Decitabine may effectively treat CMML/MDS-associated inflammatory bowel disease by regulating the Th17/Treg balance

Decitabine may effectively treat CMML/MDS-associated inflammatory bowel disease by regulating the Th17/Treg balance | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Decitabine may effectively treat CMML/MDS-associated inflammatory bowel disease by regulating the Th17/Treg balance Guobiao Luo, Guanlun Gao, Zengyan Liu, Ting Wei, Qing-Shan Li This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2565022/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background. T helper 17 (Th17) and regulatory T (Treg) cell imbalance in the immune microenvironment is involved in the pathogenesis of myelodysplastic syndrome (MDS) and inflammatory bowel disease (IBD). DNA demethylation agents are the main treatment for MDS/ chronic myelomonocytic leukemia (CMML). However, the clinical efficacy of the demethylation agent decitabine (DAC) in the treatment of MDS /CMML-associated IBD has not been reported. Methods. In this study, Decitabine was used to treat two patients with MDS/CMML-associated inflammatory bowel disease. Clinical efficacy was assessed after 5 courses of DAC treatment. Meanwhile, we performed dynamic monitoring of immune-related indicators in the intestinal, bone marrow, and peripheral blood microenvironment of one patient with CMML-associated ulcerative colitis. Results. IBD was improved in 2 patients with haematological remission in MDS or CMML. Immunohistochemical analysis of bone marrow specimens showed that PD-1, PD-L1, and Foxp3 were upregulated, and IL-17 was downregulated. In the bone marrow and intestine, quantitative RT-PCR showed that the mRNA level of IL-17 decreased after DAC treatment, whereas those Foxp3, PD-1, and PD-L1 mRNA increased. Flow cytometry showed that the percentage of Th17 cells in peripheral blood mononuclear cells decreased, whereas that of Treg cells increased. Conclusions. Our results suggest that DAC may effectively treat CMML/MDS associated IBD by affecting the balance of Th17/Treg via PD-1/PD-L1 pathway in the immune microenvironment. Figures Figure 1 Figure 2 Figure 3 Figure 4 1. Introduction myelodysplastic syndromes (MDS) is a clonal hematopoietic malignancy arising from precursors of the myeloid lineage and are characterized by dysregulated proliferation and abnormal differentiation 1 [1][1] 1 [1] 111 (Arber et al. , 2016) 1 . Autoimmune diseases (AD) are often associated with MDS and myeloproliferative neoplasms (MPNs) 2 . MDS/MPN-associated ADs include IBD includes Crohn's disease (CD) and ulcerative colitis (UC) 3 . Most UC patients are diagnosed with IBD before MDS 4 . The simultaneous development of these two diseases may be associated with common underlying pathogenesis 5, 6 . As is known to all, the pathogenesis and treatment of IBD are related to immune regulation, and the primary treatment for MDS/chronic myelomonocytic leukemia (CMML) is demethylating agents. Here are no reports on the efficacy of immunological regulation using decitabine (DAC). Although there are several reports showing immune regulation by DAC treatment 7-9 , there are no reports on the efficacy of DAC on MDS/CMML-associated IBD. In this study, we describe the outcomes of two patients with IBD-associated with MDS or CMML who were successfully treated with DAC. The T helper 17 (Th17) and regulatory T (Treg) cell balance in patients treated with DAC was monitored dynamically. 2. Materials And Methods 2.1 Screening protocol IBD-associated with MDS or CMML is a rare disease. We have obtained informed consent from two patients with IBD-associated with MDS or CMML and analyzed patient outcomes after treatment with DAC. 2.2 Bone marrow and intestinal samples Biopsy specimens from the bone marrow and intestinal lesions were collected before and after treatment. Specimens were cut into two pieces: for hematoxylin and eosin (H&E) staining and immunohistochemistry, and the other one was stored at -80°C for quantitative real-time polymerase chain reaction (qRT-PCR). 2.3 Blood sampling Peripheral blood mononuclear cells (PBMCs) were isolated using the density centrifugation technique and immediately used. 2.4 H&E staining and immunohistochemistry According to standard protocols, the 4-μm-thick paraffin sections of biopsy specimens from the bone marrow and intestinal lesions were stained with H&E. After antigen retrieval, and performed immunohistochemistry respectively. The antibodies used for immunohistochemistry were as follows: anti-IL-17 (Abcam Cambridge, UK）, anti-Foxp3 (Abcam, Cambridge, UK)， anti-PD-1 (Abclonal, Wuhan, China), and anti-PD-L1 (Abclonal Wuhan, China) antibodies. Before and after DAC treatment, the expression levels of IL-17, Foxp3, PD-1 and PD-L1 in samples was quantified by relative integrated optical density (IOD) according to our protocol described previously 10 . 2.5 qRT-PCR The levels of IL-17, Foxp3, PD-1, and PD-L1 were normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers (5′–3′) used for qPCR are presented as follows. The protocol used was based on our previously published method 10 . The sequence s of primers (5'-3') used for qPCR: IL-17： Forward: CTGCTACTGCTGCTGAGCCTG Reverse: GGTTATGGATGTTCAGGTTGACC Foxp3： Forward: GCCCTTGGACAAGGACCC Reverse: CAGCAGGTCTGAGGCTTTGG PD-1： Forward: ACCCTGGTGGTTGGTGTCGT Reverse: CCTGGCTCCTATTGTCCCTC PD-L1： Forward: TTTGCTGAACGCCCCATA Reverse: TGCTTGTCCAGATGACTTCG GAPDH： Forward: GCACCGTCAAGGCTGAGAAC Reverse：TGGTGAAGACGCCAGTGGA. 2.6 Flow cytometry Cell density of PBMNCs was adjusted to 2 × 10 6 /ml. The Th17 cells and Treg cells were detected by flow cytometry. The protocol used was based on our previously published method 10 . 2.7 Statistical method Statistical analyses were performed using SPSS 17.0. Numerical data were expressed as the mean ± standard deviation. The difference between the two groups was measured by two-tailed independent-sample Student’s t/t′ tests. A p-value of 0.05 was considered significant. 2.8 Patient data The first patient, a 73-year-old woman, was admitted to the hospital in 2016 with a week's history of abdominal pain. Peripheral blood tests showed a white blood count of 17.8 × 10 9 /L, hemoglobin 135g/L, and a platelet count of 52 × 10 9 /L. Peripheral blood profile displayed 2.2 × 10 9 /L of absolute count of monocytes, with 3% blastic cells and 12.36% monocytes in peripheral blood nucleated cells. The patient was admitted to the Department of Hematology in Guangzhou First People's Hospital of Guangzhou Medical University for further treatment. A bone marrow smear showed that bone marrow cells proliferated actively. The proportion of granulocytes was high, whereas the percentages of erythroid cells and lymphocytes were low. With dysplasia of granulocytes and megakaryocytes and 8% blastic cells in bone marrow. Genome-wide microarray analysis detected two chromosomal abnormalities in the patient, including a chimeric single diploid (11q). Screening of fourteen MDS related gene mutations detected one missense mutation in the gamma-butyrolactone gene and a shift mutation in the Tet methylcytosine dioxygenase 2 gene (TET2). The patient was diagnosed with CMML after completing bone marrow and genetic examinations. However, the patient developed hemorrhagic watery stools during hospitalization. A colonoscopy showed the disappearance of the vascular texture of the sigmoid colon and mucosal erosion and a small ulcer (Fig. 1a). A biopsy was performed during the colonoscopy and the patient was diagnosed as UC (Fig. 1b). The final diagnosis was CMML related UC. According to the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia in 2016, CMML was classified as CMML-1 1 . The second case, a 70-year-old man without previous medical history of gastrointestinal diseases, was admitted to our hospital in 2013. At that time, blood tests showed a white blood count of 11 × 10 9 /L, hemoglobin 87 g/L, and a platelet count of 712 × 10 9 /L.The absolute count of peripheral blood mononuclear cells was 0.35×10 9 /L, without blastic cells. A bone marrow smear indicated active bone marrow hyperplasia, with dysplasia in megakaryocytes and erythroid precursors, blastic cells accounted for 12% in bone marrow nucleated cells. The patient was treated with folic acid and vitamin B12, but symptoms and laboratory indicators showed no significant improvement. In 2015, the patient was hospitalized for gastrointestinal bleeding several times. A colonoscopy was performed to investigate the cause of gastrointestinal bleeding, and the results showed that the ileocecal valve was swollen and severely eroded by chronic inflammation (Fig.1d). Positron Emission Computed Tomography (PET-CT) showed digestive tract inflammation. Pathological analysis of the colon biopsy specimen showed that the intestinal mucosa was infiltrated by a large number of inflammatory cells in the ileocecal valve and ascending colon (Fig. 1e). The patient was diagnosed with CD. Fluorescence in situ hybridization (FISH) of bone marrow cells showed (5q33), del(7q31), del(20q) and (+8). According to the WHO classification of myeloid neoplasms and acute leukemia in 2016, the patient was diagnosed as MDS [RAEB II, IPSS 2.5, high risk] 1 . To sum up, these two patients were diagnosed as CMML- and MDS associated with IBD respectively, and the two patients were treated with DAC as single treatment for 5 consecutive days (Chia Tai TianQing Pharmaceutical Group) at a dose of 25 mg/d, equivalently 15 mg/m 2 /d. Two patients were evaluated after 5 courses of DAC treatment. 3. Results 3.1 Clinical efficacy Colonoscopy and bone marrow examination were performed after five courses of treatment. The patients’ clinical symptoms such as bloody stools disappeared in response to DAC treatment. The leukocyte count, hemoglobin, platelet, lymphocyte and monocyte cell levels gradually returned to normal. DAC successfully induced complete remission of MDS or CMML and its combined IBD. Endoscopy was performed to observe intestinal lesions before and after treatment. Before DAC treatment, typical intestinal lesions were observed under endoscopy, and a biopsy was performed simultaneously. After DAC treatment, the intestinal lesions improved. First case: Before DAC treatment, mucous erosion and small ulcers were detected in the sigmoid colon by endoscopy (Fig. 1a). A biopsy of the specimen was performed (Fig. 1b). After DAC treatment, endoscopy images showed that the mucosa had no obvious hyperemia and edema, and had clear small intestinal valves, although there were rough scars on the surface of the sigmoid colon (Fig. 1c). Second case: Before DAC treatment, endoscopic images showed hyperplasia of the mucous membrane, narrowing of the intestinal cavity at the liver curvature and ascending colon ring cavity, and an uneven surface with many irregular erosive foci (Fig. 1d). A biopsy was performed at the lesion site and the patient was diagnosed with CD (Fig.1e). After DAC treatment, endoscopy showed normal mucous membranes with no erosion, no polyposis, and no bleeding (Fig. 1f). 3.2 Pathological images of the bone marrow In the first patient, before DAC treatment, H&E staining detected more cytoplasmic eosinophilic, circular monocytes, as well as few single round nuclear megakaryocytes presenting as smaller cells and a reduced nuclear lobule(Fig.1g). After DAC treatment, the bone marrow hyperplasia was active, fat vacuoles were obvious and there was no obvious abnormal cell morphology (Fig.1h). In the second patient, before DAC treatment, bone marrow hyperplasia was detected, accounting for approximately 85% of hematopoietic tissue volume; Dysplasia and hyperplasia were observed in all three hematopoietic lineages (Fig.1i). After DAC treatment, the bone marrow hyperplasia was decreased, and there was no obvious abnormal cell morphology or immature cells (Fig. 1j). 3.3 Immunohistochemical analysis Intestinal biopsy samples from two patients were subjected to immunohistochemical analysis. Immunohistochemistry detected the levels of IL-17, Foxp3, PD-1, and PD-L1 in the first (Fig. 2a-d) and the second patients (Fig. 2e-h). Biopsy samples from the bone marrow were subjected to immunohistochemical analysis using anti-IL-17, anti-Foxp3, anti-PD-1, and anti-PD-L1 antibodies. Compared with the findings before DAC treatment (first case, Fig.3a–d), immunohistochemical analysis of the bone marrow after DAC treatment (first case, Fig. 3e–h) showed that the levels of Foxp3, PD-1, and PD-L1 increased and the expression of IL-17 decreased. Similar findings were obtained in the immunohistochemical analysis of the second patient (second case: Fig. 4a–d, 4e–h). Graph of IL-17, Foxp3, PD-1 and PD-L1 relative levels(relative IOD) of the patients were presented. The relative IODs of IL-17, Foxp3, PD-1 and PD-L1were significantly decreased after ADC treatment for two patients(Fig 3r and 3s). 3.4 Cytokine profiles of the intestine and bone marrow in the first patient In the first patient, analyses were performed before and after treatment as follows: intestinal, bone marrow pathology (H&E staining), and immunohistochemical staining (IL-17, Foxp3, PD-1, and PD-L1), IL-17, Foxp3, PD-1, and PD-L1mRNA expression. mRNA was isolated from endoscopic biopsy specimens of the transverse colon and bone marrow before and after DAC and subjected to quantitative reverse transcription PCR to determine the expression of IL-17, Foxp3, PD-1, and PD-L1. The expression of these molecules was normalized to the expression of GAPDH. The results showed that the expression of IL-17 mRNA decreased after treatment in the bone marrow and intestine, whereas Foxp3, PD-1, and PD-L1 mRNA levels increased(Fig. 4a and b). 3.5 Peripheral blood Th17/Treg balance The frequencies of Th17 and Treg cells in PBMNCs were measured by flow cytometry. The percentages of Treg and Th17 cells in PBMCs increased and decreased, respectively. Flow cytometry showed that the percentage of Tregs (CD4 + CD25 + Foxp3 + ) was higher after than before DAC treatment (Fig. 4c and d). However, the percentage of Th17 cells (CD4 + IL-17 + ) was lower after than before DAC treatment (Fig. 4e and f). 4. Discussion Two patients with MDS/CMML associated with IBD were treated with DAC alone and achieved complete remission. In addition to hematologic remission, the colonoscopy images showed that the two patients tended to be normal, and the ulcers and polyps gradually healed into scars (Fig. 1b and e). After DAC treatment, the number of hematopoietic cells with abnormal hyperplasia was significantly reduced. These results suggest that MDS is effectively treated along with mitigating IBD by DAC which may have interrupted the common underlying pathogenesis. MDS/IBD is similar to Th17/Treg imbalance in the immune microenvironment. Pro-inflammatory cytokines are pathogenic mediators in IBD 11, 12 . Although AZA induces complete remission in a patient with MDS-associated IBD has been reported 13 , the mechanisms of the two demethylation drugs DAC and AZA are different. AZA is primarily incorporated into RNA and to a lesser extent into DNA, whereas DAC is more selective, reducing only DNA methylation 13 . Therefore, theoretically, DAC and AZA should have different regulatory effects on the immune microenvironment of patients. To the best of our knowledge, this is the first report describing the effects of DAC on MDS/CMML-associated IBD. In addition, one of the patients with MDS-associated UC was dynamically monitored for Th17/Treg balance in the immune microenvironment. This study showed that DAC treatment upregulated Foxp3,PD-1, and PD-L1 mRNA, on the contrary, IL-17mRNA decreased. However, both endoscopic biopsy specimens and bone marrow biopsy specimens include heterogenous cell types. Therefore, in the future we will enrich specific cell populations before comparing mRNA expression or at least confirm that biopsy specimens used in these assays are composed of nearly homogenous cell populations. The therapeutic effects of hypomethylating agents (HMA) are mediated by different pathways, and the mechanisms underlying immune regulation have not been fully elucidated 14 . A study reported that Th17 differentiation was associated with epigenetic modification 15 . HMA affects the Gln metabolites alpha-KG or 2-HG which increase the methylation levels of the Foxp3 gene conserved noncoding sequence 1(CNS1) and CNS2 by decreasing the activity of TET2, and thereby promoting Th17 and inhibiting Treg differentiation 13, 14, 16 . In this study, After DAC treatment，the ratio of Th17 to Treg cells was proportionately reduced. This phenomenon may be related to DAC's regulation of the above-mentioned PD-1/PD-L1 pathway. Anti-TNF-α, anti-IL-6 and anti-IL-17 antibodies have shown efficacy in the treatment of patients with IBD 17-19 . Recent study showed 5-Azacytidine reduced the IL-6 production in mesenchymal stromal cells from myelodysplastic patients 20 . Our results showed that intestinal diseases can be controlled along with changes in intestinal cytokines above-mentioned after DAC treatment. Studies show that Th17/Treg imbalance is present in MDS patients 21, 22 . Similarly, we found that the ratio of Th17 to Treg cells decreased in the peripheral blood after treatment. This indicated that DAC treatment improved the balance of Th17/Treg cells, thereby controlling intestinal disease. We further investigated the role of the PD-1/PD-L1 pathway in the maintenance of Th17/Treg balance. For example, in preeclampsia, PD-1/PD-L1 promotes the Foxp3+Treg cell differentiation from CD4 + T cells 23 . Recent studies show that demethylating agents upregulate the expression of PD-L1 in the bone marrow microenvironment of MDS patients, melanoma cells and experimental autoimmune encephalomyelitis(EAE) mouse model 24-26 . Consistent with the above results, we found that the mRNA levels of PD-1, PD-L1, and Foxp3 in the bone marrow and intestine increased after treatment. Accordingly, IL-17 mRNA expression was reduced. These results suggest that DAC upregulates the expression of PD-1 and PD-L1 in MDS patients, thereby promoting the differentiation of CD4+T cells into Treg cells and inhibiting the differentiation of Th17 cells through both PD-1 /PD-L1 and metabolic pathways 27 . Inflammatory bowel disease is caused by dysregulation of the Th17/Treg balance 28 . In wide fields, targeting Th17/Treg balance via DAC is a challenge for the future 29, 30 . Future studies should investigate the synergistic effect of DAC with other strategies to regulate Th17/Treg balance,such as RORC2 inhibitor, BMS-336, which restore Th17-Treg stability and function in PBMCs and laminar propria mononuclear cells(LPMCs) from IBD subjects in patients CMML/MDS-associated with IBD 31 . This study had several limitations. The study included only two patients, and larger-scale clinical observations and screening of predictive factors are necessary to confirm the results. In summary, the present results provide that DAC may be effective for the treatment of CMML/MDS associated IBD by one of the mechanisms which regulate the immune microenvironment, including the intestinal Th17/Treg balance 32 . Declarations Data Availability All the data can be found in this manuscript or received from the corresponding author upon reasonable request. Conflicts of Interest The authors declare no conflicts of interest. Source of Funding Guangzhou Planned Project of Science and Technology, China (Grant/Award Number: 201707010279); Guangdong Natural Science Foundation of China (Grant/Award Number: 2214050003863). Acknowledgments This work was support by Guangzhou Planned Project of Science and Technology, China (201707010279) and Guangdong Natural Science Foundation of China (2214050003863). The funders had no roles in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The corresponding author had full access to all the data in the study and had final responsibility for the decision to submit for publication. Ethics approval and consent to participate The study received approval from the local ethics committee (the ethics committees of Guangzhou Red Cross Hospital and Guangzhou First People′s Hospital,AF/SC-07/013) and was performed in line with the principles of the Declaration of Helsinki. Informed consent was obtained from all individual participants included in the study. Author contributions LQS, LZY, and LGB contributed to the experimental design and implementation, performed the experiments and data analysis and drafted the manuscript. WT and GGL, contributed to experiment implementation and data analysis. All authors read and approved the final manuscript. References Arber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM, et al. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 2016; 127(20): 2391-2405. doi:10.1182/blood-2016-03-643544 Castro M, Conn DL, Su WP, Garton JP. Rheumatic manifestations in myelodysplastic syndromes. J Rheumatol 1991; 18(5): 721-727. Saif MW, Hopkins JL, Gore SD. Autoimmune phenomena in patients with myelodysplastic syndromes and chronic myelomonocytic leukemia. Leuk Lymphoma 2002; 43(11): 2083-2092. doi:10.1080/1042819021000016186 Harewood GC, Loftus EV, Jr., Tefferi A, Tremaine WJ, Sandborn WJ. Concurrent inflammatory bowel disease and myelodysplastic syndromes. Inflamm Bowel Dis 1999; 5(2): 98-103. doi:10.1097/00054725-199905000-00005 Neurath MF. Cytokines in inflammatory bowel disease. Nat Rev Immunol 2014; 14(5): 329-342. doi:10.1038/nri3661 Benschop RJ, Chow CK, Tian Y, Nelson J, Barmettler B, Atwell S, et al. Development of tibulizumab, a tetravalent bispecific antibody targeting BAFF and IL-17A for the treatment of autoimmune disease. MAbs 2019; 11(6): 1175-1190. doi:10.1080/19420862.2019.1624463 You L, Han Q, Zhu L, Zhu Y, Bao C, Yang C, et al. Decitabine-Mediated Epigenetic Reprograming Enhances Anti-leukemia Efficacy of CD123-Targeted Chimeric Antigen Receptor T-Cells. Front Immunol 2020; 11: 1787. doi:10.3389/fimmu.2020.01787 de Cubas AA, Dunker W, Zaninovich A, Hongo RA, Bhatia A, Panda A, et al. DNA hypomethylation promotes transposable element expression and activation of immune signaling in renal cell cancer. JCI Insight. 2020;5(11):e137569. doi:10.1172/jci.insight.137569 Zhao C, Jia B, Wang M, Schell TD, Claxton DF, Ehmann WC, et al. Multi-dimensional analysis identifies an immune signature predicting response to decitabine treatment in elderly patients with AML. Br J Haematol 2020; 188(5): 674-684. doi:10.1111/bjh.16228 Zhong W, Zhu Z, Xu X, Zhang H, Xiong H, Li Q, et al. Human bone marrow-derived mesenchymal stem cells promote the growth and drug-resistance of diffuse large B-cell lymphoma by secreting IL-6 and elevating IL-17A levels. J Exp Clin Cancer Res 2019; 38(1): 73. doi:10.1186/s13046-019-1081-7 Strober W. The multifaceted influence of the mucosal microflora on mucosal dendritic cell responses. Immunity 2009; 31(3): 377-388. doi:10.1016/j.immuni.2009.09.001 Strober W, Zhang F, Kitani A, Fuss I, Fichtner-Feigl S. Proinflammatory cytokines underlying the inflammation of Crohn's disease. Curr Opin Gastroenterol 2010; 26(4): 310-317. doi:10.1097/MOG.0b013e328339d099 Kono M, Komeda Y, Sakurai T, Okamoto A, Minaga K, Kamata K, et al. Induction of Complete Remission by Azacitidine in a Patient with Myelodysplastic Syndrome-Associated Inflammatory Bowel Disease. J Crohns Colitis 2018; 12(4): 499-502. doi:10.1073/pnas.1714717115 Voso MT, Santini V, Fabiani E, Fianchi L, Criscuolo M, Falconi G, et al. Why methylation is not a marker predictive of response to hypomethylating agents. Haematologica 2014; 99(4): 613-619. doi:10.3324/haematol.2013.099549 Yang BH, Floess S, Hagemann S, Deyneko IV, Groebe L, Pezoldt J, et al. Development of a unique epigenetic signature during in vivo Th17 differentiation. Nucleic Acids Res 2015; 43(3): 1537-1548. doi:10.1093/nar/gkv014 Xu T, Stewart KM, Wang X, Liu K, Xie M, Ryu JK, et al. Metabolic control of T(H)17 and induced T(reg) cell balance by an epigenetic mechanism. Nature 2017; 548(7666): 228-233. doi:10.1038/nature23475 Hohenberger M, Cardwell LA, Oussedik E, Feldman SR. Interleukin-17 inhibition: role in psoriasis and inflammatory bowel disease. J Dermatolog Treat 2018; 29(1): 13-18. doi:10.1080/09546634.2017.1329511 Jeong DY, Kim S, Son MJ, Son CY, Kim JY, Kronbichler A, et al. Induction and maintenance treatment of inflammatory bowel disease: A comprehensive review. Autoimmun Rev 2019; 18(5): 439-454. doi:10.1016/j.autrev.2019.03.002 Danese S, Vermeire S, Hellstern P, Panaccione R, Rogler G, Fraser G, et al. Randomised trial and open-label extension study of an anti-interleukin-6 antibody in Crohn's disease (ANDANTE I and II). Gut 2019; 68(1): 40-48. doi:10.1136/gutjnl-2017-314562 Boada M, Echarte L, Guillermo C, Diaz L, Touriño C, Grille S. 5-Azacytidine restores interleukin 6-increased production in mesenchymal stromal cells from myelodysplastic patients. Hematol Transfus Cell Ther. 2021;43(1):35-42. doi:10.1016/j.htct.2019.12.002 Bouchliou I, Miltiades P, Nakou E, Spanoudakis E, Goutzouvelidis A, Vakalopoulou S, et al. Th17 and Foxp3(+) T regulatory cell dynamics and distribution in myelodysplastic syndromes. Clin Immunol 2011; 139(3): 350-359. doi:10.1016/j.clim.2011.03.001 Winter S, Shoaie S, Kordasti S, Platzbecker U. Integrating the "Immunome" in the Stratification of Myelodysplastic Syndromes and Future Clinical Trial Design. J Clin Oncol 2020; 38(15): 1723-1735. doi:10.1200/jco.19.01823 Zhang Y, Liu Z, Tian M, Hu X, Wang L, Ji J, et al. The altered PD-1/PD-L1 pathway delivers the 'one-two punch' effects to promote the Treg/Th17 imbalance in pre-eclampsia. Cell Mol Immunol 2018; 15(7): 710-723. doi:10.1038/cmi.2017.70 Yang H, Bueso-Ramos C, DiNardo C, Estecio MR, Davanlou M, Geng QR, et al. Expression of PD-L1, PD-L2, PD-1 and CTLA4 in myelodysplastic syndromes is enhanced by treatment with hypomethylating agents. Leukemia 2014; 28(6): 1280-1288. doi:10.1038/leu.2013.355 Chang CB, Lee SP, Chen WM, Wang CM, Song YC, Chan MW, et al. Dendritic cell upregulation of programmed death ligand-1 via DNA demethylation inhibits experimental autoimmune encephalomyelitis. J Autoimmun 2020; 107: 102362. doi:10.1016/j.jaut.2019.102362 Chatterjee A, Rodger EJ, Ahn A, Stockwell PA, Parry M, Motwani J, et al. Marked Global DNA Hypomethylation Is Associated with Constitutive PD-L1 Expression in Melanoma. iScience 2018; 4: 312-325. doi:10.1016/j.isci.2018.05.021 Sun L, Fu J, Zhou Y. Metabolism Controls the Balance of Th17/T-Regulatory Cells. Front Immunol 2017; 8: 1632. doi:10.3389/fimmu.2017.01632 Lee GR. The Balance of Th17 versus Treg Cells in Autoimmunity. Int J Mol Sci 2018; 19(3). doi:10.3390/ijms19030730 Karri SK, Sheela A. Potential route of Th17/T(reg) cell dynamics in targeting type 1 diabetes and rheumatoid arthritis: an autoimmune disorder perspective. Br J Biomed Sci 2017; 74(1): 8-15. doi:10.1080/09674845.2016.1264704 Wei T, Zhong W, Li Q. Role of heterogeneous regulatory T cells in the tumor microenvironment. Pharmacol Res 2020; 153: 104659. doi:10.1016/j.phrs.2020.104659 Boardman DA-O, Garcia RV, Ivison SM, Bressler B, Dhar TM, Zhao Q, et al. Pharmacological inhibition of RORC2 enhances human Th17-Treg stability and function. Eur J Immunol. 2020;50(9):1400-1411. doi:10.1002/eji.201948435 Topper MJ, Vaz M, Marrone KA, Brahmer JR, Baylin SB. The emerging role of epigenetic therapeutics in immuno-oncology. Nat Rev Clin Oncol 2020; 17(2): 75-90. doi:10.1038/s41571-019-0266-5 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2565022","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":177016320,"identity":"e5f33d05-19f1-4333-8031-ddc6d4101edd","order_by":0,"name":"Guobiao Luo","email":"","orcid":"","institution":"Department of Gastroenterology, Guangzhou Red Cross Hospital, Jinan University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Guobiao","middleName":"","lastName":"Luo","suffix":""},{"id":177016323,"identity":"d790e1bc-e40a-4c67-b005-4110b36f3b14","order_by":1,"name":"Guanlun Gao","email":"","orcid":"","institution":"Department of Hematology, Guangzhou Red Cross Hospital, Jinan University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Guanlun","middleName":"","lastName":"Gao","suffix":""},{"id":177016324,"identity":"9b5b5551-19bc-4634-8ff7-49ac9d07cd24","order_by":2,"name":"Zengyan Liu","email":"","orcid":"","institution":"Department of Hematology, Guangzhou First People′s Hospital, Guangzhou Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zengyan","middleName":"","lastName":"Liu","suffix":""},{"id":177016326,"identity":"d17e9035-87fc-49d8-a4fb-92edeb63c512","order_by":3,"name":"Ting Wei","email":"","orcid":"","institution":"Department of Hematology, Guangzhou Red Cross Hospital, Jinan University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Wei","suffix":""},{"id":177016327,"identity":"3a4bc241-e0e4-47a0-9016-6ff5b5c786ea","order_by":4,"name":"Qing-Shan Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIiWNgGAWjYDCCA8wNBxgMgAwJEK9CQo6fsBZGZC1nLIwlG4jQAmGAtDC2VSRuIKSF7/bBxgNvCu7YzZ/d/Ozh13kSjBsYmB8+uoFHi+S5xIaDcwyeJW+4c8zcWHabBLM5A5uxcQ4eLQZnGBsO8xgcTjaQSDCTltwmwWbZwMMmTZQW+Rnp36Ql50jwGBwgUosdw40cM8mPDRISBLVIArUA/XI4weBGTpk0wzEJA8lmAn7hO8N8+MObP4ftgQ7bJvmjpq6+n7354WN8WsCAh4EhsQFIM/OAeMyElEO12INoxh/EqB4Fo2AUjIIRBwD51lGJUC1AQQAAAABJRU5ErkJggg==","orcid":"","institution":"Department of Hematology, Guangzhou Red Cross Hospital, Jinan University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Qing-Shan","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2023-02-08 14:30:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2565022/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2565022/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":33205232,"identity":"50b0340a-9cb2-46b3-a9c8-b9ba8c62e097","added_by":"auto","created_at":"2023-02-21 02:55:18","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4159787,"visible":true,"origin":"","legend":"\u003cp\u003eEndoscopic findings of the first patient. (a): Before DAC treatment, endoscopy reached the sigmoid colon, which showed mucous erosion and small ulcers. (b): A biopsy of the specimen was performed. The patient was diagnosed with ulcerative colitis [×200]. (c): After DAC treatment, the endoscopic images showed that the mucosa was nearly normal. Endoscopic findings of the second patient. (d): Endoscopy images before DAC treatment. (e): A biopsy was performed at the lesion site and the patient was diagnosed with Crohn’s Disease [×200]. (f): After DAC treatment, endoscopy showed a normal mucous membrane with no erosion, no polyposis, no bleeding, and a smooth appendix opening. (g) and (h): The pathology of bone marrow of the first patient [×200]; (i) and (j): The Pathology of the bone marrow of the second case [×200].\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-2565022/v1/a876c5f4a58e72fafb1c8d33.png"},{"id":33204568,"identity":"9a43423c-cc0a-49e8-986e-657dd368bc9a","added_by":"auto","created_at":"2023-02-21 02:47:18","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":6701190,"visible":true,"origin":"","legend":"\u003cp\u003eIntestine’s Immunohistochemistry images of the 2 patients. Biopsy samples were also subjected to immunohistochemical analysis by using anti-IL17 antibody [Ab], anti-Foxp3 antibody [Ab], anti-PD-1 antibody [Ab] and anti-PD-L1 antibody [Ab]. (a–d): Immunohistochemistry images of the first patient [×200]. (e–h): Immunohistochemistry images of the second patient [×200].\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-2565022/v1/50924b6aaf06e1e389fe829c.png"},{"id":33205526,"identity":"da678413-f426-4396-a176-603a58da6db8","added_by":"auto","created_at":"2023-02-21 03:03:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3753471,"visible":true,"origin":"","legend":"\u003cp\u003eBone marrow \u0026nbsp;immunohistochemistry images of two patients. Biopsy samples of the bone marrow were subjected to immunohistochemical analysis using anti-IL17 antibody [Ab], anti- [Foxp3] Ab, anti-PD-1 antibody [Ab] and anti-PD-L1 antibody [Ab]. The immunostaining intensity of IL-17, Foxp3, PD-1 and PD-L1 were displayed for pre-treatment(a-d: the first patient; i-m: the second patient) and after DAC treatment(e-h: the first patient; n-q: the second patient) [×200], respectively. Graph of IL-17, Foxp3, PD-1 and PD-L1 relative expression (relative IOD) of the first(r) and the second(s) patient were presented. The data shown three different microscopic fields. Significance was determined using two-tailed independent-sample student’s t/t′ test. (*P \u0026lt; 0.05), (Fig 3r and 3s) .\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-2565022/v1/f9d65f995a57eff3d24abb90.png"},{"id":33204567,"identity":"25df7fb0-e48b-45d5-8ee0-9049bbb14659","added_by":"auto","created_at":"2023-02-21 02:47:18","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1051525,"visible":true,"origin":"","legend":"\u003cp\u003e(a): Intestinal cytokine profiles of the first patient. The mRNA expression of IL-17, Foxp3, PD-1, and PD-L1. (b): The bone marrow cytokine profiles of the patient. The mRNA expression of IL-17, Foxp3, PD-1, and PD-L1. Flow cytometry: (c) and (d) show the percentages of Treg (CD4+CD25+Foxp3+) cells, (e) and (f) show the percentages of Th17 (CD4+IL-17A+) cells. Among them, (c) and (e) are flow cytometry images before treatment. (d) and (f) are flow cytometry images after treatment.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-2565022/v1/00fcf8ed7106a2dc924cc4d8.png"},{"id":37028933,"identity":"a7559f8c-9cc1-48c6-867a-c9a8cc1f5462","added_by":"auto","created_at":"2023-05-15 10:44:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4577597,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2565022/v1/73c7135c-36fd-4a5d-bb37-04ed2c5c8312.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Decitabine may effectively treat CMML/MDS-associated inflammatory bowel disease by regulating the Th17/Treg balance","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003emyelodysplastic syndromes (MDS) is a clonal hematopoietic malignancy arising from precursors of the myeloid lineage and are characterized by dysregulated proliferation and abnormal differentiation\u003csup\u003e1\u003c/sup\u003e[1][1]\u003csup\u003e1\u003c/sup\u003e[1]\u003csup\u003e111\u003c/sup\u003e(Arber\u003cem\u003e\u0026nbsp;et al.\u003c/em\u003e, 2016)\u003csup\u003e1\u003c/sup\u003e. Autoimmune diseases (AD) are often associated with MDS and myeloproliferative neoplasms (MPNs)\u0026nbsp;\u003csup\u003e2\u003c/sup\u003e. MDS/MPN-associated ADs include IBD includes Crohn\u0026apos;s disease (CD) and ulcerative colitis (UC)\u0026nbsp;\u003csup\u003e3\u003c/sup\u003e. Most UC patients are diagnosed with IBD before MDS\u003csup\u003e4\u003c/sup\u003e. The simultaneous development of these two diseases may be associated with common underlying pathogenesis\u003csup\u003e5, 6\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eAs is known to all, the pathogenesis and treatment of IBD are related to immune regulation, and the primary treatment for MDS/chronic myelomonocytic leukemia (CMML) is demethylating agents. Here are no reports on the efficacy of immunological regulation using decitabine (DAC). Although there are several reports showing immune regulation by DAC treatment\u003csup\u003e7-9\u003c/sup\u003e, there are no reports on the efficacy of DAC on MDS/CMML-associated IBD.\u003c/p\u003e\n\u003cp\u003eIn this study, we describe the outcomes of two patients with IBD-associated with MDS or CMML who were successfully treated with DAC. The T helper 17 (Th17) and regulatory T (Treg) cell balance in patients treated with DAC was monitored dynamically.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.1 Screening protocol\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIBD-associated with MDS or CMML is a rare disease. We have obtained informed consent from two patients with IBD-associated with MDS or CMML and analyzed patient outcomes after treatment with DAC. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.2 Bone marrow and intestinal samples\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBiopsy specimens from the bone marrow and intestinal lesions were collected before and after treatment. Specimens were cut into two pieces: for hematoxylin and eosin (H\u0026amp;E) staining and immunohistochemistry, and the other one was stored at -80\u0026deg;C for quantitative real-time polymerase chain reaction (qRT-PCR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.3 Blood sampling\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePeripheral blood mononuclear cells (PBMCs) were isolated using the density centrifugation technique and immediately used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.4 H\u0026amp;E staining and immunohistochemistry\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to standard protocols, the 4-\u0026mu;m-thick paraffin sections of biopsy specimens from the bone marrow and intestinal lesions were stained with H\u0026amp;E. After antigen retrieval, and performed immunohistochemistry respectively. The antibodies used for immunohistochemistry were as follows: anti-IL-17 (Abcam Cambridge, UK）, anti-Foxp3 (Abcam, Cambridge, UK)， anti-PD-1 (Abclonal, Wuhan, China), and anti-PD-L1 (Abclonal Wuhan, China) antibodies.\u003c/p\u003e\n\u003cp\u003eBefore and after DAC treatment, the expression levels of IL-17, Foxp3, PD-1 and PD-L1 in samples was quantified by relative integrated optical density (IOD) according to our protocol described previously\u003csup\u003e10\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.5 qRT-PCR\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe levels of IL-17, Foxp3, PD-1, and PD-L1 were normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primers (5\u0026prime;\u0026ndash;3\u0026prime;) used for qPCR are presented as follows. The protocol used was based on our previously published method\u003csup\u003e10\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe sequence s of primers (5\u0026apos;-3\u0026apos;) used for qPCR: \u003c/p\u003e\n\u003cp\u003eIL-17： \u003c/p\u003e\n\u003cp\u003eForward: CTGCTACTGCTGCTGAGCCTG \u003c/p\u003e\n\u003cp\u003eReverse: GGTTATGGATGTTCAGGTTGACC\u003c/p\u003e\n\u003cp\u003eFoxp3：\u003c/p\u003e\n\u003cp\u003eForward: GCCCTTGGACAAGGACCC\u003c/p\u003e\n\u003cp\u003eReverse: CAGCAGGTCTGAGGCTTTGG\u003c/p\u003e\n\u003cp\u003ePD-1：\u003c/p\u003e\n\u003cp\u003eForward: ACCCTGGTGGTTGGTGTCGT \u003c/p\u003e\n\u003cp\u003eReverse: CCTGGCTCCTATTGTCCCTC\u003c/p\u003e\n\u003cp\u003ePD-L1：\u003c/p\u003e\n\u003cp\u003eForward: TTTGCTGAACGCCCCATA \u003c/p\u003e\n\u003cp\u003eReverse: TGCTTGTCCAGATGACTTCG\u003c/p\u003e\n\u003cp\u003eGAPDH：\u003c/p\u003e\n\u003cp\u003eForward: GCACCGTCAAGGCTGAGAAC\u003c/p\u003e\n\u003cp\u003eReverse：TGGTGAAGACGCCAGTGGA. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.6 Flow cytometry\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell density of PBMNCs was adjusted to 2 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e/ml. The Th17 cells and Treg cells were detected by flow cytometry. The protocol used was based on our previously published method\u003csup\u003e10\u003c/sup\u003e. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.7 Statistical method\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStatistical analyses were performed using SPSS 17.0. Numerical data were expressed as the mean \u0026plusmn; standard deviation. The difference between the two groups was measured by two-tailed independent-sample Student\u0026rsquo;s t/t\u0026prime; tests. A p-value of 0.05 was considered significant.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e2.8 Patient data\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe first patient, a 73-year-old woman, was admitted to the hospital in 2016 with a week\u0026apos;s history of abdominal pain. Peripheral blood tests showed a white blood count of 17.8 \u0026times; 10\u003csup\u003e9\u003c/sup\u003e/L, hemoglobin 135g/L, and a platelet count of 52 \u0026times; 10\u003csup\u003e9\u003c/sup\u003e/L. Peripheral blood profile displayed 2.2 \u0026times; 10\u003csup\u003e9\u003c/sup\u003e/L of absolute count of monocytes, with 3% blastic cells and 12.36% monocytes in peripheral blood nucleated cells. The patient was admitted to the Department of Hematology in Guangzhou First People\u0026apos;s Hospital of Guangzhou Medical University for further treatment. A bone marrow smear showed that bone marrow cells proliferated actively. The proportion of granulocytes was high, whereas the percentages of erythroid cells and lymphocytes were low. With dysplasia of granulocytes and megakaryocytes and 8% blastic cells in bone marrow. Genome-wide microarray analysis detected two chromosomal abnormalities in the patient, including a chimeric single diploid (11q). Screening of fourteen MDS related gene mutations detected one missense mutation in the gamma-butyrolactone gene and a shift mutation in the Tet methylcytosine dioxygenase 2 gene (TET2). The patient was diagnosed with CMML after completing bone marrow and genetic examinations. However, the patient developed hemorrhagic watery stools during hospitalization. A colonoscopy showed the disappearance of the vascular texture of the sigmoid colon and mucosal erosion and a small ulcer (Fig. 1a). A biopsy was performed during the colonoscopy and the patient was diagnosed as UC (Fig. 1b). The final diagnosis was CMML related UC. According to the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia in 2016, CMML was classified as CMML-1\u003csup\u003e1\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe second case, a 70-year-old man without previous medical history of gastrointestinal diseases, was admitted to our hospital in 2013. At that time, blood tests showed a white blood count of 11 \u0026times; 10\u003csup\u003e9\u003c/sup\u003e/L, hemoglobin 87 g/L, and a platelet count of 712 \u0026times; 10\u003csup\u003e9\u003c/sup\u003e/L.The absolute count of peripheral blood mononuclear cells was 0.35\u0026times;10\u003csup\u003e9\u003c/sup\u003e/L, without blastic cells. A bone marrow smear indicated active bone marrow hyperplasia, with dysplasia in megakaryocytes and erythroid precursors, blastic cells accounted for 12% in bone marrow nucleated cells. The patient was treated with folic acid and vitamin B12, but symptoms and laboratory indicators showed no significant improvement. In 2015, the patient was hospitalized for gastrointestinal bleeding several times. A colonoscopy was performed to investigate the cause of gastrointestinal bleeding, and the results showed that the ileocecal valve was swollen and severely eroded by chronic inflammation (Fig.1d). Positron Emission Computed Tomography (PET-CT) showed digestive tract inflammation. Pathological analysis of the colon biopsy specimen showed that the intestinal mucosa was infiltrated by a large number of inflammatory cells in the ileocecal valve and ascending colon (Fig. 1e). The patient was diagnosed with CD. Fluorescence in situ hybridization (FISH) of bone marrow cells showed (5q33), del(7q31), del(20q) and (+8). According to the WHO classification of myeloid neoplasms and acute leukemia in 2016, the patient was diagnosed as MDS [RAEB II, IPSS 2.5, high risk] \u003csup\u003e1\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eTo sum up, these two patients were diagnosed as CMML- and MDS associated with IBD respectively, and the two patients were treated with DAC as single treatment for 5 consecutive days (Chia Tai TianQing Pharmaceutical Group) at a dose of 25 mg/d, equivalently 15 mg/m\u003csup\u003e2\u003c/sup\u003e/d. Two patients were evaluated after 5 courses of DAC treatment.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003e3.1 Clinical efficacy\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eColonoscopy and bone marrow examination were performed after five\u0026nbsp;courses\u0026nbsp;of treatment. The patients\u0026rsquo; clinical symptoms such as bloody stools disappeared in response to DAC treatment. The leukocyte count, hemoglobin, platelet, lymphocyte and monocyte cell levels gradually returned to normal. DAC successfully induced complete remission of MDS or CMML and its combined IBD.\u003c/p\u003e\n\u003cp\u003eEndoscopy was performed to observe intestinal lesions before and after treatment. Before DAC treatment, typical intestinal lesions were observed under endoscopy, and a biopsy was performed simultaneously. After DAC treatment, the intestinal lesions improved. First case: Before DAC treatment, mucous erosion and small ulcers were detected in the sigmoid colon by endoscopy (Fig. 1a). A biopsy of the specimen was performed (Fig. 1b). \u0026nbsp;After DAC treatment, endoscopy images showed that the mucosa had no obvious hyperemia and edema, and had clear small intestinal valves, although there were rough scars on the surface of the sigmoid colon (Fig. 1c).\u003c/p\u003e\n\u003cp\u003eSecond case: Before DAC treatment, endoscopic images showed hyperplasia of the mucous membrane, narrowing of the intestinal cavity at the liver curvature and ascending colon ring cavity, and an uneven surface with many irregular erosive foci (Fig. 1d). A biopsy was performed at the lesion site and the patient was diagnosed with CD (Fig.1e). After DAC treatment, endoscopy showed normal mucous membranes with no erosion, no polyposis, and no bleeding (Fig. 1f).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e3.2 Pathological images of the bone marrow\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the first patient, before DAC treatment, H\u0026amp;E staining detected more cytoplasmic eosinophilic, circular monocytes, as well as few single round nuclear megakaryocytes presenting as smaller cells and a reduced nuclear lobule(Fig.1g). After DAC treatment, the bone marrow hyperplasia was active, fat vacuoles were obvious and there was no obvious abnormal cell morphology (Fig.1h).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the second patient, before DAC treatment, bone marrow hyperplasia was detected, accounting for approximately 85% of hematopoietic tissue volume; Dysplasia and hyperplasia were observed in all three hematopoietic lineages (Fig.1i). After DAC treatment, the bone marrow hyperplasia was decreased, and there was no obvious abnormal cell morphology or immature cells (Fig. 1j).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e3.3 Immunohistochemical analysis\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIntestinal biopsy samples from two patients were subjected to immunohistochemical analysis. Immunohistochemistry detected the levels of IL-17, Foxp3, PD-1, and PD-L1 in the first (Fig. 2a-d) and the second patients (Fig. 2e-h).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eBiopsy samples from the bone marrow were subjected to immunohistochemical analysis using anti-IL-17, anti-Foxp3, anti-PD-1, and anti-PD-L1 antibodies. Compared with the findings before DAC treatment (first case, Fig.3a\u0026ndash;d), immunohistochemical analysis of the bone marrow after DAC treatment (first case, Fig. 3e\u0026ndash;h) showed that the levels of Foxp3, PD-1, and PD-L1 increased and the expression of IL-17 decreased. Similar findings were obtained in the immunohistochemical analysis of the second patient (second case: Fig. 4a\u0026ndash;d, 4e\u0026ndash;h).\u0026nbsp;Graph of IL-17, Foxp3, PD-1 and PD-L1 relative levels(relative IOD) of the patients were presented. The relative IODs of IL-17, Foxp3, PD-1 and PD-L1were significantly decreased after ADC treatment\u0026nbsp;for two patients(Fig 3r and 3s).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e3.4 Cytokine profiles of the intestine and bone marrow in the first patient\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the first patient, analyses were performed before and after treatment as follows: intestinal, bone marrow pathology (H\u0026amp;E staining), and immunohistochemical staining (IL-17, Foxp3, PD-1, and PD-L1), IL-17, Foxp3, PD-1, and PD-L1mRNA expression.\u003c/p\u003e\n\u003cp\u003emRNA was isolated from endoscopic biopsy specimens of the transverse colon and bone marrow before and after DAC and subjected to quantitative reverse transcription PCR to determine the expression of IL-17, Foxp3, PD-1, and PD-L1. The expression of these molecules was normalized to the expression of GAPDH.\u003c/p\u003e\n\u003cp\u003eThe results showed that the expression of IL-17 mRNA decreased after treatment in the bone marrow and intestine, whereas Foxp3, PD-1, and PD-L1 mRNA levels increased(Fig. 4a and b).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003e3.5 Peripheral blood Th17/Treg balance\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe frequencies of Th17 and Treg cells in PBMNCs were measured by flow cytometry. The percentages of Treg and Th17 cells in PBMCs increased and decreased, respectively. Flow cytometry showed that the percentage of Tregs (CD4\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e+\u003c/sup\u003e) was higher after than before DAC treatment (Fig. 4c and d). However, the percentage of Th17 cells (CD4\u003csup\u003e+\u003c/sup\u003eIL-17\u003csup\u003e+\u003c/sup\u003e) was lower after than before DAC treatment (Fig. 4e and f).\u003c/p\u003e"},{"header":"4. Discussion ","content":"\u003cp\u003eTwo patients with MDS/CMML associated with IBD were treated with DAC alone and achieved complete remission. In addition to hematologic remission, the colonoscopy images showed that the two patients tended to be normal, and the ulcers and polyps gradually healed into scars (Fig. 1b and e). After DAC treatment, the number of hematopoietic cells with abnormal hyperplasia was significantly reduced. These results suggest that\u0026nbsp;MDS is effectively treated along with mitigating IBD by \u0026nbsp;DAC which may have interrupted the common underlying pathogenesis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMDS/IBD is similar to Th17/Treg imbalance in the immune microenvironment. Pro-inflammatory cytokines are pathogenic mediators in IBD\u003csup\u003e11, 12\u003c/sup\u003e. Although AZA induces complete remission in a patient with MDS-associated IBD has been reported\u003csup\u003e13\u003c/sup\u003e, the mechanisms of the two demethylation drugs DAC and AZA are different. AZA is primarily incorporated into RNA and to a lesser extent into DNA, whereas DAC is more selective, reducing only DNA methylation\u003csup\u003e13\u003c/sup\u003e. Therefore, theoretically, DAC and AZA should have different regulatory effects on the immune microenvironment of patients.\u003c/p\u003e\n\u003cp\u003eTo the best of our knowledge, this is the first report describing the effects of DAC on MDS/CMML-associated IBD. In addition, one of the patients with MDS-associated UC was dynamically monitored for Th17/Treg balance in the immune microenvironment. This study showed that DAC treatment upregulated Foxp3,PD-1, and PD-L1 mRNA, on the contrary, IL-17mRNA decreased. However, both endoscopic biopsy specimens and bone marrow biopsy specimens include heterogenous cell types. Therefore, in the future we will enrich specific cell populations before comparing mRNA expression or at least confirm that biopsy specimens used in these assays are composed of nearly homogenous cell populations.\u003c/p\u003e\n\u003cp\u003eThe therapeutic effects of hypomethylating agents (HMA) are mediated by different pathways, and the mechanisms underlying immune regulation have not been fully elucidated\u003csup\u003e14\u003c/sup\u003e. A study reported that Th17 differentiation was associated with epigenetic modification\u003csup\u003e15\u003c/sup\u003e. HMA affects the Gln metabolites alpha-KG or 2-HG which increase the methylation levels of the Foxp3 gene conserved noncoding sequence 1(CNS1) and CNS2 by decreasing the activity of TET2, and thereby promoting Th17 and inhibiting Treg differentiation\u003csup\u003e13, 14, 16\u003c/sup\u003e. In this study, After DAC treatment，the ratio of Th17 to Treg cells was proportionately reduced. This phenomenon may be related to DAC\u0026apos;s regulation of the above-mentioned PD-1/PD-L1 pathway.\u003c/p\u003e\n\u003cp\u003eAnti-TNF-\u0026alpha;, anti-IL-6 and anti-IL-17 antibodies have shown efficacy in the treatment of patients with IBD\u003csup\u003e17-19\u003c/sup\u003e. Recent study showed 5-Azacytidine reduced \u0026nbsp;the IL-6 production in mesenchymal stromal cells from myelodysplastic patients\u003csup\u003e20\u003c/sup\u003e. Our results showed that intestinal diseases can be controlled along with changes in intestinal cytokines above-mentioned after DAC treatment.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eStudies show that Th17/Treg imbalance is present in MDS patients\u003csup\u003e21, 22\u003c/sup\u003e. Similarly, we found that the ratio of Th17 to Treg cells decreased in the peripheral blood after treatment. This indicated that DAC treatment improved the balance of Th17/Treg cells, thereby controlling intestinal disease.\u003c/p\u003e\n\u003cp\u003eWe further investigated the role of the PD-1/PD-L1 pathway in the maintenance of Th17/Treg balance. For example, in preeclampsia, PD-1/PD-L1 promotes the Foxp3+Treg cell differentiation from CD4\u003csup\u003e+\u003c/sup\u003eT cells\u003csup\u003e23\u003c/sup\u003e. Recent studies show that demethylating agents upregulate the expression of PD-L1 in the bone marrow microenvironment of MDS patients,\u0026nbsp;melanoma cells and experimental autoimmune encephalomyelitis(EAE) mouse model\u003csup\u003e24-26\u003c/sup\u003e.\u0026nbsp;Consistent with the above results, we found that the mRNA levels of PD-1, PD-L1, and Foxp3 in the bone marrow and intestine increased after treatment. Accordingly, IL-17 mRNA expression was reduced. These results suggest that DAC upregulates the expression of PD-1 and PD-L1 in MDS patients, thereby promoting the differentiation of CD4+T cells into Treg cells and inhibiting the differentiation of Th17 cells through both PD-1 /PD-L1 and metabolic pathways\u003csup\u003e27\u003c/sup\u003e. Inflammatory bowel disease is caused by dysregulation of the Th17/Treg balance\u003csup\u003e28\u003c/sup\u003e. In wide fields, targeting Th17/Treg balance via DAC is a challenge for the future\u003csup\u003e29, 30\u003c/sup\u003e. Future studies should investigate the synergistic effect of DAC with other strategies to regulate Th17/Treg balance,such as RORC2 inhibitor, BMS-336, which restore Th17-Treg stability and function in PBMCs and laminar propria mononuclear cells(LPMCs) from IBD subjects in patients \u0026nbsp;CMML/MDS-associated with IBD\u003csup\u003e31\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study had several limitations. The study included only two patients, and larger-scale clinical observations and screening of predictive factors are necessary to confirm the results.\u003c/p\u003e\n\u003cp\u003eIn summary, the present results provide that DAC may be effective for the treatment of CMML/MDS associated IBD by one of the mechanisms which regulate the immune microenvironment, including the intestinal Th17/Treg balance\u003csup\u003e32\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the data can be found in this manuscript or received from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSource of Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGuangzhou Planned Project of Science and Technology, China (Grant/Award Number: 201707010279); Guangdong Natural Science Foundation of China (Grant/Award Number: 2214050003863).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was support by Guangzhou Planned Project of Science and Technology, China (201707010279) and Guangdong Natural Science Foundation of China (2214050003863). The funders had no roles in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The corresponding author had full access to all the data in the study and had final responsibility for the decision to submit for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study received approval from the local ethics committee (the ethics committees of Guangzhou Red Cross Hospital and Guangzhou First People\u0026prime;s Hospital,AF/SC-07/013) and was performed in line with the principles of the Declaration of Helsinki. Informed consent was obtained from all individual participants included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLQS, LZY, and LGB contributed to the experimental design and implementation, performed the experiments and data analysis and drafted the manuscript. WT and GGL, contributed to experiment implementation and data analysis. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eArber DA, Orazi A, Hasserjian R, Thiele J, Borowitz MJ, Le Beau MM, et al. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 2016; 127(20): 2391-2405. doi:10.1182/blood-2016-03-643544\u003c/li\u003e\n\u003cli\u003eCastro M, Conn DL, Su WP, Garton JP. Rheumatic manifestations in myelodysplastic syndromes. J Rheumatol 1991; 18(5): 721-727. \u003c/li\u003e\n\u003cli\u003eSaif MW, Hopkins JL, Gore SD. Autoimmune phenomena in patients with myelodysplastic syndromes and chronic myelomonocytic leukemia. Leuk Lymphoma 2002; 43(11): 2083-2092. doi:10.1080/1042819021000016186\u003c/li\u003e\n\u003cli\u003eHarewood GC, Loftus EV, Jr., Tefferi A, Tremaine WJ, Sandborn WJ. Concurrent inflammatory bowel disease and myelodysplastic syndromes. Inflamm Bowel Dis 1999; 5(2): 98-103. doi:10.1097/00054725-199905000-00005\u003c/li\u003e\n\u003cli\u003eNeurath MF. Cytokines in inflammatory bowel disease. Nat Rev Immunol 2014; 14(5): 329-342. doi:10.1038/nri3661\u003c/li\u003e\n\u003cli\u003eBenschop RJ, Chow CK, Tian Y, Nelson J, Barmettler B, Atwell S, et al. Development of tibulizumab, a tetravalent bispecific antibody targeting BAFF and IL-17A for the treatment of autoimmune disease. MAbs 2019; 11(6): 1175-1190. doi:10.1080/19420862.2019.1624463\u003c/li\u003e\n\u003cli\u003eYou L, Han Q, Zhu L, Zhu Y, Bao C, Yang C, et al. Decitabine-Mediated Epigenetic Reprograming Enhances Anti-leukemia Efficacy of CD123-Targeted Chimeric Antigen Receptor T-Cells. Front Immunol 2020; 11: 1787. doi:10.3389/fimmu.2020.01787\u003c/li\u003e\n\u003cli\u003ede Cubas AA, Dunker W, Zaninovich A, Hongo RA, Bhatia A, Panda A, et al. DNA hypomethylation promotes transposable element expression and activation of immune signaling in renal cell cancer. JCI Insight. 2020;5(11):e137569. doi:10.1172/jci.insight.137569\u003c/li\u003e\n\u003cli\u003eZhao C, Jia B, Wang M, Schell TD, Claxton DF, Ehmann WC, et al. Multi-dimensional analysis identifies an immune signature predicting response to decitabine treatment in elderly patients with AML. Br J Haematol 2020; 188(5): 674-684. doi:10.1111/bjh.16228\u003c/li\u003e\n\u003cli\u003eZhong W, Zhu Z, Xu X, Zhang H, Xiong H, Li Q, et al. Human bone marrow-derived mesenchymal stem cells promote the growth and drug-resistance of diffuse large B-cell lymphoma by secreting IL-6 and elevating IL-17A levels. J Exp Clin Cancer Res 2019; 38(1): 73. doi:10.1186/s13046-019-1081-7\u003c/li\u003e\n\u003cli\u003eStrober W. The multifaceted influence of the mucosal microflora on mucosal dendritic cell responses. Immunity 2009; 31(3): 377-388. doi:10.1016/j.immuni.2009.09.001\u003c/li\u003e\n\u003cli\u003eStrober W, Zhang F, Kitani A, Fuss I, Fichtner-Feigl S. Proinflammatory cytokines underlying the inflammation of Crohn\u0026apos;s disease. Curr Opin Gastroenterol 2010; 26(4): 310-317. doi:10.1097/MOG.0b013e328339d099\u003c/li\u003e\n\u003cli\u003eKono M, Komeda Y, Sakurai T, Okamoto A, Minaga K, Kamata K, et al. Induction of Complete Remission by Azacitidine in a Patient with Myelodysplastic Syndrome-Associated Inflammatory Bowel Disease. J Crohns Colitis 2018; 12(4): 499-502. doi:10.1073/pnas.1714717115\u003c/li\u003e\n\u003cli\u003eVoso MT, Santini V, Fabiani E, Fianchi L, Criscuolo M, Falconi G, et al. Why methylation is not a marker predictive of response to hypomethylating agents. Haematologica 2014; 99(4): 613-619. doi:10.3324/haematol.2013.099549\u003c/li\u003e\n\u003cli\u003eYang BH, Floess S, Hagemann S, Deyneko IV, Groebe L, Pezoldt J, et al. Development of a unique epigenetic signature during in vivo Th17 differentiation. Nucleic Acids Res 2015; 43(3): 1537-1548. doi:10.1093/nar/gkv014\u003c/li\u003e\n\u003cli\u003eXu T, Stewart KM, Wang X, Liu K, Xie M, Ryu JK, et al. Metabolic control of T(H)17 and induced T(reg) cell balance by an epigenetic mechanism. Nature 2017; 548(7666): 228-233. doi:10.1038/nature23475\u003c/li\u003e\n\u003cli\u003eHohenberger M, Cardwell LA, Oussedik E, Feldman SR. Interleukin-17 inhibition: role in psoriasis and inflammatory bowel disease. J Dermatolog Treat 2018; 29(1): 13-18. doi:10.1080/09546634.2017.1329511\u003c/li\u003e\n\u003cli\u003eJeong DY, Kim S, Son MJ, Son CY, Kim JY, Kronbichler A, et al. Induction and maintenance treatment of inflammatory bowel disease: A comprehensive review. Autoimmun Rev 2019; 18(5): 439-454. doi:10.1016/j.autrev.2019.03.002\u003c/li\u003e\n\u003cli\u003eDanese S, Vermeire S, Hellstern P, Panaccione R, Rogler G, Fraser G, et al. Randomised trial and open-label extension study of an anti-interleukin-6 antibody in Crohn\u0026apos;s disease (ANDANTE I and II). Gut 2019; 68(1): 40-48. doi:10.1136/gutjnl-2017-314562\u003c/li\u003e\n\u003cli\u003eBoada M, Echarte L, Guillermo C, Diaz L, Touri\u0026ntilde;o C, Grille S. 5-Azacytidine restores interleukin 6-increased production in mesenchymal stromal cells from myelodysplastic patients. Hematol Transfus Cell Ther. 2021;43(1):35-42. doi:10.1016/j.htct.2019.12.002\u003c/li\u003e\n\u003cli\u003eBouchliou I, Miltiades P, Nakou E, Spanoudakis E, Goutzouvelidis A, Vakalopoulou S, et al. Th17 and Foxp3(+) T regulatory cell dynamics and distribution in myelodysplastic syndromes. Clin Immunol 2011; 139(3): 350-359. doi:10.1016/j.clim.2011.03.001\u003c/li\u003e\n\u003cli\u003eWinter S, Shoaie S, Kordasti S, Platzbecker U. Integrating the \u0026quot;Immunome\u0026quot; in the Stratification of Myelodysplastic Syndromes and Future Clinical Trial Design. J Clin Oncol 2020; 38(15): 1723-1735. doi:10.1200/jco.19.01823\u003c/li\u003e\n\u003cli\u003eZhang Y, Liu Z, Tian M, Hu X, Wang L, Ji J, et al. The altered PD-1/PD-L1 pathway delivers the \u0026apos;one-two punch\u0026apos; effects to promote the Treg/Th17 imbalance in pre-eclampsia. Cell Mol Immunol 2018; 15(7): 710-723. doi:10.1038/cmi.2017.70\u003c/li\u003e\n\u003cli\u003eYang H, Bueso-Ramos C, DiNardo C, Estecio MR, Davanlou M, Geng QR, et al. Expression of PD-L1, PD-L2, PD-1 and CTLA4 in myelodysplastic syndromes is enhanced by treatment with hypomethylating agents. Leukemia 2014; 28(6): 1280-1288. doi:10.1038/leu.2013.355\u003c/li\u003e\n\u003cli\u003eChang CB, Lee SP, Chen WM, Wang CM, Song YC, Chan MW, et al. Dendritic cell upregulation of programmed death ligand-1 via DNA demethylation inhibits experimental autoimmune encephalomyelitis. J Autoimmun 2020; 107: 102362. doi:10.1016/j.jaut.2019.102362\u003c/li\u003e\n\u003cli\u003eChatterjee A, Rodger EJ, Ahn A, Stockwell PA, Parry M, Motwani J, et al. Marked Global DNA Hypomethylation Is Associated with Constitutive PD-L1 Expression in Melanoma. iScience 2018; 4: 312-325. doi:10.1016/j.isci.2018.05.021\u003c/li\u003e\n\u003cli\u003eSun L, Fu J, Zhou Y. Metabolism Controls the Balance of Th17/T-Regulatory Cells. Front Immunol 2017; 8: 1632. doi:10.3389/fimmu.2017.01632\u003c/li\u003e\n\u003cli\u003eLee GR. The Balance of Th17 versus Treg Cells in Autoimmunity. Int J Mol Sci 2018; 19(3). doi:10.3390/ijms19030730\u003c/li\u003e\n\u003cli\u003eKarri SK, Sheela A. Potential route of Th17/T(reg) cell dynamics in targeting type 1 diabetes and rheumatoid arthritis: an autoimmune disorder perspective. Br J Biomed Sci 2017; 74(1): 8-15. doi:10.1080/09674845.2016.1264704\u003c/li\u003e\n\u003cli\u003eWei T, Zhong W, Li Q. Role of heterogeneous regulatory T cells in the tumor microenvironment. Pharmacol Res 2020; 153: 104659. doi:10.1016/j.phrs.2020.104659\u003c/li\u003e\n\u003cli\u003eBoardman DA-O, Garcia RV, Ivison SM, Bressler B, Dhar TM, Zhao Q, et al. Pharmacological inhibition of RORC2 enhances human Th17-Treg stability and function. Eur J Immunol. 2020;50(9):1400-1411. doi:10.1002/eji.201948435\u003c/li\u003e\n\u003cli\u003eTopper MJ, Vaz M, Marrone KA, Brahmer JR, Baylin SB. The emerging role of epigenetic therapeutics in immuno-oncology. Nat Rev Clin Oncol 2020; 17(2): 75-90. doi:10.1038/s41571-019-0266-5\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-2565022/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2565022/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eBackground. \u003c/strong\u003e\u003c/em\u003eT helper 17 (Th17) and regulatory T (Treg) cell imbalance in the immune microenvironment is involved in the pathogenesis of myelodysplastic syndrome (MDS) and inflammatory bowel disease (IBD). DNA demethylation agents are the main treatment for MDS/ chronic myelomonocytic leukemia (CMML). However, the clinical efficacy of the demethylation agent decitabine (DAC) in the treatment of MDS /CMML-associated IBD has not been reported.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eMethods.\u003c/strong\u003e\u003c/em\u003e\u003cem\u003e \u003c/em\u003e\u0026nbsp;In this study, Decitabine was used to treat two patients with MDS/CMML-associated inflammatory bowel disease. Clinical efficacy was assessed after 5 courses of DAC treatment. Meanwhile, we performed dynamic monitoring of immune-related indicators in the intestinal, bone marrow, and peripheral blood microenvironment of one patient with CMML-associated ulcerative colitis.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eResults.\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u003c/strong\u003eIBD was improved in 2 patients with haematological remission in MDS or CMML. Immunohistochemical analysis of bone marrow specimens showed that PD-1, PD-L1, and Foxp3 were upregulated, and IL-17 was downregulated. In the bone marrow and intestine, quantitative RT-PCR showed that the mRNA level of IL-17 decreased after DAC treatment, whereas those Foxp3, PD-1, and PD-L1 mRNA increased. Flow cytometry showed that the percentage of Th17 cells in peripheral blood mononuclear cells decreased, whereas that of Treg cells increased.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cstrong\u003eConclusions. \u003c/strong\u003e\u003c/em\u003eOur results suggest that DAC may effectively treat CMML/MDS associated IBD by affecting the balance of Th17/Treg via PD-1/PD-L1 pathway in the immune microenvironment.\u003c/p\u003e","manuscriptTitle":"Decitabine may effectively treat CMML/MDS-associated inflammatory bowel disease by regulating the Th17/Treg balance","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-02-21 02:47:13","doi":"10.21203/rs.3.rs-2565022/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d8d2f877-2fcb-4180-89cd-92f2984e30cc","owner":[],"postedDate":"February 21st, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-06-07T02:29:10+00:00","versionOfRecord":[],"versionCreatedAt":"2023-02-21 02:47:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2565022","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2565022","identity":"rs-2565022","version":["v1"]},"buildId":"FbvkV6FR0MCFSLy54lSbu","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}