdash;review and editing: GM, ES, LAB; funding acquisition: GM, ES, LAB supervision: GM, ES, LAB\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll methods in this study were carried out in strict accordance with relevant ethical guidelines and institutional regulations\u003c/p\u003e\n\u003cp\u003eSupplementary information is available at Cell Death and Differentiation\u0026rsquo;s website\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003e1. Fuchs Y, Steller H. Programmed cell death in animal development and disease. Cell. 2011 Nov 11;147(4):742\u0026thinsp;\u0026minus;\u0026thinsp;58. doi: 10.1016/j.cell.2011.10.033.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e2. Lohmann I, McGinnis N, Bodmer M, McGinnis W. \u0026ldquo;The Drosophila Hox gene deformed sculpts head morphology via direct regulation of the apoptosis activator reaper \u003cem\u003eCell\u003c/em\u003e. \u003cb\u003e110\u003c/b\u003e, 457\u0026thinsp;\u0026minus;\u0026thinsp;66 (2002) doi: 10.1016/s0092-8674(02)00871-1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e3. Jacobsen MD, Weil M, Raff MC. Role of Ced-3/ICE-family proteases in staurosporine-induced programmed cell death. \u003cem\u003eJ Cell Biol.\u003c/em\u003e 1996;133(5):1041\u0026ndash;51).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e4. Baonza, A., Tur-Gracia, S., P\u0026eacute;rez-Aguilera, M., Estella, C. Regulation and coordination of the different DNA damage responses in Drosophila Front. Cell Dev. Biol. 10:993257. doi: 10.3389/fcell.2022.993257.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e5. P\u0026eacute;rez-Garijo A, Mart\u0026iacute;n FA, Morata G. Caspase inhibition during apoptosis causes abnormal signalling and developmental aberrations in Drosophila. Development. 2004 Nov;131(22):5591-8. doi: 10.1242/dev.01432.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e6. Verghese S, Su TT. Drosophila Wnt and STAT Define Apoptosis-Resistant Epithelial Cells for Tissue Regeneration after Irradiation. PLoS Biol. 2016 Sep 1;14(9):e1002536. doi: 10.1371/journal.pbio.1002536.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e7. Grether ME, Abrams JM, Agapite J, White K, Steller H. The head involution defective gene of Drosophila melanogaster functions in programmed cell death. Genes Dev. 1995 Jul 15;9(14):1694\u0026thinsp;\u0026minus;\u0026thinsp;708. doi: 10.1101/gad.9.14.1694.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e8. Chen P, Nordstrom W, Gish B, Abrams JM. grim, a novel cell death gene in Drosophila. Genes Dev. 1996 Jul 15;10(14):1773-82. doi: 10.1101/gad.10.14.1773.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e9. White K, Tahaoglu E, Steller H. Science. Cell killing by the Drosophila gene reaper. 1996 Feb 9;271(5250):805-7. doi: 10.1126/science.271.5250.805.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e10. Smith-Bolton RK, Worley MI, Kanda H, Hariharan IK. Regenerative growth in Drosophila imaginal discs is regulated by Wingless and Myc. Dev Cell. 2009 Jun;16(6):797\u0026ndash;809. doi: 10.1016/j.devcel.2009.04.015.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e11. Mart\u0026iacute;n R, Pinal N, Morata G. Distinct regenerative potential of trunk and appendages of \u003cem\u003eDrosophila\u003c/em\u003e mediated by JNK signalling. Development. 2017 Nov 1;144(21):3946\u0026ndash;3956. doi: 10.1242/dev.155507.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e12. Shlevkov E, Morata G. A dp53/JNK-dependant feedback amplification loop is essential for the apoptotic response to stress in Drosophila. Cell Death Differ. 2012 Mar;19(3):451\u0026thinsp;\u0026minus;\u0026thinsp;60. doi: 10.1038/cdd.2011.113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e13. Weston CR, Davis RJ. The JNK signal transduction pathway. Curr Opin Cell Biol. 2007 Apr;19(2):142-9. doi: 10.1016/j.ceb.2007.02.001.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e14. McEwen DG, Peifer M. Puckered, a Drosophila MAPK phosphatase, ensures cell viability by antagonizing JNK-induced apoptosis. 2005 Sep;132(17):3935-46. doi: 10.1242/dev.01949. Development 132: 3935\u0026ndash;3946.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e15. McNamee, L., Brodsky, M. p53-Independent Apoptosis Limits DNA Damage-Induced Aneuploidy. Genetics. 2009 Jun;182(2):423\u0026thinsp;\u0026minus;\u0026thinsp;35. doi: 10.1534/genetics.109.102327.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e16. Wells BS, Yoshida E, Johnston LA. Compensatory proliferation in Drosophila imaginal discs requires Dronc-dependent p53 activity. Curr Biol. 2006 Aug 22;16(16):1606-15. doi: 10.1016/j.cub.2006.07.046.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e17. Fogarty CE, Diwanji N, Lindblad JL, Tare M, Amcheslavsky A, Makhijani K, Br\u0026uuml;ckner K, Fan Y, Bergmann A. Extracellular Reactive Oxygen Species drive Apoptosis-induced Proliferation via \u003cem\u003eDrosophila\u003c/em\u003e Macrophages. Curr Biol. 2016 Mar 7;26(5):575\u0026thinsp;\u0026minus;\u0026thinsp;84. doi: 10.1016/j.cub.2015.12.064.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e18. Pinal N, Calleja M, Morata G. Pro-apoptotic and pro-proliferation functions of the JNK pathway of Drosophila: roles in cell competition, tumorigenesis and regeneration Open Biol. 2019 Mar 29;9(3):180256. doi: 10.1098/rsob.180256.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e19. Blaquiere JA, Verheyen EM. Homeodomain-Interacting Protein Kinases: Diverse and Complex Roles in Development and Disease. Curr Top Dev Biol. 2017;123:73\u0026ndash;103. doi: 10.1016/bs.ctdb.2016.10.002.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e20. Choi CY, Kim YH, Kim YO, Park SJ, Kim EA, Riemenschneider W, Gajewski K, Schulz RA, Kim Y. Phosphorylation by the DHIPK2 protein kinase modulates the corepressor activity of Groucho. J Biol Chem. 2005 Jun 3;280(22):21427-36. doi: 10.1074/jbc.M500496200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e21. Rinaldo C, Prodosmo A, Siepi F, Soddu S. HIPK2: a multitalented partner for transcription factors in DNA damage response and development. Biochem Cell Biol. 2007 Aug;85(4):411-8. doi: 10.1139/O07-071.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e22. Lee W, Andrews BC, Faust M, Walldorf U, Verheyen EM. Hipk is an essential protein that promotes Notch signal transduction in the Drosophila eye by inhibition of the global co-repressor Groucho. Dev Biol. 2009 Jan 1;325(1):263\u0026thinsp;\u0026minus;\u0026thinsp;72. doi: 10.1016/j.ydbio.2008.10.029.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e23. Lee, W., Swarup, S., Chen, J., Ishitani, T., \u0026amp; Verheyen, E. M. Homeodomain interacting protein kinases (Hipks) promote Wnt/Wg signaling through stabilization of -catenin/Arm and stimulation of target gene expression. Development.2009. 136(2), 241\u0026ndash;251. doi: 10.1016/j.ydbio.2008.10.029.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e24. Chen J, Verheyen EM. Homeodomain-interacting protein kinase regulates Yorkie activity to promote tissue growth. Curr Biol. 2012 Sep 11;22(17):1582-6. doi: 10.1016/j.cub.2012.06.074.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e25. Tettweiler G, Blaquiere JA, Wray NB, Verheyen EM. Hipk is required for JAK/STAT activity during development and tumorigenesis. PLoS One. 2019 Dec 31;14(12):e0226856. doi: 10.1371/journal.pone.0226856.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e26. Huang H, Du G, Chen H, Liang X, Li C, Zhu N, Xue L, Ma J, Jiao R. Drosophila Smt3 negatively regulates JNK signaling through sequestering Hipk in the nucleus. Development. 2011 Jun;138(12):2477-85. doi: 10.1242/dev.061770.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e27. Link N, Chen P, Lu WJ, Pogue K, Chuong A, Mata M, Checketts J, Abrams JM. A collective form of cell death requires homeodomain interacting protein kinase. J Cell Biol. 2007 Aug 13;178(4):567\u0026thinsp;\u0026minus;\u0026thinsp;74. doi: 10.1083/jcb.200702125.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e28. Madhavan MM, Madhavan K. Morphogenesis of the epidermis of adult abdomen of Drosophila. J Embryol Exp Morphol. 1980 Dec;60:1\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e29. Ninov N, Chiarelli DA, Mart\u0026iacute;n-Blanco E. Extrinsic and intrinsic mechanisms directing epithelial cell sheet replacement during Drosophila metamorphosis. Development. 2007 Jan;134(2):367\u0026thinsp;\u0026minus;\u0026thinsp;79. doi: 10.1242/dev.02728\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e30. Hay BA, Wolff T, Rubin GM. Expression of baculovirus P35 prevents cell death in Drosophila. Development. 1994 Aug;120(8):2121-9. doi: 10.1242/dev.120.8.2121.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e31. Cherbas L, Hu X, Zhimulev I, Belyaeva E, Cherbas P. EcR isoforms in Drosophila: testing tissue-specific requirements by targeted blockade and rescue. Development. 2003 Jan;130(2):271\u0026thinsp;\u0026minus;\u0026thinsp;84. doi: 10.1242/dev.00205.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e32. Kester RS, Nambu JR. Targeted expression of p35 reveals a role for caspases in formation of the adult abdominal cuticle in Drosophila. Int J Dev Biol. 2011;55(1):109\u0026thinsp;\u0026minus;\u0026thinsp;19. doi: 10.1387/ijdb.103109rk.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e33. Sp\u0026eacute;der P, Ad\u0026aacute;m G, Noselli S. Type ID unconventional myosin controls left-right asymmetry in Drosophila. Nature. 2006 Apr 6;440(7085):803-7. doi: 10.1038/nature04623.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e34. Hozumi S, Maeda R, Taniguchi K, Kanai M, Shirakabe S, Sasamura T, Sp\u0026eacute;der P, Noselli S, Aigaki T, Murakami R, Matsuno K. An unconventional myosin in Drosophila reverses the default handedness in visceral Organs. Nature. 2006 Apr 6;440(7085):798\u0026ndash;802. doi: 10.1038/nature04625.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e35. Abbott MK, Lengyel JA. Embryonic head involution and rotation of male terminalia require the Drosophila locus head involution defective. Genetics. 1991 Nov;129(3):783-9. doi: 10.1093/genetics/129.3.783.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e36. Mac\u0026iacute;as A, Romero NM, Mart\u0026iacute;n F, Su\u0026aacute;rez L, Rosa AL, Morata G. PVF1/PVR signaling and apoptosis promotes the rotation and dorsal closure of the Drosophila male terminalia. Int J Dev Biol. 2004 Dec;48(10):1087-94. doi: 10.1387/ijdb.041859am.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e37. Suzanne M., Pedtzoldt A.G., Sp\u0026eacute;der P., Coutelis J.B., Steller H., Noselli S. Coupling of apoptosis and L/R patterning controls stepwise organ looping. \u003cem\u003eCurrent Biology\u003c/em\u003e 2010; 20, 1773-78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e38. Kuranaga E., Matsunuma T., Kanuka H., Takemoto K., Koto A., Kimura K., Miura M. Apoptosis controls the speed of looping morphogenesis in \u003cem\u003eDrosophila\u003c/em\u003e male terminalia. Development 2011; 138, 1493-99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e39. Ryoo HD, Bergmann A, Gonen H, Ciechanover A, Steller H. Regulation of Drosophila IAP1 degradation and apoptosis by reaper and ubcD1. Nat Cell Biol. 2002 Jun; 4(6):432-8. doi: 10.1038/ncb795.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e40. Dorstyn L, Colussi PA, Quinn LM, Richardson H, Kumar S. Proc Natl Acad Sci U S A. DRONC, an ecdysone-inducible Drosophila caspase. 1999 Apr 13;96(8):4307-12. doi: 10.1073/pnas.96.8.4307.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e41. Fraser AG, Evan GI. Identification of a Drosophila melanogaster ICE/CED-3-related protease, drICE. EMBO J. 1997 May 15;16(10):2805-13. doi: 10.1093/emboj/16.10.2805.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e42. Goyal L, McCall K, Agapite J, Hartwieg E, Steller H. Induction of apoptosis by \u003cem\u003eDrosophila\u003c/em\u003e reaper, hid and grim through inhibition of IAP function. \u003cem\u003eEMBO J\u003c/em\u003e 2000; \u003cb\u003e19\u003c/b\u003e: 589\u0026ndash;597. doi: 10.1093/emboj/19.4.589.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e43. Brand AH, Perrimon N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993 Jun;118(2):401\u0026thinsp;\u0026minus;\u0026thinsp;15. doi: 10.1242/dev.118.2.401.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e44. Lai SL, Lee T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nat Neurosci. 2006;9:703\u0026ndash;709. doi: 10.1038/nn1681.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e45. Uhlirova M, Bohmann D. JNK- and Fos-regulated Mmp1 expression cooperates with Ras to induce invasive tumors in Drosophila. EMBO J. 2006 Nov 15;25(22):5294\u0026thinsp;\u0026minus;\u0026thinsp;304. doi: 10.1038/sj.emboj.7601401.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e46. Meier P, Silke J, Leevers SJ, Evan GI. The Drosophila caspase DRONC is regulated by DIAP1. EMBO J. 2000 Feb 15;19(4):598\u0026ndash;611. doi: 10.1093/emboj/19.4.598.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e47. Hay BA, Wassarman DA, Rubin GM. Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death. Cell. 1995 Dec 29;83(7):1253-62. doi: 10.1016/0092-8674(95)90150-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e48. Wang SL, Hawkins CJ, Yoo SJ, M\u0026uuml;ller HA, Hay BA. The Drosophila caspase inhibitor DIAP1 is essential for cell survival and is negatively regulated by HID. Cell. 1999 Aug 20;98(4):453\u0026thinsp;\u0026minus;\u0026thinsp;63. doi: 10.1016/s0092-8674(00)81974-1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e49. Lisi S, Mazzon I, White K. Diverse domains of THREAD/DIAP1 are required to inhibit apoptosis induced by REAPER and HID in Drosophila. Genetics. 2000 Feb;154(2):669\u0026thinsp;\u0026minus;\u0026thinsp;78. doi: 10.1093/genetics/154.2.669.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e50. Ryoo HD, Gorenc T, Steller. Apoptotic cells can induce compensatory cell proliferation through the JNK and the Wingless signaling pathways. Dev Cell. 2004 Oct;7(4):491\u0026ndash;501. doi: 10.1016/j.devcel.2004.08.019.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e51. Poon CL, Zhang X, Lin JI, Manning SA, Harvey KF. Homeodomain-interacting protein kinase regulates Hippo pathway-dependent tissue growth. Curr Biol. 2012 Sep 11;22(17):1587-94. doi: 10.1016/j.cub.2012.06.075.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e52. Blaquiere JA, Wong KKL, Kinsey SD, Wu J, Verheyen EM. Homeodomain-interacting protein kinase promotes tumorigenesis and metastatic cell behavior. Dis Model Mech. 2018 Jan 17;11(1): dmm031146. doi: 10.1242/dmm.031146.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e53. Gresko E, Roscic A, Ritterhoff S, Vichalkovski A, del Sal G, Schmitz ML. Autoregulatory control of the p53 response by caspase-mediated processing of HIPK2. EMBO J. 2006 May 3;25(9):1883-94. doi: 10.1038/sj.emboj.7601077.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e54. Siegrist, SE.,Haque, NS, Chen, CH, Hay BA, Hariharan IK. Inactivation of both Foxo and 975 reaper promotes long-term adult neurogenesis in Drosophila. Curr. Biol. 2010 Apr 13;20(7):643-8. doi: 10.1016/j.cub.2010.01.060.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e55. Pinal N, Mart\u0026iacute;n M, Medina I, Morata G. Short-term activation of the Jun N-terminal kinase pathway in apoptosis-deficient cells of Drosophila induces tumorigenesis Nat Commun. 2018 Apr 18;9(1):1541. doi: 10.1038/s41467-018-04000-6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e56. Hofmann TG, Stollberg N, Schmitz ML, Will H. HIPK2 regulates transforming growth factor-beta-induced c-Jun NH(2)-terminal kinase activation and apoptosis in human hepatoma cells. Cancer Res. 2003 Dec 1;63(23):8271-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e57. D'Orazi G, Cecchinelli B, Bruno T, Manni I, Higashimoto Y, Saito S, Gostissa M, Coen S, Marchetti A, Del Sal G, Piaggio G, Fanciulli M, Appella E, Soddu S. Homeodomain-interacting protein kinase-2 phosphorylates p53 at Ser 46 and mediates apoptosis. Nat Cell Biol. 2002 Jan;4(1):11\u0026thinsp;\u0026minus;\u0026thinsp;9. doi: 10.1038/ncb714.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e58. Di Stefano V, Rinaldo C, Sacchi A, Soddu S, D'Orazi G. Homeodomain-interacting protein kinase-2 activity and p53 phosphorylation are critical events for cisplatin-mediated apoptosis. Exp Cell Res. 2004 Feb 15;293(2):311\u0026thinsp;\u0026minus;\u0026thinsp;20. doi: 10.1016/j.yexcr.2003.09.032.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e59. Wang Y, Debatin KM, Hug H. HIPK2 overexpression leads to stabilization of p53 protein and increased p53 transcriptional activity by decreasing Mdm2 protein levels. BMC Mol Biol. 2001;2:8. doi: 10.1186/1471-2199-2-8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e60. Zhang Q, Yoshimatsu Y, Hildebrand J, Frisch SM, Goodman RH. Homeodomain interacting protein kinase 2 promotes apoptosis by downregulating the transcriptional corepressor CtBP. \u0026lt;cell. 2003 Oct 17;115(2):177\u0026thinsp;\u0026minus;\u0026thinsp;86. doi: 10.1016/s0092-8674(03)00802-x.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e61. Sombroek D, Hofmann TG. How cells switch HIPK2 on and off. Cell Death Differ. 2009 Feb;16(2):187\u0026thinsp;\u0026minus;\u0026thinsp;94. doi: 10.1038/cdd.2008.154.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e62. Rodriguez A, Oliver H, Zou H, Chen P, Wang X, Abrams JM. Dark is a Drosophila homologue of Apaf-1/CED-4 and functions in an evolutionarily conserved death pathway Nat Cell Biol. 1999 Sep;1(5):272-9. doi: 10.1038/12984.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e63. D'Brot A, Chen P, Vaishnav M, Yuan S, Akey CW, Abrams JM. Tango7 directs cellular remodeling by the Drosophila apoptosome. Genes Dev. 2013 Aug 1;27(15):1650-5. doi: 10.1101/gad.219287.113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e64. Amcheslavsky A, Wang S, Fogarty CE, Lindblad JL, Fan Y, Bergmann A. Plasma Membrane Localization of Apoptotic Caspases for Non-apoptotic Functions Dev Cell. 2018 May 21;45(4):450\u0026ndash;464.e3. doi: 10.1016/j.devcel.2018.04.020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e65. Brady SC, Allan LA, Clarke PR. Regulation of caspase 9 through phosphorylation by protein kinase C zeta in response to hyperosmotic stress. Mol Cell Biol. 2005 Dec;25(23):10543-55. doi: 10.1128/MCB.25.23.10543-10555.2005.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e66. Martin MC, Allan LA, Lickrish M, Sampson C, Morrice N, Clarke PR. Protein kinase A regulates caspase-9 activation by Apaf-1 downstream of cytochrome c. J Biol Chem. 2005 Apr 15;280(15):15449-55. doi: 10.1074/jbc.M414325200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e67. Allan LA, Clarke PR. Apoptosis and autophagy: Regulation of caspase-9 by phosphorylation. FEBS J. 2009 Nov;276(21):6063-73. doi: 10.1111/j.1742-4658.2009.07330.x.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e68. Ge J, Wang Y, Li X, Lu Q, Yu H, Liu H, Ma K, Deng X, Luo ZQ, Liu X, Qiu J. Phosphorylation of caspases by a bacterial kinase inhibits host programmed cell death Nat Commun. 2024 Sep 30;15(1):8464. doi: 10.1038/s41467-024-52817-1.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e69. Yang CS, Thomenius MJ, Gan EC, Tang W, Freel CD, Merritt TJ, Nutt LK, Kornbluth S. Metabolic regulation of Drosophila apoptosis through inhibitory phosphorylation of Dronc EMBO J. 2010 Sep 15;29(18):3196\u0026thinsp;\u0026minus;\u0026thinsp;207. doi: 10.1038/emboj.2010.191.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e70. Liu J, Lin A. Role of JNK activation in apoptosis: a double-edged sword. Cell Res. 2005;15:36\u0026ndash;42. doi: 10.1038/sj.cr.7290262.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e71. Tanimoto H, Itoh S, ten Dijke P, Tabata T. Hedgehog creates a gradient of DPP activity in Drosophila wing imaginal discs. Mol cell. 2000;5:59\u0026ndash;71. doi: 10.1016/S1097-2765(00)80403-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e72. McGuire SE, Le PT, Osborn AJ, Matsumoto K, Davis RL. Spatiotemporal rescue of memory dysfunction in Drosophila. Science. 2003;302:1765\u0026ndash;8. doi: 10.1126/science.1089035.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e73. de Navas L, Foronda D, Suzanne M, S\u0026aacute;nchez-Herrero E. A simple and efficient method to identify replacements of P-lacZ by P-Gal4 lines allows obtaining Gal4 insertions in the bithorax complex of Drosophila. Mech Dev. 2006 Nov;123(11):860-7. doi: 10.1016/j.mod.2006.07.010.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e74. Santab\u0026aacute;rbara-Ruiz P, L\u0026oacute;pez-Santill\u0026aacute;n M, Mart\u0026iacute;nez-Rodr\u0026iacute;guez I, Binagui-Casas A, P\u0026eacute;rez L, Mil\u0026aacute;n M, Corominas M, Serras F. ROS-Induced JNK and p38 Signaling Is Required for Unpaired Cytokine Activation during Drosophila Regeneration. PLoS Genet. 2015 Oct 23;11(10):e1005595. doi: 10.1371/journal.pgen.1005595.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e75. Igaki, T., Kanuka, H., Inohara, N., Sawamoto, K., Nunez, G., Okano, H., \u0026amp; Miura, M. Drob-1, a Drosophila member of the Bcl-2/CED-9 family that promotes cell death. doi: 10.1073/pnas.97.2.662.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e76. Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P. Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery. Cell Death Differ. 2006 Oct;13(10):1663-74. doi: 10.1038/sj.cdd.4401868.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e77. Jenett A, Rubin GM, Ngo TT, Shepherd D, Murphy C, Dionne H, Pfeiffer BD, Cavallaro A, Hall D, Jeter J, Iyer N, Fetter D, Hausenfluck JH, Peng H, Trautman ET, Svirskas RR, Myers EW, Iwinski ZR, Aso Y, DePasquale GM, Enos A, Hulamm P, Lam SC, Li HH, Laverty TR, Long F, Qu L, Murphy SD, Rokicki K, Safford T, Shaw K, Simpson JH, Sowell A, Tae S, Yu Y, Zugates CT. A GAL4-driver line resource for Drosophila neurobiology. Cell Rep. 2012 Oct 25;2(4):991\u0026ndash;1001. doi: 10.1016/j.celrep.2012.09.011.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e78. Pfeiffer et al., 2010. Pfeiffer BD, Ngo TT, Hibbard KL, Murphy C, Jenett A, Truman JW, Rubin GM. Refinement of tools for targeted gene expression in Drosophila. Genetics. 2010 Oct;186(2):735\u0026thinsp;\u0026minus;\u0026thinsp;55. doi: 10.1534/genetics.110.119917.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e79. Wendler F, Park S, Hill C, Galasso A, Chang KR, Awan I, Sudarikova Y, Bustamante-Sequeiros M, Liu S, Sung EY, Aisa-Bonoko G, Kim SK, Baena-Lopez LA. A LexAop\u0026thinsp;\u0026gt;\u0026thinsp;UAS\u0026thinsp;\u0026gt;\u0026thinsp;QUAS trimeric plasmid to generate inducible and interconvertible Drosophila overexpression transgenes. Sci Rep. 2022 Mar 9;12(1):3835. doi: 10.1038/s41598-022-07852-7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003e80. Arthurton L, Nahotko DA, Alonso J, Wendler F, Baena-Lopez LA. Non-apoptotic caspase activation preserves \u003cem\u003eDrosophila\u003c/em\u003e intestinal progenitor cells in quiescence EMBO Rep. 2020 Dec 3;21(12):e48892. doi: 10.15252/embr.201948892.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-6955925/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6955925/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMembers of the evolutionarily conserved homeodomain-interacting protein kinase (Hipk) family play a critical role in regulating essential signalling pathways involved in growth, differentiation, and apoptosis. While vertebrates have multiple \u003cem\u003ehipk\u003c/em\u003e genes, \u003cem\u003eDrosophila\u003c/em\u003e contains a single \u003cem\u003ehipk\u003c/em\u003e ortholog, what facilitates functional analysis. We find that \u003cem\u003ehipk\u003c/em\u003e is necessary for the stabilization of the initiator caspase Dronc, thus enhancing the two Dronc activities in apoptotic scenarios: the induction of the caspase cascade, and the reinforcement of JNK signalling pathway. Conversely, our data suggest that Dronc also raises the expression levels of Hipk, thereby reinforcing the apoptotic response. These findings significantly enhance our understanding of caspase regulation and position Hipk as a promising target for modulating caspase activity in a variety of biological contexts.\u003c/p\u003e","manuscriptTitle":"The Homeodomain-interacting protein kinase Hipk promotes apoptosis by stabilizing the active form of Dronc","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-01 11:51:31","doi":"10.21203/rs.3.rs-6955925/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"transferred","content":"Cell Death Discovery","date":"2025-07-23T13:32:38+00:00","index":"","fulltext":""},{"type":"decision","content":"Reject after peer review","date":"2025-07-10T09:07:02+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-07-07T02:26:11+00:00","index":1,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-07-04T02:45:23+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-06-27T05:57:25+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-06-27T01:15:25+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-06-26T23:12:31+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-24T12:17:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Differentiation","date":"2025-06-23T10:46:40+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-23T10:46:40+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"74efcf61-bbf8-4bb2-a004-d8bf87d6a856","owner":[],"postedDate":"July 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":50661733,"name":"Biological sciences/Genetics/Development"},{"id":50661734,"name":"Biological sciences/Cell biology"}],"tags":[],"updatedAt":"2026-01-29T08:21:22+00:00","versionOfRecord":{"articleIdentity":"rs-6955925","link":"https://doi.org/10.1038/s41420-025-02916-9","journal":{"identity":"cell-death-discovery","isVorOnly":false,"title":"Cell Death Discovery"},"publishedOn":"2025-12-16 05:00:00","publishedOnDateReadable":"December 16th, 2025"},"versionCreatedAt":"2025-07-01 11:51:31","video":"","vorDoi":"10.1038/s41420-025-02916-9","vorDoiUrl":"https://doi.org/10.1038/s41420-025-02916-9","workflowStages":[]},"version":"v1","identity":"rs-6955925","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6955925","identity":"rs-6955925","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00