Anemoside B4 alleviates DSS-induced colitis by inhibiting CD1d-dependent NLRP3 inflammasome activation in macrophages | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Anemoside B4 alleviates DSS-induced colitis by inhibiting CD1d-dependent NLRP3 inflammasome activation in macrophages Qinggao Zhang, jiao li, Pan Li, Shuo Yuan, Jiachen Xue, Huan Meng, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4382137/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Abnormal activation of the NLRP3 inflammasome in macrophages is closely associated with Ulcerative colitis (UC) and targeting the NLRP3 inflammasome has been proposed as a potential therapeutic approach, but the underlying mechanism by which it regulates intestinal inflammation remains unclear. Anemoside B4 (AB4) has anti-inflammatory activity, but whether it alleviates UC by inhibiting the activation of NLRP3 inflammasome remains unclear. More importantly, the molecular targets of AB4 remain unknown. Our study showed that AB4 had a strong anti-inflammatory effect dextran sodium sulfate (DSS)-induced colitis in WT mice, whereas the protective effects were lost in NLRP3 -/- mice. Interestingly, AB4 inhibited the activation of NLRP3 inflammasome in colonic macrophages without affecting intestinal epithelial cells. Mechanistically, AB4 might target CD1d thus reducing the AKT-STAT1-PRDX1-NF-κB signaling pathway, eventually inhibiting the activation of NLRP3 inflammasome. Macrophage-specific CD1d depletion had been shown to reverse the protective effect of AB4. Therefore, as a natural product with high safety index, AB4 might be considered a promising candidate drug for the treatment of colitis. Biological sciences/Immunology/Inflammation/Inflammasome Health sciences/Diseases/Gastrointestinal diseases/Inflammatory bowel disease/Ulcerative colitis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 INTRODUCTION Ulcerative colitis (UC) is a type of nonspecific inflammatory bowel disease (IBD), which starts from the rectum and extends continuously to proximal segments of the colon [ 1 ]. With the rapid development of industrialization and modernization, the global incidence of UC has also been rising continuously. The main pathological lesions are mucosal ulcers, and the typical clinical symptoms are diarrhea, rectal bleeding, and weight loss. Repeated episodes of UC increase the cumulative risk of colorectal cancer (CRC) by 18–20%, which undoubtedly brings serious mental burden and psychological pressure to UC patients and seriously affects their normal life [ 1 , 2 ]. Although the exact cause of UC is uncertain at present, the activation of the mucosal immune system and the subsequent pathological cytokines play roles in the generation of UC [ 1 , 2 ]. At present, UC patients can only receive long-term immunosuppressive and anti-inflammatory treatment, such as glucocorticoids, immune-suppressants, biological agents, and 5-aminosalicylic acid (5-ASA), as well as even require surgery, which is limited due to more side effects or high recurrence rate [ 3 , 4 ]. In this case, it is urgently needed to develop highly effective drugs with fewer side effects, long-term control ability of inflammation development, and stabilization of intestinal microenvironment. Macrophages are abundant in colon samples from UC patients and animal models, which play an essential function in the occurrence, development and resolution of inflammation [ 5 ]. Macrophages can respond to the damage-associated molecular patterns (DAMPs) and the pathogen-associated molecular patterns (PAMPs), enhance the recruitment, and activate other innate and adaptive immune cells to amplify intestinal inflammation [ 4 , 5 ]. The NLR family pyrin domain containing 3 (NLRP3) inflammasome is a multiprotein complex consisting of NLRP3, the apoptosis-associated peck-like protein with CARD domain (ASC), and Caspase-1. NLRP3 is a well-studied inflammasome, and numerous types of research have revealed that the NLRP3 activation of macrophages plays an important role in mediating UC inflammatory response [ 5 – 8 ]. Activation of the NLRP3 inflammasome is mediated by two key steps: Priming and assembling. [ 5 – 8 ]. The priming step is mediated by activation of nuclear factor kappa-B (NF-κB) signaling to up-regulate the transcription of inflammasome-related proteins (NLRP3, pro-interleukin (IL)-1β and IL-18). The assembling signal is induced by various triggers, such as adenosine 5′-triphosphate (ATP), potassium (K + ) efflux, mitochondrial reactive oxygen species (mtROS), or lysosomal destabilization/rupture, induces the assembly of NLRP3 inflammasome [ 6 – 8 ]. Activation of NLRP3 inflammasome promotes the cleavage of Caspase-1 as well as the maturation and secretion of pro-inflammatory cytokines IL-1β and IL-18 [ 5 – 8 ]. Many studies have confirmed that the inhibition of NLRP3-mediated IL-1β and IL-18 production in macrophages improves dextran sulfate sodium (DSS)-induced inflammation [ 8 – 10 ]. Toward this end, searching for drug candidates targeting NLRP3 inflammasome activation is an effective anti-inflammatory strategy for the potential treatment of UC. Natural products provide a new source of compounds for the treatment of UC due to their abundant resources, definite efficacy, few side effects, and low price [ 11 , 12 ]. Pulsatilla decoction (Bai-Tou-Weng-Tang, BTWT) is a classic Chinese herbal formula for the treatment of intestinal bacterial diseases in humans [ 12 ]. In recent years, many basic studies have verified the anti-colitis efficacy of BTWT [ 13 – 15 ]. However, the active ingredient of BTWT's anti-colitis activity remains uncertain, which limits the discovery of its biological mechanisms, and hinders the further translation of BTWT into standard clinical application. Anemoside B4 (AB4) is a main natural saponin component isolated from the root of Pulsatilla Chinensis , which can be used as a quality control index. Recently, AB4 has been shown to possess antibacterial, anti-diarrhea, anti-inflammatory, anti-endotoxin, anti-tumor, and immunomodulatory [ 13 – 18 ]. Therefore, we hypothesized that AB4 might be a main component of BTWT anti-colitis. However, whether AB4 alleviates UC by inhibiting the activation of NLRP3 inflammasome remains unclear. What's more, the molecular target of AB4 remains unknown. In this study, we verified AB4’s protective effect on DSS-induced colitis. The mechanistic study highlighted that AB4 inhibited NLRP3 inflammasome activation by targeting macrophage CD1d to regulate AKT-STAT1-PRDX1-NF-κB signaling, thereby attenuating DSS-induced colitis. RESULTS AB4 ameliorates DSS-induced colitis symptoms DSS-induced colitis is known to be a widely accepted model with clinical symptoms similar to human UC, including diarrhea, rectal bleeding and weight loss [ 19 , 20 ]. To evaluate the effect of AB4 (Fig. 1 A) on colitis in mice, C57BL/6 (wild-type; WT) mice were challenged with 3.0% DSS for 7 days and then administered with AB4 (5 mg/kg) daily for 7 days or 14 days, as well as the 5-ASA (200 mg/kg) being the positive control (Supporting Information Fig. S1A). Surprisingly, AB4 significantly decreased the disease activity indices characterized by diarrhea, bleeding, and weight loss compared to the DSS group (Fig. S1B and S1C). Decreased disease severity was also accompanied by a reduction of colon shortening, which was ameliorated by both AB4 treatment and pretreatment. There was no significant difference between AB4 (5 mg/kg) alone group and the normal group (Fig. S1D). Notably, we found that the AB4 pretreatment group was more effective than the AB4 treatment group and the 5-ASA group (Fig. S1B-D). At the same time, we examined the regulation of AB4 on the secretion of inflammatory cytokines in DSS-induced colitis. We found that AB4 pretreatment group had stronger inhibition on the secretion of pro-inflammatory cytokines secretion in the serum after the DSS challenge, such as IL-1β, IL-18, IL-6, inducible NOS (iNOS) and tumor necrosis factor (TNF)-α (Fig. S1E). AB4 is the main active ingredient in BTWT [ 13 – 15 ], in order to more accurately assess the impact of AB4 on mice colitis, we conducted a comparative study of the therapeutic effects of AB4 and BTWT on DSS-induced colitis. Mice were administered with AB4 (5 mg/kg) and BTWT (5 g/kg) decreased the disease activity indices characterized by diarrhea, bleeding, and weight loss compared to the DSS group. Remarkably, there were no significant differences in body weight change, disease activity index, and colon length between the AB4 (5 mg/kg) and BTWT (5 g/kg) groups (Supporting Information Fig. S2A-D). Furthermore, we examined the regulatory effects of AB4 and BTWT on the secretion of inflammatory cytokines in DSS-induced colitis. Both AB4 (5 mg/kg) and BTWT (5 g/kg) inhibited the secretion of pro-inflammatory cytokines in the serum following DSS challenge, including IL-1β, IL-18, IL-6, iNOS, and TNF-α. Surprisingly, AB4 exhibited a stronger inhibitory effect on IL-1β compared to BTWT, although there were no significant differences observed for the other factors (Fig. S2E). Hence, we had reason to believe that AB4 might be the main component of BTWT against colitis. We continued to investigate the effect of AB4 pretreatment on DSS-induced colitis in mice. We found AB4 (5, 10, and 15 mg/kg) markedly decreased the disease activity indices characterized by body weight loss, diarrhea, and bleeding in a dose-dependent manner compared with the DSS group (Fig. 1 D and E). Colonic shortening (Fig. 1 F), and splenomegaly (Fig. 1 G) caused by the DSS challenge were also improved at the given doses. There was no significant difference between AB4 (15 mg/kg) alone group and the normal group. At the same time, the survival experiment showed that AB4 improved the survival rate of mice compared with the DSS group (Fig. 1 H). These data suggested that AB4 successfully ameliorated DSS-induced colitis in mice. AB4 attenuates DSS-induced colon injury The increased permeability in the intestinal epithelium is an important indicator that the mechanical barrier function of the intestinal mucosa is impaired [ 21 ]. Next, we further evaluated the protective effect of AB4 on DSS-induced colitis. FITC-dextran assay of intestinal permeability in mice showed that the diffusion of FITC-dextran across the epithelium was significantly lower in AB4 administration mice (Fig. 2 A). This supported the conclusion that AB4 reduced DSS-induced intestinal mucosal injury in mice. Intestinal barrier function is maintained by tight junction proteins, such as Occludin, Claudin-1, and ZO-1 [ 21 ]. Compared with the DSS group, AB4 (5, 10, and 15 mg/kg) significantly enhanced the expression of Occludin, Claudin-1, and ZO-1 proteins (Fig. 2 B), which was consistent with the FITC-dextran results. Hematoxylin and eosin (H&E) staining indicated that AB4 (5, 10, and 15 mg/kg) notably alleviated mucosal damage, infiltration of inflammatory cells, and loss of crypts (Fig. 2 C). AB4 decreased histological colon damage score compared to the DSS group (Fig. 2 C). Consistently, AB4 (5, 10, and 15 mg/kg) significantly abolished the distribution of F4/80 + macrophages in colonic lamina propria (Fig. 2 D). Thus, AB4 attenuated the severity of DSS-induced colonic injury in mice. AB4 specifically inhibits NLRP3 inflammasome activation in colonic macrophages As previously reported, increased production of inflammatory cytokines in serum and colon is an important hallmark of DSS-induced colitis [ 4 , 5 ]. We examined the regulation of AB4 on the secretion of inflammatory cytokines in DSS-induced colitis. Indeed, AB4 (5, 10, and 15 mg/kg) inhibited the secretion of pro-inflammatory cytokines secretion in the serum after the DSS challenge, such as IL-1β, IL-18, IL-6, iNOS and TNF-α (Fig. 3 A). As an important component of innate immunity, NLRP3 inflammasome plays an important role in the development of UC, and is the main and key source of inflammatory cytokines IL-1β and IL-18. Targeting NLRP3 inflammasome has been shown to have a definite therapeutic effect [ 5 – 8 ]. To investigate the regulatory role of AB4 on the NLRP3 inflammasome in DSS-induced colitis, we evaluated both mRNA and protein levels of related cytokines in collected colons. AB4 (5, 10, and 15 mg/kg) exhibited significant inhibition on protein expression of NLRP3, ASC, Caspase-1 p20, IL-1β p17, and IL-18 in the colons of colitis mice (Fig. 3 B). In parallel, AB4 significantly decreased the mRNA levels of NLRP3, ASC, Caspase-1, IL-1β, IL-18, IL-6 and TNF-α (Fig. 3 C). IL-10 is a typical anti-inflammatory cytokine, and both IL-22 and IL-10 seem to maintain the integrity of the colonic epithelium [ 22 , 23 ]. We observed that AB4 enhanced the expression of IL-10 and IL-22 proteins in colonic homogenates of DSS-induced colitis and enhanced the mRNA level of IL-10 (Fig. 3 B and C). In agreement, we found that the colonic tissues from AB4 administration mice expressed high levels of proliferative cell nuclear antigen (PCNA) (Fig. 3 B). Therefore, we hypothesized that AB4 might inhibit the expression of NLRP3 inflammasome and the release of inflammatory cytokines, thereby ameliorating impaired intestinal barrier function and alleviating DSS-induced colitis. To determine whether AB4-inactivated NLRP3 inflammasome was derived from macrophages or intestinal epithelial cells, we isolated these two types of cell lines from different groups of mice. Interestingly, Western Blot and ELISA results showed that AB4 significantly inhibited the protein expression of NLRP3, Caspase-1 p20, IL-1β and IL-18 in colonic macrophages (Fig. 3 D), but did not affect the expression in intestinal epithelial cells (Fig. 3 E). To further confirm that the relief of AB4 from DSS-induced colitis depended on the intervention of NLRP3 inflammasome, we verified it in DSS-induced NLRP3-knockout (NLRP3 −/− ) mice and WT mice. DSS-induced NLRP3 −/− mice exhibited considerably less weight loss, lower DAI score (Fig. 4 A and B), and longer colons presentation (Fig. 4 C) as compared to WT mice, supporting a critical role of NLRP3 in the development of colitis. However, it was worth noting that the protective effect of AB4 on the DSS challenge was lost in NLRP3 −/− mice (Fig. 4 A-C). H&E staining showed that the epithelial damage of WT mice colon tissue was more severe and crypt loss than NLRP3 −/− mice and AB4 improved the damage and crypt loss of colon tissue in WT mice but had no significant effect on NLRP3 −/− mice (Fig. 4 D). Meanwhile, the ELISA results also confirmed our hypothesis (Fig. 4 E). Additionally, we employed BLI to assess the binding affinity (K D value) between AB4 and NLRP3 protein. The data revealed a lower binding affinity of AB4 for NLRP3 (K D = 634 µM, Supporting Information Fig. S3A). we also conducted CETSA and observed an increase in the degradation of NLRP3 protein with higher temperatures, while AB4 did not exhibit the ability to inhibit this degradation (Fig. S3B). These data suggested that inhibition of NLRP3 inflammasome activation might be one of the main mechanisms by which AB4 attenuated DSS-induced inflammatory injury in colitis. AB4 inhibits the activation of NLRP3 inflammasome in vitro Next, we examined whether AB4 could regulate the activation of NLRP3 inflammasome in macrophages in vitro. BMDMs were pretreated with AB4 (5, 10, and 20 µM) for 4 h, and then treated with LPS (1 µg/mL) for 6 h. Meanwhile, CCK-8 results showed that 5-500µM AB4 had no toxic effects on BMDMs and THP-1 cells (Supporting Information Fig. S4). The mRNA expression of related components in NLRP3 inflammasome was analyzed by qPCR. As shown in Fig. 5 A, AB4 (5, 10, and 20 µM) significantly inhibited the mRNA expressions of NLRP3, IL-1β, and IL-18 in LPS-primed BMDMs. By contrast, the expression of ASC and Caspase-1 were unaffected by AB4. Moreover, AB4 (5, 10, and 20 µM) could significantly inhibit the protein expression of NLRP3, proIL-1β, and IL-18 (Fig. 5 B). These data suggested that AB4 might partially regulate NLRP3 inflammasome activation by inhibiting the transcription of NLRP3, pro-IL-1β and IL-18 genes in macrophages. The constituent proteins of the NLRP3 inflammasome are widely considered to be the rate-limiting point regulating inflammasome activation [ 6 ]. Western Blot confirmed that AB4 (5, 10, and 20 µM) significantly inhibited the protein expressions of NLRP3, Caspase-1 P20, IL-1β p17 and IL-18 in LPS-primed BMDMs (Fig. 5 C) and differentiated THP-1 cells (Fig. 5 D) in response to ATP (5 mM; 30 min) or nigericin (Nig; 10 µM; 30 min), suggesting inactivation of NLRP3 inflammasome by AB4. Consistently, ELISA results also confirmed that IL-1β and IL-18 in the supernatants were suppressed by AB4 in LPS-primed BMDMs and differentiated THP-1 cells in response to nigericin (Fig. 5 E). These data suggested that AB4 might also affect the NLRP3 inflammasome assembly stage, namely reducing NLRP3-mediated Caspase-1 activation and inhibiting macrophage IL-1β and IL-18 secretion. Taken together, AB4 inhibited the activation of NLRP3 inflammasome in vitro. AB4 inactivates AKT-STAT1-PRDX1-NF-κB signaling in macrophages Subsequently, we explored how AB4 regulated NLRP3 inflammasome activation. NF-κB is a key activator of inflammation, which primes the activation of NLRP3 inflammasome by promoting the transcription of NLRP3, IL-1β, IL-18 [ 24 ]. First, we assessed the effects of AB4 on NF-κB signaling in vitro, the results showed AB4 (5, 10, and 20 µM) significantly decreased the protein expression of NF-κB p65 phosphorylation and nuclear factor κB (IκBα) phosphorylation in LPS-challenged BMDMs (Fig. 6 A) and differentiated THP-1 cells (Fig. 6 B), indicating an inhibitory action of AB4 on NF-κB signaling. Meanwhile, inhibition of NF-κB P65 and IκBα phosphorylation with NF-κB inhibitor JSH-23 (25 µM; 1 h) also attenuated LPS-challenged up-regulation of NLRP3, proIL-1β, and IL-18 protein (Fig. 6 C) levels in BMDMs, which is synergistic with AB4. These data indicated that the classical NF-κB signaling pathway mediated AB4-dependent inhibition of NLRP3, IL-1β, and IL-18. TLR4 can recognize the downstream transcription factor signals initiated by LPS and cause the transcriptional expression of inflammatory genes [ 25 ]. However, our result showed that AB4 was not associated with TLR4-involved activation of NLRP3 inflammasome signaling (Supporting Information Fig. S5). Next, we explored the direct signaling events of NF-κB inactivation by AB4. Peroxiredoxin 1 (PRDX1), a protein capable of promoting NF-κB activation by inducing IκBα phosphorylation, is considered a competitive molecule for the transcriptional control of inflammatory genes [ 26 , 27 ].Western Blot confirmed that AB4 (5, 10, and 20 µM) significantly reduced LPS-challenged PRDX1 protein expression in BMDMs (Fig. 6 A) and differentiated THP-1 cells (Fig. 6 B). Studies had shown that LPS-dependent PRDX1 expression was mediated by Protein kinase B (AKT)/signal transducer and activator of transcription 1(STAT1) signaling [ 26 ]. In agreement, AB4 (5, 10, and 20 µM) significantly reduced phosphorylation of AKT and STAT1 in LPS-challenged BMDMs (Fig. 6 A) and differentiated THP-1 cells (Fig. 6 B). Western Blot confirmed that AKT inhibitor MK2206 (20 µM; 1 h) effectively inhibited LPS-challenged AKT and STAT1 phosphorylation, resulting in the reduction of PRDX1 expression, phosphorylation of IκBα and P65, and the down-regulation of NLRP3, proIL-1β, and IL-18 (Fig. 6 D). By contrast, AKT agonist SC79 (20 µM; 2 h) could reverse the inhibitory effect of AB4 on LPS-challenged p-AKT, p-STAT1, PRDX1, p-P65, p-IκBα, NLRP3, proIL-1β and IL-18 proteins in BMDMs (Fig. 6 E). In keeping with this, we also demonstrated that AB4 (5, 10, and 15 mg/kg) could reduce the expression of p-AKT/AKT, p-STAT1/STAT1, PRDX1, p-P65/P65, p-IκBα/IκBα proteins in colonic homogenates of 3.0% DSS-induced WT mice (Fig. 6 F). These data suggested that AB4 might inhibit NLRP3 inflammasome activation by inactivating NF-κB by inhibiting AKT/STAT1-mediated PRDX1 expression. AB4 inhibited the activation of NLRP3 inflammasome through targeting CD1d CD1d molecule has the role of antigen presentation, and several studies have confirmed that CD1d-related immune pathways have important effects on UC [ 28 – 32 ]. One of our recent works showed that macrophage CD1d could inhibit NLRP3 inflammasome expression during inflammation [ 26 ]. To further investigate the mechanism by which AB4 alleviated the progression of colitis, we next investigated whether AB4 inhibited NLRP3 inflammasome expression in macrophages through CD1d signaling. In 3.0% DSS-induced WT mice colitis, compared with the control group, the expression level of CD1d protein in the colon tissue of the DSS group was significantly decreased. Compared with the DSS group, AB4 (5, 10, and 15 mg/kg) significantly enhanced CD1d protein (Supporting Information Fig. S6) expression in colonic homogenates of mice. Strikingly, AB4 enhanced CD1d protein expression in colonic macrophages (Fig. 7 A). And we proposed that AB4 might directly bind to CD1d and then played a key role in colitis. we initially performed molecular dynamics simulations to evaluate the stability of AB4 and CD1d. The results demonstrated successful fitting of AB4 within the catalytic domain, with a binding energy of -10.1 kcal/mol. Moreover, AB4 established multiple interactions with internal residues of CD1d (Fig. 7 B). The high binding affinity of AB4 for CD1d protein was further confirmed through BLI (K D = 3 µM, Fig. 7 C) and CETSA (Fig. 7 D). To investigate the dependence of AB4's protective effects on the CD1d signaling pathway, we induced DSS-induced colitis in both mice with specific depletion of CD1d in macrophages (CD1d −/− ) and wild-type (WT) mice. Inflammation index values (i.e., body weight loss, DAI score, and colon length) demonstrated that CD1d −/− mice were more susceptible to DSS-induced colitis compared with WT mice (Fig. 8 A-C), supporting a critical role of macrophage CD1d in the disease development. However, macrophage-specific CD1d depletion reversed the protective effects of AB4 (15 mg/kg) on body weight loss, DAI score, and colon shortening in DSS-induced colitis (Fig. 8 A-C). H&E staining and F4/80 + immunofluorescent revealed macrophage-specific CD1d depletion abolished AB4’s protective effects both in the colonic morphometry (Fig. 8 D) and macrophagic observation (Fig. 8 E). Western Blot and ELISA results confirmed that macrophage-specific CD1d depletion reversed the inhibition of the protein expression of p-AKT/AKT, p-STAT1/STAT1, PRDX1, p-P65/P65, p-IκBα/IκBα, NLRP3, ASC, Caspase-1 p20, IL-1β, and IL-18 by AB4 (Fig. 8 F-H). Collectively, these data suggested that AB4 might target CD1d thus reducing the AKT-STAT1-PRDX1-NF-κB signaling pathway, eventually inhibiting the activation of NLRP3 inflammasome and ameliorating DSS-induced colitis in mice. Discussion In this study, to evaluate the anti-inflammatory activity of AB4, we constructed DSS-induced colitis. We notably found that the AB4 pretreatment group was more effective than the AB4 treatment group and the 5-ASA positive group, and the efficacy was similar to BTWT. AB4 reduced the severity of colitis in WT mice by inhibiting the activation of NLRP3 inflammasome and promoting the balance of inflammatory factors and repair of intestinal epithelial damage. In contrast, it lost its ability to alleviate DSS-induced colitis in NLRP3 −/− mice. Then, we were surprised to find that AB4 inhibited NLRP3 inflammasome activation in colonic macrophages, but not in intestinal epithelial cells. Mechanistically, AB4 might target CD1d thus reducing the AKT-STAT1-PRDX1-NF-κB signaling pathway, eventually inhibiting the activation of NLRP3 inflammasome. Macrophage-specific CD1d depletion had been shown to reverse the protective effect of AB4. Together these data indicated that AB4 attenuated DSS-induced colitis by inhibiting CD1d-dependent NLRP3 inflammasome activation in macrophages. Ulcerative colitis (UC) is a chronic, non-specific, non-infectious, inflammatory intestinal disease mediated by abnormal immunity caused by multiple etiological factors [ 1 – 4 ]. UC has become a huge burden to human life due to its repeated course of the disease, difficult to cure and easy to cause cancer [ 1 – 4 ]. During the novel Corona Virus Disease 2019 (COVID-2019) pandemic, the clinical management of UC has always been an area of high concern for patients and physicians around the world. UC patients have changed their potential immune response, which may make them more susceptible to infection [ 33 ]. The standard treatment for patients with UC is to receive long-term immunosuppressive and anti-inflammatory therapy, however, this can lead to severe side effects that limit long-term use [ 4 ]. Therefore, there is an urgent need for drugs with high efficacy, low cost and few side effects. Pulsatilla decoction (Bai-Tou-Weng-Tang, BTWT) is a famous Chinese medicine prescription for intestinal diseases caused by inflammation. The main component of BTWT is Pulsatilla chinensis [ 12 ]. It contains a large number of triterpenoids saponins and is considered to be its main active ingredient [ 13 – 15 ]. Among them, the content of AB4 is the highest, which can be used as the quality control index of BTWT. [ 34 – 37 ]. To evalute the anti-inflammatory activity of AB4, we investigated the role of AB4 in 3.0%DSS-induced colitis. The data showed that AB4 (5 mg/kg) could attenuate the severity of colitis in WT mice. Notably, we first found that the AB4 pretreatment group was more effective than the AB4 treatment group and 5-ASA positive group, and the efficacy was similar to BTWT. Interestingly, we found that AB4 (5, 10, and 15 mg/kg) had a significant dose-dependent effect in reducing the severity of colitis. Considering drug safety, we found no significant difference between AB4 (15 mg/kg) alone group and the normal group. In addition, studies had shown that the median lethal dose (LD50) of AB4 after intravenous injection in mice was 3.36 g/kg [ 38 ], and the intravenous infusion dose was 2.5 g/kg for 14 consecutive days, with no significant toxic changes such as body weight, liver, and kidney function of mice were detected [ 17 ]. These data indicated that AB4 had a relatively high safety index and no adverse reactions had been detected to date. Therefore, as a natural product with high safety index, AB4 might be a promising drug candidate for the treatment of colitis. But the exact molecular mechanism remains unclear. Activation of the NLRP3 inflammasome plays an important role in mediating the inflammatory response in UC [ 39 , 40 ]. Increasing evidence confirms that blocking NLRP3 inflammasome activation in macrophages is a novel strategy to block inflammatory and immune responses [ 41 , 42 ]. In this paper, we found that the protective effect of AB4 on DSS-induced colitis in mice was attributable to the inhibition of NLRP3 inflammasome activation and subsequent stimulation of colon epithelial cell proliferation, local IL-22 and IL-10 expression. At the same time, we verified DSS-induced colitis in NLRP3 −/− and WT mice, and we found that AB4 lost its protective effect in NLRP3 −/− mice. Meanwhile, BLI and CESTA experiments showed that AB4 had a low binding force with NLRP3 protein. Thus, we proposed that the inhibition of NLRP3 inflammasome activation might serve as one of the primary mechanisms through which AB4 mitigated inflammation and associated damage in DSS-induced colitis. However, it had been demonstrated that activation of the NLRP3 inflammasome in intestinal epithelial cells led to the secretion of IL-18 and contributed to ameliorating intestinal epithelial barrier dysfunction [ 43 ]. Dupaul-Chicoine showed administration of exogenous recombinant IL-18 could improve the inflammatory symptoms of DSS-induced colitis, and the colitis was more severe in NLRP3 −/− mice than in WT mice [ 43 ]. Thus, drugs that selectively inhibit NLRP3 inflammasome activation in colonic macrophages but not intestinal epithelial cells have the potential to treat colitis. Our data strongly suggested that AB4 inhibited the activation of NLRP3 inflammasome in colonic macrophages, but not in intestinal epithelial cells. Therefore, we first found that AB4 selectively inhibited the activation of NLRP3 inflammasome in colonic macrophages to attenuate DSS-induced colitis. Although various stages of signaling involved in NLRP3 inflammasome activation have been studied, NLRP3 expression is considered to be an important factor in its associated inflammatory mechanisms [ 5 – 8 ]. Many regulatory mechanisms had been shown to inhibit NLRP3 inflammasome signaling, the most classic being the activation of the NF-κB signaling pathway [ 24 , 44 ]. NF-κB plays a key role in the pathogenesis of colon immune cell infiltration in UC patients and experimental colitis models [ 44 ]. Our study confirmed that AB4 significantly inhibited the NF-κB signaling pathway, showing down-regulated expression of p-P65/P65 and p-IκB/IκB, which is synergistic with NF-κB inhibitor JSH-23. TLR4 can recognize LPS-activated downstream transcription factor signals and induce transcription expression of inflammatory genes [ 25 ]. Notably, we found that AB4 was not associated with the activation of the NLRP3 inflammasome signaling pathway involved in TLR4. However, this contradicts previous research [ 15 ]. The difference in conclusions might be caused by the difference in administration concentration, action time, mouse background, and intestinal microbe. PRDX1 is a peroxidase reductase that plays an important regulatory role in reactive oxygen species scavenging, cell proliferation, differentiation, apoptosis, and inflammation [ 45 ]. A recent study showed that PRDX1 expression was increased in DSS-induced colitis, and silencing PRDX1 expression inhibited DSS-induced inflammation and apoptosis, thereby ameliorating colonic injury in rats [ 46 ]. Hansen demonstrated that extracellular PRDX1 promoted the activation of NF-κB by inducing the phosphorylation of IκBα [ 47 ]. In this study, we found that AB4 inhibited PRDX1 protein expression in LPS-challenged macrophages. AKT signaling pathway is involved in the regulation and release of pro-inflammatory cytokines, plays an important role in the occurrence and development of UC, and can mediate the expression of LPS-induced PRDX1 [ 23 , 48 ]. Considering the inhibitory effect of AB4 on PRDX1, we further investigated its effect on AKT signaling. Western Blot confirmed that AB4 inhibited AKT/STAT1 signaling pathway synergically with AKT inhibitor MK2206. Moreover, AKT agonist SC79 reversed the inhibitory effect of AB4 on the AKT-STAT1-PRDX1-NF-κB-NLRP3 signaling pathway. Similarly, in vivo studies also confirmed that AB4 inhibited NLRP3 inflammasome activation through the AKT-STAT1-PRDX1-NF-κB signaling pathway. The molecule CD1d has the antigen-presenting effect and is a member of the glycoprotein CD1 family. The homology between human CD1d and mouse CD1d1 is more than 95% [ 25 , 27 , 28 ]. Multiple studies have confirmed that CD1d-related immune pathways have an important effect on UC [ 28 – 32 ]. It had been reported that CD1d −/− mice were more sensitive to DSS-induced colitis, CD1d expressed in colonic intestinal epithelial cells of mice binds to the exogenous glycolipid ligand α-galactothenamide (α-GalCer) and induced the activation of NKT cells in a CD1d restrictive manner, thus alleviating DSS-induced colitis [ 49 ]. Moreover, CD1d could transmit interactive signals that trigger CD1d expressing intestinal epithelial cells to produce anti-inflammatory cytokine IL-10 and heat shock protein 110 (HSP110) to relieve DSS-induced colitis in mice [ 28 ]. Targeting this mechanism may help improve the treatment of UC and prevent colitis-related colorectal cancer. A recent work had demonstrated that CD1d1 negatively regulated the expression of NLRP3 inflammasome [ 26 ]. Therefore, we hypothesized that AB4 might play a protective role in colitis by regulating the NLRP3 inflammasome through the CD1d signaling pathway. First, we performed molecular dynamics simulations, BLI, and CETSA experiments demonstrated a high binding affinity between AB4 and CD1d protein. Next, we constructed 3.0% DSS-induced colitis in WT mice and found that AB4 significantly enhanced the expression of CD1d protein in colon tissue and colon macrophages. Surprisingly, macrophage-specific CD1d depletion had been shown to reverse the protective effects of AB4 on the NLRP3 inflammasome and DSS-induced colitis, which validated that the CD1d-dependent NLRP3 axis was a preferential signaling pathway. These results demonstrated for the first time that AB4 might trigger the endogenous negative signaling of CD1d, inhibiting the expression of NLRP3 inflammasomes through the AKT-STAT1-PRDX1-NF-κB signaling cascade, and alleviating DSS-induced colitis in mice. As CD1d is an MHC-like transmembrane protein, it contains 336 amino acids and 10 amino acids in the cytoplasmic tail. Therefore, whether AB4 directly targets CD1d or indirectly targets CD1d, as well as the specific amino acid sites are worth further investigation. In summary, our study confirmed that AB4 alleviated inflammatory damage in DSS-induced colitis by reducing the expression of inflammatory factors and improving intestinal barrier damage. Notably, we found for the first time that CD1d might be a therapeutic target for AB4. AB4 targeted macrophages CD1d thus to reduce AKT-STAT1-PRDX1-NF-κB signaling cascade, eventually inhibiting the activation of NLRP3 inflammasome and ameliorating DSS-induced colitis. As the main active component of BTWT, AB4 lays the groundwork for a better understanding of BTWT's clinical efficacy from an active ingredient perspective, and also lays a theoretical foundation for the future systematic study of the corresponding mechanism of action of BTWT. More importantly, new resources have been provided for the treatment of UC. However, the comprehensive safety evaluation and treatment optimization of AB4 in the clinical application is worthy of further study. MATERIALS AND METHODS Chemicals and reagents AB4 (C59H96O26, MW: 1221.38, > 98% purity) was purchased from Sichuan weikeqi-biotech (Chengdu, China). 5-ASA was purchased from Ipsen Pharma (Houdan, France). Dulbecco’s modified Eagle medium (DMEM), RPMI-1640, Fetal bovine serum (FBS), and penicillin-streptomycin were purchased from Gibco (Grand Island, USA). The Cell Counting Kit-8 (CCK-8) was purchased from Dojindo (Tokyo, Japan). Lipopolysaccharides (LPS), adenosine triphosphate (ATP), phorbol myristate acetate (PMA), and Nigericin (Nig) were purchased from Sigma-Aldrich (St. Louis, USA). Dextran sulfate sodium (DSS, molecular weight 36-50kDa) was purchased from MP Biomedicals (Solon, USA). Recombinant Murine M-CSF was purchased from PEPROTECH (Rocky Hill, USA). Cells culture and treatments Human monocyte cell line THP-1 was obtained from the Cell Bank of the Chinese Academic of Sciences (Shanghai, China). The THP-1 cells were cultured in 1640 supplemented with 2-mercaptoethanol (0.5 mM), penicillin (100 U/mL), streptomycin (100 µg/mL), and 10% FBS in an atmosphere of 5.0% CO 2 at 37°C. The cells can be induced to differentiate into macrophages by 0.5 mM PMA for 3 h. Bone marrow-derived macrophages (BMDMs) were cultured in a complete DMEM medium supplemented with 10% FBS and 30 ng/mL M-CSF [ 26 ]. The THP-1 cells and BMDMs were treated with LPS (1 µg/mL; 6 h) in the absence or presence of AB4. In order to activate NLRP3 inflammasome, BMDMs and the THP-1 cells were first treated by LPS (1 µg/mL; 6 h), and cells were further co-treated with ATP (5 mM; 30 min), or nigericin (10 µM; 30 min), respectively. In some experiments in this paper, cells were first treated with the NF-κB inhibitor JSH-23 (25 µM; 1 h; #B1645, APExBIO Technology LLC, USA), the AKT inhibitor MK220 (20 µM; 1 h; #SF2712, Beyotine, Shanghai, China), the AKT agonist SC79 (20 µM; 2 h; #SML0749, Sigma-Aldrich, Louis, USA), cells were further treated with LPS (1 µg/mL; 6 h). Cell lysates were extracted for qPCR or Western blot, and supernatants were collected for ELISA to detect the release of related cytokines. Cell viability Assess the viability of cells by using the CCK-8 assay. Briefly, the THP-1 cells or BMDMs were plated overnight in 96-well plates at a cell density of 1×10 5 cells/well. Cells were treated with various concentrations of AB4 (5-500 µM) for 24 h, with NaCl or 0.1% DMSO as control. All samples were then incubated with 90 µL fresh medium and 10 µL CCK-8 at 37°C for 2 h. Absorbance was measured with a microplate reader at 450 nm. Experiments were performed independently three times. Animals C57BL/6 mice (male, 20–22 g, 6–8 weeks) were purchased from Dalian Medical University (Dalian, China). NLRP3-deficient (NLRP3 −/− ; #017970) mice (male, 20–22 g, 6–8 weeks) and macrophage-specific CD1d deficient (CD1d −/− ) mice (male, 20–22 g, 6–8 weeks;CD1d1 fl/fl (#016929) mice were crossed with LyzM-Cre (#004781) mice to develop Lym CD1d1−/− mice, we referred to the mice as " CD1d −/− mice " for brevity [ 50 , 51 ]. These genetically modified mice were obtained from the Department of Immunology at the Third Military Medical University in Chongqing, China. The initial acquisition of these mice was made from the reputable Jackson Laboratory located in Bar Harbor, ME, USA. To ensure genetic stability and minimize the influence of unforeseen variables, all mice underwent a rigorous process of backcrossing for ten generations onto the B6 background. All mice were housed at a temperature of 20–25 ℃ and a relative humidity of 55%-65%, and free diet and water. All animal experiments were approved by the Animal Welfare and Ethics Committee of Dalian University (no. SCAV-EXPANIM). DSS-induced colitis and design of drug treatment C57BL/6 mice were fed with 3.0% ( w/v ) DSS in drinking water for 7 days to induce acute colitis. In order to explore the impact of AB4 on colitis, the mice were randomly divided into 5 groups ( n = 6 in each group): Normal group, DSS group, 5-ASA (200 mg/kg) group, AB4 pretreatment group (5 mg/kg), and AB4 treatment group (5 mg/kg). In order to more accurately evaluate the effect of AB4 on mice colitis, we compared the therapeutic effect of BTWT and AB4 on DSS-induced colitis, the mice were randomly divided into 4 groups ( n = 6 in each group): Normal group, DSS group, BTWT pretreatment group (5 g/kg), and AB4 pretreatment group (5 mg/kg). To further confirm the protective effect of AB4, the mice were randomly divided into 6 groups ( n = 8 in each group): Normal group, DSS group, AB4 (5, 10, and 15 mg/kg) groups, and AB4 (15 mg/kg) alone group. To further confirm that the protective effect of AB4 in DSS-induced colitis is dependent on the intervention of NLRP3 inflammasome, WT and NLRP3 −/− mice were randomly divided into 6 groups (n = 8 in each group): WT normal group, WT + DSS group, WT + DSS + AB4 (15 mg/kg) group, NLRP3 −/− normal group, NLRP3 −/− +DSS group, NLRP3 −/− +DSS + AB4 (15 mg/kg) group. To investigate whether the protective effect of AB4 against colitis depends on the CD1d signaling pathway, the WT and CD1d −/− mice were randomly divided into 6 groups (n = 8 in each group): WT normal group; WT + DSS group; WT + DSS + AB4 (15 mg/kg) group; CD1d −/− normal group; CD1d −/− +DSS group; CD1d −/− +DSS + AB4 (15 mg/kg) group. Measure and record the changes in body weight, blood in the stool, and diarrhea every day, and use a complete system to calculate the disease activity index (DAI) score [ 26 , 41 ]. Spleen index On the 7th day of modeling, the mice were sacrificed and the spleens of each group were taken. Spleen index = (Spleen weight (mg)/ Body weight (g)) ×10. FITC-dextran intestine-blood barrier tests To analyze the permeability of the epithelial barrier in mice, on the 7th day, mice in each group were deprived of water and fasted for 4 h, and then each mouse was gavaged with FITC-dextran (0.6 mg/g; Sigma-Aldrich). The blood was collected after 4 h, and the content of FITC-dextran in serum was measured with a fluorescence spectrophotometer setup with an emission wavelength of 490 nm and an excitation wavelength of 520 nm. Histological analysis and histopathological scores On the 7th day of modeling, the mice were sacrificed and the colons were taken. The colons were carefully rinsed with PBS solution, and the same parts of each colon were soaked and fixed with 4% paraformaldehyde. Conventional paraffin-embedded sections were stained with hematoxylin and eosin (H&E staining). The histopathological scores were determined using a well-established system [ 26 , 41 ]. Immunofluorescence of colon issues Paraformaldehyde-fixed colon tissues were embedded in paraffin for analysis of F4/80 + cell infiltration. Sections were washed three times with PBS and then exposed to 3.0% H 2 O 2 for 1 h to block endogenous peroxidase activity. Subsequently, the sections were blocked with 3% BSA for 30 min at room temperature and then incubated at 4°C overnight with anti-F4/80 (#GB11027, 1:500 per mouse, Servicebio). The next day, sections were placed in PBS (pH 7.4) and washed 3 times on a decolorizing shaker for 5 min each time. The corresponding secondary antibody was added and incubated for 50 min at room temperature and away from light. Fluorescence microscopy to analyze the results (Zeiss Axioplan 2). Enzyme-linked immunosorbent assay (ELISA) Assays were performed according to the manufacturer's protocol (CUSABIO BIOTECH, Wuhan, China), using mouse IL-1β, IL-18, IL-6, TNF-α, iNOS ELISA kits to detect supernatants of BMDMs culture, mouse serum, or colon tissue homogenate, and using human IL-1β, IL-18 ELISA kits to detect the supernatant of the THP-1 cells culture. Quantitative Real-time Polymerase Chain Reaction (qPCR) The expression of mRNA encoding for indicated genes in the THP-1cells or BMDMs was quantified by qPCR with the SYBR® Premix Ex Taq™ (#RR820A, Takara). Table 1 showed the main primers sequence used in this experiment. The relative expression of target gene was calculated by the 2 − ΔΔ C t method. Table 1 Primer sequences Primer Sequence (5′-3′) GAPDH Forward CCCACTCCTCCACCTTTGAC Reverse TGTTGCTGTAGCCAAATTCGTT IL-1β Forward CAGGCAGGCAGTATCACTCATTG Reverse CGTCACACACCAGCAGGTTATC NLRP3 Forward CCTGACCCAAACCCACCAGT Reverse TTCTTTCGGATGAGGCTGCTTA Caspase-1 Forward AAGAACAGAACAAAAGAAGATGGA Reverse ACCCTCGGAGAAAGATGTTGAAA ASC Forward GGATCCCACCCCACCCTAA Reverse CTCGAGTCAGCAGGCAGGAATAG IL-18 Forward TGAAGTAAGAGGACTGGCTGTGA Reverse ATCTTGTTGTGTCCTGGAACACG IL-6 Forward GACTGATGCTGGTGACAACC Reverse AGACAGGTCTGTTGGGAGTG TNF-α Forward CTCATGCACCACCATCAAGG Reverse ACCTGACCACTCTCCCTTTG Western blots Protein expression was detected by Western blots in the THP-1 cells, BMDMs, colonic macrophages, colonic epithelial cells, or colon tissues. Briefly, cells or tissues were lysed using RIPA lysis buffer (#P0013B, Beyotime Biotechnology). The cell lysates were centrifuged at 13000 g for 15 min, and the supernatant was mixed with 5×SDS sample buffer (#P0015L, Beyotime Biotechnology). After boiling, each group of samples was separated by electrophoresis and transferred to PVDF membrane (#FFP39, Beyotime Biotechnology). The membranes were probed with the appropriate antibodies and then detected using Western Blotting Substrate (#180–501, Tanon). The antibodies used are as follows: anti-actin-β (#AF7018, Affinity), anti-GAPDH (#AF7021, Affinity), anti-AKT (#AF6216, Affinity), anti–p-AKT (#AF0016, Affinity), anti-STAT1 (#AF6300, Affinity), anti-p-STAT1 (#AF3300, Affinity), anti-PRDX1 (#DF6652, Affinity), anti-CD1d (#ab215445, Abcam), anti-IL-18 (#ab71495, Abcam), anti-IL-1β (#ab234437, Abcam), anti-ZO1 (#ab216880, Abcam), anti-Claudin1 (#ab180158, Abcam), anti-Occludin (#ab222691, Abcam),anti-PCNA (#13100, CST), anti-p-IκBα (#2859, CST), anti-IκBα (#4812, CST), anti-p-p65 (#3033, CST), anti-p65 (#WL01273b, Wanleibio), anti-ASC (#WL02462, Wanleibio),anti-IL-22 (#WL04441, Wanleibio), anti-IL-10(#sc-365858, Santa Cruz Biotechnology), anti-Caspase-1 (#AG-20B-0042, AdipoGen), and anti-NLRP3 (#AG-20B-0014-C100, AdipoGen). The primary antibody dilution was 1:1000 ~ 1:2000. Biolayer Interferometry (BLI) assay For the measurement of the interaction between AB4 and the NLRP3 or CD1d protein, BLI was employed. Concentration gradients were prepared as follows: 500-250-125-62.5-31.25-15.625-7.8 µM for NLRP3 and 60-20-6.67-2.22-0.74 µM for CD1d. The proteins were mixed with AB4 and subsequently incubated at room temperature for 60 min. During the measurement process, the sample injection time was set as follows: 60 s for baseline, 120 s for contact time, and 80 s for dissociation time. All measurements were conducted at a temperature of 25°C. The obtained data from the Octet system were analyzed and processed using Octet Data Analysis 11.1 software, which enabled accurate interpretation and evaluation of the BLI results [ 52 ]. Cellular Thermal Shift Assay (CETSA) Referring to the previous literature by J. M. Li et al. [ 52 ], BMDM cell lysates were divided into two groups: one group was treated with compound AB5 (5 µM) and the other serving as a control with NaCl solution. After 1 h incubation at 37°C, the proteins in each group were divided into six individual samples. These samples were subjected to heat treatment, gradually increasing the temperature from 45°C to 65°C for 5 min at each temperature. Following centrifugation at 12,000 g for 15 min at 4°C, the supernatant was collected for subsequent analysis using the Western blot technique. Molecular Docking The crystal structure of CD1d (PDB ID: 1ZT4) was downloaded from the protein databank ( https://www.rcsb.org/ ). Download the chemical structure of AB4 (PubChem ID: 71307558) from the NCBI Compound Database ( https://pubchem.ncbi.nlm.nih.gov/ ). Molecular docking calculations were performed using Discovery Studio 3.0 (Accelrys, San Diego, CA) as previously described [ 53 ]. Isolation of colonic macrophages from mice Colonic macrophages were prepared as previously described [ 42 ]. First, the whole colons of mice in each group were collected and washed several times with HBSS. Then, the colonic tissue was cut into small pieces of 0.5 cm and added to predigestion solution (containing 1mM DTT, 5 mM EDTA, and 5% FBS) to remove epithelial cells and mucus. Then centrifuge at 140 g for 5 min. The supernatant was aspirated and the remaining colon fragments were cultured with 8 times the volume of digestive fluid containing 1 mg/ml collagenase VIII, 0.2 mg/mL DNaseI, 1 mg/mL Dispase II, and 10% FBS. It was digested at 37°C for 90 min. The samples were filtered, and resuspended in 40% and 80% fractions of the Percoll solution. After centrifugation at 386 g for 20 min, live cells in the middle layer were collected and the colonic macrophages were classified using Anti-F4/80 MicroBeads UltraPure mouse (#130-110-443, Miltenyi Biotec). Isolation of intestine epithelial cells from mice Intestine epithelial cells were prepared as previously described [ 42 ]. Briefly, precooled PBS (containing 5% penicillin, and streptomycin) was used to wash the colons of each group of mice, and ophthalmic shears were used to remove the Pyle's node, fat, and mesentery on the surface of the small intestine, and the tissue was cut to the size of 1cm. Incubate with 1 mM DTT and 3 mM EDTA at room temperature for 1 h without shaking. Cells were washed with PBS by centrifuging and then were solubilized in cell lysis buffer containing 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 10 mM Tris (pH 7.4), 150 mM NaCl, and protease, and phosphatase inhibitor cocktail (Solarbio). Statistical analysis Data shown in this study were obtained in at least three independent experiments. All results represent mean ± SD Statistical analysis was performed with GraphPad Prism 8.0 (San Diego, CA), and the differences among multiple groups were evaluated by one-way ANOVA test, and the survival data of in vivo experiments were analyzed by the log-rank test of the curve. P < 0.05 was considered statistically significant. Declarations COMPETING INTERESTS The authors declare no competing interests. AUTHOR CONTRIBUTIONS Jiao Li and Pan Li contributed to the conceptualization and writing of the manuscript. Shuo Yuan contributed to the methodology of the manuscript. Jia-Chen Xue contributed to the software of the manuscript. Huan Meng and Xiao-Ting Hou contributed to the data curation of the manuscript. Qing-Gao Zhang, Bi-Hu Gao and Xu-De Wang contributed to the manuscript revision, and decision to submit for publication. Qing-Gao Zhang, Bi-Hu Gao and Xu-De Wang contributed to reference analysis (corresponding authors). Jiao Li and Pan Li contributed equally to this work (co-first authors). ACKNOWLEDGEMENTS This work was supported by the National Natural Science Foundation of China (61671098), and the Korean Food Research Project (2017029). References Ge Y, Li Y, Gong J, Zhu W. Mesenteric organ lymphatics and inflammatory bowel disease. Ann Anat . 2018; 218 : 199-204. Torres J, Halfvarson J, Rodriguez-Lago I, Hedin CRH, Jess T, Dubinsky M , et al. Results of the Seventh Scientific Workshop of ECCO: Precision Medicine in IBD-Prediction and Prevention of Inflammatory Bowel Disease. J Crohns Colitis . 2021; 15(9) : 1443-1454. Kaplan GG. The global burden of IBD: from 2015 to 2025. Nat Rev Gastroenterol Hepatol . 2015; 12(12) : 720-727. de Lange KM, Barrett JC. Understanding inflammatory bowel disease via immunogenetics. J Autoimmun . 2015; 64 : 91-100. Moreira Lopes TC, Mosser DM, Goncalves R. Macrophage polarization in intestinal inflammation and gut homeostasis. Inflamm Res . 2020; 69(12) : 1163-1172. Song Y, Zhao Y, Ma Y, Wang Z, Rong L, Wang B , et al. Biological functions of NLRP3 inflammasome: A therapeutic target in inflammatory bowel disease. Cytokine Growth Factor Rev . 2021; 60 : 61-75. Zaki MH, Lamkanfi M, Kanneganti TD. The Nlrp3 inflammasome: contributions to intestinal homeostasis. Trends Immunol . 2011; 32(4) : 171-179. Hirota SA, Ng J, Lueng A, Khajah M, Parhar K, Li Y , et al. NLRP3 inflammasome plays a key role in the regulation of intestinal homeostasis. Inflamm Bowel Dis . 2011; 17(6) : 1359-1372. Bauer C, Duewell P, Mayer C, Lehr HA, Fitzgerald KA, Dauer M , et al. Colitis induced in mice with dextran sulfate sodium (DSS) is mediated by the NLRP3 inflammasome. Gut . 2010; 59(9) : 1192-1199. Sun Y, Zhao Y, Yao J, Zhao L, Wu Z, Wang Y , et al. Wogonoside protects against dextran sulfate sodium-induced experimental colitis in mice by inhibiting NF-kappaB and NLRP3 inflammasome activation. Biochem Pharmacol . 2015; 94(2) : 142-154. Newman DJ, Cragg GM. Natural Products as Sources of New Drugs over the Nearly Four Decades from 01/1981 to 09/2019. J Nat Prod . 2020; 83(3) : 770-803. Gu Z. Efficacy of the Baitouweng decoction plus mesalazine on ulcerative colonitis of the Shire type. Chinese Medicine Clinical Research . 2018; 10(10) : 105-106. Li YH, Zou M, Han Q, Deng LR, Weinshilboum RM. Therapeutic potential of triterpenoid saponin anemoside B4 from Pulsatilla chinensis. Pharmacol Res . 2020; 160 : 105079. Ma H, Zhou M, Duan W, Chen L, Wang L, Liu P. Anemoside B4 prevents acute ulcerative colitis through inhibiting of TLR4/NF-kappaB/MAPK signaling pathway. Int Immunopharmacol . 2020; 87 : 106794. Zhang Y, Zha Z, Shen W, Li D, Kang N, Chen Z , et al. Anemoside B4 ameliorates TNBS-induced colitis through S100A9/MAPK/NF-kappaB signaling pathway. Chin Med . 2021; 16(1) : 11. Han Q, Deng LR, Zou M, Tang HZ, Huang CY, Chen FJ , et al. Anemoside B4 protects against chronic relapsing colitis in mice by modulating inflammatory response, colonic transcriptome and the gut microbiota. Phytomedicine . 2022; 106 : 154416. He L, Zhang Y, Kang N, Wang Y, Zhang Z, Zha Z , et al. Anemoside B4 attenuates nephrotoxicity of cisplatin without reducing anti-tumor activity of cisplatin. Phytomedicine . 2019; 56 : 136-146. Yuan R, He J, Huang L, Du LJ, Gao H, Xu Q , et al. Anemoside B4 Protects against Acute Lung Injury by Attenuating Inflammation through Blocking NLRP3 Inflammasome Activation and TLR4 Dimerization. J Immunol Res . 2020; 2020 : 7502301. Chassaing B, Aitken JD, Malleshappa M, Vijay-Kumar M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr Protoc Immunol . 2014; 104 : 15 25 11-15 25 14. Clapper ML, Cooper HS, Chang WC. Dextran sulfate sodium-induced colitis-associated neoplasia: a promising model for the development of chemopreventive interventions. Acta Pharmacol Sin . 2007; 28(9) : 1450-1459. Sommer K, Wiendl M, Muller TM, Heidbreder K, Voskens C, Neurath MF , et al. Intestinal Mucosal Wound Healing and Barrier Integrity in IBD-Crosstalk and Trafficking of Cellular Players. Front Med (Lausanne) . 2021; 8 : 643973. Huber S, Gagliani N, Zenewicz LA, Huber FJ, Bosurgi L, Hu B , et al. IL-22BP is regulated by the inflammasome and modulates tumorigenesis in the intestine. Nature . 2012; 491(7423) : 259-263. Wu Q, Xie S, Zhu Y, Chen J, Tian J, Xiong S , et al. Wogonin Strengthens the Therapeutic Effects of Mesenchymal Stem Cells in DSS-Induced Colitis via Promoting IL-10 Production. Oxid Med Cell Longev . 2021; 2021 : 5527935. Schreiber S, Nikolaus S, Hampe J. Activation of nuclear factor kappa B inflammatory bowel disease. Gut . 1998; 42(4) : 477-484. Sheng K, Xu Y, Kong X, Wang J, Zha X, Wang Y. Probiotic Bacillus cereus Alleviates Dextran Sulfate Sodium-Induced Colitis in Mice through Improvement of the Intestinal Barrier Function, Anti-Inflammation, and Gut Microbiota Modulation. J Agric Food Chem . 2021; 69(49) : 14810-14823. Cui S, Wang C, Bai W, Li J, Pan Y, Huang X , et al. CD1d1 intrinsic signaling in macrophages controls NLRP3 inflammasome expression during inflammation. Sci Adv . 2020; 6(43). Ishii T, Yamada M, Sato H, Matsue M, Taketani S, Nakayama K , et al. Cloning and characterization of a 23-kDa stress-induced mouse peritoneal macrophage protein. J Biol Chem . 1993; 268(25) : 18633-18636. Olszak T, Neves JF, Dowds CM, Baker K, Glickman J, Davidson NO , et al. Protective mucosal immunity mediated by epithelial CD1d and IL-10. Nature . 2014; 509(7501) : 497-502. Mizoguchi A, Mizoguchi E, Takedatsu H, Blumberg RS, Bhan AK. Chronic intestinal inflammatory condition generates IL-10-producing regulatory B cell subset characterized by CD1d upregulation. Immunity . 2002; 16(2) : 219-230. Lee C, Hong SN, Paik NY, Kim TJ, Kim ER, Chang DK , et al. CD1d Modulates Colonic Inflammation in NOD2-/- Mice by Altering the Intestinal Microbial Composition Comprising Acetatifactor muris. J Crohns Colitis . 2019; 13(8) : 1081-1091. Huang E, Liu R, Lu Z, Liu J, Liu X, Zhang D , et al. NKT cells mediate the recruitment of neutrophils by stimulating epithelial chemokine secretion during colitis. Biochem Biophys Res Commun . 2016; 474(2) : 252-258. Fuss IJ, Heller F, Boirivant M, Leon F, Yoshida M, Fichtner-Feigl S , et al. Nonclassical CD1d-restricted NK T cells that produce IL-13 characterize an atypical Th2 response in ulcerative colitis. J Clin Invest . 2004; 113(10) : 1490-1497. Peng Y, Mentzer AJ, Liu G, Yao X, Yin Z, Dong D , et al. Broad and strong memory CD4(+) and CD8(+) T cells induced by SARS-CoV-2 in UK convalescent individuals following COVID-19. Nat Immunol . 2020; 21(11) : 1336-1345. Wang CM, Lin ZH, Lin ZQ, Yao QY, Zhang YF. Anemoside A3 rapidly reverses depression-like behaviors and weakening of excitatory synaptic transmission in mouse models of depression. J Psychopharmacol . 2019; 33(1) : 37-50. Ip FCF, Ng YP, Or TCT, Sun P, Fu G, Li JYH , et al. Anemoside A3 ameliorates experimental autoimmune encephalomyelitis by modulating T helper 17 cell response. PLoS One . 2017; 12(7) : e0182069. Ye B, Ji ZN. 23-hydroxybetulinic acid-induced HL-60 cell autophagic apoptosis and its molecular mechanism. Nat Prod Res . 2012; 26(11) : 1063-1068. Yao H, Wei G, Liu Y, Yao H, Zhu Z, Ye W , et al. Synthesis, Biological Evaluation of Fluorescent 23-Hydroxybetulinic Acid Probes, and Their Cellular Localization Studies. ACS Med Chem Lett . 2018; 9(10) : 1030-1034. Qin G, Mulan W, Luling H, Yulin F, Shilin Y, Lijun D , et al. Protective effect of Baicalin Saponin B4 on experimental acute renal function injury. Chinese Modern Traditional Chinese Medicine . 2019; 21(01) : 62-67+70. Zmora N, Levy M, Pevsner-Fishcer M, Elinav E. Inflammasomes and intestinal inflammation. Mucosal Immunol . 2017; 10(4) : 865-883. Qu S, Fan L, Qi Y, Xu C, Hu Y, Chen S , et al. Akkermansia muciniphila Alleviates Dextran Sulfate Sodium (DSS)-Induced Acute Colitis by NLRP3 Activation. Microbiol Spectr . 2021; 9(2) : e0073021. Lv Q, Xing Y, Liu J, Dong D, Liu Y, Qiao H , et al. Lonicerin targets EZH2 to alleviate ulcerative colitis by autophagy-mediated NLRP3 inflammasome inactivation. Acta Pharm Sin B . 2021; 11(9) : 2880-2899. Zhao Y, Guo Q, Zhu Q, Tan R, Bai D, Bu X , et al. Flavonoid VI-16 protects against DSS-induced colitis by inhibiting Txnip-dependent NLRP3 inflammasome activation in macrophages via reducing oxidative stress. Mucosal Immunol . 2019; 12(5) : 1150-1163. Dupaul-Chicoine J, Yeretssian G, Doiron K, Bergstrom KS, McIntire CR, LeBlanc PM , et al. Control of intestinal homeostasis, colitis, and colitis-associated colorectal cancer by the inflammatory caspases. Immunity . 2010; 32(3) : 367-378. Guo C, He Y, Gai L, Qu J, Shi Y, Xu W , et al. Balanophora polyandra Griff. prevents dextran sulfate sodium-induced murine experimental colitis via the regulation of NF-kappaB and NLRP3 inflammasome. Food Funct . 2020; 11(7) : 6104-6114. He Y, Li S, Tang D, Peng Y, Meng J, Peng S , et al. Circulating Peroxiredoxin-1 is a novel damage-associated molecular pattern and aggravates acute liver injury via promoting inflammation. Free Radic Biol Med . 2019; 137 : 24-36. Wu N, Du X, Peng Z, Zhang Z, Cui L, Li D , et al. Silencing of peroxiredoxin 1 expression ameliorates ulcerative colitis in a rat model. J Int Med Res . 2021; 49(3) : 300060520986313. Hansen JM, Moriarty-Craige S, Jones DP. Nuclear and cytoplasmic peroxiredoxin-1 differentially regulate NF-kappaB activities. Free Radic Biol Med . 2007; 43(2) : 282-288. Bast A, Fischer K, Erttmann SF, Walther R. Induction of peroxiredoxin I gene expression by LPS involves the Src/PI3K/JNK signalling pathway. Biochim Biophys Acta . 2010; 1799(5-6) : 402-410. Saubermann LJ, Beck P, De Jong YP, Pitman RS, Ryan MS, Kim HS , et al. Activation of natural killer T cells by alpha-galactosylceramide in the presence of CD1d provides protection against colitis in mice. Gastroenterology . 2000; 119(1) : 119-128. Huang XY, Feng ZQ, Jiang YZ, Li JL, Xiang Q, Guo S , et al. VSIG4 mediates transcriptional inhibition of Nlrp3 and Il-1β in macrophages. Sci Adv . 2019; 5(1) : 14. Cui S, Wang CH, Bai WZ, Li J, Pan Y, Huang XY , et al. CD1d1 intrinsic signaling in macrophages controls NLRP3 inflammasome expression during inflammation. Sci Adv . 2020a; 6(43). Li JM, Sheng HD, Wang YC, Lai ZC, Wang Y, Cui SL. Scaffold Hybrid of the Natural Product Tanshinone I with Piperidine for the Discovery of a Potent NLRP3 Inflammasome Inhibitor. Journal of Medicinal Chemistry . 2023; 66(4) : 2946-2963. Chen FY, Li C, Cao HY, Zhang HT, Lu C, Li RM , et al. Identification of Adenylate Kinase 5 as a Protein Target of Ginsenosides in Brain Tissues Using Mass Spectrometry-Based Drug Affinity Responsive Target Stability (DARTS) and Cellular Thermal Shift Assay (CETSA) Techniques. J Agric Food Chem . 2022; 70(8) : 2741-2751. Additional Declarations (Not answered) Supplementary Files WBXXXXXXXXXXXX.pdf western blots Supplementaryfile.docx FigureS1,FigureS2,FigureS3,FigureS4,FigureS5,FigureS6 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4382137","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":302764497,"identity":"e52f731d-ef3e-4e86-85d2-aa0b11e02bc2","order_by":0,"name":"Qinggao Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+0lEQVRIiWNgGAWjYDACCSSS4QObBYgyIF4L4ww2CaK1QAAzDzFa5Gc3P3v4pcwiT95/8cPHNmUSiQ3szdskGGru4NTCOOeYubHMOYliwxvPjI1zzgG18Bwrk2A49gynFmaJBDNpyTaJxI0zDphJ5wIZDRI5ZhKMDYdxamGTSP8G1XL8m7QlSIv8G/xaeIBmSn4EqpzP32MmzQi2hQe/FgmJnDJpBqAXNkjwFBv2nJMwbuNJK7ZIOIZbi/yM9G2SP8rqEuf3H9/44EeZjWw/++GNNz7U4NYCDgIeNmBc3EiA+g5EJODVAAzoH0Bl8v0HCCgbBaNgFIyCEQsAdD1QLoLdBlQAAAAASUVORK5CYII=","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Qinggao","middleName":"","lastName":"Zhang","suffix":""},{"id":302764498,"identity":"6ee754ab-2ae4-41ad-bebf-cc1d60c60ec0","order_by":1,"name":"jiao li","email":"","orcid":"","institution":"Affiliated Zhongshan Hospital of Dalian University","correspondingAuthor":false,"prefix":"","firstName":"jiao","middleName":"","lastName":"li","suffix":""},{"id":302764499,"identity":"f13091bf-3417-47a3-b382-65b929bc89b6","order_by":2,"name":"Pan Li","email":"","orcid":"","institution":"City University of Hong Kong","correspondingAuthor":false,"prefix":"","firstName":"Pan","middleName":"","lastName":"Li","suffix":""},{"id":302764500,"identity":"08c2e906-1126-4a3b-80c2-532bd09552d2","order_by":3,"name":"Shuo Yuan","email":"","orcid":"","institution":"dalian univisity","correspondingAuthor":false,"prefix":"","firstName":"Shuo","middleName":"","lastName":"Yuan","suffix":""},{"id":302764501,"identity":"3a615dfa-8527-4159-98ee-a972422c4748","order_by":4,"name":"Jiachen Xue","email":"","orcid":"","institution":"dalian univisity","correspondingAuthor":false,"prefix":"","firstName":"Jiachen","middleName":"","lastName":"Xue","suffix":""},{"id":302764502,"identity":"d5f23b1a-a899-4e2a-b68f-89e8e3ce1dae","order_by":5,"name":"Huan Meng","email":"","orcid":"","institution":"dalian univisity","correspondingAuthor":false,"prefix":"","firstName":"Huan","middleName":"","lastName":"Meng","suffix":""},{"id":302764503,"identity":"79908a73-9c00-4b6d-8d2d-83af9e8acb43","order_by":6,"name":"Xiaoting Hou","email":"","orcid":"","institution":"dalian univisity","correspondingAuthor":false,"prefix":"","firstName":"Xiaoting","middleName":"","lastName":"Hou","suffix":""},{"id":302764504,"identity":"b0ae36a0-9914-4d74-8696-4f5dfac95fe0","order_by":7,"name":"Bihu Gao","email":"","orcid":"","institution":"Affiliated Zhongshan Hospital of Dalian University","correspondingAuthor":false,"prefix":"","firstName":"Bihu","middleName":"","lastName":"Gao","suffix":""}],"badges":[],"createdAt":"2024-05-07 10:08:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4382137/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4382137/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":60566716,"identity":"4daac822-b3f0-47fc-8292-559da86d6976","added_by":"auto","created_at":"2024-07-18 08:40:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":675214,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAB4 ameliorates DSS-induced colitis symptoms.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Chemical structure of AB4. C57BL/6 mice were intraperitoneally injected with AB4 (5, 10, and 15 mg/kg) for 7 days, and then given 3.0% DSS in drinking water for 7 days, during which AB4 (5, 10, and 15 mg/kg) was continuously injected intraperitoneally (n = 8 per group). At the end of the experiment, the mice were sacrificed, and the colons and the spleens were collected. (\u003cstrong\u003eB\u003c/strong\u003e) The body weight change, (C) DAI score, (\u003cstrong\u003eD\u003c/strong\u003e) the colon length, (\u003cstrong\u003eE\u003c/strong\u003e) the spleen index, and (\u003cstrong\u003eF\u003c/strong\u003e) the survival rate were measured. Data are presented as mean ± SD. \u003cem\u003e**P \u0026lt; 0.01 \u003c/em\u003eand ns, not significantly different \u003cem\u003evs.\u003c/em\u003e Normal group; \u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.01\u003c/em\u003e \u003cem\u003evs.\u003c/em\u003e DSS group.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/5c4f513c355f734947696681.png"},{"id":60566709,"identity":"6c4271ae-cef9-4abc-b79d-ecbae9a5d434","added_by":"auto","created_at":"2024-07-18 08:40:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1621538,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAB4 attenuates DSS-induced colon injury.\u003c/strong\u003e Mice were pretreated with AB4 (5, 10, and 15 mg/kg) for 7 days, followed by DSS-induced colitis, the serum, and the colons were collected on day 7. (\u003cstrong\u003eA\u003c/strong\u003e) Measurement of serum permeability tracer FITC-dextran. (\u003cstrong\u003eB\u003c/strong\u003e) The protein expression of Occludin, Claudin-1 and ZO-1 was detected by Western Blot. (\u003cstrong\u003eC\u003c/strong\u003e) H\u0026amp;E staining analysis of histopathological changes (left) and semi-quantitative scoring of histopathology (right) and the images was taken at 200× magnification (scale bar: 50 μm). (\u003cstrong\u003eD\u003c/strong\u003e) The infiltration of F4/80\u003csup\u003e+\u003c/sup\u003e macrophages in colonic tissues were detected by immunofluorescence, and the images were taken at 200× magnification (scale bar: 50 μm). Data are presented as mean ± SD. \u003cem\u003e**P \u0026lt; 0.01\u003c/em\u003e \u003cem\u003evs. \u003c/em\u003eNormal group; \u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.01 vs.\u003c/em\u003e DSS group.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/68c50929e142fec8b646cb6d.png"},{"id":60566710,"identity":"e9dab71d-6703-4d2d-80e8-d4b45f2441bd","added_by":"auto","created_at":"2024-07-18 08:40:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":764136,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAB4 specifically inhibits NLRP3 inflammasome activation in colonic macrophages.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Production of IL-1β, IL-18, IL-6, iNOS, and TNF-α in the serum of DSS-induced colitis mice was determined by ELISA. (\u003cstrong\u003eB\u003c/strong\u003e) The indicated proteins of colonic homogenate-related factors were determined by Western Blot. (\u003cstrong\u003eC\u003c/strong\u003e) The mRNA levels of colonic homogenate-related factors were determined by qPCR. Western Blot was used to detect NLRP3, Caspase-1, and IL-18 protein expression in colon macrophages (\u003cstrong\u003eD\u003c/strong\u003e) and epithelial cells (\u003cstrong\u003eE\u003c/strong\u003e), and ELISA was used to detect IL-1β protein expression. Data are presented as mean ± SD. \u003cem\u003e**P \u0026lt; 0.01\u003c/em\u003e \u003cem\u003evs. \u003c/em\u003eNormal group; \u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.01 vs.\u003c/em\u003e DSS group.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/bc45e3462e401bd599de97d6.png"},{"id":60567244,"identity":"bc2e4aa5-00fa-4eea-a7bd-d5d11f3330fa","added_by":"auto","created_at":"2024-07-18 08:48:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1123247,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNLRP3 is critical for protection against DSS-induced injury by AB4.\u003c/strong\u003e NLRP3\u003csup\u003e-/-\u003c/sup\u003e mice and WT mice were intraperitoneally injected with AB4 (15 mg/kg) for 7 days, and then given 3.0% DSS in drinking water for 7 days, during which AB4 (15 mg/kg) was continuously injected intraperitoneally (n = 8 per group). At the end of the experiment, the mice were sacrificed, and the colons were collected. (\u003cstrong\u003eA\u003c/strong\u003e) The body weight change, (\u003cstrong\u003eB\u003c/strong\u003e) DAI score, and (\u003cstrong\u003eC\u003c/strong\u003e) the colon length was measured. (\u003cstrong\u003eD\u003c/strong\u003e) H\u0026amp;E staining analysis of histopathological changes (left) and semi-quantitative scoring of histopathology (right) and the images was taken at 200× magnification (scale bar: 50 μm). (\u003cstrong\u003eE\u003c/strong\u003e) Production of IL-1β, IL-18, IL-6, iNOS, and TNF-α in the serum of DSS-induced colitis mice was determined by ELISA. Data are presented as mean ± SD. \u003cem\u003e**P \u0026lt; 0.01 \u003c/em\u003eNLRP3\u003csup\u003e-/-\u003c/sup\u003e+DSS \u003cem\u003evs.\u003c/em\u003e WT+DSS; ns, not significantly different NLRP3\u003csup\u003e-/-\u003c/sup\u003e+DSS+AB4 \u003cem\u003evs.\u003c/em\u003e NLRP3\u003csup\u003e-/-\u003c/sup\u003e+DSS.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/024af01a62807d3f4d26dd13.png"},{"id":60566712,"identity":"fb5669d7-9243-4ff1-940a-77f5f7780773","added_by":"auto","created_at":"2024-07-18 08:40:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":638940,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAB4 inhibits the activation of NLRP3 inflammasome in vitro.\u003c/strong\u003e (\u003cstrong\u003eA-B\u003c/strong\u003e) BMDMs were pretreated with AB4 (5, 10, and 20 μM) for 4 h, and then cultured with LPS (1 μg/mL) for 6 h. The mRNA expression of related components in NLRP3 inflammasome was analyzed by qPCR (\u003cstrong\u003eA\u003c/strong\u003e). The protein expression of related components in NLRP3 inflammasome was analyzed by Western Blot (\u003cstrong\u003eB\u003c/strong\u003e). Data are presented as mean ± SD. \u003cem\u003e**P \u0026lt; 0.01 vs.\u003c/em\u003e Control group; \u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.01\u003c/em\u003e \u003cem\u003evs.\u003c/em\u003e LPS group. (\u003cstrong\u003eC-E\u003c/strong\u003e) BMDMs and differentiated THP-1 cells were pretreated with AB4 (5, 10, and 20 μM) for 4 h, and then cultured with LPS (1 μg/mL) for 6 h, followed by incubation with ATP (5 mM) for 30 min, nigericin (10 μM) for 30 min. The protein expressions of NLRP3, Caspase-1, IL-1β, and IL-18 were determined by Western Blot in BMDMs (\u003cstrong\u003eC\u003c/strong\u003e) and THP-1 cells (\u003cstrong\u003eD\u003c/strong\u003e); the production of IL-1β and IL-18 was analyzed by ELISA (\u003cstrong\u003eE\u003c/strong\u003e). Data are presented as mean ± SD. **\u003cem\u003eP\u003c/em\u003e \u0026lt; \u003cem\u003e0.01\u003c/em\u003e \u003cem\u003evs.\u003c/em\u003e Control group; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt;\u003cem\u003e 0.05\u003c/em\u003e, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; \u003cem\u003e0.01\u003c/em\u003e \u003cem\u003evs. \u003c/em\u003eLPS+ATP or LPS+Nig group.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/77de45d21ccf767a741af4fc.png"},{"id":60566713,"identity":"e78ab3d5-3867-4c5a-98ba-142564f3292e","added_by":"auto","created_at":"2024-07-18 08:40:31","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":841892,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAB4 inactivates AKT-STAT1-PRDX1-NF-kB signaling in macrophages.\u003c/strong\u003e BMDMs (\u003cstrong\u003eA\u003c/strong\u003e) and differentiated THP-1 cells (\u003cstrong\u003eB\u003c/strong\u003e) were pretreated with AB4 (5, 10, and 20 μM) for 4 h, and then cultured with LPS (1 μg/mL) for 6 h. The protein of the indicated molecule was detected by Western Blot. BMDMs were pretreated with AB4 (20 μM) for 4 h or NF-kB inhibitor JSH-23 (25 μM) for 1 h and then cultured with LPS (1 μg/mL) for 6 h. The protein of the indicated molecule was detected by Western Blot (\u003cstrong\u003eC\u003c/strong\u003e). (\u003cstrong\u003eD\u003c/strong\u003e) BMDMs were pretreated with AB4 (20 μM) for 4 h or AKT inhibitor MK2206 (20 μM) for 1 h and then cultured with LPS (1 μg/mL) for 6 h. The protein of the indicated molecule was detected by Western Blot. Data are presented as mean ± SD. \u003cem\u003e**P \u0026lt; 0.01 vs.\u003c/em\u003e Control group; \u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.01\u003c/em\u003e \u003cem\u003evs.\u003c/em\u003e LPS group. (\u003cstrong\u003eE\u003c/strong\u003e) BMDMs were pretreated with AB4 (20 μM) for 4 h or AKT agonist SC79 (20 μM) for 2 h and then cultured with LPS (1 μg/mL) for 6 h. The protein of the indicated molecule was detected by Western Blot. Data are presented as mean ± SD. \u003cem\u003e**P \u0026lt; 0.01 \u003c/em\u003eLPS+SC79+AB4 \u003cem\u003evs.\u003c/em\u003e LPS+AB4 group. (\u003cstrong\u003eF\u003c/strong\u003e) WT mice were subjected to DSS-induced colitis. The protein expression of the indicated molecule in colons was detected by Western Blot. Data are presented as mean ± SD. \u003cem\u003e**P \u0026lt; 0.01 vs.\u003c/em\u003e Normal group; \u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.01\u003c/em\u003e \u003cem\u003evs.\u003c/em\u003e DSS group.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/510e95a71e628c9a776e9dd5.png"},{"id":60566714,"identity":"7b0724f0-96a8-4877-8853-3558e80275b7","added_by":"auto","created_at":"2024-07-18 08:40:31","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":622618,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eInteraction of CD1d with AB4. \u003c/strong\u003eWT mice were subjected to DSS-induced colitis. The protein expression of CD1d in colonic macrophages (\u003cstrong\u003eA\u003c/strong\u003e) was detected by Western Blot. Data are presented as mean ± SD. \u003cem\u003e**P \u0026lt; 0.01 vs.\u003c/em\u003e Normal group; \u003csup\u003e\u003cem\u003e#\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.05, \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.01\u003c/em\u003e \u003cem\u003evs.\u003c/em\u003e DSS group. (\u003cstrong\u003eB\u003c/strong\u003e) BLI to determine the binding affinity (K\u003csub\u003eD\u003c/sub\u003e value) of the CD1d protein with AB4. The concentrations of AB4 were set to 0.74, 2.22, 6.67, 20, and 60 μM. (\u003cstrong\u003eC\u003c/strong\u003e) CETSA of the CD1d protein with AB4. Data are presented as mean ± SD.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/04c018773b0d1c42ede8b170.png"},{"id":60566719,"identity":"42ba22ac-5115-4016-9900-6d706a72508e","added_by":"auto","created_at":"2024-07-18 08:40:32","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1995485,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAB4 inhibits the activation of NLRP3 inflammasome through targeting CD1d.\u003c/strong\u003e CD1d\u003csup\u003e-/-\u003c/sup\u003e mice and WT mice were intraperitoneally injected with AB4 (15 mg/kg) for 7 days, and then given 3.0% DSS in drinking water for 7 days, during which AB4 (15 mg/kg) was continuously injected intraperitoneally (n = 8 per group). At the end of the experiment, the mice were sacrificed, and the colons were collected. (\u003cstrong\u003eA\u003c/strong\u003e) The body weight change, (\u003cstrong\u003eB\u003c/strong\u003e) DAI score, and (\u003cstrong\u003eC\u003c/strong\u003e) the colon length was measured. (\u003cstrong\u003eD\u003c/strong\u003e) H\u0026amp;E staining analysis of histopathological changes (left) and semi-quantitative scoring of histopathology (right) and the images was taken at 200× magnification (scale bar: 50 μm). (\u003cstrong\u003eE\u003c/strong\u003e) The infiltration of F4/80\u003csup\u003e+\u003c/sup\u003e macrophages in colonic tissue were determined by using an immunofluorescence assay, and the images were taken at 200x magnification (scale bar: 50 μm). Data are presented as mean ± SD. \u003cem\u003e*P \u0026lt; 0.05\u003c/em\u003e CD1d\u003csup\u003e-/- \u003c/sup\u003e+DSS\u003cem\u003e vs. \u003c/em\u003eWT+DSS;\u003cem\u003e \u003c/em\u003e\u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.01 \u003c/em\u003eCD1d\u003csup\u003e-/-\u003c/sup\u003e +DSS\u003cem\u003e+\u003c/em\u003eAB4 \u003cem\u003evs.\u003c/em\u003e WT+DSS\u003cem\u003e+\u003c/em\u003eAB4 group. (\u003cstrong\u003eE\u003c/strong\u003e) Production of IL-1β, IL-18, IL-6, iNOS, and TNF-α in the serum of DSS-induced colitis mice was determined by ELISA. (\u003cstrong\u003eF\u003c/strong\u003e) The protein of the indicated molecule was detected by Western Blot. (\u003cstrong\u003eG\u003c/strong\u003e) The production of IL-1β and IL-18 in colons was analyzed by ELISA. Data are presented as mean ± SD. \u003csup\u003e\u003cem\u003e##\u003c/em\u003e\u003c/sup\u003e\u003cem\u003eP \u0026lt; 0.01 \u003c/em\u003eCD1d\u003csup\u003e-/-\u003c/sup\u003e +DSS\u003cem\u003e+\u003c/em\u003eAB4 \u003cem\u003evs.\u003c/em\u003e WT+DSS\u003cem\u003e+\u003c/em\u003eAB4 group.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/83ff40a31fe831d51dcf1a1c.png"},{"id":60567879,"identity":"b93a953b-ff0b-49fe-840c-12657836419c","added_by":"auto","created_at":"2024-07-18 08:56:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":10351685,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/acc8d2f0-3ca6-4c88-8a39-105f47568fd7.pdf"},{"id":60567242,"identity":"0fb43fda-f5ed-452b-8b03-6f1a7a5498c5","added_by":"auto","created_at":"2024-07-18 08:48:31","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":5400795,"visible":true,"origin":"","legend":"western blots","description":"","filename":"WBXXXXXXXXXXXX.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/d9a643e52d8c2c7776d0c5e0.pdf"},{"id":60567243,"identity":"791bf658-d292-4948-9668-73cfb5a3f026","added_by":"auto","created_at":"2024-07-18 08:48:31","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1874742,"visible":true,"origin":"","legend":"FigureS1,FigureS2,FigureS3,FigureS4,FigureS5,FigureS6","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-4382137/v1/c413ac6a90ecba920b9a1d7d.docx"}],"financialInterests":"(Not answered)","formattedTitle":"Anemoside B4 alleviates DSS-induced colitis by inhibiting CD1d-dependent NLRP3 inflammasome activation in macrophages","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eUlcerative colitis (UC) is a type of nonspecific inflammatory bowel disease (IBD), which starts from the rectum and extends continuously to proximal segments of the colon [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. With the rapid development of industrialization and modernization, the global incidence of UC has also been rising continuously. The main pathological lesions are mucosal ulcers, and the typical clinical symptoms are diarrhea, rectal bleeding, and weight loss. Repeated episodes of UC increase the cumulative risk of colorectal cancer (CRC) by 18\u0026ndash;20%, which undoubtedly brings serious mental burden and psychological pressure to UC patients and seriously affects their normal life [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Although the exact cause of UC is uncertain at present, the activation of the mucosal immune system and the subsequent pathological cytokines play roles in the generation of UC [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. At present, UC patients can only receive long-term immunosuppressive and anti-inflammatory treatment, such as glucocorticoids, immune-suppressants, biological agents, and 5-aminosalicylic acid (5-ASA), as well as even require surgery, which is limited due to more side effects or high recurrence rate [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In this case, it is urgently needed to develop highly effective drugs with fewer side effects, long-term control ability of inflammation development, and stabilization of intestinal microenvironment.\u003c/p\u003e \u003cp\u003eMacrophages are abundant in colon samples from UC patients and animal models, which play an essential function in the occurrence, development and resolution of inflammation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Macrophages can respond to the damage-associated molecular patterns (DAMPs) and the pathogen-associated molecular patterns (PAMPs), enhance the recruitment, and activate other innate and adaptive immune cells to amplify intestinal inflammation [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The NLR family pyrin domain containing 3 (NLRP3) inflammasome is a multiprotein complex consisting of NLRP3, the apoptosis-associated peck-like protein with CARD domain (ASC), and Caspase-1. NLRP3 is a well-studied inflammasome, and numerous types of research have revealed that the NLRP3 activation of macrophages plays an important role in mediating UC inflammatory response [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Activation of the NLRP3 inflammasome is mediated by two key steps: Priming and assembling. [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The priming step is mediated by activation of nuclear factor kappa-B (NF-κB) signaling to up-regulate the transcription of inflammasome-related proteins (NLRP3, pro-interleukin (IL)-1β and IL-18). The assembling signal is induced by various triggers, such as adenosine 5\u0026prime;-triphosphate (ATP), potassium (K\u003csup\u003e+\u003c/sup\u003e) efflux, mitochondrial reactive oxygen species (mtROS), or lysosomal destabilization/rupture, induces the assembly of NLRP3 inflammasome [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Activation of NLRP3 inflammasome promotes the cleavage of Caspase-1 as well as the maturation and secretion of pro-inflammatory cytokines IL-1β and IL-18 [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Many studies have confirmed that the inhibition of NLRP3-mediated IL-1β and IL-18 production in macrophages improves dextran sulfate sodium (DSS)-induced inflammation [\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Toward this end, searching for drug candidates targeting NLRP3 inflammasome activation is an effective anti-inflammatory strategy for the potential treatment of UC.\u003c/p\u003e \u003cp\u003eNatural products provide a new source of compounds for the treatment of UC due to their abundant resources, definite efficacy, few side effects, and low price [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. \u003cem\u003ePulsatilla\u003c/em\u003e decoction (Bai-Tou-Weng-Tang, BTWT) is a classic Chinese herbal formula for the treatment of intestinal bacterial diseases in humans [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In recent years, many basic studies have verified the anti-colitis efficacy of BTWT [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. However, the active ingredient of BTWT's anti-colitis activity remains uncertain, which limits the discovery of its biological mechanisms, and hinders the further translation of BTWT into standard clinical application. Anemoside B4 (AB4) is a main natural saponin component isolated from the root of \u003cem\u003ePulsatilla Chinensis\u003c/em\u003e, which can be used as a quality control index. Recently, AB4 has been shown to possess antibacterial, anti-diarrhea, anti-inflammatory, anti-endotoxin, anti-tumor, and immunomodulatory [\u003cspan additionalcitationids=\"CR14 CR15 CR16 CR17\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Therefore, we hypothesized that AB4 might be a main component of BTWT anti-colitis. However, whether AB4 alleviates UC by inhibiting the activation of NLRP3 inflammasome remains unclear. What's more, the molecular target of AB4 remains unknown. In this study, we verified AB4\u0026rsquo;s protective effect on DSS-induced colitis. The mechanistic study highlighted that AB4 inhibited NLRP3 inflammasome activation by targeting macrophage CD1d to regulate AKT-STAT1-PRDX1-NF-κB signaling, thereby attenuating DSS-induced colitis.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAB4 ameliorates DSS-induced colitis symptoms\u003c/h2\u003e \u003cp\u003eDSS-induced colitis is known to be a widely accepted model with clinical symptoms similar to human UC, including diarrhea, rectal bleeding and weight loss [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. To evaluate the effect of AB4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) on colitis in mice, C57BL/6 (wild-type; WT) mice were challenged with 3.0% DSS for 7 days and then administered with AB4 (5 mg/kg) daily for 7 days or 14 days, as well as the 5-ASA (200 mg/kg) being the positive control (Supporting Information Fig. S1A). Surprisingly, AB4 significantly decreased the disease activity indices characterized by diarrhea, bleeding, and weight loss compared to the DSS group (Fig. S1B and S1C). Decreased disease severity was also accompanied by a reduction of colon shortening, which was ameliorated by both AB4 treatment and pretreatment. There was no significant difference between AB4 (5 mg/kg) alone group and the normal group (Fig. S1D). Notably, we found that the AB4 pretreatment group was more effective than the AB4 treatment group and the 5-ASA group (Fig. S1B-D). At the same time, we examined the regulation of AB4 on the secretion of inflammatory cytokines in DSS-induced colitis. We found that AB4 pretreatment group had stronger inhibition on the secretion of pro-inflammatory cytokines secretion in the serum after the DSS challenge, such as IL-1β, IL-18, IL-6, inducible NOS (iNOS) and tumor necrosis factor (TNF)-α (Fig. S1E). AB4 is the main active ingredient in BTWT [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], in order to more accurately assess the impact of AB4 on mice colitis, we conducted a comparative study of the therapeutic effects of AB4 and BTWT on DSS-induced colitis. Mice were administered with AB4 (5 mg/kg) and BTWT (5 g/kg) decreased the disease activity indices characterized by diarrhea, bleeding, and weight loss compared to the DSS group. Remarkably, there were no significant differences in body weight change, disease activity index, and colon length between the AB4 (5 mg/kg) and BTWT (5 g/kg) groups (Supporting Information Fig. S2A-D). Furthermore, we examined the regulatory effects of AB4 and BTWT on the secretion of inflammatory cytokines in DSS-induced colitis. Both AB4 (5 mg/kg) and BTWT (5 g/kg) inhibited the secretion of pro-inflammatory cytokines in the serum following DSS challenge, including IL-1β, IL-18, IL-6, iNOS, and TNF-α. Surprisingly, AB4 exhibited a stronger inhibitory effect on IL-1β compared to BTWT, although there were no significant differences observed for the other factors (Fig. S2E). Hence, we had reason to believe that AB4 might be the main component of BTWT against colitis.\u003c/p\u003e \u003cp\u003eWe continued to investigate the effect of AB4 pretreatment on DSS-induced colitis in mice. We found AB4 (5, 10, and 15 mg/kg) markedly decreased the disease activity indices characterized by body weight loss, diarrhea, and bleeding in a dose-dependent manner compared with the DSS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD and E). Colonic shortening (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF), and splenomegaly (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG) caused by the DSS challenge were also improved at the given doses. There was no significant difference between AB4 (15 mg/kg) alone group and the normal group. At the same time, the survival experiment showed that AB4 improved the survival rate of mice compared with the DSS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). These data suggested that AB4 successfully ameliorated DSS-induced colitis in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eAB4 attenuates DSS-induced colon injury\u003c/h2\u003e \u003cp\u003eThe increased permeability in the intestinal epithelium is an important indicator that the mechanical barrier function of the intestinal mucosa is impaired [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Next, we further evaluated the protective effect of AB4 on DSS-induced colitis. FITC-dextran assay of intestinal permeability in mice showed that the diffusion of FITC-dextran across the epithelium was significantly lower in AB4 administration mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). This supported the conclusion that AB4 reduced DSS-induced intestinal mucosal injury in mice. Intestinal barrier function is maintained by tight junction proteins, such as Occludin, Claudin-1, and ZO-1 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Compared with the DSS group, AB4 (5, 10, and 15 mg/kg) significantly enhanced the expression of Occludin, Claudin-1, and ZO-1 proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), which was consistent with the FITC-dextran results. Hematoxylin and eosin (H\u0026amp;E) staining indicated that AB4 (5, 10, and 15 mg/kg) notably alleviated mucosal damage, infiltration of inflammatory cells, and loss of crypts (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). AB4 decreased histological colon damage score compared to the DSS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Consistently, AB4 (5, 10, and 15 mg/kg) significantly abolished the distribution of F4/80\u003csup\u003e+\u003c/sup\u003e macrophages in colonic lamina propria (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Thus, AB4 attenuated the severity of DSS-induced colonic injury in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAB4 specifically inhibits NLRP3 inflammasome activation in colonic macrophages\u003c/h2\u003e \u003cp\u003eAs previously reported, increased production of inflammatory cytokines in serum and colon is an important hallmark of DSS-induced colitis [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. We examined the regulation of AB4 on the secretion of inflammatory cytokines in DSS-induced colitis. Indeed, AB4 (5, 10, and 15 mg/kg) inhibited the secretion of pro-inflammatory cytokines secretion in the serum after the DSS challenge, such as IL-1β, IL-18, IL-6, iNOS and TNF-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). As an important component of innate immunity, NLRP3 inflammasome plays an important role in the development of UC, and is the main and key source of inflammatory cytokines IL-1β and IL-18. Targeting NLRP3 inflammasome has been shown to have a definite therapeutic effect [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. To investigate the regulatory role of AB4 on the NLRP3 inflammasome in DSS-induced colitis, we evaluated both mRNA and protein levels of related cytokines in collected colons. AB4 (5, 10, and 15 mg/kg) exhibited significant inhibition on protein expression of NLRP3, ASC, Caspase-1 p20, IL-1β p17, and IL-18 in the colons of colitis mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). In parallel, AB4 significantly decreased the mRNA levels of NLRP3, ASC, Caspase-1, IL-1β, IL-18, IL-6 and TNF-α (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). IL-10 is a typical anti-inflammatory cytokine, and both IL-22 and IL-10 seem to maintain the integrity of the colonic epithelium [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. We observed that AB4 enhanced the expression of IL-10 and IL-22 proteins in colonic homogenates of DSS-induced colitis and enhanced the mRNA level of IL-10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB and C). In agreement, we found that the colonic tissues from AB4 administration mice expressed high levels of proliferative cell nuclear antigen (PCNA) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Therefore, we hypothesized that AB4 might inhibit the expression of NLRP3 inflammasome and the release of inflammatory cytokines, thereby ameliorating impaired intestinal barrier function and alleviating DSS-induced colitis. To determine whether AB4-inactivated NLRP3 inflammasome was derived from macrophages or intestinal epithelial cells, we isolated these two types of cell lines from different groups of mice. Interestingly, Western Blot and ELISA results showed that AB4 significantly inhibited the protein expression of NLRP3, Caspase-1 p20, IL-1β and IL-18 in colonic macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), but did not affect the expression in intestinal epithelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eTo further confirm that the relief of AB4 from DSS-induced colitis depended on the intervention of NLRP3 inflammasome, we verified it in DSS-induced NLRP3-knockout (NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) mice and WT mice. DSS-induced NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice exhibited considerably less weight loss, lower DAI score (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B), and longer colons presentation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) as compared to WT mice, supporting a critical role of NLRP3 in the development of colitis. However, it was worth noting that the protective effect of AB4 on the DSS challenge was lost in NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-C). H\u0026amp;E staining showed that the epithelial damage of WT mice colon tissue was more severe and crypt loss than NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice and AB4 improved the damage and crypt loss of colon tissue in WT mice but had no significant effect on NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Meanwhile, the ELISA results also confirmed our hypothesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Additionally, we employed BLI to assess the binding affinity (K\u003csub\u003eD\u003c/sub\u003e value) between AB4 and NLRP3 protein. The data revealed a lower binding affinity of AB4 for NLRP3 (K\u003csub\u003eD\u003c/sub\u003e = 634 \u0026micro;M, Supporting Information Fig. S3A). we also conducted CETSA and observed an increase in the degradation of NLRP3 protein with higher temperatures, while AB4 did not exhibit the ability to inhibit this degradation (Fig. S3B). These data suggested that inhibition of NLRP3 inflammasome activation might be one of the main mechanisms by which AB4 attenuated DSS-induced inflammatory injury in colitis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAB4 inhibits the activation of NLRP3 inflammasome in vitro\u003c/h2\u003e \u003cp\u003eNext, we examined whether AB4 could regulate the activation of NLRP3 inflammasome in macrophages in vitro. BMDMs were pretreated with AB4 (5, 10, and 20 \u0026micro;M) for 4 h, and then treated with LPS (1 \u0026micro;g/mL) for 6 h. Meanwhile, CCK-8 results showed that 5-500\u0026micro;M AB4 had no toxic effects on BMDMs and THP-1 cells (Supporting Information Fig. S4). The mRNA expression of related components in NLRP3 inflammasome was analyzed by qPCR. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, AB4 (5, 10, and 20 \u0026micro;M) significantly inhibited the mRNA expressions of NLRP3, IL-1β, and IL-18 in LPS-primed BMDMs. By contrast, the expression of ASC and Caspase-1 were unaffected by AB4. Moreover, AB4 (5, 10, and 20 \u0026micro;M) could significantly inhibit the protein expression of NLRP3, proIL-1β, and IL-18 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). These data suggested that AB4 might partially regulate NLRP3 inflammasome activation by inhibiting the transcription of NLRP3, pro-IL-1β and IL-18 genes in macrophages. The constituent proteins of the NLRP3 inflammasome are widely considered to be the rate-limiting point regulating inflammasome activation [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Western Blot confirmed that AB4 (5, 10, and 20 \u0026micro;M) significantly inhibited the protein expressions of NLRP3, Caspase-1 P20, IL-1β p17 and IL-18 in LPS-primed BMDMs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC) and differentiated THP-1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD) in response to ATP (5 mM; 30 min) or nigericin (Nig; 10 \u0026micro;M; 30 min), suggesting inactivation of NLRP3 inflammasome by AB4. Consistently, ELISA results also confirmed that IL-1β and IL-18 in the supernatants were suppressed by AB4 in LPS-primed BMDMs and differentiated THP-1 cells in response to nigericin (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). These data suggested that AB4 might also affect the NLRP3 inflammasome assembly stage, namely reducing NLRP3-mediated Caspase-1 activation and inhibiting macrophage IL-1β and IL-18 secretion. Taken together, AB4 inhibited the activation of NLRP3 inflammasome in vitro.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAB4 inactivates AKT-STAT1-PRDX1-NF-κB signaling in macrophages\u003c/h2\u003e \u003cp\u003eSubsequently, we explored how AB4 regulated NLRP3 inflammasome activation. NF-κB is a key activator of inflammation, which primes the activation of NLRP3 inflammasome by promoting the transcription of NLRP3, IL-1β, IL-18 [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. First, we assessed the effects of AB4 on NF-κB signaling in vitro, the results showed AB4 (5, 10, and 20 \u0026micro;M) significantly decreased the protein expression of NF-κB p65 phosphorylation and nuclear factor κB (IκBα) phosphorylation in LPS-challenged BMDMs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) and differentiated THP-1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), indicating an inhibitory action of AB4 on NF-κB signaling. Meanwhile, inhibition of NF-κB P65 and IκBα phosphorylation with NF-κB inhibitor JSH-23 (25 \u0026micro;M; 1 h) also attenuated LPS-challenged up-regulation of NLRP3, proIL-1β, and IL-18 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) levels in BMDMs, which is synergistic with AB4. These data indicated that the classical NF-κB signaling pathway mediated AB4-dependent inhibition of NLRP3, IL-1β, and IL-18. TLR4 can recognize the downstream transcription factor signals initiated by LPS and cause the transcriptional expression of inflammatory genes [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. However, our result showed that AB4 was not associated with TLR4-involved activation of NLRP3 inflammasome signaling (Supporting Information Fig. S5).\u003c/p\u003e \u003cp\u003eNext, we explored the direct signaling events of NF-κB inactivation by AB4. Peroxiredoxin 1 (PRDX1), a protein capable of promoting NF-κB activation by inducing IκBα phosphorylation, is considered a competitive molecule for the transcriptional control of inflammatory genes [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].Western Blot confirmed that AB4 (5, 10, and 20 \u0026micro;M) significantly reduced LPS-challenged PRDX1 protein expression in BMDMs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) and differentiated THP-1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Studies had shown that LPS-dependent PRDX1 expression was mediated by Protein kinase B (AKT)/signal transducer and activator of transcription 1(STAT1) signaling [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. In agreement, AB4 (5, 10, and 20 \u0026micro;M) significantly reduced phosphorylation of AKT and STAT1 in LPS-challenged BMDMs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) and differentiated THP-1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Western Blot confirmed that AKT inhibitor MK2206 (20 \u0026micro;M; 1 h) effectively inhibited LPS-challenged AKT and STAT1 phosphorylation, resulting in the reduction of PRDX1 expression, phosphorylation of IκBα and P65, and the down-regulation of NLRP3, proIL-1β, and IL-18 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). By contrast, AKT agonist SC79 (20 \u0026micro;M; 2 h) could reverse the inhibitory effect of AB4 on LPS-challenged p-AKT, p-STAT1, PRDX1, p-P65, p-IκBα, NLRP3, proIL-1β and IL-18 proteins in BMDMs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). In keeping with this, we also demonstrated that AB4 (5, 10, and 15 mg/kg) could reduce the expression of p-AKT/AKT, p-STAT1/STAT1, PRDX1, p-P65/P65, p-IκBα/IκBα proteins in colonic homogenates of 3.0% DSS-induced WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). These data suggested that AB4 might inhibit NLRP3 inflammasome activation by inactivating NF-κB by inhibiting AKT/STAT1-mediated PRDX1 expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAB4 inhibited the activation of NLRP3 inflammasome through targeting CD1d\u003c/h2\u003e \u003cp\u003eCD1d molecule has the role of antigen presentation, and several studies have confirmed that CD1d-related immune pathways have important effects on UC [\u003cspan additionalcitationids=\"CR29 CR30 CR31\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. One of our recent works showed that macrophage CD1d could inhibit NLRP3 inflammasome expression during inflammation [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. To further investigate the mechanism by which AB4 alleviated the progression of colitis, we next investigated whether AB4 inhibited NLRP3 inflammasome expression in macrophages through CD1d signaling. In 3.0% DSS-induced WT mice colitis, compared with the control group, the expression level of CD1d protein in the colon tissue of the DSS group was significantly decreased. Compared with the DSS group, AB4 (5, 10, and 15 mg/kg) significantly enhanced CD1d protein (Supporting Information Fig. S6) expression in colonic homogenates of mice. Strikingly, AB4 enhanced CD1d protein expression in colonic macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). And we proposed that AB4 might directly bind to CD1d and then played a key role in colitis. we initially performed molecular dynamics simulations to evaluate the stability of AB4 and CD1d. The results demonstrated successful fitting of AB4 within the catalytic domain, with a binding energy of -10.1 kcal/mol. Moreover, AB4 established multiple interactions with internal residues of CD1d (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). The high binding affinity of AB4 for CD1d protein was further confirmed through BLI (K\u003csub\u003eD\u003c/sub\u003e = 3 \u0026micro;M, Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC) and CETSA (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eTo investigate the dependence of AB4's protective effects on the CD1d signaling pathway, we induced DSS-induced colitis in both mice with specific depletion of CD1d in macrophages (CD1d\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) and wild-type (WT) mice. Inflammation index values (i.e., body weight loss, DAI score, and colon length) demonstrated that CD1d\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice were more susceptible to DSS-induced colitis compared with WT mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA-C), supporting a critical role of macrophage CD1d in the disease development. However, macrophage-specific CD1d depletion reversed the protective effects of AB4 (15 mg/kg) on body weight loss, DAI score, and colon shortening in DSS-induced colitis (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA-C). H\u0026amp;E staining and F4/80\u003csup\u003e+\u003c/sup\u003e immunofluorescent revealed macrophage-specific CD1d depletion abolished AB4\u0026rsquo;s protective effects both in the colonic morphometry (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD) and macrophagic observation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). Western Blot and ELISA results confirmed that macrophage-specific CD1d depletion reversed the inhibition of the protein expression of p-AKT/AKT, p-STAT1/STAT1, PRDX1, p-P65/P65, p-IκBα/IκBα, NLRP3, ASC, Caspase-1 p20, IL-1β, and IL-18 by AB4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF-H). Collectively, these data suggested that AB4 might target CD1d thus reducing the AKT-STAT1-PRDX1-NF-κB signaling pathway, eventually inhibiting the activation of NLRP3 inflammasome and ameliorating DSS-induced colitis in mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, to evaluate the anti-inflammatory activity of AB4, we constructed DSS-induced colitis. We notably found that the AB4 pretreatment group was more effective than the AB4 treatment group and the 5-ASA positive group, and the efficacy was similar to BTWT. AB4 reduced the severity of colitis in WT mice by inhibiting the activation of NLRP3 inflammasome and promoting the balance of inflammatory factors and repair of intestinal epithelial damage. In contrast, it lost its ability to alleviate DSS-induced colitis in NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice. Then, we were surprised to find that AB4 inhibited NLRP3 inflammasome activation in colonic macrophages, but not in intestinal epithelial cells. Mechanistically, AB4 might target CD1d thus reducing the AKT-STAT1-PRDX1-NF-κB signaling pathway, eventually inhibiting the activation of NLRP3 inflammasome. Macrophage-specific CD1d depletion had been shown to reverse the protective effect of AB4. Together these data indicated that AB4 attenuated DSS-induced colitis by inhibiting CD1d-dependent NLRP3 inflammasome activation in macrophages.\u003c/p\u003e \u003cp\u003eUlcerative colitis (UC) is a chronic, non-specific, non-infectious, inflammatory intestinal disease mediated by abnormal immunity caused by multiple etiological factors [\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. UC has become a huge burden to human life due to its repeated course of the disease, difficult to cure and easy to cause cancer [\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. During the novel Corona Virus Disease 2019 (COVID-2019) pandemic, the clinical management of UC has always been an area of high concern for patients and physicians around the world. UC patients have changed their potential immune response, which may make them more susceptible to infection [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The standard treatment for patients with UC is to receive long-term immunosuppressive and anti-inflammatory therapy, however, this can lead to severe side effects that limit long-term use [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Therefore, there is an urgent need for drugs with high efficacy, low cost and few side effects.\u003c/p\u003e \u003cp\u003e \u003cem\u003ePulsatilla\u003c/em\u003e decoction (Bai-Tou-Weng-Tang, BTWT) is a famous Chinese medicine prescription for intestinal diseases caused by inflammation. The main component of BTWT is \u003cem\u003ePulsatilla chinensis\u003c/em\u003e [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. It contains a large number of triterpenoids saponins and is considered to be its main active ingredient [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Among them, the content of AB4 is the highest, which can be used as the quality control index of BTWT. [\u003cspan additionalcitationids=\"CR35 CR36\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. To evalute the anti-inflammatory activity of AB4, we investigated the role of AB4 in 3.0%DSS-induced colitis. The data showed that AB4 (5 mg/kg) could attenuate the severity of colitis in WT mice. Notably, we first found that the AB4 pretreatment group was more effective than the AB4 treatment group and 5-ASA positive group, and the efficacy was similar to BTWT. Interestingly, we found that AB4 (5, 10, and 15 mg/kg) had a significant dose-dependent effect in reducing the severity of colitis. Considering drug safety, we found no significant difference between AB4 (15 mg/kg) alone group and the normal group. In addition, studies had shown that the median lethal dose (LD50) of AB4 after intravenous injection in mice was 3.36 g/kg [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], and the intravenous infusion dose was 2.5 g/kg for 14 consecutive days, with no significant toxic changes such as body weight, liver, and kidney function of mice were detected [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. These data indicated that AB4 had a relatively high safety index and no adverse reactions had been detected to date. Therefore, as a natural product with high safety index, AB4 might be a promising drug candidate for the treatment of colitis. But the exact molecular mechanism remains unclear.\u003c/p\u003e \u003cp\u003eActivation of the NLRP3 inflammasome plays an important role in mediating the inflammatory response in UC [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Increasing evidence confirms that blocking NLRP3 inflammasome activation in macrophages is a novel strategy to block inflammatory and immune responses [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. In this paper, we found that the protective effect of AB4 on DSS-induced colitis in mice was attributable to the inhibition of NLRP3 inflammasome activation and subsequent stimulation of colon epithelial cell proliferation, local IL-22 and IL-10 expression. At the same time, we verified DSS-induced colitis in NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e and WT mice, and we found that AB4 lost its protective effect in NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice. Meanwhile, BLI and CESTA experiments showed that AB4 had a low binding force with NLRP3 protein. Thus, we proposed that the inhibition of NLRP3 inflammasome activation might serve as one of the primary mechanisms through which AB4 mitigated inflammation and associated damage in DSS-induced colitis. However, it had been demonstrated that activation of the NLRP3 inflammasome in intestinal epithelial cells led to the secretion of IL-18 and contributed to ameliorating intestinal epithelial barrier dysfunction [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Dupaul-Chicoine showed administration of exogenous recombinant IL-18 could improve the inflammatory symptoms of DSS-induced colitis, and the colitis was more severe in NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice than in WT mice [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Thus, drugs that selectively inhibit NLRP3 inflammasome activation in colonic macrophages but not intestinal epithelial cells have the potential to treat colitis. Our data strongly suggested that AB4 inhibited the activation of NLRP3 inflammasome in colonic macrophages, but not in intestinal epithelial cells. Therefore, we first found that AB4 selectively inhibited the activation of NLRP3 inflammasome in colonic macrophages to attenuate DSS-induced colitis.\u003c/p\u003e \u003cp\u003eAlthough various stages of signaling involved in NLRP3 inflammasome activation have been studied, NLRP3 expression is considered to be an important factor in its associated inflammatory mechanisms [\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Many regulatory mechanisms had been shown to inhibit NLRP3 inflammasome signaling, the most classic being the activation of the NF-κB signaling pathway [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. NF-κB plays a key role in the pathogenesis of colon immune cell infiltration in UC patients and experimental colitis models [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Our study confirmed that AB4 significantly inhibited the NF-κB signaling pathway, showing down-regulated expression of p-P65/P65 and p-IκB/IκB, which is synergistic with NF-κB inhibitor JSH-23. TLR4 can recognize LPS-activated downstream transcription factor signals and induce transcription expression of inflammatory genes [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Notably, we found that AB4 was not associated with the activation of the NLRP3 inflammasome signaling pathway involved in TLR4. However, this contradicts previous research [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The difference in conclusions might be caused by the difference in administration concentration, action time, mouse background, and intestinal microbe. PRDX1 is a peroxidase reductase that plays an important regulatory role in reactive oxygen species scavenging, cell proliferation, differentiation, apoptosis, and inflammation [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. A recent study showed that PRDX1 expression was increased in DSS-induced colitis, and silencing PRDX1 expression inhibited DSS-induced inflammation and apoptosis, thereby ameliorating colonic injury in rats [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Hansen demonstrated that extracellular PRDX1 promoted the activation of NF-κB by inducing the phosphorylation of IκBα [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. In this study, we found that AB4 inhibited PRDX1 protein expression in LPS-challenged macrophages. AKT signaling pathway is involved in the regulation and release of pro-inflammatory cytokines, plays an important role in the occurrence and development of UC, and can mediate the expression of LPS-induced PRDX1 [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Considering the inhibitory effect of AB4 on PRDX1, we further investigated its effect on AKT signaling. Western Blot confirmed that AB4 inhibited AKT/STAT1 signaling pathway synergically with AKT inhibitor MK2206. Moreover, AKT agonist SC79 reversed the inhibitory effect of AB4 on the AKT-STAT1-PRDX1-NF-κB-NLRP3 signaling pathway. Similarly, in vivo studies also confirmed that AB4 inhibited NLRP3 inflammasome activation through the AKT-STAT1-PRDX1-NF-κB signaling pathway.\u003c/p\u003e \u003cp\u003eThe molecule CD1d has the antigen-presenting effect and is a member of the glycoprotein CD1 family. The homology between human CD1d and mouse CD1d1 is more than 95% [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Multiple studies have confirmed that CD1d-related immune pathways have an important effect on UC [\u003cspan additionalcitationids=\"CR29 CR30 CR31\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. It had been reported that CD1d\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice were more sensitive to DSS-induced colitis, CD1d expressed in colonic intestinal epithelial cells of mice binds to the exogenous glycolipid ligand α-galactothenamide (α-GalCer) and induced the activation of NKT cells in a CD1d restrictive manner, thus alleviating DSS-induced colitis [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Moreover, CD1d could transmit interactive signals that trigger CD1d expressing intestinal epithelial cells to produce anti-inflammatory cytokine IL-10 and heat shock protein 110 (HSP110) to relieve DSS-induced colitis in mice [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Targeting this mechanism may help improve the treatment of UC and prevent colitis-related colorectal cancer. A recent work had demonstrated that CD1d1 negatively regulated the expression of NLRP3 inflammasome [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Therefore, we hypothesized that AB4 might play a protective role in colitis by regulating the NLRP3 inflammasome through the CD1d signaling pathway. First, we performed molecular dynamics simulations, BLI, and CETSA experiments demonstrated a high binding affinity between AB4 and CD1d protein. Next, we constructed 3.0% DSS-induced colitis in WT mice and found that AB4 significantly enhanced the expression of CD1d protein in colon tissue and colon macrophages. Surprisingly, macrophage-specific CD1d depletion had been shown to reverse the protective effects of AB4 on the NLRP3 inflammasome and DSS-induced colitis, which validated that the CD1d-dependent NLRP3 axis was a preferential signaling pathway. These results demonstrated for the first time that AB4 might trigger the endogenous negative signaling of CD1d, inhibiting the expression of NLRP3 inflammasomes through the AKT-STAT1-PRDX1-NF-κB signaling cascade, and alleviating DSS-induced colitis in mice. As CD1d is an MHC-like transmembrane protein, it contains 336 amino acids and 10 amino acids in the cytoplasmic tail. Therefore, whether AB4 directly targets CD1d or indirectly targets CD1d, as well as the specific amino acid sites are worth further investigation.\u003c/p\u003e \u003cp\u003eIn summary, our study confirmed that AB4 alleviated inflammatory damage in DSS-induced colitis by reducing the expression of inflammatory factors and improving intestinal barrier damage. Notably, we found for the first time that CD1d might be a therapeutic target for AB4. AB4 targeted macrophages CD1d thus to reduce AKT-STAT1-PRDX1-NF-κB signaling cascade, eventually inhibiting the activation of NLRP3 inflammasome and ameliorating DSS-induced colitis. As the main active component of BTWT, AB4 lays the groundwork for a better understanding of BTWT's clinical efficacy from an active ingredient perspective, and also lays a theoretical foundation for the future systematic study of the corresponding mechanism of action of BTWT. More importantly, new resources have been provided for the treatment of UC. However, the comprehensive safety evaluation and treatment optimization of AB4 in the clinical application is worthy of further study.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eChemicals and reagents\u003c/h2\u003e \u003cp\u003eAB4 (C59H96O26, MW: 1221.38, \u0026gt;\u0026thinsp;98% purity) was purchased from Sichuan weikeqi-biotech (Chengdu, China). 5-ASA was purchased from Ipsen Pharma (Houdan, France). Dulbecco\u0026rsquo;s modified Eagle medium (DMEM), RPMI-1640, Fetal bovine serum (FBS), and penicillin-streptomycin were purchased from Gibco (Grand Island, USA). The Cell Counting Kit-8 (CCK-8) was purchased from Dojindo (Tokyo, Japan). Lipopolysaccharides (LPS), adenosine triphosphate (ATP), phorbol myristate acetate (PMA), and Nigericin (Nig) were purchased from Sigma-Aldrich (St. Louis, USA). Dextran sulfate sodium (DSS, molecular weight 36-50kDa) was purchased from MP Biomedicals (Solon, USA). Recombinant Murine M-CSF was purchased from PEPROTECH (Rocky Hill, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eCells culture and treatments\u003c/h2\u003e \u003cp\u003eHuman monocyte cell line THP-1 was obtained from the Cell Bank of the Chinese Academic of Sciences (Shanghai, China). The THP-1 cells were cultured in 1640 supplemented with 2-mercaptoethanol (0.5 mM), penicillin (100 U/mL), streptomycin (100 \u0026micro;g/mL), and 10% FBS in an atmosphere of 5.0% CO\u003csub\u003e2\u003c/sub\u003e at 37\u0026deg;C. The cells can be induced to differentiate into macrophages by 0.5 mM PMA for 3 h. Bone marrow-derived macrophages (BMDMs) were cultured in a complete DMEM medium supplemented with 10% FBS and 30 ng/mL M-CSF [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The THP-1 cells and BMDMs were treated with LPS (1 \u0026micro;g/mL; 6 h) in the absence or presence of AB4. In order to activate NLRP3 inflammasome, BMDMs and the THP-1 cells were first treated by LPS (1 \u0026micro;g/mL; 6 h), and cells were further co-treated with ATP (5 mM; 30 min), or nigericin (10 \u0026micro;M; 30 min), respectively. In some experiments in this paper, cells were first treated with the NF-κB inhibitor JSH-23 (25 \u0026micro;M; 1 h; #B1645, APExBIO Technology LLC, USA), the AKT inhibitor MK220 (20 \u0026micro;M; 1 h; #SF2712, Beyotine, Shanghai, China), the AKT agonist SC79 (20 \u0026micro;M; 2 h; #SML0749, Sigma-Aldrich, Louis, USA), cells were further treated with LPS (1 \u0026micro;g/mL; 6 h). Cell lysates were extracted for qPCR or Western blot, and supernatants were collected for ELISA to detect the release of related cytokines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCell viability\u003c/h2\u003e \u003cp\u003eAssess the viability of cells by using the CCK-8 assay. Briefly, the THP-1 cells or BMDMs were plated overnight in 96-well plates at a cell density of 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well. Cells were treated with various concentrations of AB4 (5-500 \u0026micro;M) for 24 h, with NaCl or 0.1% DMSO as control. All samples were then incubated with 90 \u0026micro;L fresh medium and 10 \u0026micro;L CCK-8 at 37\u0026deg;C for 2 h. Absorbance was measured with a microplate reader at 450 nm. Experiments were performed independently three times.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eC57BL/6 mice (male, 20\u0026ndash;22 g, 6\u0026ndash;8 weeks) were purchased from Dalian Medical University (Dalian, China). NLRP3-deficient (NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e; #017970) mice (male, 20\u0026ndash;22 g, 6\u0026ndash;8 weeks) and macrophage-specific CD1d deficient (CD1d\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) mice (male, 20\u0026ndash;22 g, 6\u0026ndash;8 weeks;CD1d1\u003csup\u003e\u003cem\u003efl/fl\u003c/em\u003e\u003c/sup\u003e (#016929) mice were crossed with \u003cem\u003eLyzM-Cre\u003c/em\u003e (#004781) mice to develop \u003cem\u003eLym\u003c/em\u003e\u003csup\u003e\u003cem\u003eCD1d1\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice, we referred to the mice as \" CD1d\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice \" for brevity [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. These genetically modified mice were obtained from the Department of Immunology at the Third Military Medical University in Chongqing, China. The initial acquisition of these mice was made from the reputable Jackson Laboratory located in Bar Harbor, ME, USA. To ensure genetic stability and minimize the influence of unforeseen variables, all mice underwent a rigorous process of backcrossing for ten generations onto the B6 background. All mice were housed at a temperature of 20\u0026ndash;25 ℃ and a relative humidity of 55%-65%, and free diet and water. All animal experiments were approved by the Animal Welfare and Ethics Committee of Dalian University (no. SCAV-EXPANIM).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eDSS-induced colitis and design of drug treatment\u003c/h2\u003e \u003cp\u003eC57BL/6 mice were fed with 3.0% (\u003cem\u003ew/v\u003c/em\u003e) DSS in drinking water for 7 days to induce acute colitis. In order to explore the impact of AB4 on colitis, the mice were randomly divided into 5 groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6 in each group): Normal group, DSS group, 5-ASA (200 mg/kg) group, AB4 pretreatment group (5 mg/kg), and AB4 treatment group (5 mg/kg). In order to more accurately evaluate the effect of AB4 on mice colitis, we compared the therapeutic effect of BTWT and AB4 on DSS-induced colitis, the mice were randomly divided into 4 groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;6 in each group): Normal group, DSS group, BTWT pretreatment group (5 g/kg), and AB4 pretreatment group (5 mg/kg). To further confirm the protective effect of AB4, the mice were randomly divided into 6 groups (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;8 in each group): Normal group, DSS group, AB4 (5, 10, and 15 mg/kg) groups, and AB4 (15 mg/kg) alone group.\u003c/p\u003e \u003cp\u003eTo further confirm that the protective effect of AB4 in DSS-induced colitis is dependent on the intervention of NLRP3 inflammasome, WT and NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice were randomly divided into 6 groups (n\u0026thinsp;=\u0026thinsp;8 in each group): WT normal group, WT\u0026thinsp;+\u0026thinsp;DSS group, WT\u0026thinsp;+\u0026thinsp;DSS\u0026thinsp;+\u0026thinsp;AB4 (15 mg/kg) group, NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e normal group, NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e+DSS group, NLRP3\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e+DSS\u0026thinsp;+\u0026thinsp;AB4 (15 mg/kg) group.\u003c/p\u003e \u003cp\u003eTo investigate whether the protective effect of AB4 against colitis depends on the CD1d signaling pathway, the WT and CD1d\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice were randomly divided into 6 groups (n\u0026thinsp;=\u0026thinsp;8 in each group): WT normal group; WT\u0026thinsp;+\u0026thinsp;DSS group; WT\u0026thinsp;+\u0026thinsp;DSS\u0026thinsp;+\u0026thinsp;AB4 (15 mg/kg) group; CD1d\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e normal group; CD1d\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e+DSS group; CD1d\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e+DSS\u0026thinsp;+\u0026thinsp;AB4 (15 mg/kg) group. Measure and record the changes in body weight, blood in the stool, and diarrhea every day, and use a complete system to calculate the disease activity index (DAI) score [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eSpleen index\u003c/h2\u003e \u003cp\u003eOn the 7th day of modeling, the mice were sacrificed and the spleens of each group were taken. Spleen index = (Spleen weight (mg)/ Body weight (g)) \u0026times;10.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eFITC-dextran intestine-blood barrier tests\u003c/h2\u003e \u003cp\u003eTo analyze the permeability of the epithelial barrier in mice, on the 7th day, mice in each group were deprived of water and fasted for 4 h, and then each mouse was gavaged with FITC-dextran (0.6 mg/g; Sigma-Aldrich). The blood was collected after 4 h, and the content of FITC-dextran in serum was measured with a fluorescence spectrophotometer setup with an emission wavelength of 490 nm and an excitation wavelength of 520 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eHistological analysis and histopathological scores\u003c/h2\u003e \u003cp\u003eOn the 7th day of modeling, the mice were sacrificed and the colons were taken. The colons were carefully rinsed with PBS solution, and the same parts of each colon were soaked and fixed with 4% paraformaldehyde. Conventional paraffin-embedded sections were stained with hematoxylin and eosin (H\u0026amp;E staining). The histopathological scores were determined using a well-established system [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence of colon issues\u003c/h2\u003e \u003cp\u003eParaformaldehyde-fixed colon tissues were embedded in paraffin for analysis of F4/80\u003csup\u003e+\u003c/sup\u003e cell infiltration. Sections were washed three times with PBS and then exposed to 3.0% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 1 h to block endogenous peroxidase activity. Subsequently, the sections were blocked with 3% BSA for 30 min at room temperature and then incubated at 4\u0026deg;C overnight with anti-F4/80 (#GB11027, 1:500 per mouse, Servicebio). The next day, sections were placed in PBS (pH 7.4) and washed 3 times on a decolorizing shaker for 5 min each time. The corresponding secondary antibody was added and incubated for 50 min at room temperature and away from light. Fluorescence microscopy to analyze the results (Zeiss Axioplan 2).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e \u003cp\u003e Assays were performed according to the manufacturer's protocol (CUSABIO BIOTECH, Wuhan, China), using mouse IL-1β, IL-18, IL-6, TNF-α, iNOS ELISA kits to detect supernatants of BMDMs culture, mouse serum, or colon tissue homogenate, and using human IL-1β, IL-18 ELISA kits to detect the supernatant of the THP-1 cells culture.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative Real-time Polymerase Chain Reaction (qPCR)\u003c/h2\u003e \u003cp\u003eThe expression of mRNA encoding for indicated genes in the THP-1cells or BMDMs was quantified by qPCR with the SYBR\u0026reg; Premix Ex Taq\u0026trade; (#RR820A, Takara). Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e showed the main primers sequence used in this experiment. The relative expression of target gene was calculated by the 2\u003csup\u003e\u0026minus;\u0026thinsp;ΔΔ\u003cem\u003eC\u003c/em\u003et\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCACTCCTCCACCTTTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTTGCTGTAGCCAAATTCGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGCAGGCAGTATCACTCATTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTCACACACCAGCAGGTTATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNLRP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTGACCCAAACCCACCAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTTTCGGATGAGGCTGCTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGAACAGAACAAAAGAAGATGGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCCTCGGAGAAAGATGTTGAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eASC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATCCCACCCCACCCTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGAGTCAGCAGGCAGGAATAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAAGTAAGAGGACTGGCTGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTTGTTGTGTCCTGGAACACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTGATGCTGGTGACAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGACAGGTCTGTTGGGAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCATGCACCACCATCAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCTGACCACTCTCCCTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eWestern blots\u003c/h2\u003e \u003cp\u003eProtein expression was detected by Western blots in the THP-1 cells, BMDMs, colonic macrophages, colonic epithelial cells, or colon tissues. Briefly, cells or tissues were lysed using RIPA lysis buffer (#P0013B, Beyotime Biotechnology). The cell lysates were centrifuged at 13000 g for 15 min, and the supernatant was mixed with 5\u0026times;SDS sample buffer (#P0015L, Beyotime Biotechnology). After boiling, each group of samples was separated by electrophoresis and transferred to PVDF membrane (#FFP39, Beyotime Biotechnology). The membranes were probed with the appropriate antibodies and then detected using Western Blotting Substrate (#180\u0026ndash;501, Tanon). The antibodies used are as follows: anti-actin-β (#AF7018, Affinity), anti-GAPDH (#AF7021, Affinity), anti-AKT (#AF6216, Affinity), anti\u0026ndash;p-AKT (#AF0016, Affinity), anti-STAT1 (#AF6300, Affinity), anti-p-STAT1 (#AF3300, Affinity), anti-PRDX1 (#DF6652, Affinity), anti-CD1d (#ab215445, Abcam), anti-IL-18 (#ab71495, Abcam), anti-IL-1β (#ab234437, Abcam), anti-ZO1 (#ab216880, Abcam), anti-Claudin1 (#ab180158, Abcam), anti-Occludin (#ab222691, Abcam),anti-PCNA (#13100, CST), anti-p-IκBα (#2859, CST), anti-IκBα (#4812, CST), anti-p-p65 (#3033, CST), anti-p65 (#WL01273b, Wanleibio), anti-ASC (#WL02462, Wanleibio),anti-IL-22 (#WL04441, Wanleibio), anti-IL-10(#sc-365858, Santa Cruz Biotechnology), anti-Caspase-1 (#AG-20B-0042, AdipoGen), and anti-NLRP3 (#AG-20B-0014-C100, AdipoGen). The primary antibody dilution was 1:1000\u0026thinsp;~\u0026thinsp;1:2000.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eBiolayer Interferometry (BLI) assay\u003c/h2\u003e \u003cp\u003eFor the measurement of the interaction between AB4 and the NLRP3 or CD1d protein, BLI was employed. Concentration gradients were prepared as follows: 500-250-125-62.5-31.25-15.625-7.8 \u0026micro;M for NLRP3 and 60-20-6.67-2.22-0.74 \u0026micro;M for CD1d. The proteins were mixed with AB4 and subsequently incubated at room temperature for 60 min. During the measurement process, the sample injection time was set as follows: 60 s for baseline, 120 s for contact time, and 80 s for dissociation time. All measurements were conducted at a temperature of 25\u0026deg;C. The obtained data from the Octet system were analyzed and processed using Octet Data Analysis 11.1 software, which enabled accurate interpretation and evaluation of the BLI results [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eCellular Thermal Shift Assay (CETSA)\u003c/h2\u003e \u003cp\u003eReferring to the previous literature by J. M. Li et al. [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], BMDM cell lysates were divided into two groups: one group was treated with compound AB5 (5 \u0026micro;M) and the other serving as a control with NaCl solution. After 1 h incubation at 37\u0026deg;C, the proteins in each group were divided into six individual samples. These samples were subjected to heat treatment, gradually increasing the temperature from 45\u0026deg;C to 65\u0026deg;C for 5 min at each temperature. Following centrifugation at 12,000 g for 15 min at 4\u0026deg;C, the supernatant was collected for subsequent analysis using the Western blot technique.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eMolecular Docking\u003c/h2\u003e \u003cp\u003eThe crystal structure of CD1d (PDB ID: 1ZT4) was downloaded from the protein databank (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.rcsb.org/\u003c/span\u003e\u003cspan address=\"https://www.rcsb.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Download the chemical structure of AB4 (PubChem ID: 71307558) from the NCBI Compound Database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubchem.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://pubchem.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Molecular docking calculations were performed using Discovery Studio 3.0 (Accelrys, San Diego, CA) as previously described [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eIsolation of colonic macrophages from mice\u003c/h2\u003e \u003cp\u003eColonic macrophages were prepared as previously described [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. First, the whole colons of mice in each group were collected and washed several times with HBSS. Then, the colonic tissue was cut into small pieces of 0.5 cm and added to predigestion solution (containing 1mM DTT, 5 mM EDTA, and 5% FBS) to remove epithelial cells and mucus. Then centrifuge at 140 g for 5 min. The supernatant was aspirated and the remaining colon fragments were cultured with 8 times the volume of digestive fluid containing 1 mg/ml collagenase VIII, 0.2 mg/mL DNaseI, 1 mg/mL Dispase II, and 10% FBS. It was digested at 37\u0026deg;C for 90 min. The samples were filtered, and resuspended in 40% and 80% fractions of the Percoll solution. After centrifugation at 386 g for 20 min, live cells in the middle layer were collected and the colonic macrophages were classified using Anti-F4/80 MicroBeads UltraPure mouse (#130-110-443, Miltenyi Biotec).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section3\"\u003e \u003ch2\u003eIsolation of intestine epithelial cells from mice\u003c/h2\u003e \u003cp\u003eIntestine epithelial cells were prepared as previously described [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Briefly, precooled PBS (containing 5% penicillin, and streptomycin) was used to wash the colons of each group of mice, and ophthalmic shears were used to remove the Pyle's node, fat, and mesentery on the surface of the small intestine, and the tissue was cut to the size of 1cm. Incubate with 1 mM DTT and 3 mM EDTA at room temperature for 1 h without shaking. Cells were washed with PBS by centrifuging and then were solubilized in cell lysis buffer containing 1% Triton X-100, 1 mM EDTA, 1 mM EGTA, 10 mM Tris (pH 7.4), 150 mM NaCl, and protease, and phosphatase inhibitor cocktail (Solarbio).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData shown in this study were obtained in at least three independent experiments. All results represent mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD Statistical analysis was performed with GraphPad Prism 8.0 (San Diego, CA), and the differences among multiple groups were evaluated by one-way ANOVA test, and the survival data of in vivo experiments were analyzed by the log-rank test of the curve. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCOMPETING INTERESTS\u003c/h2\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAUTHOR CONTRIBUTIONS\u003c/h2\u003e \u003cp\u003eJiao Li and Pan Li contributed to the conceptualization and writing of the manuscript. Shuo Yuan contributed to the methodology of the manuscript. Jia-Chen Xue contributed to the software of the manuscript. Huan Meng and Xiao-Ting Hou contributed to the data curation of the manuscript. Qing-Gao Zhang, Bi-Hu Gao and Xu-De Wang contributed to the manuscript revision, and decision to submit for publication. Qing-Gao Zhang, Bi-Hu Gao and Xu-De Wang contributed to reference analysis (corresponding authors). Jiao Li and Pan Li contributed equally to this work (co-first authors).\u003c/p\u003e\u003ch2\u003eACKNOWLEDGEMENTS\u003c/h2\u003e \u003cp\u003eThis work was supported by the National Natural Science Foundation of China (61671098), and the Korean Food Research Project (2017029).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGe Y, Li Y, Gong J, Zhu W. Mesenteric organ lymphatics and inflammatory bowel disease. Ann Anat\u003cem\u003e.\u003c/em\u003e 2018; 218\u003cstrong\u003e:\u003c/strong\u003e 199-204.\u003c/li\u003e\n\u003cli\u003eTorres J, Halfvarson J, Rodriguez-Lago I, Hedin CRH, Jess T, Dubinsky M\u003cem\u003e, et al.\u003c/em\u003e Results of the Seventh Scientific Workshop of ECCO: Precision Medicine in IBD-Prediction and Prevention of Inflammatory Bowel Disease. J Crohns Colitis\u003cem\u003e.\u003c/em\u003e 2021; 15(9)\u003cstrong\u003e:\u003c/strong\u003e 1443-1454.\u003c/li\u003e\n\u003cli\u003eKaplan GG. The global burden of IBD: from 2015 to 2025. Nat Rev Gastroenterol Hepatol\u003cem\u003e.\u003c/em\u003e 2015; 12(12)\u003cstrong\u003e:\u003c/strong\u003e 720-727.\u003c/li\u003e\n\u003cli\u003ede Lange KM, Barrett JC. Understanding inflammatory bowel disease via immunogenetics. J Autoimmun\u003cem\u003e.\u003c/em\u003e 2015; 64\u003cstrong\u003e:\u003c/strong\u003e 91-100.\u003c/li\u003e\n\u003cli\u003eMoreira Lopes TC, Mosser DM, Goncalves R. Macrophage polarization in intestinal inflammation and gut homeostasis. Inflamm Res\u003cem\u003e.\u003c/em\u003e 2020; 69(12)\u003cstrong\u003e:\u003c/strong\u003e 1163-1172.\u003c/li\u003e\n\u003cli\u003eSong Y, Zhao Y, Ma Y, Wang Z, Rong L, Wang B\u003cem\u003e, et al.\u003c/em\u003e Biological functions of NLRP3 inflammasome: A therapeutic target in inflammatory bowel disease. Cytokine Growth Factor Rev\u003cem\u003e.\u003c/em\u003e 2021; 60\u003cstrong\u003e:\u003c/strong\u003e 61-75.\u003c/li\u003e\n\u003cli\u003eZaki MH, Lamkanfi M, Kanneganti TD. The Nlrp3 inflammasome: contributions to intestinal homeostasis. Trends Immunol\u003cem\u003e.\u003c/em\u003e 2011; 32(4)\u003cstrong\u003e:\u003c/strong\u003e 171-179.\u003c/li\u003e\n\u003cli\u003eHirota SA, Ng J, Lueng A, Khajah M, Parhar K, Li Y\u003cem\u003e, et al.\u003c/em\u003e NLRP3 inflammasome plays a key role in the regulation of intestinal homeostasis. Inflamm Bowel Dis\u003cem\u003e.\u003c/em\u003e 2011; 17(6)\u003cstrong\u003e:\u003c/strong\u003e 1359-1372.\u003c/li\u003e\n\u003cli\u003eBauer C, Duewell P, Mayer C, Lehr HA, Fitzgerald KA, Dauer M\u003cem\u003e, et al.\u003c/em\u003e Colitis induced in mice with dextran sulfate sodium (DSS) is mediated by the NLRP3 inflammasome. Gut\u003cem\u003e.\u003c/em\u003e 2010; 59(9)\u003cstrong\u003e:\u003c/strong\u003e 1192-1199.\u003c/li\u003e\n\u003cli\u003eSun Y, Zhao Y, Yao J, Zhao L, Wu Z, Wang Y\u003cem\u003e, et al.\u003c/em\u003e Wogonoside protects against dextran sulfate sodium-induced experimental colitis in mice by inhibiting NF-kappaB and NLRP3 inflammasome activation. Biochem Pharmacol\u003cem\u003e.\u003c/em\u003e 2015; 94(2)\u003cstrong\u003e:\u003c/strong\u003e 142-154.\u003c/li\u003e\n\u003cli\u003eNewman DJ, Cragg GM. Natural Products as Sources of New Drugs over the Nearly Four Decades from 01/1981 to 09/2019. J Nat Prod\u003cem\u003e.\u003c/em\u003e 2020; 83(3)\u003cstrong\u003e:\u003c/strong\u003e 770-803.\u003c/li\u003e\n\u003cli\u003eGu Z. Efficacy of the Baitouweng decoction plus mesalazine on ulcerative colonitis of the Shire type. Chinese Medicine Clinical Research\u003cem\u003e.\u003c/em\u003e 2018; 10(10)\u003cstrong\u003e:\u003c/strong\u003e 105-106.\u003c/li\u003e\n\u003cli\u003eLi YH, Zou M, Han Q, Deng LR, Weinshilboum RM. Therapeutic potential of triterpenoid saponin anemoside B4 from Pulsatilla chinensis. Pharmacol Res\u003cem\u003e.\u003c/em\u003e 2020; 160\u003cstrong\u003e:\u003c/strong\u003e 105079.\u003c/li\u003e\n\u003cli\u003eMa H, Zhou M, Duan W, Chen L, Wang L, Liu P. Anemoside B4 prevents acute ulcerative colitis through inhibiting of TLR4/NF-kappaB/MAPK signaling pathway. Int Immunopharmacol\u003cem\u003e.\u003c/em\u003e 2020; 87\u003cstrong\u003e:\u003c/strong\u003e 106794.\u003c/li\u003e\n\u003cli\u003eZhang Y, Zha Z, Shen W, Li D, Kang N, Chen Z\u003cem\u003e, et al.\u003c/em\u003e Anemoside B4 ameliorates TNBS-induced colitis through S100A9/MAPK/NF-kappaB signaling pathway. Chin Med\u003cem\u003e.\u003c/em\u003e 2021; 16(1)\u003cstrong\u003e:\u003c/strong\u003e 11.\u003c/li\u003e\n\u003cli\u003eHan Q, Deng LR, Zou M, Tang HZ, Huang CY, Chen FJ\u003cem\u003e, et al.\u003c/em\u003e Anemoside B4 protects against chronic relapsing colitis in mice by modulating inflammatory response, colonic transcriptome and the gut microbiota. Phytomedicine\u003cem\u003e.\u003c/em\u003e 2022; 106\u003cstrong\u003e:\u003c/strong\u003e 154416.\u003c/li\u003e\n\u003cli\u003eHe L, Zhang Y, Kang N, Wang Y, Zhang Z, Zha Z\u003cem\u003e, et al.\u003c/em\u003e Anemoside B4 attenuates nephrotoxicity of cisplatin without reducing anti-tumor activity of cisplatin. Phytomedicine\u003cem\u003e.\u003c/em\u003e 2019; 56\u003cstrong\u003e:\u003c/strong\u003e 136-146.\u003c/li\u003e\n\u003cli\u003eYuan R, He J, Huang L, Du LJ, Gao H, Xu Q\u003cem\u003e, et al.\u003c/em\u003e Anemoside B4 Protects against Acute Lung Injury by Attenuating Inflammation through Blocking NLRP3 Inflammasome Activation and TLR4 Dimerization. J Immunol Res\u003cem\u003e.\u003c/em\u003e 2020; 2020\u003cstrong\u003e:\u003c/strong\u003e 7502301.\u003c/li\u003e\n\u003cli\u003eChassaing B, Aitken JD, Malleshappa M, Vijay-Kumar M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr Protoc Immunol\u003cem\u003e.\u003c/em\u003e 2014; 104\u003cstrong\u003e:\u003c/strong\u003e 15 25 11-15 25 14.\u003c/li\u003e\n\u003cli\u003eClapper ML, Cooper HS, Chang WC. Dextran sulfate sodium-induced colitis-associated neoplasia: a promising model for the development of chemopreventive interventions. Acta Pharmacol Sin\u003cem\u003e.\u003c/em\u003e 2007; 28(9)\u003cstrong\u003e:\u003c/strong\u003e 1450-1459.\u003c/li\u003e\n\u003cli\u003eSommer K, Wiendl M, Muller TM, Heidbreder K, Voskens C, Neurath MF\u003cem\u003e, et al.\u003c/em\u003e Intestinal Mucosal Wound Healing and Barrier Integrity in IBD-Crosstalk and Trafficking of Cellular Players. Front Med (Lausanne)\u003cem\u003e.\u003c/em\u003e 2021; 8\u003cstrong\u003e:\u003c/strong\u003e 643973.\u003c/li\u003e\n\u003cli\u003eHuber S, Gagliani N, Zenewicz LA, Huber FJ, Bosurgi L, Hu B\u003cem\u003e, et al.\u003c/em\u003e IL-22BP is regulated by the inflammasome and modulates tumorigenesis in the intestine. Nature\u003cem\u003e.\u003c/em\u003e 2012; 491(7423)\u003cstrong\u003e:\u003c/strong\u003e 259-263.\u003c/li\u003e\n\u003cli\u003eWu Q, Xie S, Zhu Y, Chen J, Tian J, Xiong S\u003cem\u003e, et al.\u003c/em\u003e Wogonin Strengthens the Therapeutic Effects of Mesenchymal Stem Cells in DSS-Induced Colitis via Promoting IL-10 Production. Oxid Med Cell Longev\u003cem\u003e.\u003c/em\u003e 2021; 2021\u003cstrong\u003e:\u003c/strong\u003e 5527935.\u003c/li\u003e\n\u003cli\u003eSchreiber S, Nikolaus S, Hampe J. Activation of nuclear factor kappa B inflammatory bowel disease. Gut\u003cem\u003e.\u003c/em\u003e 1998; 42(4)\u003cstrong\u003e:\u003c/strong\u003e 477-484.\u003c/li\u003e\n\u003cli\u003eSheng K, Xu Y, Kong X, Wang J, Zha X, Wang Y. Probiotic Bacillus cereus Alleviates Dextran Sulfate Sodium-Induced Colitis in Mice through Improvement of the Intestinal Barrier Function, Anti-Inflammation, and Gut Microbiota Modulation. J Agric Food Chem\u003cem\u003e.\u003c/em\u003e 2021; 69(49)\u003cstrong\u003e:\u003c/strong\u003e 14810-14823.\u003c/li\u003e\n\u003cli\u003eCui S, Wang C, Bai W, Li J, Pan Y, Huang X\u003cem\u003e, et al.\u003c/em\u003e CD1d1 intrinsic signaling in macrophages controls NLRP3 inflammasome expression during inflammation. Sci Adv\u003cem\u003e.\u003c/em\u003e 2020; 6(43).\u003c/li\u003e\n\u003cli\u003eIshii T, Yamada M, Sato H, Matsue M, Taketani S, Nakayama K\u003cem\u003e, et al.\u003c/em\u003e Cloning and characterization of a 23-kDa stress-induced mouse peritoneal macrophage protein. J Biol Chem\u003cem\u003e.\u003c/em\u003e 1993; 268(25)\u003cstrong\u003e:\u003c/strong\u003e 18633-18636.\u003c/li\u003e\n\u003cli\u003eOlszak T, Neves JF, Dowds CM, Baker K, Glickman J, Davidson NO\u003cem\u003e, et al.\u003c/em\u003e Protective mucosal immunity mediated by epithelial CD1d and IL-10. Nature\u003cem\u003e.\u003c/em\u003e 2014; 509(7501)\u003cstrong\u003e:\u003c/strong\u003e 497-502.\u003c/li\u003e\n\u003cli\u003eMizoguchi A, Mizoguchi E, Takedatsu H, Blumberg RS, Bhan AK. Chronic intestinal inflammatory condition generates IL-10-producing regulatory B cell subset characterized by CD1d upregulation. Immunity\u003cem\u003e.\u003c/em\u003e 2002; 16(2)\u003cstrong\u003e:\u003c/strong\u003e 219-230.\u003c/li\u003e\n\u003cli\u003eLee C, Hong SN, Paik NY, Kim TJ, Kim ER, Chang DK\u003cem\u003e, et al.\u003c/em\u003e CD1d Modulates Colonic Inflammation in NOD2-/- Mice by Altering the Intestinal Microbial Composition Comprising Acetatifactor muris. J Crohns Colitis\u003cem\u003e.\u003c/em\u003e 2019; 13(8)\u003cstrong\u003e:\u003c/strong\u003e 1081-1091.\u003c/li\u003e\n\u003cli\u003eHuang E, Liu R, Lu Z, Liu J, Liu X, Zhang D\u003cem\u003e, et al.\u003c/em\u003e NKT cells mediate the recruitment of neutrophils by stimulating epithelial chemokine secretion during colitis. Biochem Biophys Res Commun\u003cem\u003e.\u003c/em\u003e 2016; 474(2)\u003cstrong\u003e:\u003c/strong\u003e 252-258.\u003c/li\u003e\n\u003cli\u003eFuss IJ, Heller F, Boirivant M, Leon F, Yoshida M, Fichtner-Feigl S\u003cem\u003e, et al.\u003c/em\u003e Nonclassical CD1d-restricted NK T cells that produce IL-13 characterize an atypical Th2 response in ulcerative colitis. J Clin Invest\u003cem\u003e.\u003c/em\u003e 2004; 113(10)\u003cstrong\u003e:\u003c/strong\u003e 1490-1497.\u003c/li\u003e\n\u003cli\u003ePeng Y, Mentzer AJ, Liu G, Yao X, Yin Z, Dong D\u003cem\u003e, et al.\u003c/em\u003e Broad and strong memory CD4(+) and CD8(+) T cells induced by SARS-CoV-2 in UK convalescent individuals following COVID-19. Nat Immunol\u003cem\u003e.\u003c/em\u003e 2020; 21(11)\u003cstrong\u003e:\u003c/strong\u003e 1336-1345.\u003c/li\u003e\n\u003cli\u003eWang CM, Lin ZH, Lin ZQ, Yao QY, Zhang YF. Anemoside A3 rapidly reverses depression-like behaviors and weakening of excitatory synaptic transmission in mouse models of depression. J Psychopharmacol\u003cem\u003e.\u003c/em\u003e 2019; 33(1)\u003cstrong\u003e:\u003c/strong\u003e 37-50.\u003c/li\u003e\n\u003cli\u003eIp FCF, Ng YP, Or TCT, Sun P, Fu G, Li JYH\u003cem\u003e, et al.\u003c/em\u003e Anemoside A3 ameliorates experimental autoimmune encephalomyelitis by modulating T helper 17 cell response. PLoS One\u003cem\u003e.\u003c/em\u003e 2017; 12(7)\u003cstrong\u003e:\u003c/strong\u003e e0182069.\u003c/li\u003e\n\u003cli\u003eYe B, Ji ZN. 23-hydroxybetulinic acid-induced HL-60 cell autophagic apoptosis and its molecular mechanism. Nat Prod Res\u003cem\u003e.\u003c/em\u003e 2012; 26(11)\u003cstrong\u003e:\u003c/strong\u003e 1063-1068.\u003c/li\u003e\n\u003cli\u003eYao H, Wei G, Liu Y, Yao H, Zhu Z, Ye W\u003cem\u003e, et al.\u003c/em\u003e Synthesis, Biological Evaluation of Fluorescent 23-Hydroxybetulinic Acid Probes, and Their Cellular Localization Studies. ACS Med Chem Lett\u003cem\u003e.\u003c/em\u003e 2018; 9(10)\u003cstrong\u003e:\u003c/strong\u003e 1030-1034.\u003c/li\u003e\n\u003cli\u003eQin G, Mulan W, Luling H, Yulin F, Shilin Y, Lijun D\u003cem\u003e, et al.\u003c/em\u003e Protective effect of Baicalin Saponin B4 on experimental acute renal function injury. Chinese Modern Traditional Chinese Medicine\u003cem\u003e.\u003c/em\u003e 2019; 21(01)\u003cstrong\u003e:\u003c/strong\u003e 62-67+70.\u003c/li\u003e\n\u003cli\u003eZmora N, Levy M, Pevsner-Fishcer M, Elinav E. Inflammasomes and intestinal inflammation. Mucosal Immunol\u003cem\u003e.\u003c/em\u003e 2017; 10(4)\u003cstrong\u003e:\u003c/strong\u003e 865-883.\u003c/li\u003e\n\u003cli\u003eQu S, Fan L, Qi Y, Xu C, Hu Y, Chen S\u003cem\u003e, et al.\u003c/em\u003e Akkermansia muciniphila Alleviates Dextran Sulfate Sodium (DSS)-Induced Acute Colitis by NLRP3 Activation. Microbiol Spectr\u003cem\u003e.\u003c/em\u003e 2021; 9(2)\u003cstrong\u003e:\u003c/strong\u003e e0073021.\u003c/li\u003e\n\u003cli\u003eLv Q, Xing Y, Liu J, Dong D, Liu Y, Qiao H\u003cem\u003e, et al.\u003c/em\u003e Lonicerin targets EZH2 to alleviate ulcerative colitis by autophagy-mediated NLRP3 inflammasome inactivation. Acta Pharm Sin B\u003cem\u003e.\u003c/em\u003e 2021; 11(9)\u003cstrong\u003e:\u003c/strong\u003e 2880-2899.\u003c/li\u003e\n\u003cli\u003eZhao Y, Guo Q, Zhu Q, Tan R, Bai D, Bu X\u003cem\u003e, et al.\u003c/em\u003e Flavonoid VI-16 protects against DSS-induced colitis by inhibiting Txnip-dependent NLRP3 inflammasome activation in macrophages via reducing oxidative stress. Mucosal Immunol\u003cem\u003e.\u003c/em\u003e 2019; 12(5)\u003cstrong\u003e:\u003c/strong\u003e 1150-1163.\u003c/li\u003e\n\u003cli\u003eDupaul-Chicoine J, Yeretssian G, Doiron K, Bergstrom KS, McIntire CR, LeBlanc PM\u003cem\u003e, et al.\u003c/em\u003e Control of intestinal homeostasis, colitis, and colitis-associated colorectal cancer by the inflammatory caspases. Immunity\u003cem\u003e.\u003c/em\u003e 2010; 32(3)\u003cstrong\u003e:\u003c/strong\u003e 367-378.\u003c/li\u003e\n\u003cli\u003eGuo C, He Y, Gai L, Qu J, Shi Y, Xu W\u003cem\u003e, et al.\u003c/em\u003e Balanophora polyandra Griff. prevents dextran sulfate sodium-induced murine experimental colitis via the regulation of NF-kappaB and NLRP3 inflammasome. Food Funct\u003cem\u003e.\u003c/em\u003e 2020; 11(7)\u003cstrong\u003e:\u003c/strong\u003e 6104-6114.\u003c/li\u003e\n\u003cli\u003eHe Y, Li S, Tang D, Peng Y, Meng J, Peng S\u003cem\u003e, et al.\u003c/em\u003e Circulating Peroxiredoxin-1 is a novel damage-associated molecular pattern and aggravates acute liver injury via promoting inflammation. Free Radic Biol Med\u003cem\u003e.\u003c/em\u003e 2019; 137\u003cstrong\u003e:\u003c/strong\u003e 24-36.\u003c/li\u003e\n\u003cli\u003eWu N, Du X, Peng Z, Zhang Z, Cui L, Li D\u003cem\u003e, et al.\u003c/em\u003e Silencing of peroxiredoxin 1 expression ameliorates ulcerative colitis in a rat model. J Int Med Res\u003cem\u003e.\u003c/em\u003e 2021; 49(3)\u003cstrong\u003e:\u003c/strong\u003e 300060520986313.\u003c/li\u003e\n\u003cli\u003eHansen JM, Moriarty-Craige S, Jones DP. Nuclear and cytoplasmic peroxiredoxin-1 differentially regulate NF-kappaB activities. Free Radic Biol Med\u003cem\u003e.\u003c/em\u003e 2007; 43(2)\u003cstrong\u003e:\u003c/strong\u003e 282-288.\u003c/li\u003e\n\u003cli\u003eBast A, Fischer K, Erttmann SF, Walther R. Induction of peroxiredoxin I gene expression by LPS involves the Src/PI3K/JNK signalling pathway. Biochim Biophys Acta\u003cem\u003e.\u003c/em\u003e 2010; 1799(5-6)\u003cstrong\u003e:\u003c/strong\u003e 402-410.\u003c/li\u003e\n\u003cli\u003eSaubermann LJ, Beck P, De Jong YP, Pitman RS, Ryan MS, Kim HS\u003cem\u003e, et al.\u003c/em\u003e Activation of natural killer T cells by alpha-galactosylceramide in the presence of CD1d provides protection against colitis in mice. Gastroenterology\u003cem\u003e.\u003c/em\u003e 2000; 119(1)\u003cstrong\u003e:\u003c/strong\u003e 119-128.\u003c/li\u003e\n\u003cli\u003eHuang XY, Feng ZQ, Jiang YZ, Li JL, Xiang Q, Guo S\u003cem\u003e, et al.\u003c/em\u003e VSIG4 mediates transcriptional inhibition of Nlrp3 and Il-1\u0026beta; in macrophages. Sci Adv\u003cem\u003e.\u003c/em\u003e 2019; 5(1)\u003cstrong\u003e:\u003c/strong\u003e 14.\u003c/li\u003e\n\u003cli\u003eCui S, Wang CH, Bai WZ, Li J, Pan Y, Huang XY\u003cem\u003e, et al.\u003c/em\u003e CD1d1 intrinsic signaling in macrophages controls NLRP3 inflammasome expression during inflammation. Sci Adv\u003cem\u003e.\u003c/em\u003e 2020a; 6(43).\u003c/li\u003e\n\u003cli\u003eLi JM, Sheng HD, Wang YC, Lai ZC, Wang Y, Cui SL. Scaffold Hybrid of the Natural Product Tanshinone I with Piperidine for the Discovery of a Potent NLRP3 Inflammasome Inhibitor. Journal of Medicinal Chemistry\u003cem\u003e.\u003c/em\u003e 2023; 66(4)\u003cstrong\u003e:\u003c/strong\u003e 2946-2963.\u003c/li\u003e\n\u003cli\u003eChen FY, Li C, Cao HY, Zhang HT, Lu C, Li RM\u003cem\u003e, et al.\u003c/em\u003e Identification of Adenylate Kinase 5 as a Protein Target of Ginsenosides in Brain Tissues Using Mass Spectrometry-Based Drug Affinity Responsive Target Stability (DARTS) and Cellular Thermal Shift Assay (CETSA) Techniques. J Agric Food Chem\u003cem\u003e.\u003c/em\u003e 2022; 70(8)\u003cstrong\u003e:\u003c/strong\u003e 2741-2751.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4382137/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4382137/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAbnormal activation of the NLRP3 inflammasome in macrophages is closely associated with Ulcerative colitis (UC) and targeting the NLRP3 inflammasome has been proposed as a potential therapeutic approach, but the underlying mechanism by which it regulates intestinal inflammation remains unclear. Anemoside B4 (AB4) has anti-inflammatory activity, but whether it alleviates UC by inhibiting the activation of NLRP3 inflammasome remains unclear. More importantly, the molecular targets of AB4 remain unknown. Our study showed that AB4 had a strong anti-inflammatory effect dextran sodium sulfate (DSS)-induced colitis in WT mice, whereas the protective effects were lost in NLRP3\u003csup\u003e-/-\u003c/sup\u003e mice. Interestingly, AB4 inhibited the activation of NLRP3 inflammasome in colonic macrophages without affecting intestinal epithelial cells. Mechanistically, AB4 might target CD1d thus reducing the AKT-STAT1-PRDX1-NF-κB signaling pathway, eventually inhibiting the activation of NLRP3 inflammasome. Macrophage-specific CD1d depletion had been shown to reverse the protective effect of AB4. Therefore, as a natural product with high safety index, AB4 might be considered a promising candidate drug for the treatment of colitis.\u003c/p\u003e","manuscriptTitle":"Anemoside B4 alleviates DSS-induced colitis by inhibiting CD1d-dependent NLRP3 inflammasome activation in macrophages","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-18 08:40:26","doi":"10.21203/rs.3.rs-4382137/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0b76a083-5737-4da1-a99d-8177e006315f","owner":[],"postedDate":"July 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":31948209,"name":"Biological sciences/Immunology/Inflammation/Inflammasome"},{"id":31948210,"name":"Health sciences/Diseases/Gastrointestinal diseases/Inflammatory bowel disease/Ulcerative colitis"}],"tags":[],"updatedAt":"2024-07-18T08:40:27+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-18 08:40:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4382137","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4382137","identity":"rs-4382137","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.