STRAP positively regulates the antiviral immune response against pseudorabies virus via targeting TBK1

STRAP positively regulates the antiviral immune response against pseudorabies virus via targeting TBK1 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article STRAP positively regulates the antiviral immune response against pseudorabies virus via targeting TBK1 Wenfeng He, Hongtao Chang, Chen Li, Chenlong Wang, Longxi Li, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4645344/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 24 Aug, 2024 Read the published version in Virology Journal → Version 1 posted 9 You are reading this latest preprint version Abstract Serine/threonine kinase receptor associated protein (STRAP) functions as a scaffold protein and involves in diverse cellular processes, yet its role in antiviral innate immunity is still elusive. Here, we found that STRAP acts as an interferon (IFN)-inducible positive regulator to facilitate type I IFN signaling during pseudorabies virus (PRV) infection. Mechanistically, STRAP interacted with TBK1 and promoted the activation of type I IFN signaling. Both the CT and WD40 7 − 6 domains contribute to STRAP’s function. Furthermore, TBK1 competed with PRV-UL50 for binding to STRAP, and STRAP impedes the degradation of TBK1 mediated by PRV-UL50, thereby augmenting the interaction between STRAP and TBK1. In general, these findings revealed a previously unrecognized role for STRAP in innate antiviral immune responses in PRV infection. STRAP could be a potential therapeutic target for viral infectious diseases. STRAP TBK1 Pseudorabies virus antiviral immunity type I interferon Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Pseudorabies virus (PRV), also referred as suid herpesvirus 1 or Aujeszky’s disease, belongs to the alphaherpesvirus subfamily and infects a wide range of hosts, including its natural host, swine [ 1 ]. PRV infection in swine can lead to severe disease and substantial economic losses on a global scale [ 2 ]. Recent studies have provided evidence suggesting the possibility of PRV transmission from domestic animals to humans, posing a potential risk to human health [ 3 , 4 ]. PRV is an enveloped virus with a large linear double-strand DNA genome that encodes over 70 functional proteins [ 5 ]. Presently, vaccination is available to prevent PRV infection, but there remains a pressing need to develop novel preventive and therapeutic strategies to effectively combat PRV infection. The innate immune system functions as the first line of defense against viral infection when it recognizes pathogen-associated molecular patterns (PAMPs). Pathogen-derived DNA is sensed by cytosolic DNA sensors such as cyclic GAMP synthase (cGAS), which directly binds to DNA and produces cyclic GMP-AMP (cGAMP) [ 6 , 7 ]. cGAMP activates the stimulator of interferon gene (STING), which recruits TNAK-binding kinase 1 (TBK1) and promotes the phosphorylation of downstream IFN regulatory factor 3 (IRF3), leading to the expression of type I interferon (IFN) and the downstream antiviral IFN-stimulated genes (ISGs) [ 8 , 9 ]. TBK1 is a key adaptor protein that participates in the production of IFN-I to prevent the invasion of pathogenic microorganisms. Accumulating evidence has suggested that the activation of cGAS-STING axis is critical for innate antiviral responses [ 10 , 11 ]. For example, studies have reported that the herpes simplex virus 1 (HSV-1) protein ICP27 interacts with the STING-TBK1 complex to inhibit IRF3 phosphorylation [ 12 ], and the tegument protein UL41 and UL46 of HSV-1 directly degrade cGAS mRNA or inhibit TBK1 activation, respectively [ 13 , 14 ]. Similarly, the human cytomegalovirus (HCMV) tegument protein UL82 was reported to impair the trafficking of STING and the recruitment of TBK1 or IRF3 to STING [ 15 ]. HCMV US9 was confirmed to disrupt STING-TBK1 association and block IRF3 nuclear translocation [ 16 ]. Additionally, PRV UL13 functions as an antagonist of IFN signaling via targeting STING to evade host antiviral responses [ 1 ]. Despite these findings, the roles and molecular mechanisms of TBK1-mediated antiviral response against PRV infection remain largely unclear. Serine-threonine kinase receptor-associated protein (STRAP), as a scaffolding protein, mediates multiple cellular functions including signal transduction, protein transportation, transcription regulation and RNA processing [ 17 – 20 ]. Particularly, STRAP inhibits the transforming growth factor-β (TGF-β) signaling via by interacting with decapentaplegic homolog 7 (Smad7) [ 21 ]. The inhibitory effect of STRAP on TGF-β signaling contributes to tumorigenesis, which is supported by STRAP overexpression in breast and lung cancer [ 22 , 23 ]. In addition, recent studies have indicated that STRAP regulates a variety of signal transduction pathway including TGF-β signaling, PI3K/PDK, ASK1, and p53 pathway, which are involved in the regulation of cell proliferation and apoptosis [ 20 , 24 – 26 ]. Moreover, STRAP positively regulates TLR-mediated NF-κB signaling as a scaffold protein [ 27 ]. Acetylation of STRAP plays an important role in regulating p53 activity and stability [ 26 ]. STRAP contains seven WD40-repeat domains, which is involved in activating TLR2/4-mediated cytokine production via facilitating TAK1-IKKα-p65 interactions [ 27 ]. However, the involvement of STRAP in host antiviral innate immune response still needs to be investigated. This study provides evidence that upregulation of STRAP plays a positive regulatory role in the type I IFN-mediated antiviral response during PRV infection by interacting with TBK1. The STRAP-TBK1 interaction enhances the phosphorylation of IRF3 and production of IFN-I in response to PRV infection. Mechanistically, STRAP possesses the ability to impair the degradation of TBK1 mediated by PRV-UL50, thereby promoting STRAP-TBK1 interaction on IFN-I signaling. Our findings uncovered a novel role of STRAP as a positive regulator of innate immune responses against PRV. Materials and methods Cells, viruses and antibodies PK15 and BHK21 cell were cultured in Dulbecco’s modified Eagle medium (DMEM) medium supplemented with 10% (vol/vol) fetal bovine serum (FBS) (Gibco), penicillin and streptomycin. PRV strain QXX was preserved in our laboratory, as previously described [ 28 ]. The recombinant PRV UL50-knockout virus (PRV UL50 KO) was kindly donated by Prof. Tang Jun, from Chinese Agricultural University. Viral aliquots were stored at -80 ˚C until use. Mouse β-actin, anti-HA, anti-Myc, and anti-Flag monoclonal antibodies (MAbs) were purchased from Santa Cruz Biotechnology. Rabbit anti-STRAP, anti-IRF3, anti-TBK1, and anti-cGAS, anti-STING polyclonal antibodies (PAbs) were purchased from Proteintech Group Inc. (Shanghai, China). Phospho-TBK1 and phospho-IRF3 (Ser396) were purchased from Cell Signaling Technology (Danvers, MA, USA). Virus infection and plaque assay PRV WT, EMCV or PRV-UL50 KO viruses were propagated and titrated in PK15 cells. To infect, the cells were incubated with PRV or PRV-UL50 KO for 1 h, washed with PBS, and incubated in DMEM supplemented with 5% FBS until the times indicated. PK15 cells were treated with either 10 µM MG132 or 0.2 µM Bafilomycin A1 (BafA1) for 2 h, and then infected with PRV (MO = 1) for 24 h. The viral yield was determined by tittering in PK15 cells. Briefly, the supernatants of PRV-infected cells were harvested and diluted at 1:10 to 1:109. The supernatants were removed after 1 h and the medium containing 1% agar was overlaid on the cells. At 72 hpi, the cells were fixed for 20 min with 4% formaldehyde, stained with 0.2% crystal violet, and then the plaques in each well were counted. The results were averaged and multiplied by the dilution factor for the calculation of viral titers as PFU/mL. Plasmid construction PRV ORFs were amplified from the PRV genome, and swine STRAP (XM_003355564.4), STING (NM_001142838.1), TBK1(XM_021090852.1), and IRF3 (NM_213770.1) genes were amplified from PK15 cells and then cloned into pCMV-Myc or pCMV-Flag plasmid. Multiple truncation mutants of STRAP were amplified from the templates of full-length STRAP, which were cloned into pCAGGS-HA plasmid. The IFN-β promoter luciferase reporter plasmid and NF-κΒ promoter luciferase reporter plasmids were stored in our lab. All constructed plasmids were analyzed and verified by DNA sequencing. The plasmids were transfected into PK15 cells using Lipofectamine 3000 (Thermo Scientific), according to the manufacture’s protocol. RNA extraction and Real-time quantitative PCR (RT-qPCR) Total RNA was extracted from BHK21 and PK15 cells using TRIzol reagent (Invitrogen, Carlsbad, CA) and reverse transcribed into cDNA according to the manufacturer’s protocol. RT-qPCR was performed using SYBR green real-time PCR Master Mix and ABI QuantStudio 7 qPCR System. The β-actin gene was used as an internal control. The relative expression of mRNA was calculated using the comparative cycle threshold (CT) (2-ΔΔCT) method. The qPCR primers sequences are as follows: swine PRV-gE-F: GACACGTTCGACCTGATGCC, R: TGGTAGATGCAGGGCTCGTA; swine STRAP-F: TGCTACGCCAGGGAGATACA, R: CAGCATCCCATACTTTGGCTG T; swine IFNα-F: CACCTCAGCCAGGACAGAAGC, R: ATGAGGGGATCCAAAGTC CCT; swine IFN-β β-F: TGATGGGCAGATGGATGACC, R: AGGCACAGCTTCTGT ACTCC; swine Mx1-F: GTCATCGGGGACCAGAGTTC, R: TCCCGGTAACTGAC TTTGCC; swine OAS1-F: GTTTCCGAACGCAGGTCAAG, R: GGAAGACGACGA GGTCAGCATC; swine IFIT1-F: GACTCACAGCAACCATGAGTAATA, R: CCTCATTCTGGCCTTTCAGGT; swine ISG15-F: GGTGAGGAACGACAAGGGT C, R: GGCTTGAGGTCATACTCCCC; swine β-actin-F: TGGAACGGTGAAGGTGA CAG, R: CTTTTGGGAAGGCAGGGACT. Coimmunoprecipitation (Co-IP) and Western blotting PK15 cells were transfected with various indicated expressing plasmids. The cells were collected and lysed at the indicated time points with lysis buffer supplemented with a protease inhibitor cocktail. Then, the cell lysates were immunoprecipitated with the indicated antibodies, coimmunoprecipitation samples were subjected to SDS-PAGE and then transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skim milk power in TBST for 2 h at room temperature (RT), and then incubated with indicated primary antibodies for 6–8 h at 4 ˚C. After washing three times with TBST, membranes were incubated with horseradish peroxidase (HRP)-labeled goat anti-mouse IgG or anti-rabbit antibody for 1 h at RT. The antibody-antigen complexes were visualized using chemiluminescence detection reagents (Thermo Fisher Scientific). Knockdown of STRAP using siRNA The small interfering RNAs (siRNAs) used in this study were designed and synthesized by Tsingke Biological Technology (Wuhan, China). Knockdown of endogenous STRAP in PK15 cells were performed by transfection of STRAP siRNA, and NC siRNA was used as a negative control. According to the manufacture’s protocol, the siRNA transfection was performed using Lipofectamine 3000. The swine STRAP siRNA sequence is GCACUUCCCACCUGAUAA. Luciferase reporter assay PK15 cells were seeded in 24-well plates, and the monolayer cells were co-transfected with IFN-β -Luc, ISRE-Luc, or NF-κΒ-Luc along with pRL-TK Renilla luciferase reporter plasmid and other plasmids. Twenty-four hours later, the cells lysates were analyzed for firefly and Renilla luciferase activities using the Dual Luciferase Reporter Assay Kit (Promega) following the manufactures directions. ELISA The expression of IFN-α and IFN-β protein in the PRV-infected cells supernatant were analyzed using porcine IFN-α and IFN-β ELISA kits (Solarbio). The measured value was compared with the standard following the manufacturer’s instructions. Nuclear and cytoplasmic extraction PK15 cells were transfected with different plasmids and subsequently infected with PRV (MOI = 1). The cells were harvested, and subcellular fractions were isolated using a nuclear and cytoplasm extraction kit (Thermo Fisher Scientific) following the manufacturer’s instructions. Statistical analysis Statistical analysis was conducted using the GraphPad Prism software to perform by Student’s t test or analysis of variance (ANOVA) on at least three independent replicates. A significance level of p < 0.05 was employed to determine statistically significance for each test. Data are shown as mean ± standard deviation (SD) of at least three independent experiments. Results PRV infection upregulates STRAP To explore the function of STRAP in PRV infection, we first examined whether PRV infection affects STRAP expression in cells, including PK15 and BHK21 cells. We found that an increase in both mRNA and protein levels of STRAP in PRV-infected cells, as compared to uninfected cells (Fig. 1 A). This suggests that PRV infection led to an increase of endogenous STRAP in both PK15 and BHK21 cells. However, an RNA virus (encephalomyocarditis virus, EMCV) failed to induce STRAP mRNA expression in PK15 cells (Fig. 1 B). Next, we sought to evaluate whether endogenous STRAP is required for PRV replication. PK15 cells were infected with ultraviolet-inactivated PRV (UV-PRV) or PRV at a MOI of 1 for 24 h. Notably, UV-PRV infection did not elicit STRAP expression in PK15 cells (Fig. 1 C), suggesting that the failure of STRAP induction was possibly due to the inability of PRV gene expression. We previously found that UV inactivation prevents PRV gene expression after viral entry [ 28 ], thus, it is possible that the STRAP upregulation is attributed to PRV infection and viral gene expression. Furthermore, it was observed that STRAP predominantly localized in the cytoplasm, whereas PRV infection promoted an accumulation of STRAP in both the cytoplasm and nucleus (Fig. 1 D). Thus, we inferred that STRAP mainly exerts its function in the cytoplasm. In general, these findings provide evidence that PRV infection induces an upregulation of STRAP expression in host cells, suggesting that STRAP plays an important role during PRV infection. STRAP can suppress PRV replication Given that STRAP’s role in PRV infection, we further examined whether the STRAP affects PRV replication in vitro. We transfected STRAP plasmids (HA-STRAP) into PK15 cells. After transfection for 24h, PRV was infected into cells PRV at a MOI of 1. We gathered infected cell culture supernatants and cell at indicated time points and measured PRV viral titers and PRV gE expression. When STRAP was overexpressed, we observed reduced PRV-gE mRNA and protein levels (Fig. 2 A). Consistent result was observed for the viral titers in the supernatants of PRV-infected cells (Fig. 2 B). Simultaneously, we designed siRNAs targeting STRAP, transfected the STRAP siRNA into PK15 cells, and detected that the interference efficiency of STRAP siRNA reached about 91% (Fig. 2 C). As anticipated, silencing of STRAP obviously promoted PRV replication in PK15 cells (Figs. 2 D and 2 E). These data indicated that STRAP restricted PRV replication in vitro. Type I IFN (IFN-I) plays a critical role in inducing an antiviral state and controlling viral infection [ 29 ]. Accordingly, we determined whether STRAP inhibition of PRV replication was due to IFN-I response, we assessed the effects of STRAP on IFN-I production in response to PRV infection. The mRNA expression and protein secretion of IFN-I were markedly enhanced when STRAP was overexpressed, but they are reduced by STRAP knockdown (Figs. 2 F to 2 I). STRAP thus appears to play a crucial role in promoting IFN-I production induced by PRV. To rule out the possibility of cell specificity, we performed the above-described experiments in BHK21 cells and obtained similar results (Figs. 2 J to 2 M). Collectively, these data presented provide evidence that STRAP plays a promoting role in IFN-I production triggered by PRV and exhibits antiviral activity. TBK1 is a potential target of the STRAP Having known that STRAP expression promotes PRV-triggered type I IFN production, we speculate that STRAP targets one or several components of the type I IFN signaling pathway. To identify the potential candidate target regulated by STRAP, we firstly analyzed the PRV-induced activation of IFN-β and NF-κΒ promoter. Overexpression of STRAP enhanced PRV-induced activation of IFN-β promoter but not NF-κΒ (Figs. 3 A and 3 B). To further test whether STRAP leads to the induction of the IFN-I response through the STING-TBK1-IRF3 pathway, PK15 cells were co-transfected with Flag-STRAP expression plasmid and plasmids expressing each component of the innate immune signaling pathway (including cGAS, STING, TBK1 and IRF3), together with IFN-β -Luc or ISRE-Luc and pRL-TK plasmids. The activities of IFN-β and ISRE promoters were determined by the Dual-Luciferase Reporter Assay system. The results showed that STRAP overexpression remarkedly enhanced the activation of IFN-β and ISRE promoters induced by all of these molecules, except for IRF3 (Figs. 3 C and D). The results of Western blotting indicated that both TBK1 and IRF3 phosphorylation were obviously augmented in STRAP-overexpressed PK15 cells, while attenuated in STRAP-silenced cells (Fig. 3 E). Conversely, no changes in protein expression of cGAS, STING, and the downstream effectors total TBK1 and IRF3 were observed (Fig. 3 E). Meanwhile, our data showed that STRAP did not interact with STING or IRF3 (Fig. 3 F). Hence, it was hypothesized that STRAP might target TBK1 to enhance the production of type I IFN. STRAP interacts with TBK1 To elucidate how STRAP promoted IFN-I production via TBK1, we next explored possible interaction between STRAP and TBK1. PK15 cells were transfected with Myc empty vector, Myc-TBK1 expression plasmids with or without HA-STRAP expression plasmid. After 24 hours transfection, cells were infected with PRV for 24 hours, and cell lysates were immunoprecipitated with anti-HA antibody and subjected to SDS-PAGE. HA-STRAP pulled down Myc-TBK1 (Fig. 4 A). To confirm the endogenous interaction between STRAP and TBK1, PK15 cells were infected with PRV, and the cell lysates were immunoprecipitated with anti-TBK1 and anti-IgG antibodies and subjected to Western blotting. The results showed that endogenous STRAP pulled down TBK1 (Fig. 4 B), and endogenous TBK1 also pulled down STRAP in PK15 cell lysates (Fig. 4 C). These results support our observation that STRAP targets and interacts with TBK1. We next addressed which domain of STRAP is essential for its interaction with TBK1. STRAP is composed of 350 amino acids (aa) and contains seven WD40-repeat domains, which are believed to stabilize their structure and serve regulatory functions in various cellular process [ 30 ]. We constructed four plasmids expressing various truncated fragments of STRAP: STRAP ΔCT (1-293aa), STRAPΔ7 − 6 (1-221aa), STRAPΔ5 − 4 (1-141aa), STRAPΔ3 (1-103aa) (Fig. 4 D). PK15 cells were transfected with Myc-tagged TBK1 together with HA empty vector, HA-STRAP, HA-STRAP mutants expression plasmids. The cell lysates were precipitated with anti-Myc antibody, and the precipitates were probed for HA antibody. The results show that the ability of STRAP to bind TBK1 was clearly impaired by the deletion of its C-terminal (CT) region, while the deletion of CT and 6–7 domains lost the ability to interact with TBK1 (Fig. 4 E). These findings suggested that both the CT and WD40 6–7 domains of STRAP are critical for its binding to TBK1. STRAP potentiates antiviral immunity via interacting with TBK1 The above data provide evidence that STRAP overexpression facilitates the phosphorylation of IRF3 upon PRV infection. To detect the effect of STRAP-TBK1 interaction on IFN-I production and signaling, we performed an IFN-β -luc reporter assay in STRAP-overexpressing PK15 cells. IFN-β promoter activation was enhanced upon the exogenous expression of STRAP in a dose-dependent manner (Fig. 5 A). To further confirm the promotion effect of STRAP on IFN-β induction, the transcription of IFN-β was measured by RT-qPCR upon PRV infection. Consistent with the IFN-β reporter assay, STRAP-TBK1 binding also facilitated IFN-β mRNA level (Fig. 5 B). Furthermore, STRAP-TBK1 interaction potentiated IRF3 activation (Fig. 5 C). These data suggested that STRAP promotes the type I IFN signaling via targeting with TBK1. The STING-TBK1-IRF3 pathway is critical for IFN-I production, and activated STING recruits the kinase TBK1 to stimulate the phosphorylation of IRF3 [ 31 ]. To assess the effect of STRAP on the STING-TBK1-IRF3 complex, PK15 cells were transfected with plasmids expressing STING, TBK1 and IRF3 along with Flag-STRAP or siSTRAP. We found that STRAP overexpression enhanced the formation of TBK1-IRF3 dimers (Fig. 5 D) and STING-TBK1-IRF3 trimeric complex (Fig. 5 E), while STRAP knockdown disrupted the formation of complexes (Figs. 5 D and E). Additionally, we examined the effect of the STRAP-TBK1 interaction on the transcription of IFN-I and downstream antiviral genes, such as IFIT1, OAS1, ISG15 and Mx1. As shown in Figs. 5 F and 5 G, the interaction of exogenous TBK1 and STRAP significantly augmented the production of IFN-I and transcription of downstream antiviral genes induced by PRV infection, while a noticeable reduction was observed when TBK1 and siSTRAP interaction was compared with TBK1-transfected group. Taken together, these data indicated that STRAP acts as a scaffold protein and facilitates the recruitment of STING, TBK1 and IRF3, leading to the activation of type I IFN signaling pathway. Both CT and WD40 7 − 6 domains contribute to STRAP’s antiviral activity As mentioned above, the CT and WD40 7 − 6 domains of STRAP are important for the interaction between STRAP and TBK1. Consistent with this result, the inhibition effect of the CT deletion mutant on PRV replication was impaired, but the different WD40 truncations of STRAP completely lost the ability to inhibit PRV replication (Figs. 6 A and 6 B). Our above data demonstrated that STRAP exerts its antiviral role by positively regulating the IFN-I signaling pathway. Thus, we further investigated the effect of different truncations of STRAP on the IFN-β induction and relative IFN-stimulated genes (ISGs) expression. Data are illustrated in Figs. 6 C to 6 F, the luciferase activities of IFN-β and ISRE did not exhibit obvious changes in PK15 cells overexpressing different STRAP truncated mutants compared to cells transfected with the empty vector (EV). Moreover, the mRNA levels of relevant ISGs in different truncations of STRAP were normalized to those in EV-transfected PK15 cells. Inconsistent with a previous report [ 27 ], these observations indicated that both the CT and WD40 7 − 6 domains of STRAP are necessary for its antiviral activity. PRV-UL50 can interact with STRAP and induce TBK1 degradation To further explore the mechanism through which STRAP hinders PRV replication, we analyzed whether STRAP inhibits PRV replication by regulating the PRV tegument proteins (UL56, UL50, UL24, UL13, US3), PRV glycoprotein E (PRV-gE), and PRV thymidine kinase (PRV-TK) proteins. A co-IP assay was performed using indicated antibodies in PK15 cells subjected to specific plasmid and Myc-STRAP plasmid cotransfection. The result revealed that PRV-UL50 was precipitated using Myc-STRAP (Fig. 7 A), indicating that PRV-UL50 protein shows direct interaction with STRAP. Furthermore, the CT and WD40 7 − 6 domains of STRAP are required for its interaction with PRV-UL50 protein (Fig. 7 B). Considering that STRAP exerts antiviral activity against PRV via interacting with TBK1, we next examined the effect of PRV-UL50 on TBK1 expression. PK15 cells were infected with wild type PRV (PRV-WT) and PRV UL50-knockout virus (PRV-UL50 KO), and endogenous TBK1 and phosphorylated IRF3 were analyzed. Western blot analysis revealed that the UL50 knockout led to increased TBK1 expression and subsequently enhanced the level of IRF3 phosphorylation (Fig. 7 C), indicating that PRV-UL50 could induce TBK1 degradation. Protein degradation in eukaryotic cells is mediated by two major pathways: ubiquitin-proteasome and autolysosome pathways [ 32 ]. To further explore the mechanism by which PRV-UL50 affected the stability of TBK1, PK15 cells were co-transfected with HA-UL50 plasmid for 24 h and treated with various inhibitors of the protein degradation pathway. The results demonstrated that TBK1 expression was significantly decreased by ectopic expression of PRV- UL50 (lane 1 and lane 2, Figs. 7 D-E), consistent with the result in Fig. 7 C. Furthermore, no significant difference is observed in UL50-untransfected group without inhibitors, compared with UL50-transfected group with inhibitors (lane 1 and lane 4, Figs. 7 D-E). Notably, ectopic expression of UL50 resulted in a partial restoration of TBK1 expression following inhibitor treatment, in comparison to the UL50-untransfected group. These data suggest that TBK1 degradation is partially, not totally dependent on PRV-UL50. STRAP impairs TBK1 degradation induced by PRV-UL50 Based on our aforementioned findings, we hypothesized that there might exist a competitive binding of TBK1 and PRV-UL50 to STRAP. To confirm the role of PRV-UL50 on the interaction between STRAP and TBK1, the endogenous STRAP-TBK1 interactions between in PRV WT and UL50 KO-infected PK15 cells were analyzed. Co-IP results demonstrated that PRV UL50 deficiency markedly promoted the STRAP-TBK1 interaction (Figs. 8 A-B), indicating that STRAP can competitively interact with TBK1 and PRV-UL50. Next, we sought to determine whether STRAP-TBK1 interaction affects the binding of STRAP and PRV-UL50. PK15 cells were co-transfected with Myc-TBK1 and Flag-STRAP, together with increasing doses of HA-UL50. The immunoblot results showed that the expression of TBK1 was gradually decreased accompanied by the increased amount of PRV-UL50, while no change was observed in STRAP expression (Fig. 8 C). This suggests that the binding of STRAP and UL50 inhibits the STRAP-TBK1 interaction. To further validate this, PK15 cells were co-transfected with HA-UL50 and Flag-STRAP, along with increasing doses of TBK1. This result further confirmed that the STRAP-TBK1 interaction hindered the interaction between STRAP and UL50 (Fig. 8 D). Together, these findings provided support for the hypothesis that TBK1 and PRV-UL50 may competitively interact with STRAP. Since we found that STRAP exerted its anti-PRV activity by promoting IFN-I production, while PRV-UL50 can inhibit IFN-I signaling pathway [ 33 ]. Therefore, we postulate that the STRAP-TBK1 interaction may potentially hinder the interaction of STRAP and PRV-UL50, thereby impairing the inhibition effect of UL50 on the IFN-I response. To validate this hypothesis, PK15 cells were transfected with Flag-STRAP and HA-UL50 plasmids in the presence or absence of BafA1 or MG132, and the levels of endogenous TBK1 protein were assessed. Notably, STRAP overexpression partially restored the inhibition of TBK1 (lanes 1 and 2 to 5 and 6, Figs. 7 D and 7 E). Significantly, the UL50-induced degradation of TBK1 was restored the accumulation by overexpression of STRAP mainly via Baf A1 treatment, but not MG132 (lanes 3 and 4 to lane 7 and 8, Figs. 7 D and 7 E). These data demonstrated that STRAP could block TBK1 degradation induced by PRV-UL50, partially via the autophagy pathway. This was further confirmed in PK15 cells with Baf A1 treatment at different time points (Fig. 8 E). However, this mechanism needs to be investigated in further detail. Based on these observations, we propose that STRAP, as a scaffold protein, prevents the TBK1 degradation induced by UL50 to enhance the STRAP-TBK1 interaction, thereby promoting the type I IFN-mediated antiviral activity. Discussion The cGAS-mediated innate immune response forms the first line of defense that protect hosts from invasion by DNA viruses. After virus infection, the IFN-β signaling pathway is activated to induce IFN-β and ISGs expression, thereby initiating the appropriate adaptive immune response. Investigating the mechanisms underlying the innate immune response holds great potential for bettering disease control and designing effective vaccines. In the present study, we first investigated the roles of STRAP in type I IFN-mediated innate immunity response against PRV. The overexpression of STRAP exhibited a notable inhibition effect on the activation of IFN-β promoter and IFN-β induction in response to PRV, whereas STRAP knockdown had the opposite effects. This finding establishes a critical role for STRAP in the innate immune response. While much is known about STRAP as a scaffold protein implicated in diverse cellular functions, its involvement in the regulation of innate immunity remains poorly understood [ 18 , 19 , 34 , 35 ]. In this study, we provided five lines of evidence indicating that STRAP exerts a positive regulatory effect on the type I IFN signaling response to PRV infection. Firstly, we observed a significant upregulation of STRAP expression in response to PRV, suggesting a potential crucial role for STRAP during PRV infection. Secondly, we demonstrated that overexpression or silencing of STRAP results in heightened or diminished production of IFN-I triggered by PRV infection, respectively, underscoring the critical role of STRAP in promoting the innate immune response against PRV. Thirdly, we uncovered that STRAP facilitates the IFN-I signaling pathway against PRV infection by targeting the kinase TBK1. Fourthly, we revealed that both CT and WD40 7 − 6 domains contribute to STRAP’s function in the IFN-I signaling pathway. Lastly, we showed that STRAP impairs the ability of the PRV-UL50 to degrade TBK1 expression, thereby promoting the interaction between STRAP and TBK1. Together, these findings establish STRAP as a positive regulatory in IFN-I signaling and highlight its significance in host innate immunity against PRV infection, potentially extending to other viral infections. Notably, previous studies have shown that STRAP positively regulates the TLR-mediated signaling pathway [ 27 ], but negatively regulates the TGF-β signaling pathway [ 21 ]. Here, we identified that STRAP functions as a positive regulator in the IFN-I signaling pathway and participates in host antiviral response against PRV. Again, STRAP exerts its antiviral activity via interacting with TBK1. STRAP has been shown to interacting with PDK1 and p53 to regulate ASK1 and p53 function [ 20 , 25 ]. It has been reported that STRAP directly interacts with Smad proteins and suppresses TGF-β signaling [ 21 ]. Therefore, it is likely that STRAP functionally links TBK1 and ASK1, TGF-β, p53, PI3K and IFN-I signaling pathways. Furthermore, we observed that STRAP is predominantly distributed in the cytoplasm, with only a small proportion in the nucleus (Fig. 1 D). Thus, it can be inferred that STRAP functions in the cytoplasm. WD40 repeat proteins appear to severe regulatory functions in various cellular processes [ 30 ]. The WD40 domains of STRAP play a critical role in mediating protein-to-protein interactions, despite lacking intrinsic enzymatic activity. Our data provides evidence that the WD40 domains of STRAP play a crucial role in the interaction between STRAP with TBK1, as well as in its antiviral response. To investigate the significance of WD40 region, we constructed four truncations of STRAP by selectively deleting one or two WD40 repeats, with or without intervening regions, from the C terminus. In comparison to the wild-type and C-terminal deleted STRAP, four truncates exhibited the lack of interaction with TBK1 and anti-PRV activity. It is plausible that both the CT and WD40 7 − 6 domains of STRAP play a critical role in recruiting other cellular proteins in IFN-I signaling. This regulation is comparable to the synergistic effect of STRAP-Smad7 interaction in the suppression of TGF-β signaling [ 21 ], in line with STRAP’s positive role in regulating the MyD88-dependent TLR2/4 signaling pathway [ 27 ]. However, in contrast to our results, one previous study found that the C-terminal domain is required for its functional activity in TLR3-mediated cytokines production [ 36 ]. In conclusion, our research reveals a previously unidentified role for STRAP in host defense against PRV infection. TBK1, a key kinase for IFN production, undergoes phosphorylation after virus infection, which is a required step for its activation as well as type I IFNs production [ 10 ]. The data presented in this study provide evidence that overexpression of STRAP enhanced TBK1 phosphorylation, and STRAP knockdown leads to a decrease in TBK1 phosphorylation following PRV infection (Fig. 3 E). This supports the crucial involvement of STRAP in TBK1 activation to facilitate the IFN-I signaling. However, the precise mechanism underlying how STRAP regulates the kinase activity of TBK1 requires further investigation. Additionally, the stability of TBK1 is also essential for its function in modulating type I IFN signaling. TBK1 can be degraded through ubiquitin-proteasome pathway by many regulators, such as DTX4, NLRP4, TRIM27, USP38, TRIP and TRAF3IP3 [ 37 – 41 ]. We demonstrated that UL50 encoded by PRV possesses the capability to induce TBK1 degradation through both the proteasome and autophagy pathways. Notably, the TBK1 degradation induced by PRV-UL50 was restored by STRAP overexpression. Thus, STRAP might play essential roles in the maintenance of TBK1 stability. To effectively establish and sustain infection, herpesviruses, including HCMV and HSV-1, have evolved diverse mechanisms to circumvent host antiviral immunity and promote viral infection. However, research on PRV proteins involved in modulation of the cGAS-STING signaling pathway remains scarce compared to other herpesviruses [ 12 , 14 , 15 ]. We found that STRAP can interact with PRV-UL50, a tegument protein encoded by PRV. Additionally, we also identified that UL50 degraded TBK1 expression, thereby impairing the phosphorylation of IRF3, which supports that PRV inhibit the type I IFN signaling to establish persistent infection. Significantly, our findings identified that STRAP exhibits competitive interacting with TBK1, results in the disruption of STRAP-UL50 interaction, and enhances TBK1 stability, subsequent promoting production of IFN-I. These findings not only provide further evidence regarding the regulatory mechanism of STRAP on the IFN-I signaling pathway, but also present a proposed mechanism through which UL50 inhibits IFN-I production. This argument offers a more comprehensive explanation for why STRAP promotes cellular antiviral activity in response to PRV. Based on our findings, we proposed a model elucidating the role of STRAP in antiviral innate immune reposes (Fig. 9 ). STRAP positively regulated PRV-triggered innate immune response. STRAP interacts with TBK1 and impedes the degradation of TBK1 induced by PRV-UL50, resulting in enhanced production of IFN-I and its downstream ISGs, inhibiting PRV replication. The CT and WD40 7 − 6 domains of STRAP are responsible for its function. In conclusion, our study revealed an underlying mechanism of how STRAP positively regulated type I IFN signaling by targeting TBK1, which would contribute to understanding the positive regulation of host innate immune responses and the function of STRAP during PRV infection. Declarations Data availability statement The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation. Acknowledgments We thank Prof. Tang Jun for providing the recombinant PRV UL50-knockout virus (PRV UL50 KO) strain. Author Contributions Wenfeng He, Hongtao Chang and Chen Liu: writing-original draft, data curation, methodology and software; Chenlong Wang: software; Guoqing Yang: conceptualization; Jing Chen: validation; Longxi Li: visualization; Huimin Liu: visualization and editing; Huimin Liu: writing-review and funding acquisition. Availability of data and materials The materials described in the manuscript will be made freely available to any scientist wishing to use them. All the data produced during this study have been included in the manuscript or its supplementary materials. Funding This work was supported by the National Natural Science Foundation of China (31902268) and the Youth Backbone Teachers’ Training Program of Colleges and Universities of Henan Province (2021GGJS034). Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Conflict of Interest The authors have no financial conflicts of interest. References Kong Z, Yin H, Wang F, Liu Z, Luan X, Sun L, Liu W, Shang Y. Pseudorabies virus tegument protein UL13 recruits RNF5 to inhibit STING-mediated antiviral immunity. PLoS Pathog. 2022;18(5):e1010544. Sehl J, Teifke JP. Comparative Pathology of Pseudorabies in Different Naturally and Experimentally Infected Species—A. Rev Pathogens. 2020;9(8):633. Wang D, Tao X, Fei M, Chen J, Guo W, Li P, Wang J. Human encephalitis caused by pseudorabies virus infection: a case report. J Neurovirol. 2020;26(3):442–8. Yang X, Guan H, Li C, Li Y, Wang S, Zhao X, Zhao Y, Liu Y. Characteristics of human encephalitis caused by pseudorabies virus: A case series study. Int J Infect Dis. 2019;87:92–9. Pomeranz LE, Reynolds AE, Hengartner CJ. Molecular Biology of Pseudorabies Virus: Impact on Neurovirology and Veterinary Medicine. Microbiol Mol Biol Rev. 2005;69(3):462–500. Wu J, Chen ZJ. Innate immune sensing and signaling of cytosolic nucleic acids. Annu Rev Immunol. 2014;32:461–88. Hu MM, Shu HB. Cytoplasmic Mechanisms of Recognition and Defense of Microbial Nucleic Acids. Annu Rev Cell Dev Biol. 2018;34:357–79. Yang Q, Shu HB. Chapter One - Deciphering the pathways to antiviral innate immunity and inflammation. In: Advances in Immunology. Volume 145, edn. Edited by Dong C, Jiang Z: Academic Press; 2020: 1–36. Lu B, Ren Y, Sun X, Han C, Wang H, Chen Y, Peng Q, Cheng Y, Cheng X, Zhu Q, et al. Induction of INKIT by Viral Infection Negatively Regulates Antiviral Responses through Inhibiting Phosphorylation of p65 and IRF3. Cell Host Microbe. 2017;22(1):86–e9884. Eaglesham JB, Kranzusch PJ. Conserved strategies for pathogen evasion of cGAS–STING immunity. Curr Opin Immunol. 2020;66:27–34. Zhu H, Zheng C. The Race between Host Antiviral Innate Immunity and the Immune Evasion Strategies of Herpes Simplex Virus 1. Microbiol Mol Biol Rev. 2020;84(4):e00099–00020. Christensen MH, Jensen SB, Miettinen JJ, Luecke S, Prabakaran T, Reinert LS, Mettenleiter T, Chen ZJ, Knipe DM, Sandri-Goldin RM, et al. HSV-1 ICP27 targets the TBK1-activated STING signalsome to inhibit virus-induced type I IFN expression. Embo j. 2016;35(13):1385–99. Su C, Zheng C. Herpes Simplex Virus 1 Abrogates the cGAS/STING-Mediated Cytosolic DNA-Sensing Pathway via Its Virion Host Shutoff Protein, UL41. J Virol 2017, 91(6). You H, Zheng S, Huang Z, Lin Y, Shen Q, Zheng C. Herpes Simplex Virus 1 Tegument Protein UL46 Inhibits TANK-Binding Kinase 1-Mediated Signaling. mBio 2019, 10(3). Fu YZ, Su S, Gao YQ, Wang PP, Huang ZF, Hu MM, Luo WW, Li S, Luo MH, Wang YY, et al. Human Cytomegalovirus Tegument Protein UL82 Inhibits STING-Mediated Signaling to Evade Antiviral Immunity. Cell Host Microbe. 2017;21(2):231–43. Choi HJ, Park A, Kang S, Lee E, Lee TA, Ra EA, Lee J, Lee S, Park B. Human cytomegalovirus-encoded US9 targets MAVS and STING signaling to evade type I interferon immune responses. Nat Commun. 2018;9(1):125. Manoharan R, Seong HA, Ha H. Dual Roles of Serine-Threonine Kinase Receptor-Associated Protein (STRAP) in Redox-Sensitive Signaling Pathways Related to Cancer Development. Oxid Med Cell Longev 2018, 2018:5241524. Kashikar ND, Reiner J, Datta A, Datta PK. Serine threonine receptor-associated protein (STRAP) plays a role in the maintenance of mesenchymal morphology. Cell Signal. 2010;22(1):138–49. Kashikar ND, Zhang W, Massion PP, Gonzalez AL, Datta PK. Role of STRAP in regulating GSK3β function and Notch3 stabilization. Cell Cycle. 2011;10(10):1639–54. Jung H, Seong HA, Manoharan R, Ha H. Serine-threonine kinase receptor-associated protein inhibits apoptosis signal-regulating kinase 1 function through direct interaction. J Biol Chem. 2010;285(1):54–70. Datta PK, Moses HL. STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 2000;20(9):3157–67. Anumanthan G, Halder SK, Friedman DB, Datta PK. Oncogenic serine-threonine kinase receptor-associated protein modulates the function of Ewing sarcoma protein through a novel mechanism. Cancer Res. 2006;66(22):10824–32. Kim CJ, Choi BJ, Song JH, Park YK, Cho YG, Nam SW, Yoo NJ, Lee JY, Park WS. Overexpression of serine-threonine receptor kinase-associated protein in colorectal cancers. Pathol Int. 2007;57(4):178–82. Seong HA, Jung H, Choi HS, Kim KT, Ha H. Regulation of transforming growth factor-beta signaling and PDK1 kinase activity by physical interaction between PDK1 and serine-threonine kinase receptor-associated protein. J Biol Chem. 2005;280(52):42897–908. Jung H, Seong HA, Ha H. NM23-H1 tumor suppressor and its interacting partner STRAP activate p53 function. J Biol Chem. 2007;282(48):35293–307. Yu M, Shi X, Ren M, Liu L, Qi H, Zhang C, Zou J, Qiu X, Zhu WG, Zhang YE et al. SIRT7 Deacetylates STRAP to Regulate p53 Activity and Stability. Int J Mol Sci 2020, 21(11). Huh HD, Ra EA, Lee TA, Kang S, Park A, Lee E, Choi JL, Jang E, Lee JE, Lee S, et al. STRAP Acts as a Scaffolding Protein in Controlling the TLR2/4 Signaling Pathway. Sci Rep. 2016;6:38849. Liu H, Li C, He W, Chen J, Yang G, Chen L, Chang H. Free ISG15 inhibits Pseudorabies virus infection by positively regulating type I IFN signaling. PLoS Pathog. 2022;18(10):e1010921. Brukman A, Enquist LW. Suppression of the Interferon-Mediated Innate Immune Response by Pseudorabies Virus. J Virol. 2006;80(13):6345–56. Neer EJ, Schmidt CJ, Nambudripad R, Smith TF. The ancient regulatory-protein family of WD-repeat proteins. Nature. 1994;371(6495):297–300. Tanaka Y, Chen ZJ. STING Specifies IRF3 Phosphorylation by TBK1 in the Cytosolic DNA Signaling Pathway. Sci Signal. 2012;5(214):ra20–20. Mizushima N, Komatsu M. Autophagy: renovation of cells and tissues. Cell. 2011;147(4):728–41. Zhang R, Xu A, Qin C, Zhang Q, Chen S, Lang Y, Wang M, Li C, Feng W, Zhang R et al. Pseudorabies Virus dUTPase UL50 Induces Lysosomal Degradation of Type I Interferon Receptor 1 and Antagonizes the Alpha Interferon Response. J Virol 2017, 91(21). Yuan G, Zhang B, Yang S, Jin L, Datta A, Bae S, Chen X, Datta PK. Novel role of STRAP in progression and metastasis of colorectal cancer through Wnt/β-catenin signaling. Oncotarget. 2016;7(13):16023–37. Moore KS, Yagci N, van Alphen F, Meijer AB, t Hoen PAC, von Lindern M. Strap associates with Csde1 and affects expression of select Csde1-bound transcripts. PLoS ONE. 2018;13(8):e0201690. Huh HD, Lee E, Shin J, Park B, Lee S. STRAP positively regulates TLR3-triggered signaling pathway. Cell Immunol. 2017;318:55–60. Cui J, Li Y, Zhu L, Liu D, Songyang Z, Wang HY, Wang RF. NLRP4 negatively regulates type I interferon signaling by targeting the kinase TBK1 for degradation via the ubiquitin ligase DTX4. Nat Immunol. 2012;13(4):387–95. Zhang M, Wang L, Zhao X, Zhao K, Meng H, Zhao W, Gao C. TRAF-interacting protein (TRIP) negatively regulates IFN-β production and antiviral response by promoting proteasomal degradation of TANK-binding kinase 1. J Exp Med. 2012;209(10):1703–11. Zheng Q, Hou J, Zhou Y, Yang Y, Xie B, Cao X. Siglec1 suppresses antiviral innate immune response by inducing TBK1 degradation via the ubiquitin ligase TRIM27. Cell Res. 2015;25(10):1121–36. Deng M, Tam JW, Wang L, Liang K, Li S, Zhang L, Guo H, Luo X, Zhang Y, Petrucelli A, et al. TRAF3IP3 negatively regulates cytosolic RNA induced anti-viral signaling by promoting TBK1 K48 ubiquitination. Nat Commun. 2020;11(1):2193. Lin M, Zhao Z, Yang Z, Meng Q, Tan P, Xie W, Qin Y, Wang RF, Cui J. USP38 Inhibits Type I Interferon Signaling by Editing TBK1 Ubiquitination through NLRP4 Signalosome. Mol Cell. 2016;64(2):267–81. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 24 Aug, 2024 Read the published version in Virology Journal → Version 1 posted Editorial decision: Revision requested 03 Jul, 2024 Reviews received at journal 03 Jul, 2024 Reviews received at journal 30 Jun, 2024 Reviewers agreed at journal 29 Jun, 2024 Reviewers agreed at journal 29 Jun, 2024 Reviewers invited by journal 28 Jun, 2024 Editor assigned by journal 27 Jun, 2024 Submission checks completed at journal 27 Jun, 2024 First submitted to journal 26 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4645344","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":322470469,"identity":"f3de1157-ddba-428d-9b1d-746fcef64490","order_by":0,"name":"Wenfeng He","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Wenfeng","middleName":"","lastName":"He","suffix":""},{"id":322470470,"identity":"bf90e6ee-a841-411a-b345-8de6d759dfe9","order_by":1,"name":"Hongtao Chang","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Hongtao","middleName":"","lastName":"Chang","suffix":""},{"id":322470471,"identity":"1b009612-ed5a-4531-8362-70e7eb2a4b6b","order_by":2,"name":"Chen Li","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chen","middleName":"","lastName":"Li","suffix":""},{"id":322470472,"identity":"c857d713-8f4d-493d-8b06-263cc1f6c7f9","order_by":3,"name":"Chenlong Wang","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chenlong","middleName":"","lastName":"Wang","suffix":""},{"id":322470473,"identity":"e62be0c1-fbcb-464b-9189-d713d913a74a","order_by":4,"name":"Longxi Li","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Longxi","middleName":"","lastName":"Li","suffix":""},{"id":322470474,"identity":"580f7610-a0d9-47f1-881b-b12aa2aa493e","order_by":5,"name":"Guoqing Yang","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Guoqing","middleName":"","lastName":"Yang","suffix":""},{"id":322470475,"identity":"1d6ad8a1-4425-47f8-bd6f-63acdadbf7d7","order_by":6,"name":"Jing Chen","email":"","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Chen","suffix":""},{"id":322470476,"identity":"c5effbec-443a-4623-a89b-fe9b4dc1e496","order_by":7,"name":"Huimin Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1klEQVRIiWNgGAWjYBACPmYGNgYGAwYeBvYemFgCfi1scC08Z4jVAkYgIJFDrBZ2HrPHPAXbZMwl3x58XFBzmIGfPceA4ecOfA7jMTfmMbjNYzk7L9l4xrHDDJI9bwwYe8/g1WImDdJicDsHyGA7zGBwI8eAmbGNGC03z5j/5vl3mMGeeC03eMyYeduAtkgQ1MJWJjkHpOVMjrE0b186j8SZZwUHe/Fo4ec/vE3izZ/b9gbHzxh+5vlmLcffnrzxwU88WjAAD4g4QIKGUTAKRsEoGAVYAACfx0FWQwKWfwAAAABJRU5ErkJggg==","orcid":"","institution":"Henan Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Huimin","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-06-27 01:44:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4645344/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4645344/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12985-024-02474-z","type":"published","date":"2024-08-24T15:57:13+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60841409,"identity":"1b626a63-f5ba-42f5-a71d-45b54f0fb047","added_by":"auto","created_at":"2024-07-22 17:23:45","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":286141,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePRV replication induces STRAP upregulation in PK15 cells.\u003c/strong\u003ePK15 and BHK21 cells were infected with PRV or EMCV at indicated different time points (MOI=1). (A) The mRNA and protein levels of STRAP were analyzed using RT-qPCR and Western blotting, respectively. (B) RT-qPCR was employed for examining the STRAP mRNA expression in ECMV-infected PK15 cells. (C) PK15 cells were infected with PRV or UV-PRV (MOI=1) for 24 h, and STRAP and PRV-gE expression levels were detected. (D) Nuclear and cytoplasmic extract from PRV-infected PK15 cells were prepared at the identified times, and STRAP expression levels were analyzed by Western blotting. Means ± SDs are plotted from triplicate experiments. Statistical significance was analyzed by Student's t test with GraphPad Prism 6.0 software. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/d321251568bb435176787e35.jpg"},{"id":60840638,"identity":"87d4fe87-99f3-4614-aeed-a9fcc4762ecf","added_by":"auto","created_at":"2024-07-22 17:15:45","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":450321,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOverexpression of STRAP promotes the innate immune response to PRV infection.\u003c/strong\u003ePK15 cells and BHK21 cells were transfected with plasmids encoding HA, HA-STRAP, NC, or siSTRAP. At 24 hpt, the cells were infected with PRV at a MOI of 1, and the mRNA and protein levels of PRV-gE were analyzed by RT-qPCR and Western blotting, respectively (A and D). Virus titers were measured as viral plaque at 24 hpi (B, E and K). The mRNA and protein levels of IFN-α and IFN-β were examined by RT-qPCR (F and G) and enzyme-linked immunosorbent assays (ELISA) (H, I, L and M). Means ± SDs are plotted from triplicate experiments. Statistical significance was analyzed by Student's t test. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/54dba5e784c94a9dd6d7e9dc.jpg"},{"id":60841410,"identity":"81f01546-b3c4-4929-b9d7-4c75ad8c401b","added_by":"auto","created_at":"2024-07-22 17:23:46","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":414657,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSTRAP promoted type I IFN production by targeting TBK1. \u003c/strong\u003ePK15 cells were transfected with 0.1 μg of IFN-β -Luc, ISRE-Luc, and 0.01 μg of pRL-TK plasmid along with Flag empty vector (EV) or Flag-STRAP expression plasmid. At 24 hpt, the cells were mock-infected or infected with PRV (MOI=1) or transfected with poly (I:C). The promoter activation of IFN-β (A), and NF-κΒ (B) was determined by the dual-luciferase assay kit. (C-D) Luciferase activity of cell lysates transfected for 24 h with IFN-β -Luc or ISRE-Luc plus STING, TBK1 or IRF3 along with STRAP and EV was analyzed. (E) PK15 cells were transfected with EV, HA-STRAP, NC or siSTRAP, and then infected with PRV (MOI=1) for 24 h. Immunoblotting assays were performed with the indicated antibodies. (F) PK15 cells were co-transfected with Myc-STRAP expression plasmid along with HA empty vector, HA-tagged STING, TBK1 and IRF3. Immunoprecipitation and Western blotting were performed with the identified antibodies. Means ± SDs are plotted from triplicate experiments. Statistical significance was analyzed by Student's t test. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/5aa2d514d51de314e6fe3685.jpg"},{"id":60840640,"identity":"2f579a31-cb6d-449b-9ec9-bf87b368e644","added_by":"auto","created_at":"2024-07-22 17:15:45","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":271097,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSTRAP interacts with TBK1. \u003c/strong\u003e(A) PK15 cells were transfected with HA-STRAP expression plasmid along with Myc-tagged empty vector or Myc-TBK1 expression plasmids. The cell lysates were immunoprecipitated with anti-HA antibody and subjected to Western blotting. (B and C) PK15 cells were infected with PRV for 12 h, and the cell lysates were immunoprecipitated with anti-STRAP and anti-IgG or anti-TBK1 antibodies and subjected to Western blotting, and the lysate was immunoprecipitated with IgG as negative control. (D) Schematic illustration of STRAP and its different truncations. (E) PK15 cells were co-transfected with plasmids encoding Myc-TBK1 and full-length HA-STRAP or four STRAP mutants for 12h, and then infected with PRV for 24h. Co-IP and immunoblotting were performed with the indicated antibodies. Means ± SDs are plotted from triplicate experiments. Statistical significance was analyzed by Student's t test with GraphPad Prism 6.0 software. ns, no significance; *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/219a40db8df7f0e1018f4fd4.jpg"},{"id":60840641,"identity":"7cef50e5-34d5-4ef9-9428-653152cf6eda","added_by":"auto","created_at":"2024-07-22 17:15:45","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":455651,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSTRAP-TBK1 interaction promotes cellular antiviral responses. \u003c/strong\u003e(A and B) PK15 cells were transfected with 0.1 μg/well of IFN-β -Luc, 0.01 μg/well of pRL-TK plasmids together with TBK1 or EV with the increasing doses of STRAP expressing plasmid. At 24 hpt, the activity of the IFN-β promoter and mRNA level of IFN-β was evaluated by the dual-luciferase assay kit and RT-qPCR assays, respectively. (C) PK15 cells were co-transfected with TBK1 and plasmids encoding EV, STRAP, or siSTRAP upon PRV infection for 24 h. Immunoprecipitation and Western blotting were performed with the identified antibodies. (D and E) PK15 cells were co-transfected with the indicated plasmids along with Flag-STRAP or si-STRAP for 24 h, followed by PRV infection for 24 h. (F) The mRNA level and protein content of IFN-α and IFN-β in PK15 cells transfected with TBK1, TBK1 and STRAP, or TBK1 and siSTRAP were detected by RT-qPCR and ELISA, respectively. (G) As in panel F, the mRNA levels of ISGs (IFIT1, OAS1, ISG15 and Mx1) were analyzed by RT-qPCR. Means ± SDs are plotted from triplicate experiments. Statistical significance was analyzed by Student's t test with GraphPad Prism 6.0 software. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Fig.5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/90a795ad3b77288f22501c80.jpg"},{"id":60840636,"identity":"b312b698-433a-4e10-9c92-87be312cf53b","added_by":"auto","created_at":"2024-07-22 17:15:45","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":367592,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe CT and WD40 7-6 domain of STRAP are essential for its antiviral activity. \u003c/strong\u003e(A and B) PK15 cells were co-transfected with STRAP and its four truncation mutants, and the mRNA and protein levels of PRV-gE were detected by RT-qPCR and Western blotting, respectively. (C and D) Luciferase activities of IFN-β IFN-β and ISRE were detected by a dual-luciferase assay. (E and F) PK15 cells were transfected with EV, STRAP or its different mutants, and the mRNA levels of ISGs (IFN-β IFN-β , IFIT1, OAS1, Mx1 and ISG15) were detected by RT-qPCR. The data are representative of three independent experiments. *, p \u0026lt; 0.05; **, p \u0026lt; 0.01; ***, p \u0026lt; 0.001; ns, no significant difference by Student's test.\u003c/p\u003e","description":"","filename":"Fig.6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/b27cc23900906b75f2f9849f.jpg"},{"id":60840643,"identity":"09b4838f-8aa8-4af4-bef8-5e3af90831b6","added_by":"auto","created_at":"2024-07-22 17:15:46","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":458929,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePRV-UL50 can induce TBK1 degradation.\u003c/strong\u003e (A) PK15 cells were co-transfected with Myc-STRAP and HA-tag vector, PRV encoded proteins: gE, TK, UL56, UL50, UL24, UL13 or US3. At 24 hpt, the cells were lysed in IP lysis buffer and whole-cell lysis (WCL) were loaded as input. WCLs were incubated with the indicated antibody and protein A+G, and the precipitates were fractionated by SDS-PAGE. Western blotting was performed with the appropriate antibody. (B) The interactions between Myc-UL50 and plasmids encoding full-length STRAP and four STRAP truncation mutants were also analyzed by Western blotting. (C) PK15 cells were infected with either wild-type PRV (PRV WT) or a recombinant PRV UL50-knockout virus (PRV UL50 KO) (MOI=1). At 12 and 18 hpi, the protein expression of total TBK1 and phosphorylated IRF3 were detected by Western blotting. (D and E) PK15 cells were co-transfected with the indicated plasmids for 24 h, infected with PRV, and treated with BafA1 or MG132 for an additional 6 h. Experiments were independently repeated two or three times, with similar results.\u003c/p\u003e","description":"","filename":"Fig.7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/7de7ebe2ac03b1ae633523f6.jpg"},{"id":60840645,"identity":"d898ee9a-9afc-4da2-9e1a-089f6a44f13e","added_by":"auto","created_at":"2024-07-22 17:15:46","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":381308,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSTRAP blocks TBK1 degradation.\u003c/strong\u003e (A and B) PK15 cells were infected with either PRV WT or PRV-UL50 KO (MOI=1) for 24 h, and the interaction of endogenous STRAP and TBK1 was detected by Co-IP. (C and D) PK15 cells were co-transfected with the indicated plasmids with increasing doses of UL50 or TBK1 plasmids for 24 h and infected with PRV (MOI=1). (E) PK15 cells were transfected with the indicated plasmids for 24 h, and then infected with PRV with or without BafA1 for different time points. Immunoblot assay was performed with the indicated antibodies. Experiments were independently repeated two or three times, with similar results.\u003c/p\u003e","description":"","filename":"Fig.8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/10435832bed8b42866cc91a9.jpg"},{"id":60840639,"identity":"2f581084-b434-4201-b64e-48f0c1fd5821","added_by":"auto","created_at":"2024-07-22 17:15:45","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":327862,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic representation of proposed model. \u003c/strong\u003eIn this model, STRAP positively regulates PRV-triggered innate immune response. STRAP interacts with TBK1 to block the binding of PRV-UL50 to STRAP, resulting in enhanced production of type I IFN, which in turn suppresses PRV replication.\u003c/p\u003e","description":"","filename":"Fig.9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/c6e259de78b90cc80fb9906f.jpg"},{"id":63300155,"identity":"bca2ca78-6149-4082-9560-af06ec63bb2d","added_by":"auto","created_at":"2024-08-26 16:11:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4112017,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4645344/v1/f3d1972d-0dc7-4a95-a2b2-3187227df01a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"STRAP positively regulates the antiviral immune response against pseudorabies virus via targeting TBK1","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePseudorabies virus (PRV), also referred as suid herpesvirus 1 or Aujeszky\u0026rsquo;s disease, belongs to the alphaherpesvirus subfamily and infects a wide range of hosts, including its natural host, swine [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. PRV infection in swine can lead to severe disease and substantial economic losses on a global scale [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Recent studies have provided evidence suggesting the possibility of PRV transmission from domestic animals to humans, posing a potential risk to human health [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. PRV is an enveloped virus with a large linear double-strand DNA genome that encodes over 70 functional proteins [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Presently, vaccination is available to prevent PRV infection, but there remains a pressing need to develop novel preventive and therapeutic strategies to effectively combat PRV infection.\u003c/p\u003e \u003cp\u003eThe innate immune system functions as the first line of defense against viral infection when it recognizes pathogen-associated molecular patterns (PAMPs). Pathogen-derived DNA is sensed by cytosolic DNA sensors such as cyclic GAMP synthase (cGAS), which directly binds to DNA and produces cyclic GMP-AMP (cGAMP) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. cGAMP activates the stimulator of interferon gene (STING), which recruits TNAK-binding kinase 1 (TBK1) and promotes the phosphorylation of downstream IFN regulatory factor 3 (IRF3), leading to the expression of type I interferon (IFN) and the downstream antiviral IFN-stimulated genes (ISGs) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. TBK1 is a key adaptor protein that participates in the production of IFN-I to prevent the invasion of pathogenic microorganisms. Accumulating evidence has suggested that the activation of cGAS-STING axis is critical for innate antiviral responses [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. For example, studies have reported that the herpes simplex virus 1 (HSV-1) protein ICP27 interacts with the STING-TBK1 complex to inhibit IRF3 phosphorylation [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], and the tegument protein UL41 and UL46 of HSV-1 directly degrade cGAS mRNA or inhibit TBK1 activation, respectively [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Similarly, the human cytomegalovirus (HCMV) tegument protein UL82 was reported to impair the trafficking of STING and the recruitment of TBK1 or IRF3 to STING [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. HCMV US9 was confirmed to disrupt STING-TBK1 association and block IRF3 nuclear translocation [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Additionally, PRV UL13 functions as an antagonist of IFN signaling via targeting STING to evade host antiviral responses [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Despite these findings, the roles and molecular mechanisms of TBK1-mediated antiviral response against PRV infection remain largely unclear.\u003c/p\u003e \u003cp\u003eSerine-threonine kinase receptor-associated protein (STRAP), as a scaffolding protein, mediates multiple cellular functions including signal transduction, protein transportation, transcription regulation and RNA processing [\u003cspan additionalcitationids=\"CR18 CR19\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Particularly, STRAP inhibits the transforming growth factor-β (TGF-β) signaling via by interacting with decapentaplegic homolog 7 (Smad7) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The inhibitory effect of STRAP on TGF-β signaling contributes to tumorigenesis, which is supported by STRAP overexpression in breast and lung cancer [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In addition, recent studies have indicated that STRAP regulates a variety of signal transduction pathway including TGF-β signaling, PI3K/PDK, ASK1, and p53 pathway, which are involved in the regulation of cell proliferation and apoptosis [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Moreover, STRAP positively regulates TLR-mediated NF-κB signaling as a scaffold protein [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Acetylation of STRAP plays an important role in regulating p53 activity and stability [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. STRAP contains seven WD40-repeat domains, which is involved in activating TLR2/4-mediated cytokine production via facilitating TAK1-IKKα-p65 interactions [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, the involvement of STRAP in host antiviral innate immune response still needs to be investigated.\u003c/p\u003e \u003cp\u003eThis study provides evidence that upregulation of STRAP plays a positive regulatory role in the type I IFN-mediated antiviral response during PRV infection by interacting with TBK1. The STRAP-TBK1 interaction enhances the phosphorylation of IRF3 and production of IFN-I in response to PRV infection. Mechanistically, STRAP possesses the ability to impair the degradation of TBK1 mediated by PRV-UL50, thereby promoting STRAP-TBK1 interaction on IFN-I signaling. Our findings uncovered a novel role of STRAP as a positive regulator of innate immune responses against PRV.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCells, viruses and antibodies\u003c/h2\u003e \u003cp\u003ePK15 and BHK21 cell were cultured in Dulbecco\u0026rsquo;s modified Eagle medium (DMEM) medium supplemented with 10% (vol/vol) fetal bovine serum (FBS) (Gibco), penicillin and streptomycin. PRV strain QXX was preserved in our laboratory, as previously described [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The recombinant PRV UL50-knockout virus (PRV UL50 KO) was kindly donated by Prof. Tang Jun, from Chinese Agricultural University. Viral aliquots were stored at -80 ˚C until use. Mouse β-actin, anti-HA, anti-Myc, and anti-Flag monoclonal antibodies (MAbs) were purchased from Santa Cruz Biotechnology. Rabbit anti-STRAP, anti-IRF3, anti-TBK1, and anti-cGAS, anti-STING polyclonal antibodies (PAbs) were purchased from Proteintech Group Inc. (Shanghai, China). Phospho-TBK1 and phospho-IRF3 (Ser396) were purchased from Cell Signaling Technology (Danvers, MA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eVirus infection and plaque assay\u003c/h2\u003e \u003cp\u003ePRV WT, EMCV or PRV-UL50 KO viruses were propagated and titrated in PK15 cells. To infect, the cells were incubated with PRV or PRV-UL50 KO for 1 h, washed with PBS, and incubated in DMEM supplemented with 5% FBS until the times indicated. PK15 cells were treated with either 10 \u0026micro;M MG132 or 0.2 \u0026micro;M Bafilomycin A1 (BafA1) for 2 h, and then infected with PRV (MO\u0026thinsp;=\u0026thinsp;1) for 24 h.\u003c/p\u003e \u003cp\u003eThe viral yield was determined by tittering in PK15 cells. Briefly, the supernatants of PRV-infected cells were harvested and diluted at 1:10 to 1:109. The supernatants were removed after 1 h and the medium containing 1% agar was overlaid on the cells. At 72 hpi, the cells were fixed for 20 min with 4% formaldehyde, stained with 0.2% crystal violet, and then the plaques in each well were counted. The results were averaged and multiplied by the dilution factor for the calculation of viral titers as PFU/mL.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePlasmid construction\u003c/h2\u003e \u003cp\u003ePRV ORFs were amplified from the PRV genome, and swine STRAP (XM_003355564.4), STING (NM_001142838.1), TBK1(XM_021090852.1), and IRF3 (NM_213770.1) genes were amplified from PK15 cells and then cloned into pCMV-Myc or pCMV-Flag plasmid. Multiple truncation mutants of STRAP were amplified from the templates of full-length STRAP, which were cloned into pCAGGS-HA plasmid. The IFN-β promoter luciferase reporter plasmid and NF-κΒ promoter luciferase reporter plasmids were stored in our lab. All constructed plasmids were analyzed and verified by DNA sequencing. The plasmids were transfected into PK15 cells using Lipofectamine 3000 (Thermo Scientific), according to the manufacture\u0026rsquo;s protocol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and Real-time quantitative PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from BHK21 and PK15 cells using TRIzol reagent (Invitrogen, Carlsbad, CA) and reverse transcribed into cDNA according to the manufacturer\u0026rsquo;s protocol. RT-qPCR was performed using SYBR green real-time PCR Master Mix and ABI QuantStudio 7 qPCR System. The β-actin gene was used as an internal control. The relative expression of mRNA was calculated using the comparative cycle threshold (CT) (2-ΔΔCT) method. The qPCR primers sequences are as follows: swine PRV-gE-F: GACACGTTCGACCTGATGCC, R: TGGTAGATGCAGGGCTCGTA; swine STRAP-F: TGCTACGCCAGGGAGATACA, R: CAGCATCCCATACTTTGGCTG T; swine IFNα-F: CACCTCAGCCAGGACAGAAGC, R: ATGAGGGGATCCAAAGTC\u003c/p\u003e \u003cp\u003eCCT; swine IFN-β β-F: TGATGGGCAGATGGATGACC, R: AGGCACAGCTTCTGT\u003c/p\u003e \u003cp\u003eACTCC; swine Mx1-F: GTCATCGGGGACCAGAGTTC, R: TCCCGGTAACTGAC\u003c/p\u003e \u003cp\u003eTTTGCC; swine OAS1-F: GTTTCCGAACGCAGGTCAAG, R: GGAAGACGACGA\u003c/p\u003e \u003cp\u003eGGTCAGCATC; swine IFIT1-F: GACTCACAGCAACCATGAGTAATA, R: CCTCATTCTGGCCTTTCAGGT; swine ISG15-F: GGTGAGGAACGACAAGGGT\u003c/p\u003e \u003cp\u003eC, R: GGCTTGAGGTCATACTCCCC; swine β-actin-F: TGGAACGGTGAAGGTGA\u003c/p\u003e \u003cp\u003eCAG, R: CTTTTGGGAAGGCAGGGACT.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCoimmunoprecipitation (Co-IP) and Western blotting\u003c/h2\u003e \u003cp\u003ePK15 cells were transfected with various indicated expressing plasmids. The cells were collected and lysed at the indicated time points with lysis buffer supplemented with a protease inhibitor cocktail. Then, the cell lysates were immunoprecipitated with the indicated antibodies, coimmunoprecipitation samples were subjected to SDS-PAGE and then transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were blocked with 5% skim milk power in TBST for 2 h at room temperature (RT), and then incubated with indicated primary antibodies for 6\u0026ndash;8 h at 4 ˚C. After washing three times with TBST, membranes were incubated with horseradish peroxidase (HRP)-labeled goat anti-mouse IgG or anti-rabbit antibody for 1 h at RT. The antibody-antigen complexes were visualized using chemiluminescence detection reagents (Thermo Fisher Scientific).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eKnockdown of STRAP using siRNA\u003c/h2\u003e \u003cp\u003eThe small interfering RNAs (siRNAs) used in this study were designed and synthesized by Tsingke Biological Technology (Wuhan, China). Knockdown of endogenous STRAP in PK15 cells were performed by transfection of STRAP siRNA, and NC siRNA was used as a negative control. According to the manufacture\u0026rsquo;s protocol, the siRNA transfection was performed using Lipofectamine 3000. The swine STRAP siRNA sequence is GCACUUCCCACCUGAUAA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eLuciferase reporter assay\u003c/h2\u003e \u003cp\u003ePK15 cells were seeded in 24-well plates, and the monolayer cells were co-transfected with IFN-β -Luc, ISRE-Luc, or NF-κΒ-Luc along with pRL-TK Renilla luciferase reporter plasmid and other plasmids. Twenty-four hours later, the cells lysates were analyzed for firefly and Renilla luciferase activities using the Dual Luciferase Reporter Assay Kit (Promega) following the manufactures directions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eELISA\u003c/h2\u003e \u003cp\u003eThe expression of IFN-α and IFN-β protein in the PRV-infected cells supernatant were analyzed using porcine IFN-α and IFN-β ELISA kits (Solarbio). The measured value was compared with the standard following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eNuclear and cytoplasmic extraction\u003c/h2\u003e \u003cp\u003ePK15 cells were transfected with different plasmids and subsequently infected with PRV (MOI\u0026thinsp;=\u0026thinsp;1). The cells were harvested, and subcellular fractions were isolated using a nuclear and cytoplasm extraction kit (Thermo Fisher Scientific) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis was conducted using the GraphPad Prism software to perform by Student\u0026rsquo;s t test or analysis of variance (ANOVA) on at least three independent replicates. A significance level of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was employed to determine statistically significance for each test. Data are shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) of at least three independent experiments.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePRV infection upregulates STRAP\u003c/h2\u003e \u003cp\u003eTo explore the function of STRAP in PRV infection, we first examined whether PRV infection affects STRAP expression in cells, including PK15 and BHK21 cells. We found that an increase in both mRNA and protein levels of STRAP in PRV-infected cells, as compared to uninfected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). This suggests that PRV infection led to an increase of endogenous STRAP in both PK15 and BHK21 cells. However, an RNA virus (encephalomyocarditis virus, EMCV) failed to induce STRAP mRNA expression in PK15 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we sought to evaluate whether endogenous STRAP is required for PRV replication. PK15 cells were infected with ultraviolet-inactivated PRV (UV-PRV) or PRV at a MOI of 1 for 24 h. Notably, UV-PRV infection did not elicit STRAP expression in PK15 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), suggesting that the failure of STRAP induction was possibly due to the inability of PRV gene expression. We previously found that UV inactivation prevents PRV gene expression after viral entry [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], thus, it is possible that the STRAP upregulation is attributed to PRV infection and viral gene expression. Furthermore, it was observed that STRAP predominantly localized in the cytoplasm, whereas PRV infection promoted an accumulation of STRAP in both the cytoplasm and nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Thus, we inferred that STRAP mainly exerts its function in the cytoplasm. In general, these findings provide evidence that PRV infection induces an upregulation of STRAP expression in host cells, suggesting that STRAP plays an important role during PRV infection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eSTRAP can suppress PRV replication\u003c/h2\u003e \u003cp\u003eGiven that STRAP\u0026rsquo;s role in PRV infection, we further examined whether the STRAP affects PRV replication in vitro. We transfected STRAP plasmids (HA-STRAP) into PK15 cells. After transfection for 24h, PRV was infected into cells PRV at a MOI of 1. We gathered infected cell culture supernatants and cell at indicated time points and measured PRV viral titers and PRV gE expression. When STRAP was overexpressed, we observed reduced PRV-gE mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Consistent result was observed for the viral titers in the supernatants of PRV-infected cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Simultaneously, we designed siRNAs targeting STRAP, transfected the STRAP siRNA into PK15 cells, and detected that the interference efficiency of STRAP siRNA reached about 91% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). As anticipated, silencing of STRAP obviously promoted PRV replication in PK15 cells (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). These data indicated that STRAP restricted PRV replication in vitro.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eType I IFN (IFN-I) plays a critical role in inducing an antiviral state and controlling viral infection [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Accordingly, we determined whether STRAP inhibition of PRV replication was due to IFN-I response, we assessed the effects of STRAP on IFN-I production in response to PRV infection. The mRNA expression and protein secretion of IFN-I were markedly enhanced when STRAP was overexpressed, but they are reduced by STRAP knockdown (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF to \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI). STRAP thus appears to play a crucial role in promoting IFN-I production induced by PRV. To rule out the possibility of cell specificity, we performed the above-described experiments in BHK21 cells and obtained similar results (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ to \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eM). Collectively, these data presented provide evidence that STRAP plays a promoting role in IFN-I production triggered by PRV and exhibits antiviral activity.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eTBK1 is a potential target of the STRAP\u003c/h2\u003e \u003cp\u003eHaving known that STRAP expression promotes PRV-triggered type I IFN production, we speculate that STRAP targets one or several components of the type I IFN signaling pathway. To identify the potential candidate target regulated by STRAP, we firstly analyzed the PRV-induced activation of IFN-β and NF-κΒ promoter. Overexpression of STRAP enhanced PRV-induced activation of IFN-β promoter but not NF-κΒ (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). To further test whether STRAP leads to the induction of the IFN-I response through the STING-TBK1-IRF3 pathway, PK15 cells were co-transfected with Flag-STRAP expression plasmid and plasmids expressing each component of the innate immune signaling pathway (including cGAS, STING, TBK1 and IRF3), together with IFN-β -Luc or ISRE-Luc and pRL-TK plasmids. The activities of IFN-β and ISRE promoters were determined by the Dual-Luciferase Reporter Assay system. The results showed that STRAP overexpression remarkedly enhanced the activation of IFN-β and ISRE promoters induced by all of these molecules, except for IRF3 (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and D). The results of Western blotting indicated that both TBK1 and IRF3 phosphorylation were obviously augmented in STRAP-overexpressed PK15 cells, while attenuated in STRAP-silenced cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Conversely, no changes in protein expression of cGAS, STING, and the downstream effectors total TBK1 and IRF3 were observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Meanwhile, our data showed that STRAP did not interact with STING or IRF3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Hence, it was hypothesized that STRAP might target TBK1 to enhance the production of type I IFN.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eSTRAP interacts with TBK1\u003c/h2\u003e \u003cp\u003eTo elucidate how STRAP promoted IFN-I production via TBK1, we next explored possible interaction between STRAP and TBK1. PK15 cells were transfected with Myc empty vector, Myc-TBK1 expression plasmids with or without HA-STRAP expression plasmid. After 24 hours transfection, cells were infected with PRV for 24 hours, and cell lysates were immunoprecipitated with anti-HA antibody and subjected to SDS-PAGE. HA-STRAP pulled down Myc-TBK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). To confirm the endogenous interaction between STRAP and TBK1, PK15 cells were infected with PRV, and the cell lysates were immunoprecipitated with anti-TBK1 and anti-IgG antibodies and subjected to Western blotting. The results showed that endogenous STRAP pulled down TBK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), and endogenous TBK1 also pulled down STRAP in PK15 cell lysates (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). These results support our observation that STRAP targets and interacts with TBK1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe next addressed which domain of STRAP is essential for its interaction with TBK1. STRAP is composed of 350 amino acids (aa) and contains seven WD40-repeat domains, which are believed to stabilize their structure and serve regulatory functions in various cellular process [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. We constructed four plasmids expressing various truncated fragments of STRAP: STRAP ΔCT (1-293aa), STRAPΔ7\u0026thinsp;\u0026minus;\u0026thinsp;6 (1-221aa), STRAPΔ5\u0026thinsp;\u0026minus;\u0026thinsp;4 (1-141aa), STRAPΔ3 (1-103aa) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). PK15 cells were transfected with Myc-tagged TBK1 together with HA empty vector, HA-STRAP, HA-STRAP mutants expression plasmids. The cell lysates were precipitated with anti-Myc antibody, and the precipitates were probed for HA antibody. The results show that the ability of STRAP to bind TBK1 was clearly impaired by the deletion of its C-terminal (CT) region, while the deletion of CT and 6\u0026ndash;7 domains lost the ability to interact with TBK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). These findings suggested that both the CT and WD40 6\u0026ndash;7 domains of STRAP are critical for its binding to TBK1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eSTRAP potentiates antiviral immunity via interacting with TBK1\u003c/h2\u003e \u003cp\u003eThe above data provide evidence that STRAP overexpression facilitates the phosphorylation of IRF3 upon PRV infection. To detect the effect of STRAP-TBK1 interaction on IFN-I production and signaling, we performed an IFN-β -luc reporter assay in STRAP-overexpressing PK15 cells. IFN-β promoter activation was enhanced upon the exogenous expression of STRAP in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). To further confirm the promotion effect of STRAP on IFN-β induction, the transcription of IFN-β was measured by RT-qPCR upon PRV infection. Consistent with the IFN-β reporter assay, STRAP-TBK1 binding also facilitated IFN-β mRNA level (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Furthermore, STRAP-TBK1 interaction potentiated IRF3 activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). These data suggested that STRAP promotes the type I IFN signaling via targeting with TBK1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe STING-TBK1-IRF3 pathway is critical for IFN-I production, and activated STING recruits the kinase TBK1 to stimulate the phosphorylation of IRF3 [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. To assess the effect of STRAP on the STING-TBK1-IRF3 complex, PK15 cells were transfected with plasmids expressing STING, TBK1 and IRF3 along with Flag-STRAP or siSTRAP. We found that STRAP overexpression enhanced the formation of TBK1-IRF3 dimers (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD) and STING-TBK1-IRF3 trimeric complex (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), while STRAP knockdown disrupted the formation of complexes (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD and E). Additionally, we examined the effect of the STRAP-TBK1 interaction on the transcription of IFN-I and downstream antiviral genes, such as IFIT1, OAS1, ISG15 and Mx1. As shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG, the interaction of exogenous TBK1 and STRAP significantly augmented the production of IFN-I and transcription of downstream antiviral genes induced by PRV infection, while a noticeable reduction was observed when TBK1 and siSTRAP interaction was compared with TBK1-transfected group. Taken together, these data indicated that STRAP acts as a scaffold protein and facilitates the recruitment of STING, TBK1 and IRF3, leading to the activation of type I IFN signaling pathway.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eBoth CT and WD40 7\u0026thinsp;\u0026minus;\u0026thinsp;6 domains contribute to STRAP\u0026rsquo;s antiviral activity\u003c/h2\u003e \u003cp\u003eAs mentioned above, the CT and WD40 7\u0026thinsp;\u0026minus;\u0026thinsp;6 domains of STRAP are important for the interaction between STRAP and TBK1. Consistent with this result, the inhibition effect of the CT deletion mutant on PRV replication was impaired, but the different WD40 truncations of STRAP completely lost the ability to inhibit PRV replication (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA and \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Our above data demonstrated that STRAP exerts its antiviral role by positively regulating the IFN-I signaling pathway. Thus, we further investigated the effect of different truncations of STRAP on the IFN-β induction and relative IFN-stimulated genes (ISGs) expression. Data are illustrated in Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC to \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF, the luciferase activities of IFN-β and ISRE did not exhibit obvious changes in PK15 cells overexpressing different STRAP truncated mutants compared to cells transfected with the empty vector (EV). Moreover, the mRNA levels of relevant ISGs in different truncations of STRAP were normalized to those in EV-transfected PK15 cells. Inconsistent with a previous report [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], these observations indicated that both the CT and WD40 7\u0026thinsp;\u0026minus;\u0026thinsp;6 domains of STRAP are necessary for its antiviral activity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003ePRV-UL50 can interact with STRAP and induce TBK1 degradation\u003c/h2\u003e \u003cp\u003eTo further explore the mechanism through which STRAP hinders PRV replication, we analyzed whether STRAP inhibits PRV replication by regulating the PRV tegument proteins (UL56, UL50, UL24, UL13, US3), PRV glycoprotein E (PRV-gE), and PRV thymidine kinase (PRV-TK) proteins. A co-IP assay was performed using indicated antibodies in PK15 cells subjected to specific plasmid and Myc-STRAP plasmid cotransfection. The result revealed that PRV-UL50 was precipitated using Myc-STRAP (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), indicating that PRV-UL50 protein shows direct interaction with STRAP. Furthermore, the CT and WD40 7\u0026thinsp;\u0026minus;\u0026thinsp;6 domains of STRAP are required for its interaction with PRV-UL50 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eConsidering that STRAP exerts antiviral activity against PRV via interacting with TBK1, we next examined the effect of PRV-UL50 on TBK1 expression. PK15 cells were infected with wild type PRV (PRV-WT) and PRV UL50-knockout virus (PRV-UL50 KO), and endogenous TBK1 and phosphorylated IRF3 were analyzed. Western blot analysis revealed that the UL50 knockout led to increased TBK1 expression and subsequently enhanced the level of IRF3 phosphorylation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC), indicating that PRV-UL50 could induce TBK1 degradation. Protein degradation in eukaryotic cells is mediated by two major pathways: ubiquitin-proteasome and autolysosome pathways [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. To further explore the mechanism by which PRV-UL50 affected the stability of TBK1, PK15 cells were co-transfected with HA-UL50 plasmid for 24 h and treated with various inhibitors of the protein degradation pathway. The results demonstrated that TBK1 expression was significantly decreased by ectopic expression of PRV- UL50 (lane 1 and lane 2, Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD-E), consistent with the result in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC. Furthermore, no significant difference is observed in UL50-untransfected group without inhibitors, compared with UL50-transfected group with inhibitors (lane 1 and lane 4, Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD-E). Notably, ectopic expression of UL50 resulted in a partial restoration of TBK1 expression following inhibitor treatment, in comparison to the UL50-untransfected group. These data suggest that TBK1 degradation is partially, not totally dependent on PRV-UL50.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eSTRAP impairs TBK1 degradation induced by PRV-UL50\u003c/h2\u003e \u003cp\u003eBased on our aforementioned findings, we hypothesized that there might exist a competitive binding of TBK1 and PRV-UL50 to STRAP. To confirm the role of PRV-UL50 on the interaction between STRAP and TBK1, the endogenous STRAP-TBK1 interactions between in PRV WT and UL50 KO-infected PK15 cells were analyzed. Co-IP results demonstrated that PRV UL50 deficiency markedly promoted the STRAP-TBK1 interaction (Figs.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA-B), indicating that STRAP can competitively interact with TBK1 and PRV-UL50. Next, we sought to determine whether STRAP-TBK1 interaction affects the binding of STRAP and PRV-UL50. PK15 cells were co-transfected with Myc-TBK1 and Flag-STRAP, together with increasing doses of HA-UL50. The immunoblot results showed that the expression of TBK1 was gradually decreased accompanied by the increased amount of PRV-UL50, while no change was observed in STRAP expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). This suggests that the binding of STRAP and UL50 inhibits the STRAP-TBK1 interaction. To further validate this, PK15 cells were co-transfected with HA-UL50 and Flag-STRAP, along with increasing doses of TBK1. This result further confirmed that the STRAP-TBK1 interaction hindered the interaction between STRAP and UL50 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). Together, these findings provided support for the hypothesis that TBK1 and PRV-UL50 may competitively interact with STRAP.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSince we found that STRAP exerted its anti-PRV activity by promoting IFN-I production, while PRV-UL50 can inhibit IFN-I signaling pathway [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Therefore, we postulate that the STRAP-TBK1 interaction may potentially hinder the interaction of STRAP and PRV-UL50, thereby impairing the inhibition effect of UL50 on the IFN-I response. To validate this hypothesis, PK15 cells were transfected with Flag-STRAP and HA-UL50 plasmids in the presence or absence of BafA1 or MG132, and the levels of endogenous TBK1 protein were assessed. Notably, STRAP overexpression partially restored the inhibition of TBK1 (lanes 1 and 2 to 5 and 6, Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). Significantly, the UL50-induced degradation of TBK1 was restored the accumulation by overexpression of STRAP mainly via Baf A1 treatment, but not MG132 (lanes 3 and 4 to lane 7 and 8, Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). These data demonstrated that STRAP could block TBK1 degradation induced by PRV-UL50, partially via the autophagy pathway. This was further confirmed in PK15 cells with Baf A1 treatment at different time points (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). However, this mechanism needs to be investigated in further detail.\u003c/p\u003e \u003cp\u003eBased on these observations, we propose that STRAP, as a scaffold protein, prevents the TBK1 degradation induced by UL50 to enhance the STRAP-TBK1 interaction, thereby promoting the type I IFN-mediated antiviral activity.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe cGAS-mediated innate immune response forms the first line of defense that protect hosts from invasion by DNA viruses. After virus infection, the IFN-β signaling pathway is activated to induce IFN-β and ISGs expression, thereby initiating the appropriate adaptive immune response. Investigating the mechanisms underlying the innate immune response holds great potential for bettering disease control and designing effective vaccines. In the present study, we first investigated the roles of STRAP in type I IFN-mediated innate immunity response against PRV. The overexpression of STRAP exhibited a notable inhibition effect on the activation of IFN-β promoter and IFN-β induction in response to PRV, whereas STRAP knockdown had the opposite effects. This finding establishes a critical role for STRAP in the innate immune response.\u003c/p\u003e \u003cp\u003eWhile much is known about STRAP as a scaffold protein implicated in diverse cellular functions, its involvement in the regulation of innate immunity remains poorly understood [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In this study, we provided five lines of evidence indicating that STRAP exerts a positive regulatory effect on the type I IFN signaling response to PRV infection. Firstly, we observed a significant upregulation of STRAP expression in response to PRV, suggesting a potential crucial role for STRAP during PRV infection. Secondly, we demonstrated that overexpression or silencing of STRAP results in heightened or diminished production of IFN-I triggered by PRV infection, respectively, underscoring the critical role of STRAP in promoting the innate immune response against PRV. Thirdly, we uncovered that STRAP facilitates the IFN-I signaling pathway against PRV infection by targeting the kinase TBK1. Fourthly, we revealed that both CT and WD40 7\u0026thinsp;\u0026minus;\u0026thinsp;6 domains contribute to STRAP\u0026rsquo;s function in the IFN-I signaling pathway. Lastly, we showed that STRAP impairs the ability of the PRV-UL50 to degrade TBK1 expression, thereby promoting the interaction between STRAP and TBK1. Together, these findings establish STRAP as a positive regulatory in IFN-I signaling and highlight its significance in host innate immunity against PRV infection, potentially extending to other viral infections.\u003c/p\u003e \u003cp\u003eNotably, previous studies have shown that STRAP positively regulates the TLR-mediated signaling pathway [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], but negatively regulates the TGF-β signaling pathway [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Here, we identified that STRAP functions as a positive regulator in the IFN-I signaling pathway and participates in host antiviral response against PRV. Again, STRAP exerts its antiviral activity via interacting with TBK1. STRAP has been shown to interacting with PDK1 and p53 to regulate ASK1 and p53 function [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. It has been reported that STRAP directly interacts with Smad proteins and suppresses TGF-β signaling [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Therefore, it is likely that STRAP functionally links TBK1 and ASK1, TGF-β, p53, PI3K and IFN-I signaling pathways. Furthermore, we observed that STRAP is predominantly distributed in the cytoplasm, with only a small proportion in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Thus, it can be inferred that STRAP functions in the cytoplasm.\u003c/p\u003e \u003cp\u003eWD40 repeat proteins appear to severe regulatory functions in various cellular processes [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The WD40 domains of STRAP play a critical role in mediating protein-to-protein interactions, despite lacking intrinsic enzymatic activity. Our data provides evidence that the WD40 domains of STRAP play a crucial role in the interaction between STRAP with TBK1, as well as in its antiviral response. To investigate the significance of WD40 region, we constructed four truncations of STRAP by selectively deleting one or two WD40 repeats, with or without intervening regions, from the C terminus. In comparison to the wild-type and C-terminal deleted STRAP, four truncates exhibited the lack of interaction with TBK1 and anti-PRV activity. It is plausible that both the CT and WD40 7\u0026thinsp;\u0026minus;\u0026thinsp;6 domains of STRAP play a critical role in recruiting other cellular proteins in IFN-I signaling. This regulation is comparable to the synergistic effect of STRAP-Smad7 interaction in the suppression of TGF-β signaling [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], in line with STRAP\u0026rsquo;s positive role in regulating the MyD88-dependent TLR2/4 signaling pathway [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, in contrast to our results, one previous study found that the C-terminal domain is required for its functional activity in TLR3-mediated cytokines production [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In conclusion, our research reveals a previously unidentified role for STRAP in host defense against PRV infection.\u003c/p\u003e \u003cp\u003eTBK1, a key kinase for IFN production, undergoes phosphorylation after virus infection, which is a required step for its activation as well as type I IFNs production [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The data presented in this study provide evidence that overexpression of STRAP enhanced TBK1 phosphorylation, and STRAP knockdown leads to a decrease in TBK1 phosphorylation following PRV infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). This supports the crucial involvement of STRAP in TBK1 activation to facilitate the IFN-I signaling. However, the precise mechanism underlying how STRAP regulates the kinase activity of TBK1 requires further investigation. Additionally, the stability of TBK1 is also essential for its function in modulating type I IFN signaling. TBK1 can be degraded through ubiquitin-proteasome pathway by many regulators, such as DTX4, NLRP4, TRIM27, USP38, TRIP and TRAF3IP3 [\u003cspan additionalcitationids=\"CR38 CR39 CR40\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. We demonstrated that UL50 encoded by PRV possesses the capability to induce TBK1 degradation through both the proteasome and autophagy pathways. Notably, the TBK1 degradation induced by PRV-UL50 was restored by STRAP overexpression. Thus, STRAP might play essential roles in the maintenance of TBK1 stability.\u003c/p\u003e \u003cp\u003eTo effectively establish and sustain infection, herpesviruses, including HCMV and HSV-1, have evolved diverse mechanisms to circumvent host antiviral immunity and promote viral infection. However, research on PRV proteins involved in modulation of the cGAS-STING signaling pathway remains scarce compared to other herpesviruses [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. We found that STRAP can interact with PRV-UL50, a tegument protein encoded by PRV. Additionally, we also identified that UL50 degraded TBK1 expression, thereby impairing the phosphorylation of IRF3, which supports that PRV inhibit the type I IFN signaling to establish persistent infection. Significantly, our findings identified that STRAP exhibits competitive interacting with TBK1, results in the disruption of STRAP-UL50 interaction, and enhances TBK1 stability, subsequent promoting production of IFN-I. These findings not only provide further evidence regarding the regulatory mechanism of STRAP on the IFN-I signaling pathway, but also present a proposed mechanism through which UL50 inhibits IFN-I production. This argument offers a more comprehensive explanation for why STRAP promotes cellular antiviral activity in response to PRV.\u003c/p\u003e \u003cp\u003eBased on our findings, we proposed a model elucidating the role of STRAP in antiviral innate immune reposes (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). STRAP positively regulated PRV-triggered innate immune response. STRAP interacts with TBK1 and impedes the degradation of TBK1 induced by PRV-UL50, resulting in enhanced production of IFN-I and its downstream ISGs, inhibiting PRV replication. The CT and WD40 7\u0026thinsp;\u0026minus;\u0026thinsp;6 domains of STRAP are responsible for its function. In conclusion, our study revealed an underlying mechanism of how STRAP positively regulated type I IFN signaling by targeting TBK1, which would contribute to understanding the positive regulation of host innate immune responses and the function of STRAP during PRV infection.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Prof. Tang Jun for providing the recombinant PRV UL50-knockout virus (PRV UL50 KO) strain.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWenfeng He, Hongtao Chang and Chen Liu: writing-original draft, data curation, methodology and software; Chenlong Wang: software; Guoqing Yang: conceptualization; Jing Chen: validation; Longxi Li: visualization; Huimin Liu: visualization and editing; Huimin Liu: writing-review and funding acquisition.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe materials described in the manuscript will be made freely available to any scientist wishing to use them. All the data produced during this study have been included in the manuscript or its supplementary materials.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (31902268) and the Youth Backbone Teachers\u0026rsquo; Training Program of Colleges and Universities of Henan Province (2021GGJS034).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no financial conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKong Z, Yin H, Wang F, Liu Z, Luan X, Sun L, Liu W, Shang Y. Pseudorabies virus tegument protein UL13 recruits RNF5 to inhibit STING-mediated antiviral immunity. PLoS Pathog. 2022;18(5):e1010544.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSehl J, Teifke JP. Comparative Pathology of Pseudorabies in Different Naturally and Experimentally Infected Species\u0026mdash;A. Rev Pathogens. 2020;9(8):633.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang D, Tao X, Fei M, Chen J, Guo W, Li P, Wang J. Human encephalitis caused by pseudorabies virus infection: a case report. J Neurovirol. 2020;26(3):442\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang X, Guan H, Li C, Li Y, Wang S, Zhao X, Zhao Y, Liu Y. Characteristics of human encephalitis caused by pseudorabies virus: A case series study. Int J Infect Dis. 2019;87:92\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePomeranz LE, Reynolds AE, Hengartner CJ. Molecular Biology of Pseudorabies Virus: Impact on Neurovirology and Veterinary Medicine. Microbiol Mol Biol Rev. 2005;69(3):462\u0026ndash;500.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu J, Chen ZJ. Innate immune sensing and signaling of cytosolic nucleic acids. Annu Rev Immunol. 2014;32:461\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu MM, Shu HB. Cytoplasmic Mechanisms of Recognition and Defense of Microbial Nucleic Acids. Annu Rev Cell Dev Biol. 2018;34:357\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang Q, Shu HB. Chapter One - Deciphering the pathways to antiviral innate immunity and inflammation. In: Advances in Immunology. Volume 145, edn. Edited by Dong C, Jiang Z: Academic Press; 2020: 1\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu B, Ren Y, Sun X, Han C, Wang H, Chen Y, Peng Q, Cheng Y, Cheng X, Zhu Q, et al. Induction of INKIT by Viral Infection Negatively Regulates Antiviral Responses through Inhibiting Phosphorylation of p65 and IRF3. Cell Host Microbe. 2017;22(1):86\u0026ndash;e9884.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEaglesham JB, Kranzusch PJ. Conserved strategies for pathogen evasion of cGAS\u0026ndash;STING immunity. Curr Opin Immunol. 2020;66:27\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu H, Zheng C. The Race between Host Antiviral Innate Immunity and the Immune Evasion Strategies of Herpes Simplex Virus 1. Microbiol Mol Biol Rev. 2020;84(4):e00099\u0026ndash;00020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChristensen MH, Jensen SB, Miettinen JJ, Luecke S, Prabakaran T, Reinert LS, Mettenleiter T, Chen ZJ, Knipe DM, Sandri-Goldin RM, et al. HSV-1 ICP27 targets the TBK1-activated STING signalsome to inhibit virus-induced type I IFN expression. Embo j. 2016;35(13):1385\u0026ndash;99.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu C, Zheng C. Herpes Simplex Virus 1 Abrogates the cGAS/STING-Mediated Cytosolic DNA-Sensing Pathway via Its Virion Host Shutoff Protein, UL41. J Virol 2017, 91(6).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYou H, Zheng S, Huang Z, Lin Y, Shen Q, Zheng C. Herpes Simplex Virus 1 Tegument Protein UL46 Inhibits TANK-Binding Kinase 1-Mediated Signaling. mBio 2019, 10(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu YZ, Su S, Gao YQ, Wang PP, Huang ZF, Hu MM, Luo WW, Li S, Luo MH, Wang YY, et al. Human Cytomegalovirus Tegument Protein UL82 Inhibits STING-Mediated Signaling to Evade Antiviral Immunity. Cell Host Microbe. 2017;21(2):231\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi HJ, Park A, Kang S, Lee E, Lee TA, Ra EA, Lee J, Lee S, Park B. Human cytomegalovirus-encoded US9 targets MAVS and STING signaling to evade type I interferon immune responses. Nat Commun. 2018;9(1):125.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManoharan R, Seong HA, Ha H. Dual Roles of Serine-Threonine Kinase Receptor-Associated Protein (STRAP) in Redox-Sensitive Signaling Pathways Related to Cancer Development. Oxid Med Cell Longev 2018, 2018:5241524.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKashikar ND, Reiner J, Datta A, Datta PK. Serine threonine receptor-associated protein (STRAP) plays a role in the maintenance of mesenchymal morphology. Cell Signal. 2010;22(1):138\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKashikar ND, Zhang W, Massion PP, Gonzalez AL, Datta PK. Role of STRAP in regulating GSK3β function and Notch3 stabilization. Cell Cycle. 2011;10(10):1639\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung H, Seong HA, Manoharan R, Ha H. Serine-threonine kinase receptor-associated protein inhibits apoptosis signal-regulating kinase 1 function through direct interaction. J Biol Chem. 2010;285(1):54\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDatta PK, Moses HL. STRAP and Smad7 synergize in the inhibition of transforming growth factor beta signaling. Mol Cell Biol. 2000;20(9):3157\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnumanthan G, Halder SK, Friedman DB, Datta PK. Oncogenic serine-threonine kinase receptor-associated protein modulates the function of Ewing sarcoma protein through a novel mechanism. Cancer Res. 2006;66(22):10824\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim CJ, Choi BJ, Song JH, Park YK, Cho YG, Nam SW, Yoo NJ, Lee JY, Park WS. Overexpression of serine-threonine receptor kinase-associated protein in colorectal cancers. Pathol Int. 2007;57(4):178\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeong HA, Jung H, Choi HS, Kim KT, Ha H. Regulation of transforming growth factor-beta signaling and PDK1 kinase activity by physical interaction between PDK1 and serine-threonine kinase receptor-associated protein. J Biol Chem. 2005;280(52):42897\u0026ndash;908.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJung H, Seong HA, Ha H. NM23-H1 tumor suppressor and its interacting partner STRAP activate p53 function. J Biol Chem. 2007;282(48):35293\u0026ndash;307.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu M, Shi X, Ren M, Liu L, Qi H, Zhang C, Zou J, Qiu X, Zhu WG, Zhang YE et al. SIRT7 Deacetylates STRAP to Regulate p53 Activity and Stability. Int J Mol Sci 2020, 21(11).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuh HD, Ra EA, Lee TA, Kang S, Park A, Lee E, Choi JL, Jang E, Lee JE, Lee S, et al. STRAP Acts as a Scaffolding Protein in Controlling the TLR2/4 Signaling Pathway. Sci Rep. 2016;6:38849.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu H, Li C, He W, Chen J, Yang G, Chen L, Chang H. Free ISG15 inhibits Pseudorabies virus infection by positively regulating type I IFN signaling. PLoS Pathog. 2022;18(10):e1010921.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrukman A, Enquist LW. Suppression of the Interferon-Mediated Innate Immune Response by Pseudorabies Virus. J Virol. 2006;80(13):6345\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeer EJ, Schmidt CJ, Nambudripad R, Smith TF. The ancient regulatory-protein family of WD-repeat proteins. Nature. 1994;371(6495):297\u0026ndash;300.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka Y, Chen ZJ. STING Specifies IRF3 Phosphorylation by TBK1 in the Cytosolic DNA Signaling Pathway. Sci Signal. 2012;5(214):ra20\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMizushima N, Komatsu M. Autophagy: renovation of cells and tissues. Cell. 2011;147(4):728\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang R, Xu A, Qin C, Zhang Q, Chen S, Lang Y, Wang M, Li C, Feng W, Zhang R et al. Pseudorabies Virus dUTPase UL50 Induces Lysosomal Degradation of Type I Interferon Receptor 1 and Antagonizes the Alpha Interferon Response. J Virol 2017, 91(21).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYuan G, Zhang B, Yang S, Jin L, Datta A, Bae S, Chen X, Datta PK. Novel role of STRAP in progression and metastasis of colorectal cancer through Wnt/β-catenin signaling. Oncotarget. 2016;7(13):16023\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoore KS, Yagci N, van Alphen F, Meijer AB, t Hoen PAC, von Lindern M. Strap associates with Csde1 and affects expression of select Csde1-bound transcripts. PLoS ONE. 2018;13(8):e0201690.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuh HD, Lee E, Shin J, Park B, Lee S. STRAP positively regulates TLR3-triggered signaling pathway. Cell Immunol. 2017;318:55\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCui J, Li Y, Zhu L, Liu D, Songyang Z, Wang HY, Wang RF. NLRP4 negatively regulates type I interferon signaling by targeting the kinase TBK1 for degradation via the ubiquitin ligase DTX4. Nat Immunol. 2012;13(4):387\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang M, Wang L, Zhao X, Zhao K, Meng H, Zhao W, Gao C. TRAF-interacting protein (TRIP) negatively regulates IFN-β production and antiviral response by promoting proteasomal degradation of TANK-binding kinase 1. J Exp Med. 2012;209(10):1703\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZheng Q, Hou J, Zhou Y, Yang Y, Xie B, Cao X. Siglec1 suppresses antiviral innate immune response by inducing TBK1 degradation via the ubiquitin ligase TRIM27. Cell Res. 2015;25(10):1121\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng M, Tam JW, Wang L, Liang K, Li S, Zhang L, Guo H, Luo X, Zhang Y, Petrucelli A, et al. TRAF3IP3 negatively regulates cytosolic RNA induced anti-viral signaling by promoting TBK1 K48 ubiquitination. Nat Commun. 2020;11(1):2193.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin M, Zhao Z, Yang Z, Meng Q, Tan P, Xie W, Qin Y, Wang RF, Cui J. USP38 Inhibits Type I Interferon Signaling by Editing TBK1 Ubiquitination through NLRP4 Signalosome. Mol Cell. 2016;64(2):267\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"STRAP, TBK1, Pseudorabies virus, antiviral immunity, type I interferon","lastPublishedDoi":"10.21203/rs.3.rs-4645344/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4645344/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSerine/threonine kinase receptor associated protein (STRAP) functions as a scaffold protein and involves in diverse cellular processes, yet its role in antiviral innate immunity is still elusive. Here, we found that STRAP acts as an interferon (IFN)-inducible positive regulator to facilitate type I IFN signaling during pseudorabies virus (PRV) infection. Mechanistically, STRAP interacted with TBK1 and promoted the activation of type I IFN signaling. Both the CT and WD40 7\u0026thinsp;\u0026minus;\u0026thinsp;6 domains contribute to STRAP\u0026rsquo;s function. Furthermore, TBK1 competed with PRV-UL50 for binding to STRAP, and STRAP impedes the degradation of TBK1 mediated by PRV-UL50, thereby augmenting the interaction between STRAP and TBK1. In general, these findings revealed a previously unrecognized role for STRAP in innate antiviral immune responses in PRV infection. STRAP could be a potential therapeutic target for viral infectious diseases.\u003c/p\u003e","manuscriptTitle":"STRAP positively regulates the antiviral immune response against pseudorabies virus via targeting TBK1","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-22 17:15:39","doi":"10.21203/rs.3.rs-4645344/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-07-04T02:47:34+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-04T02:21:40+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-30T17:42:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"183562591291994810110104987131431667839","date":"2024-06-29T13:39:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"203038702033936150896537183339720969955","date":"2024-06-29T10:43:40+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-06-29T03:24:41+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-28T03:26:49+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-28T03:12:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"Virology Journal","date":"2024-06-27T01:42:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3d0b92f4-b2d4-42ec-b1ca-e44cbdf18611","owner":[],"postedDate":"July 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-26T16:00:40+00:00","versionOfRecord":{"articleIdentity":"rs-4645344","link":"https://doi.org/10.1186/s12985-024-02474-z","journal":{"identity":"virology-journal","isVorOnly":false,"title":"Virology Journal"},"publishedOn":"2024-08-24 15:57:13","publishedOnDateReadable":"August 24th, 2024"},"versionCreatedAt":"2024-07-22 17:15:39","video":"","vorDoi":"10.1186/s12985-024-02474-z","vorDoiUrl":"https://doi.org/10.1186/s12985-024-02474-z","workflowStages":[]},"version":"v1","identity":"rs-4645344","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4645344","identity":"rs-4645344","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}