Actin polymerization drives endogenous MMP-9 upregulation and blood–brain barrier disruption in ischemic brain endothelial cells

Actin polymerization drives endogenous MMP-9 upregulation and blood–brain barrier disruption in ischemic brain endothelial cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Actin polymerization drives endogenous MMP-9 upregulation and blood–brain barrier disruption in ischemic brain endothelial cells Yiyin Zhao, Songbin He, Yiming Wang, Meng Jin, Yichao Fu, Xiaojing Zhou This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9032259/v1 This work is licensed under a CC BY 4.0 License Status: Under Revision Version 1 posted 8 You are reading this latest preprint version Abstract Blood–brain barrier (BBB) disruption is a critical early pathological event in ischemic stroke. Matrix metalloproteinase-9 (MMP-9) is a well-established effector of junctional protein degradation and barrier breakdown. While circulating MMP-9 derived from neutrophils has been extensively studied, the mechanisms underlying endogenous MMP-9 upregulation within brain endothelial cells during early ischemia remain poorly defined. Here, we provide evidence that actin polymerization functionally contributes to endothelial MMP-9 upregulation under ischemic conditions. Using an oxygen–glucose deprivation (OGD) model in mouse brain microvascular endothelial cells (bEnd.3), time-course analysis identified 6 h as a critical window at which cells remained viable but exhibited significant actin remodeling. At this time point, both intracellular and secreted MMP-9 levels were significantly increased, concurrent with reduced expression and disrupted membrane localization of occludin, ZO-1, and VE-cadherin, as well as increased transendothelial permeability to both 4.4-kDa and 70-kDa tracers. Pharmacological modulation of actin dynamics bidirectionally regulated these changes: jasplakinolide further amplified MMP-9 expression, exacerbated junctional protein loss, and increased barrier permeability, whereas latrunculin B significantly suppressed MMP-9 upregulation, preserved junctional protein integrity, and reduced permeability. These findings indicate that excessive actin polymerization in brain endothelial cells is functionally linked to MMP-9 activation and early BBB destabilization, independent of inflammatory cell infiltration. These in vitro findings suggest an endothelial-autonomous mechanism that may contribute to early BBB dysfunction Actin Blood–brain barrier Oxygen–glucose deprivation Brain endothelial cells MMP-9 Tight junction proteins Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Ischemic stroke is one of the leading causes of death and long-term disability worldwide. Although reperfusion therapy has significantly improved the outcome of acute treatment, a large number of patients still experience severe long-term neurological dysfunction, suggesting that the key molecular events in the early stage of ischemia have not been fully elucidated[ 1 , 2 ]. Understanding these early changes is of great significance for the development of effective neuroprotective strategies. Among the earliest pathological events, BBB disruption has been recognized as a key driver of secondary brain injury, yet the upstream cellular mechanisms that initiate barrier destabilization remain incompletely defined. The blood brain barrier (BBB) exhibits structural and functional impairments within a few h after ischemia. Matrix metalloproteinase-9 (MMP-9) is a central effector of BBB disruption in ischemic stroke. Through proteolytic degradation of tight junction (TJ) proteins such as occludin and claudin, as well as the adherens junction (AJ) protein VE-cadherin, MMP-9 directly compromises the structural integrity of the endothelial barrier, leading to increased vascular permeability, inflammatory cell infiltration, and secondary brain injury[ 3 – 6 ]. The pathogenic role of MMP-9 is well established; however, a critical question remains: what triggers MMP-9 upregulation in the earliest phase of ischemia, before large-scale inflammatory cell infiltration occurs? In the context of acute cerebral ischemia, MMP-9 originates from two distinct sources. Exogenous MMP-9, primarily released by infiltrating neutrophils, has been the focus of extensive research and is responsible for converting transient TJ disruption into sustained, severe barrier damage[ 7 – 10 ]. Several broad-spectrum MMP inhibitors and, more recently, MMP-9-selective neutralizing antibodies have been developed to target this circulating pool[ 11 ]. However, these strategies primarily address the exogenous component and have limited efficacy against endothelial-derived MMP-9. Critically, brain microvascular endothelial cells themselves constitute an important local source of MMP-9. MMP-9 expression is particularly prominent in cerebral microvessels within the ischemic region[ 12 ], where endothelial-derived MMP-9 directly degrades basement membrane components and tight junction proteins leading to increased BBB permeability and vasogenic cerebral edema[ 13 – 15 ]. Given that neutrophil infiltration is a relatively delayed event, occurring hours after ischemic onset, endothelial-derived MMP-9 may serve as the initiating factor that destabilizes the BBB before inflammatory amplification takes place. Yet, the upstream cellular events that trigger endothelial MMP-9 upregulation in early ischemia remain largely undefined, representing a key knowledge gap in understanding the molecular basis of early BBB dysfunction. Emerging evidence, including our own previous work, points to actin cytoskeletal remodeling as a candidate upstream event. Clinically, we observed that serum F-actin levels are significantly elevated in acute ischemic stroke patients and correlate with stroke severity and early neurological deterioration[ 5 ]. In a subsequent in vitro study, we demonstrated that oxygen–glucose deprivation (OGD) induces rapid actin remodeling in brain endothelial cells, characterized by enhanced F-actin polymerization, cofilin dephosphorylation, and myosin light chain phosphorylation, accompanied by β-actin spillover into the extracellular space within 6 h[ 16 ]. These findings suggest that the actin cytoskeleton undergoes early and significant pathological changes under ischemic stress. Notably, scattered evidence from non-cerebrovascular systems indicates that cytoskeletal perturbations can influence MMP expression. For instance, actin depolymerization has been shown to promote MMP gene expression in breast cancer cells through nuclear translocation of cysteine-rich protein 2[ 17 ], and the RhoA/ROCK pathway, a key regulator of actin dynamics, has been linked to MMP-9 signaling in the context of brain plasticity[ 18 , 19 ]. However, whether actin remodeling directly drives MMP-9 upregulation in ischemic brain endothelial cells has not been systematically examined. In the present study, we hypothesized that actin polymerization under OGD conditions functions as an upstream driver of endothelial MMP-9 upregulation, which in turn contributes to junctional protein disruption and BBB permeability increase. To test this hypothesis, we employed a pharmacological approach using jasplakinolide (an F-actin stabilizer that promotes polymerization) and latrunculin B (an actin polymerization inhibitor) to bidirectionally modulate actin dynamics in bEnd.3 cells subjected to 6 h of OGD. We systematically assessed MMP-9 expression and secretion, TJ and AJ protein expression and membrane localization, and transendothelial barrier permeability. This bidirectional pharmacological strategy allows us to move beyond correlative observations and provide functional evidence supporting a link between actin polymerization status, endothelial MMP-9 activation, and early BBB destabilization. Materials and methods Cell culture conditions The mouse brain microvascular endothelial cell line bEnd.3 was obtained from ATCC (American Type Culture Collection, Rockville, MD, USA) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 µg/mL streptomycin at 37°C in a humidified atmosphere containing 5% CO₂. Experimental grouping and treatment This study included two distinct experimental designs. (1) Time-course experiment for cell injury and actin dynamics Cells were seeded at 5 × 10 5 cells per well in 6-well plates and cultured until approximately 80% confluence. For OGD treatment, the culture medium was replaced with glucose-free and serum-free medium, and cells were transferred to a tri-gas incubator (Thermo Fisher, Pittsburgh, PA, USA) maintained at 5% CO 2 , 94% N 2 , and 1% O 2 for 0, 0.5, 1, 2, 3, 6, 12, or 24 h. At each time point, cell viability (N = 10), β-actin mRNA levels (N = 10), β-actin release in supernatant (N = 6), and F-actin expression (N = 6) were assessed. (2) Actin remodeling intervention experiment : Cells were divided into four groups: control, OGD, OGD + 1 µM jasplakinolide, and OGD + 1 µM latrunculin B (N = 3 per group). All cells were first cultured in standard medium for 24 h. Subsequently, control group cells continued in standard medium for 6 h, while the remaining groups were switched to glucose-free and serum-free medium under OGD conditions. Jasplakinolide or latrunculin B was added at the time of medium change. After 6 h of OGD, MMP-9 expression and secretion, TJ and AJ protein expression and distribution, and BBB permeability were assessed. (3) MMP-9 gene expression time-course experiment To investigate temporal changes in MMP-9 gene expression, bEnd.3 cells were subjected to OGD for 0, 2, 4, 6, or 12 h (N = 3). MMP-9 mRNA levels were assessed by RT-qPCR at each time point. Immunofluorescence After treatment, cells were fixed with 4% paraformaldehyde at room temperature for 15 min, permeabilized with 0.1% Triton X-100 for 10 min, and blocked with 5% bovine serum albumin (BSA) for 30 min. Cells were then incubated overnight at 4°C with primary antibodies, including occludin antibody (1:100, ab216327, Abcam, Cambridge, UK), ZO-1 antibody (1:100, ab307799, Abcam), VE-cadherin antibody (1:500, ab205336, Abcam), and phalloidin (1:500, A12379, Thermo Fisher). After washing three times with PBS, cells were incubated with the corresponding secondary antibodies at room temperature in the dark for 1 h. Secondary antibodies included Alexa Fluor® 488-labeled goat anti-rabbit IgG H&L antibody (1:200, ab150079, Abcam) and Alexa Fluor® 647-labeled goat anti-mouse IgG H&L antibody (1:200, ab150115, Abcam). Nuclei were counterstained with DAPI. Images were acquired at 400× magnification using a laser confocal microscope (Leica Microsystems, Wetzlar, Germany). Fluorescence intensity was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA). For F-actin staining, cells were fixed with PBS containing 3.7% formaldehyde for 15 min, then washed three times with PBS containing 0.1% Triton X-100. ActinTracker Green-488 (C2201S, Beyotime, Shanghai, China) was diluted at 1:40 with PBS containing 0.1% Triton X-100 to prepare the staining working solution. Each coverslip was incubated with 200 µL staining solution at room temperature in the dark for 30 min. After washing, nuclei were counterstained with DAPI and images were captured at 400× magnification using a fluorescence microscope. Western blot Western blot Cells were lysed with RIPA buffer containing PMSF, and the lysates were centrifuged at 12,000 × g for 5 min at 4°C using a refrigerated high-speed centrifuge (Sigma, St. Louis, MO, USA) to collect the supernatant as total protein samples. Protein concentration was determined using the BCA Protein Quantification Kit (KGB2101, KeyGEN BioTECH, Nanjing, China), and samples were stored at − 20°C. A total of 60 µg of protein per sample was separated by SDS-PAGE at an initial voltage of 80 V for 30 min, followed by 120 V after the samples entered the resolving gel. Proteins were transferred to a PVDF membrane at 300 mA for 60 min. The membrane was blocked with 5% skim milk in TBST for 1 h at room temperature and then incubated overnight at 4°C with primary antibodies: MMP-9 antibody (1:1000, #24317, Cell Signaling Technology, Boston, USA) and β-tubulin antibody (1:1000, ab18207, Abcam). After washing, the membrane was incubated with the corresponding HRP-labeled secondary antibody (Goat Anti-Rabbit IgG H&L:1:2000, ab6721, Abcam; Goat Anti-Rabbit IgG H&L:1:2000, ab205719, Abcam) for 1 h at room temperature. Protein bands were visualized using ECL chemiluminescence reagent (32209, Thermo Fisher Scientific) and captured with a Tanon 5200 imaging system (Tanon, Shanghai, China). Band intensity was quantified using Image Pro Plus 6.0 software. ELISA assay Cell culture supernatants were collected after treatment. β-actin content was measured using a mouse β-actin ELISA Kit (EM1627, FineTest, Wuhan, China) according to the manufacturer's instructions. MMP-9 content was measured using a mouse MMP-9 ELISA Kit (E-EL-M3052, Elabscience, Wuhan, China). Briefly, standards with concentrations of 100, 50, 25, 12.5, 6.25, 3.13, 1.56, and 0 ng/mL were prepared. Standards and samples (100 µL each) were added to the wells and incubated at 37°C for 90 minutes. After washing, biotin-labeled antibody working solution was added and incubated at 37°C for 60 min. Following additional washing steps, HRP-conjugated working solution was added and incubated at 37°C for 30 min. After final washing, TMB substrate solution was added and incubated at 37°C for 15–20 min in the dark. The reaction was stopped by adding stop solution, and absorbance was measured at 450 nm using a microplate reader (Berthold Company, Bad Wildbad, Germany). RT-qPCR Total RNA extraction from the samples occurred through the use of TRIzol reagent (15596026, Thermo Fisher). Briefly, cells were lysed in 0.5 mL TRIzol, and chloroform (0.1 mL) was added for phase separation. After centrifugation at 12,000 rpm for 15 min at 4°C, the aqueous phase was collected and RNA was precipitated with isopropanol at − 20°C for 30 min. The RNA pellet was washed with 75% ethanol prepared in DEPC-treated water and dissolved in 10 µL nuclease-free water. RNA concentration and purity were determined using Nanodrop 2000 (Thermo Fisher). The iScript cDNA Synthesis Kit (1708891EDU, Bio-Rad, Hercules, CA, USA) was used for reverse transcription with 2 µL of RNA as the template. The reaction mixture (total volume: 20 µL) included 4 µL of 5× iScript reaction mix, 1 µL of iScript reverse transcriptase, 2 µL of RNA, and 13 µL of nuclease-free water. The reaction was carried out on a PCR system (Applied Biosystems, Foster City, CA, USA) under the following conditions: 25°C for 5 min, 46°C for 20 min, and 95°C for 1 min. The synthesized cDNA samples were preserved at − 70°C for subsequent evaluations. TB Green Premix Ex Taq™ (RR420A, Takara, Otsu, Japan) was used to conduct real-time PCR on an ABI 7500 system. The following primers were used: β-actin: Forward (5′→3′): ATCAAGATCATTGCTCCTCC, Reverse (5′→3′): GTAAAACGCAGCTCAGTAAC; MMP-9: Forward (5′→3′): AAAACCTCCAACCTCACGGA, Reverse (5′→3′): CACAGCGTGGTGTTCGAATG; β-tubulin: Forward (5′→3′): GTATCTCTTTTCTTCCCGGT, Reverse (5′→3′): CATTGCTCAGTACCATCCTG. The analysis of gene expression levels utilized the 2^−ΔΔCt method and employed β-tubulin as the reference gene. BBB permeability assay The bEnd.3 cells were seeded at a density of 5 × 10⁵ cells per well onto the upper chamber of the Transwell chamber (with a pore size of 0.4 µm, Corning) and cultured for 6 days until fusion. According to the experimental groups, the cells were treated with 1 µM Jasplakinolide or 1 µM Latrunculin B. 2 mg/mL of 4.4-kDa TRITC-polymer (MS0911, MK, Shanghai, China) or 2 mg/mL of 70-kDa FITC-polymer (MS0905, MK) was added to the upper chamber. The OGD group cells were subjected to OGD treatment for 6 h, while the control group cells were cultured under normal conditions for 6 h. After incubation, the fluorescence intensities of the upper and lower chambers were detected using an enzyme detector. The relative permeability coefficient (Pdextran) was calculated according to the following formula: Pdextran = (RFU of lower chamber/RFU of upper chamber) × V × (1/t) × (1/A), where V is the volume of the solution in the lower chamber, t is the incubation time, and A is the surface area of the Transwell chamber. Cell viability assay Cell viability was determined using the Cell Counting Kit-8 (CCK-8, Beyotime, Shanghai, China). Cells were seeded at a density of 1 × 10 4 cells per well in 96-well plates. After treatment according to experimental groupings, cells were washed with PBS three times, and 100 µL of medium containing 10% CCK-8 working solution was added to each well. After incubation at 37°C for 2 h, the absorbance was measured at 450 nm using a microplate reader. Statistical analysis All data were expressed as means ± SD. Each experiment was independently repeated three times (N = 3 biological replicates). For CCK-8 assays, 10 replicates per condition were used in each independent experiment. Statistical comparisons between groups were performed using one-way analysis of variance (ANOVA) followed by post-hoc tests. GraphPad Prism 9 (San Diego, CA, USA) and SPSS 22.0 (SPSS, Inc., Chicago, IL, USA) software were used for data analysis and visualization. * P < 0.05 was considered statistically significant. Results OGD induced time-dependent endothelial cell injury and actin dynamics changes Building on our previously published time-course characterization of OGD-induced actin dynamics in bEnd.3 cells[ 16 ], we extended these observations to include additional time points and functional assessments to establish the optimal window for mechanistic studies. We performed a time-course experiment examining cell viability, actin gene expression, actin release, and F-actin remodeling. The CCK-8 assay showed that cell viability remained relatively stable during the first 3 h of OGD exposure, then moderately decreased at 6 h, and markedly declined at 12 h and 24 h (Fig. 1 A). RT-qPCR analysis indicated that the β-actin mRNA level remained unchanged throughout the entire OGD period (Fig. 1 B), suggesting that the observed changes in intracellular actin were not attributable to transcriptional inhibition. ELISA analysis of culture supernatants showed that β-actin concentrations were significantly elevated starting from 3 h of OGD compared with the control group, with further increases at 6, 12, and 24 h (Fig. 1 C). Notably, this increase in supernatant β-actin was already evident at time points when cell viability remained above 90% (0–3 h), indicating that the release of β-actin into the extracellular space was not simply a consequence of cell lysis. F-actin immunofluorescence staining revealed dynamic changes in cytoskeletal organization during OGD exposure. F-actin fluorescence intensity significantly increased at 3 h and 6 h of OGD, consistent with a stress-induced polymerization response. In contrast, F-actin signals declined at 12 h and 24 h, accompanied by disordered redistribution and loss of organized filament structure (Fig. 2 A, B). These results collectively indicate that 6 h represents a critical time point at which endothelial cells remain viable but exhibit significant actin remodeling and early functional impairment, making it an appropriate time window for investigating the molecular mechanisms of early ischemic endothelial injury. Therefore, subsequent experiments focused primarily on the 6-h OGD time point. OGD-induced actin remodeling upregulated MMP-9 expression in bEnd.3 cells Based on our previous research, it was shown that OGD can induce the reorganization of actin in endothelial cells[ 16 ]. To further explore the relationship between this process and MMP-9, we first examined the temporal changes in MMP-9 expression during the OGD process. RT-qPCR results showed that MMP-9 mRNA levels remained unchanged at 2 h of OGD, but significantly increased starting from 4 h, with progressively greater upregulation at 6 h and 12 h (Fig. 3 A). This time-dependent increase in MMP-9 expression paralleled the temporal pattern of actin remodeling observed in our time-course study, suggesting a potential temporal association between these two events. To determine whether actin dynamics directly influence MMP-9 expression, we employed pharmacological modulation of actin polymerization at the 6-h OGD time point. Western blot analysis showed that OGD significantly increased MMP-9 protein expression compared with the control group. Jasplakinolide, which stabilizes and promotes F-actin polymerization, further elevated MMP-9 levels under OGD conditions, whereas latrunculin B, which inhibits actin polymerization, significantly reduced MMP-9 expression (Fig. 3 B, C). Consistently, ELISA results demonstrated that OGD significantly increased MMP-9 content in cell culture supernatants, and this effect was further enhanced by jasplakinolide and attenuated by latrunculin B (Fig. 3 D). These results indicate that OGD-induced actin remodeling is functionally linked to the upregulation of MMP-9 in brain endothelial cells. OGD-induced actin remodeling disrupted tight junction and adherens junction proteins MMP-9 is a well-recognized mediator of BBB disruption. Given the close association between MMP-9 activation and BBB structural integrity, we examined whether the actin remodeling induced by OGD for 6 h altered the expression and distribution of key TJ and AJ proteins in bEnd.3 cells. Immunofluorescence analysis revealed that under control conditions, occludin, ZO-1, and VE-cadherin exhibited continuous, well-organized distribution along cell-cell borders. OGD for 6 h resulted in decreased fluorescence intensity and disrupted membrane localization of all three junctional proteins, with discontinuous and fragmented staining patterns at cell peripheries. Jasplakinolide further decreased junctional protein levels and exacerbated the loss of organized membrane distribution, while latrunculin B significantly preserved their expression levels and maintained relatively continuous membrane localization patterns (Fig. 4 , 5 , 6 ). These findings collectively indicate that actin remodeling under OGD conditions is closely associated with the destabilization and redistribution of both tight junction and adherens junction proteins in brain endothelial cells. OGD-induced actin remodeling increased BBB permeability in bEnd.3 To assess the functional impact of actin remodeling on barrier integrity, we used 4.4-kDa TRITC-dextran and 70-kDa FITC-dextran for BBB permeability detection. Compared with the control group, OGD treatment for 6 h significantly increased the permeability coefficients of both 4.4-kDa TRITC-dextran and 70-kDa FITC-dextran, indicating that OGD-induced barrier disruption was not limited to paracellular gap widening but may also involve structural compromise of the endothelial monolayer. Jasplakinolide further increased the permeability coefficients, while latrunculin B significantly reduced the permeability coefficients compared with the OGD group (Fig. 7 A, B). These results indicate that modulation of actin dynamics significantly influenced the barrier function of the endothelial monolayer under OGD conditions. Discussion The present study demonstrates that actin polymerization in brain endothelial cells under OGD conditions is functionally linked to MMP-9 upregulation, junctional protein destabilization, and increased BBB permeability. Through bidirectional pharmacological modulation, we show that jasplakinolide amplified whereas latrunculin B attenuated these changes, establishing a functional relationship between actin polymerization status and endothelial MMP-9 activation. Importantly, these events occurred within a 6-h window during which cell viability was largely preserved, indicating that barrier dysfunction precedes overt cell death. A central finding is that actin remodeling is closely associated with endogenous MMP-9 upregulation within endothelial cells during early ischemia. This contrasts with the conventional focus on neutrophil-derived MMP-9 or inflammatory mediator-driven activation[ 8 – 10 ]. Our data show that enhancing actin polymerization under OGD amplified both intracellular and secreted MMP-9 levels, while inhibiting polymerization significantly reduced them. These results suggest that actin polymerization is not merely a passive accompaniment to ischemic injury but may actively contribute to MMP-9 upregulation. The underlying signaling may involve mechanotransduction pathways activated by increased cytoskeletal tension, such as RhoA/ROCK-mediated transcription factor regulation[ 18 , 19 ], though the specific intermediaries remain to be defined. Furthermore, MMP-9 itself can promote actin rearrangement by degrading the extracellular matrix and modulating the F-actin/G-actin ratio[ 20 – 22 ], raising the possibility of a positive feedback loop that accelerates endothelial injury. The concurrent disruption of occludin, ZO-1, and VE-cadherin observed in this study is consistent with a dual mechanism involving both mechanical and proteolytic components. Under physiological conditions, these junctional proteins are anchored to the cortical actin network: ZO-1 bridges occludin to the cytoskeleton and is essential for junctional continuity, while VE-cadherin relies on actin association through its cytoplasmic tail for adhesion regulation[ 23 – 28 ]. OGD-induced pathological stress fiber formation weakens this mechanical anchorage, promoting junctional protein internalization and redistribution, as reflected by the decreased fluorescence intensity and disrupted peripheral patterns in our immunofluorescence analysis[ 25 , 29 – 32 ]. Concurrently, MMP-9 upregulation adds a proteolytic dimension: both occludin and VE-cadherin are established substrates of MMP-9, and their extracellular domains can undergo cleavage during ischemic injury[ 33 – 36 ]. Thus, in the setting of weakened cytoskeletal support, MMP-9 activation may advance junctional disruption from loss of mechanical anchoring to active proteolytic degradation. The simultaneous impairment of all three proteins likely reflects their shared dependence on actin for structural support and their concurrent exposure to MMP-9-mediated proteolysis. The structural disruption described above was directly confirmed by the permeability assay: OGD for 6 h significantly increased transendothelial permeability to both 4.4-kDa and 70-kDa tracers, and pharmacological modulation of actin dynamics bidirectionally regulated this change. The concurrent permeability increase to both small and large molecules can be explained by the combined effects of cytoskeletal destabilization and early MMP-9 activation. Actin remodeling under OGD shifts the cytoskeleton from a physiological, high-turnover state to a low-reversibility, high-tension configuration driven by ATP depletion and RhoA/ROCK activation[ 37 , 38 ], increasing membrane tension and weakening junctional anchorage to facilitate paracellular leakage. Simultaneously, the early endogenous MMP-9 increase, while perhaps insufficient to completely degrade the basement membrane, may loosen junctional complexes sufficiently to reduce the mechanical resistance to macromolecular diffusion. It should be noted that in vivo BBB opening typically follows a staged pattern, with macromolecular permeability becoming prominent later than small-molecule leakage[ 39 , 40 ]. In our in vitro monolayer model, the absence of the neurovascular unit components (pericytes, astrocytes, and basement membrane) likely removes this buffering effect, allowing both small- and large-molecule leakage to occur concurrently. Nevertheless, recent in vivo studies have also demonstrated that BBB opens to macromolecules within hours after ischemia onset[ 41 , 42 ], suggesting that our in vitro observations may partially reflect the intrinsic vulnerability of endothelial cells to early ischemic stress. The protective effect of latrunculin B may appear counterintuitive, as the actin cytoskeleton is generally required for barrier maintenance. However, under OGD conditions, endothelial cells undergo actin remodeling characterized by excessive stress fiber formation. At the concentration used (1 µM), latrunculin B likely attenuates this pathological polymerization rather than abolishing the cytoskeleton entirely. This interpretation is supported by analogous findings: in chronic hypoxia-induced pulmonary hypertension, latrunculin B suppressed ROS-ROCK-dependent pathological vasoconstriction[ 43 ], and low-dose latrunculin A prevented dexamethasone-induced aberrant actin reorganization in trabecular meshwork cells[ 44 ]. The concurrent reduction in MMP-9 expression in the latrunculin B group suggests that the protective effect is at least partially mediated through suppression of MMP-9-dependent junctional protein degradation. These findings extend our previous observations by revealing that OGD-induced actin remodeling is not merely a structural event but is functionally linked to MMP-9 activation and barrier disruption, suggesting a self-amplifying pathological cascade: increased actin tension promotes MMP-9 expression, while MMP-9-mediated junctional and matrix degradation further destabilizes cytoskeletal architecture. Our earlier clinical finding that serum F-actin correlates with stroke severity may be partially explained by the early BBB structural damage enabling F-actin leakage into the circulation[ 5 ]. Several limitations should be acknowledged. First, the current findings were obtained using an in vitro endothelial cell model, and extending these observations to in vivo ischemic models incorporating the full neurovascular unit will be an important next step to further elucidate the pathological significance of actin remodeling in BBB injury. This represents a key direction of our ongoing research. Second, the specific signaling intermediaries linking actin dynamics to MMP-9 transcription remain to be identified, this will be a focus of our future work. Third, validation under ischemia-reperfusion conditions is needed, as reperfusion often exacerbates BBB injury. Fourth, the use of a mouse cell line may limit generalizability, and confirmation in human endothelial models is warranted. Future studies should address these questions using complementary genetic approaches and in vivo ischemic models. Conclusions This study demonstrates that OGD-induced actin polymerization in brain endothelial cells is functionally linked to MMP-9 upregulation, junctional protein disruption, and increased BBB permeability. Pharmacological inhibition of actin polymerization attenuated these changes, while promoting polymerization exacerbated them. These findings identify endothelial actin dynamics as a functional upstream event associated with endogenous MMP-9 upregulation and early BBB destabilization in vitro. This work provides a basis for further investigation of actin homeostasis as a potential therapeutic target for early barrier protection in ischemic stroke. Declarations Declaration of Competing Interest The authors declared no potential conflicts of interest with respect to the research, Author Contribution Xiaojing Zhou contributed to conceptualization, funding acquisition, supervision and validation. Yiyin Zhao contributed to methodology and writing-original draft. Songbin He contributed to funding acquisition, data curation and project administration. Yiming Wang contributed to conceptualization, resources. Meng Jin contributed to software and visualization. Yichao Fu contributed to methodology. Acknowledgement The authors are grateful to Prof. Yuanzheng Xia for insightful guidance and stimulating discussions throughout this work. Data Availability The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. References Maïer B, Tsai AS, Einhaus JF et al (2023) Neuroimaging is the new spatial omic: multi-omic approaches to neuro-inflammation and immuno-thrombosis in acute ischemic stroke. Semin Immunopathol 45(1):125–143. https://doi.org/10.1007/s00281-023-00984-6 Sennfält S, Norrving B, Petersson J et al (2019) Long-Term Survival and Function After Stroke: A Longitudinal Observational Study From the Swedish Stroke Register. Stroke 50(1):53–61. https://doi.org/10.1161/strokeaha.118.022913 Ji Y, Gao Q, Ma Y et al (2023) An MMP-9 exclusive neutralizing antibody attenuates blood-brain barrier breakdown in mice with stroke and reduces stroke patient-derived MMP-9 activity. Pharmacol Res 190:106720. https://doi.org/10.1016/j.phrs.2023.106720 Guo P, Li H, Zhang X et al (2025) Matrix metalloproteinase–9 in hemorrhagic transformation after acute ischemic stroke (Review). Mol Med Rep 32(2). https://doi.org/10.3892/mmr.2025.13590 Li J, Wang B, Dai F et al (2024) The predictive value of serum F-actin on the severity and early neurological deterioration of acute ischemic stroke: Predictive value of F-actin in stroke. J Stroke Cerebrovasc Dis 33(6):107727. https://doi.org/10.1016/j.jstrokecerebrovasdis.2024.107727 Liao B, Geng L, Zhang F et al (2020) Adipocyte fatty acid-binding protein exacerbates cerebral ischaemia injury by disrupting the blood-brain barrier. Eur Heart J 41(33):3169–3180. https://doi.org/10.1093/eurheartj/ehaa207 McColl BW, Rothwell NJ, Allan SM (2008) Systemic inflammation alters the kinetics of cerebrovascular tight junction disruption after experimental stroke in mice. J Neurosci 28(38):9451–9462. .https://doi.org/10.1523/jneurosci.2674-08.2008 Du LD, Fang C, Wang YQ et al (2025) MMP-9 inhibitor SB-3CT improves neurological outcomes in ischemic stroke mice by modulation of astrocytic lipid metabolism. Acta Pharmacol Sin 46(8):2120–2135. https://doi.org/10.1038/s41401-025-01505-x Justicia C, Panés J, Solé S et al (2003) Neutrophil infiltration increases matrix metalloproteinase-9 in the ischemic brain after occlusion/reperfusion of the middle cerebral artery in rats. J Cereb Blood Flow Metab 23(12):1430–1440. .https://doi.org/10.1097/01.Wcb.0000090680.07515.C8 Prause O, Bozinovski S, Anderson GP et al (2004) Increased matrix metalloproteinase-9 concentration and activity after stimulation with interleukin-17 in mouse airways. Thorax 59(4):313–317. .https://doi.org/10.1136/thx.2003.008854 Chaturvedi M, Kaczmarek L (2014) Mmp-9 inhibition: a therapeutic strategy in ischemic stroke. Mol Neurobiol 49(1):563–573. https://doi.org/10.1007/s12035-013-8538-z Douglas AS, Shearer JA, Okolo A et al (2021) The Relationship Between Cerebral Reperfusion And Regional Expression Of Matrix Metalloproteinase-9 In Rat Brain Following Focal Cerebral Ischemia. Neuroscience 453:256–265. https://doi.org/10.1016/j.neuroscience.2020.10.034 Jiao-Yan Y, Qing-Qing L, Xi L et al (2021) Oxymatrine improves blood-brain barrier integrity after cerebral ischemia-reperfusion injury by downregulating CAV1 and MMP9 expression. Phytomedicine 84:153505. https://doi.org/10.1016/j.phymed.2021.153505 Liu MB, Wang W, Gao JM et al (2020) Icariside II attenuates cerebral ischemia/reperfusion-induced blood-brain barrier dysfunction in rats via regulating the balance of MMP9/TIMP1. Acta Pharmacol Sin 41(12):1547–1556. https://doi.org/10.1038/s41401-020-0409-3 Castillo-González J, González-Rey E (2025) Beyond wrecking a wall: revisiting the concept of blood-brain barrier breakdown in ischemic stroke. Neural Regen Res 20(7):1944–1956. https://doi.org/10.4103/nrr.Nrr-d-24-00392 Zhao Y, Zhou X, He S et al (2025) Oxygen-glucose deprivation induces actin spillover in brain endothelial cells. Tissue Cell 95:102946. https://doi.org/10.1016/j.tice.2025.102946 Mgrditchian T, Brown-Clay J, Hoffmann C et al (2023) Actin cytoskeleton depolymerization increases matrix metalloproteinase gene expression in breast cancer cells by promoting translocation of cysteine-rich protein 2 to the nucleus. Front Cell Dev Biol 11:1100938. https://doi.org/10.3389/fcell.2023.1100938 Lu W, Chen Z, Wen J (2023) The role of RhoA/ROCK pathway in the ischemic stroke-induced neuroinflammation. Biomed Pharmacother 165:115141. https://doi.org/10.1016/j.biopha.2023.115141 Figiel I, Kruk PK, Zaręba-Kozioł M et al (2021) MMP-9 Signaling Pathways That Engage Rho GTPases in Brain Plasticity. Cells 10(1). https://doi.org/10.3390/cells10010166 Qorri B, Kalaydina RV, Velickovic A et al (2018) Agonist-Biased Signaling via Matrix Metalloproteinase-9 Promotes Extracellular Matrix Remodeling. Cells 7(9). https://doi.org/10.3390/cells7090117 Chen K, Xu M, Lu F et al (2023) Development of Matrix Metalloproteinases-Mediated Extracellular Matrix Remodeling in Regenerative Medicine: A Mini Review. Tissue Eng Regen Med 20(5):661–670. https://doi.org/10.1007/s13770-023-00536-x Yin LT, Feng RR, Xie XY et al (2023) Matrix metalloproteinase-9 overexpression in the hippocampus reduces alcohol-induced conditioned-place preference by regulating synaptic plasticity in mice. Behav Brain Res 442:114330. https://doi.org/10.1016/j.bbr.2023.114330 Odenwald MA, Choi W, Buckley A et al (2017) ZO-1 interactions with F-actin and occludin direct epithelial polarization and single lumen specification in 3D culture. J Cell Sci 130(1):243–259. https://doi.org/10.1242/jcs.188185 Fanning AS, Jameson BJ, Jesaitis LA et al (1998) The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. J Biol Chem 273(45):29745–29753. .https://doi.org/10.1074/jbc.273.45.29745 Spadaro D, Le S, Laroche T et al (2017) Tension-Dependent Stretching Activates ZO-1 to Control the Junctional Localization of Its Interactors. Curr Biol 27(24):3783–3795. e8.https://doi.org/10.1016/j.cub.2017.11.014 Kale G, Naren AP, Sheth P et al (2003) Tyrosine phosphorylation of occludin attenuates its interactions with ZO-1, ZO-2, and ZO-3. Biochem Biophys Res Commun 302(2):324–329. .https://doi.org/10.1016/s0006-291x(03)00167-0 Dorland YL, Huveneers S (2017) Cell-cell junctional mechanotransduction in endothelial remodeling. Cell Mol Life Sci 74(2):279–292. https://doi.org/10.1007/s00018-016-2325-8 Grimsley-Myers CM, Isaacson RH, Cadwell CM et al (2020) VE-cadherin endocytosis controls vascular integrity and patterning during development. J Cell Biol 219(5). https://doi.org/10.1083/jcb.201909081 Tang J, Kang Y, Zhou Y et al (2023) TIMP2 ameliorates blood-brain barrier disruption in traumatic brain injury by inhibiting Src-dependent VE-cadherin internalization. J Clin Invest 134(3). https://doi.org/10.1172/jci164199 Wu J, Yang J, Yu M et al (2020) Lanthanum chloride causes blood-brain barrier disruption through intracellular calcium-mediated RhoA/Rho kinase signaling and myosin light chain kinase. Metallomics 12(12):2075–2083. https://doi.org/10.1039/d0mt00187b Luo PL, Wang YJ, Yang YY et al (2018) Hypoxia-induced hyperpermeability of rat glomerular endothelial cells involves HIF-2α mediated changes in the expression of occludin and ZO-1. Braz J Med Biol Res 51(7):e6201. https://doi.org/10.1590/1414-431x20186201 Zhang S, An Q, Wang T et al (2018) Autophagy- and MMP-2/9-mediated Reduction and Redistribution of ZO-1 Contribute to Hyperglycemia-increased Blood-Brain Barrier Permeability During Early Reperfusion in Stroke. Neuroscience 377:126–137. https://doi.org/10.1016/j.neuroscience.2018.02.035 Ivaldo C, Passalacqua M, Furfaro AL et al (2023) Oxidative stress-induced MMP- and γ-secretase-dependent VE-cadherin processing is modulated by the proteasome and BMP9/10. Sci Rep 13(1):597. https://doi.org/10.1038/s41598-022-27308-2 Zuo X, Lu J, Manaenko A et al (2019) MicroRNA-132 attenuates cerebral injury by protecting blood-brain-barrier in MCAO mice. Exp Neurol 316:12–19. https://doi.org/10.1016/j.expneurol.2019.03.017 Wendt TS, Gonzales RJ (2023) Ozanimod differentially preserves human cerebrovascular endothelial barrier proteins and attenuates matrix metalloproteinase-9 activity following in vitro acute ischemic injury. Am J Physiol Cell Physiol 325(4):C951. c971.https://doi.org/10.1152/ajpcell.00342.2023 Li XF, Zhang XJ, Zhang C et al (2018) Ulinastatin protects brain against cerebral ischemia/reperfusion injury through inhibiting MMP-9 and alleviating loss of ZO-1 and occludin proteins in mice. Exp Neurol 302:68–74. https://doi.org/10.1016/j.expneurol.2017.12.016 Guo CY, Xiong TQ, Tan BH et al (2019) The temporal and spatial changes of actin cytoskeleton in the hippocampal CA1 neurons following transient global ischemia. Brain Res 1720:146297. https://doi.org/10.1016/j.brainres.2019.06.016 Gisselsson L, Toresson H, Ruscher K et al (2010) Rho kinase inhibition protects CA1 cells in organotypic hippocampal slices during in vitro ischemia. Brain Res 1316:92–100. https://doi.org/10.1016/j.brainres.2009.11.087 Blase A, di Girasole CG, Benjamin L et al (2025) Phased blood-brain barrier disruption in ischaemic stroke: implications for therapy? Fluids Barriers CNS 22(1):90. https://doi.org/10.1186/s12987-025-00701-5 Du W, Chen H, Gróf I et al (2024) Antidepressant-induced membrane trafficking regulates blood-brain barrier permeability. Mol Psychiatry 29(11):3590–3598. https://doi.org/10.1038/s41380-024-02626-1 Kozler P, Marešová D, Pokorný J (2024) Assessment of Blood-Brain Barrier Permeability in a Cerebral Ischemia-Reperfusion Model in Rats; A Pilot Study. Physiol Res 73(6):1099–1105. https://doi.org/10.33549/physiolres.935432 Shiraishi K, Wang Z, Kokuryo D et al (2017) A polymeric micelle magnetic resonance imaging (MRI) contrast agent reveals blood-brain barrier (BBB) permeability for macromolecules in cerebral ischemia-reperfusion injury. J Control Release 253:165–171. https://doi.org/10.1016/j.jconrel.2017.03.020 Weise-Cross L, Sands MA, Sheak JR et al (2018) Actin polymerization contributes to enhanced pulmonary vasoconstrictor reactivity after chronic hypoxia. Am J Physiol Heart Circ Physiol 314(5):H1011. h1021.https://doi.org/10.1152/ajpheart.00664.2017 Liu X, Wu Z, Sheibani N et al (2003) Low dose latrunculin-A inhibits dexamethasone-induced changes in the actin cytoskeleton and alters extracellular matrix protein expression in cultured human trabecular meshwork cells. Exp Eye Res 77(2):181–188. .https://doi.org/10.1016/s0014-4835(03)00118-0 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Revision Version 1 posted Editorial decision: Revision requested 16 Apr, 2026 Reviews received at journal 29 Mar, 2026 Reviewers agreed at journal 14 Mar, 2026 Reviewers agreed at journal 13 Mar, 2026 Reviewers invited by journal 11 Mar, 2026 Editor assigned by journal 06 Mar, 2026 Submission checks completed at journal 06 Mar, 2026 First submitted to journal 04 Mar, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9032259","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":605964046,"identity":"7445b83e-ea7b-4df6-8a7d-70e782c8f992","order_by":0,"name":"Yiyin Zhao","email":"","orcid":"","institution":"Zhoushan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yiyin","middleName":"","lastName":"Zhao","suffix":""},{"id":605964047,"identity":"ef28250d-050f-498c-a586-32f8012f890a","order_by":1,"name":"Songbin He","email":"","orcid":"","institution":"Zhoushan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Songbin","middleName":"","lastName":"He","suffix":""},{"id":605964048,"identity":"21fd2ff9-487e-4846-a2c8-c40fdace5ee6","order_by":2,"name":"Yiming Wang","email":"","orcid":"","institution":"Zhoushan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yiming","middleName":"","lastName":"Wang","suffix":""},{"id":605964049,"identity":"5c8bd85c-5ae0-4419-a9d7-bceee473ff6b","order_by":3,"name":"Meng Jin","email":"","orcid":"","institution":"Zhoushan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Meng","middleName":"","lastName":"Jin","suffix":""},{"id":605964050,"identity":"0e543e09-b074-44af-8b42-20fdd1442790","order_by":4,"name":"Yichao Fu","email":"","orcid":"","institution":"Zhoushan Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yichao","middleName":"","lastName":"Fu","suffix":""},{"id":605964051,"identity":"66db9e6a-ec5b-4289-8548-f1d7dcd636d9","order_by":5,"name":"Xiaojing Zhou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAz0lEQVRIiWNgGAWjYBAC+waGBCBVw2Pf3tj48AMxWhghWo7JGPAcbjaWIFILCDDbGEiktwnwEKOFWSLh4YefbWw85pIP2xgkGOzkdBsIaGHjOZAs2XNGhsdydmLbgwKGZGOzAwS08LA3pDEzVLDxMNxObDeQYDiQuI2QFglmBqAWA2YehpsH2yR4iNFiALGFmcfgBiOxWiB+OcYj2ZMIDGQDIvxiPyMnERhiNfb87McfPvxQYSdHUAswABKQLSWoHATYCZs6CkbBKBgFIxwAAOoUPW8icsa6AAAAAElFTkSuQmCC","orcid":"","institution":"Zhoushan Hospital","correspondingAuthor":true,"prefix":"","firstName":"Xiaojing","middleName":"","lastName":"Zhou","suffix":""}],"badges":[],"createdAt":"2026-03-04 16:09:00","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9032259/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9032259/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":104706719,"identity":"5488532e-6305-46d8-83be-5c34df352f50","added_by":"auto","created_at":"2026-03-16 09:36:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":166857,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe influence of varying OGD durations on the viability and morphology of bEnd.3 cells. \u003c/strong\u003ebEnd.3 cells were exposed to OGD for 0, 0.5, 1, 2, 3, 6, 12, or 24 h. (A) The viability of bEnd.3 cells at indicated time points was determined using CCK-8 assay. (B) The mRNA levels of β-actin were evaluated via RT-qPCR assay. (C) The concentrations of β-actin in the cell supernatant at each time point were determined using ELISA assay. Results were mean ± SD for three individual experiments. \u003cem\u003e*P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-9032259/v1/ce1180569ecf99b8fb3a9187.png"},{"id":104706721,"identity":"9c6c0332-8029-4239-8543-6caa6237eef0","added_by":"auto","created_at":"2026-03-16 09:36:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3495135,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDynamic changes in F-actin expression during OGD exposure in bEnd.3 cells. \u003c/strong\u003ebEnd.3 cells were exposed to OGD for 0, 0.5, 1, 2, 3, 6, 12, or 24 h. (A) The morphology and distribution of F-actin in bEnd.3 cells were determined via phalloidin immunofluorescence staining. Bar = 100 μm. (B) Bar chart of the fluorescence intensity of F-actin in bEnd.3 cells at each time point corresponding to immunofluorescence staining. Results were mean ± SD for three individual experiments. \u003cem\u003e*P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-9032259/v1/642076c5d5e39e28052bf2b8.png"},{"id":104706720,"identity":"039084d2-d738-4281-ad27-12c6d4416ef4","added_by":"auto","created_at":"2026-03-16 09:36:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1005489,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of OGD and actin dynamics modulation on MMP-9 expression in bEnd.3 cells.\u003c/strong\u003e (A) bEnd.3 cells were exposed to OGD for 0, 2, 4, 6, or 12 h. MMP-9 mRNA levels were assessed by RT-qPCR. (B–D) bEnd.3 cells were subjected to OGD for 6 h in the presence or absence of 1 μM jasplakinolide or 1 μM latrunculin B. (B) Representative western blot images showing MMP-9 protein expression. β-tubulin served as the loading control. (C) Quantification of MMP-9 protein levels from western blot analysis. (D) MMP-9 concentrations in cell culture supernatants measured by ELISA. Data are presented as mean ± SD from three independent experiments. \u003cem\u003e*P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-9032259/v1/ba8b5e9bdbc45c725790165c.png"},{"id":104782261,"identity":"1ed8f56d-2e6a-4d76-9ada-10c79abb1214","added_by":"auto","created_at":"2026-03-17 07:57:04","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2391744,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of OGD and actin dynamics modulation on occludin expression and distribution in bEnd.3 cells. \u003c/strong\u003ebEnd.3 cells were subjected to OGD for 6 h in the presence or absence of 1 μM jasplakinolide or 1 μM latrunculin B. (A) Representative immunofluorescence images showing occludin expression and membrane distribution. Occludin is shown in green, and nuclei were counterstained with DAPI (blue). Scale bar = 50 μm. (B) Quantification of occludin fluorescence intensity. Data are presented as mean ± SD from three independent experiments.\u003cem\u003e*P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-9032259/v1/bf97424a0efedab879f60e9a.png"},{"id":104783094,"identity":"eda26f5b-bed8-446e-8517-b5591c9bd6ae","added_by":"auto","created_at":"2026-03-17 07:58:13","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1538570,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of OGD and actin dynamics modulation on ZO-1 expression and distribution in bEnd.3 cells. \u003c/strong\u003ebEnd.3 cells were subjected to OGD for 6 h in the presence or absence of 1 μM jasplakinolide or 1 μM latrunculin B. (A) Representative immunofluorescence images showing ZO-1 expression and membrane distribution. ZO-1 is shown in red, and nuclei were counterstained with DAPI (blue). Scale bar = 50 μm. (B) Quantification of ZO-1 fluorescence intensity. Data are presented as mean ± SD from three independent experiments. \u003cem\u003e*P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-9032259/v1/0a54395932e063be979b065c.png"},{"id":104706723,"identity":"84575e3a-b02e-4ac8-b9d2-f1aac7328ef9","added_by":"auto","created_at":"2026-03-16 09:36:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2873473,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of OGD and actin dynamics modulation on VE-cadherin expression and distribution in bEnd.3 cells. \u003c/strong\u003ebEnd.3 cells were subjected to OGD for 6 h in the presence or absence of 1 μM jasplakinolide or 1 μM latrunculin B. (A) Representative immunofluorescence images showing VE-cadherin expression and membrane distribution. VE-cadherin is shown in green, and nuclei were counterstained with DAPI (blue). Scale bar = 50 μm. (B) Quantification of VE-cadherin fluorescence intensity. Data are presented as mean ± SD from three independent experiments. \u003cem\u003e*P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-9032259/v1/2c96a95a327b04a65e81ef05.png"},{"id":104706724,"identity":"a7970825-6301-4e67-9fd8-69feef434615","added_by":"auto","created_at":"2026-03-16 09:36:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":695792,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of OGD and actin dynamics modulation on BBB permeability in bEnd.3 cells. \u003c/strong\u003ebEnd.3 cells were subjected to OGD for 6 h in the presence of 1 μM jasplakinolide or 1 μM Latrunculin B. (A) The permeability coefficient of 4.4-kDa TRITC-dextran in different groups. (B) The permeability coefficient of 70-kDa FITC-dextran in different groups. Results were mean ± SD for three individual experiments. \u003cem\u003e*P \u0026lt; 0.05, **P \u0026lt; 0.01.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-9032259/v1/73dc690290f24c4c83242a22.png"},{"id":104784883,"identity":"579f06bb-661d-44a3-b7df-ed75d289f90a","added_by":"auto","created_at":"2026-03-17 08:09:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":11799864,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9032259/v1/da8cf485-30a0-4c9c-afec-b44c3d2a7b25.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Actin polymerization drives endogenous MMP-9 upregulation and blood–brain barrier disruption in ischemic brain endothelial cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eIschemic stroke is one of the leading causes of death and long-term disability worldwide. Although reperfusion therapy has significantly improved the outcome of acute treatment, a large number of patients still experience severe long-term neurological dysfunction, suggesting that the key molecular events in the early stage of ischemia have not been fully elucidated[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Understanding these early changes is of great significance for the development of effective neuroprotective strategies. Among the earliest pathological events, BBB disruption has been recognized as a key driver of secondary brain injury, yet the upstream cellular mechanisms that initiate barrier destabilization remain incompletely defined.\u003c/p\u003e \u003cp\u003eThe blood brain barrier (BBB) exhibits structural and functional impairments within a few h after ischemia. Matrix metalloproteinase-9 (MMP-9) is a central effector of BBB disruption in ischemic stroke. Through proteolytic degradation of tight junction (TJ) proteins such as occludin and claudin, as well as the adherens junction (AJ) protein VE-cadherin, MMP-9 directly compromises the structural integrity of the endothelial barrier, leading to increased vascular permeability, inflammatory cell infiltration, and secondary brain injury[\u003cspan additionalcitationids=\"CR4 CR5\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The pathogenic role of MMP-9 is well established; however, a critical question remains: what triggers MMP-9 upregulation in the earliest phase of ischemia, before large-scale inflammatory cell infiltration occurs?\u003c/p\u003e \u003cp\u003eIn the context of acute cerebral ischemia, MMP-9 originates from two distinct sources. Exogenous MMP-9, primarily released by infiltrating neutrophils, has been the focus of extensive research and is responsible for converting transient TJ disruption into sustained, severe barrier damage[\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Several broad-spectrum MMP inhibitors and, more recently, MMP-9-selective neutralizing antibodies have been developed to target this circulating pool[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, these strategies primarily address the exogenous component and have limited efficacy against endothelial-derived MMP-9. Critically, brain microvascular endothelial cells themselves constitute an important local source of MMP-9. MMP-9 expression is particularly prominent in cerebral microvessels within the ischemic region[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], where endothelial-derived MMP-9 directly degrades basement membrane components and tight junction proteins leading to increased BBB permeability and vasogenic cerebral edema[\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Given that neutrophil infiltration is a relatively delayed event, occurring hours after ischemic onset, endothelial-derived MMP-9 may serve as the initiating factor that destabilizes the BBB before inflammatory amplification takes place. Yet, the upstream cellular events that trigger endothelial MMP-9 upregulation in early ischemia remain largely undefined, representing a key knowledge gap in understanding the molecular basis of early BBB dysfunction.\u003c/p\u003e \u003cp\u003eEmerging evidence, including our own previous work, points to actin cytoskeletal remodeling as a candidate upstream event. Clinically, we observed that serum F-actin levels are significantly elevated in acute ischemic stroke patients and correlate with stroke severity and early neurological deterioration[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. In a subsequent in vitro study, we demonstrated that oxygen\u0026ndash;glucose deprivation (OGD) induces rapid actin remodeling in brain endothelial cells, characterized by enhanced F-actin polymerization, cofilin dephosphorylation, and myosin light chain phosphorylation, accompanied by β-actin spillover into the extracellular space within 6 h[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. These findings suggest that the actin cytoskeleton undergoes early and significant pathological changes under ischemic stress. Notably, scattered evidence from non-cerebrovascular systems indicates that cytoskeletal perturbations can influence MMP expression. For instance, actin depolymerization has been shown to promote MMP gene expression in breast cancer cells through nuclear translocation of cysteine-rich protein 2[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], and the RhoA/ROCK pathway, a key regulator of actin dynamics, has been linked to MMP-9 signaling in the context of brain plasticity[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, whether actin remodeling directly drives MMP-9 upregulation in ischemic brain endothelial cells has not been systematically examined.\u003c/p\u003e \u003cp\u003eIn the present study, we hypothesized that actin polymerization under OGD conditions functions as an upstream driver of endothelial MMP-9 upregulation, which in turn contributes to junctional protein disruption and BBB permeability increase. To test this hypothesis, we employed a pharmacological approach using jasplakinolide (an F-actin stabilizer that promotes polymerization) and latrunculin B (an actin polymerization inhibitor) to bidirectionally modulate actin dynamics in bEnd.3 cells subjected to 6 h of OGD. We systematically assessed MMP-9 expression and secretion, TJ and AJ protein expression and membrane localization, and transendothelial barrier permeability. This bidirectional pharmacological strategy allows us to move beyond correlative observations and provide functional evidence supporting a link between actin polymerization status, endothelial MMP-9 activation, and early BBB destabilization.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture conditions\u003c/h2\u003e \u003cp\u003eThe mouse brain microvascular endothelial cell line bEnd.3 was obtained from ATCC (American Type Culture Collection, Rockville, MD, USA) and maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 \u0026micro;g/mL streptomycin at 37\u0026deg;C in a humidified atmosphere containing 5% CO₂.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eExperimental grouping and treatment\u003c/h3\u003e\n\u003cp\u003eThis study included two distinct experimental designs.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(1) Time-course experiment for cell injury and actin dynamics\u003c/strong\u003e \u003cp\u003eCells were seeded at 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well in 6-well plates and cultured until approximately 80% confluence. For OGD treatment, the culture medium was replaced with glucose-free and serum-free medium, and cells were transferred to a tri-gas incubator (Thermo Fisher, Pittsburgh, PA, USA) maintained at 5% CO\u003csub\u003e2\u003c/sub\u003e, 94% N\u003csub\u003e2\u003c/sub\u003e, and 1% O\u003csub\u003e2\u003c/sub\u003e for 0, 0.5, 1, 2, 3, 6, 12, or 24 h. At each time point, cell viability (N\u0026thinsp;=\u0026thinsp;10), β-actin mRNA levels (N\u0026thinsp;=\u0026thinsp;10), β-actin release in supernatant (N\u0026thinsp;=\u0026thinsp;6), and F-actin expression (N\u0026thinsp;=\u0026thinsp;6) were assessed.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e(2) Actin remodeling intervention experiment\u003c/b\u003e: Cells were divided into four groups: control, OGD, OGD\u0026thinsp;+\u0026thinsp;1 \u0026micro;M jasplakinolide, and OGD\u0026thinsp;+\u0026thinsp;1 \u0026micro;M latrunculin B (N\u0026thinsp;=\u0026thinsp;3 per group). All cells were first cultured in standard medium for 24 h. Subsequently, control group cells continued in standard medium for 6 h, while the remaining groups were switched to glucose-free and serum-free medium under OGD conditions. Jasplakinolide or latrunculin B was added at the time of medium change. After 6 h of OGD, MMP-9 expression and secretion, TJ and AJ protein expression and distribution, and BBB permeability were assessed.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003e(3) MMP-9 gene expression time-course experiment\u003c/strong\u003e \u003cp\u003eTo investigate temporal changes in MMP-9 gene expression, bEnd.3 cells were subjected to OGD for 0, 2, 4, 6, or 12 h (N\u0026thinsp;=\u0026thinsp;3). MMP-9 mRNA levels were assessed by RT-qPCR at each time point.\u003c/p\u003e \u003c/p\u003e\n\u003ch3\u003eImmunofluorescence\u003c/h3\u003e\n\u003cp\u003eAfter treatment, cells were fixed with 4% paraformaldehyde at room temperature for 15 min, permeabilized with 0.1% Triton X-100 for 10 min, and blocked with 5% bovine serum albumin (BSA) for 30 min. Cells were then incubated overnight at 4\u0026deg;C with primary antibodies, including occludin antibody (1:100, ab216327, Abcam, Cambridge, UK), ZO-1 antibody (1:100, ab307799, Abcam), VE-cadherin antibody (1:500, ab205336, Abcam), and phalloidin (1:500, A12379, Thermo Fisher). After washing three times with PBS, cells were incubated with the corresponding secondary antibodies at room temperature in the dark for 1 h. Secondary antibodies included Alexa Fluor\u0026reg; 488-labeled goat anti-rabbit IgG H\u0026amp;L antibody (1:200, ab150079, Abcam) and Alexa Fluor\u0026reg; 647-labeled goat anti-mouse IgG H\u0026amp;L antibody (1:200, ab150115, Abcam). Nuclei were counterstained with DAPI. Images were acquired at 400\u0026times; magnification using a laser confocal microscope (Leica Microsystems, Wetzlar, Germany). Fluorescence intensity was quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA).\u003c/p\u003e \u003cp\u003eFor F-actin staining, cells were fixed with PBS containing 3.7% formaldehyde for 15 min, then washed three times with PBS containing 0.1% Triton X-100. ActinTracker Green-488 (C2201S, Beyotime, Shanghai, China) was diluted at 1:40 with PBS containing 0.1% Triton X-100 to prepare the staining working solution. Each coverslip was incubated with 200 \u0026micro;L staining solution at room temperature in the dark for 30 min. After washing, nuclei were counterstained with DAPI and images were captured at 400\u0026times; magnification using a fluorescence microscope.\u003c/p\u003e\n\u003ch3\u003eWestern blot\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eWestern blot\u003c/div\u003e \u003cp\u003eCells were lysed with RIPA buffer containing PMSF, and the lysates were centrifuged at 12,000 \u0026times; g for 5 min at 4\u0026deg;C using a refrigerated high-speed centrifuge (Sigma, St. Louis, MO, USA) to collect the supernatant as total protein samples. Protein concentration was determined using the BCA Protein Quantification Kit (KGB2101, KeyGEN BioTECH, Nanjing, China), and samples were stored at \u0026minus;\u0026thinsp;20\u0026deg;C. A total of 60 \u0026micro;g of protein per sample was separated by SDS-PAGE at an initial voltage of 80 V for 30 min, followed by 120 V after the samples entered the resolving gel. Proteins were transferred to a PVDF membrane at 300 mA for 60 min. The membrane was blocked with 5% skim milk in TBST for 1 h at room temperature and then incubated overnight at 4\u0026deg;C with primary antibodies: MMP-9 antibody (1:1000, #24317, Cell Signaling Technology, Boston, USA) and β-tubulin antibody (1:1000, ab18207, Abcam). After washing, the membrane was incubated with the corresponding HRP-labeled secondary antibody (Goat Anti-Rabbit IgG H\u0026amp;L:1:2000, ab6721, Abcam; Goat Anti-Rabbit IgG H\u0026amp;L:1:2000, ab205719, Abcam) for 1 h at room temperature. Protein bands were visualized using ECL chemiluminescence reagent (32209, Thermo Fisher Scientific) and captured with a Tanon 5200 imaging system (Tanon, Shanghai, China). Band intensity was quantified using Image Pro Plus 6.0 software.\u003c/p\u003e\n\u003ch3\u003eELISA assay\u003c/h3\u003e\n\u003cp\u003eCell culture supernatants were collected after treatment. β-actin content was measured using a mouse β-actin ELISA Kit (EM1627, FineTest, Wuhan, China) according to the manufacturer's instructions. MMP-9 content was measured using a mouse MMP-9 ELISA Kit (E-EL-M3052, Elabscience, Wuhan, China). Briefly, standards with concentrations of 100, 50, 25, 12.5, 6.25, 3.13, 1.56, and 0 ng/mL were prepared. Standards and samples (100 \u0026micro;L each) were added to the wells and incubated at 37\u0026deg;C for 90 minutes. After washing, biotin-labeled antibody working solution was added and incubated at 37\u0026deg;C for 60 min. Following additional washing steps, HRP-conjugated working solution was added and incubated at 37\u0026deg;C for 30 min. After final washing, TMB substrate solution was added and incubated at 37\u0026deg;C for 15\u0026ndash;20 min in the dark. The reaction was stopped by adding stop solution, and absorbance was measured at 450 nm using a microplate reader (Berthold Company, Bad Wildbad, Germany).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRT-qPCR\u003c/h2\u003e \u003cp\u003eTotal RNA extraction from the samples occurred through the use of TRIzol reagent (15596026, Thermo Fisher). Briefly, cells were lysed in 0.5 mL TRIzol, and chloroform (0.1 mL) was added for phase separation. After centrifugation at 12,000 rpm for 15 min at 4\u0026deg;C, the aqueous phase was collected and RNA was precipitated with isopropanol at \u0026minus;\u0026thinsp;20\u0026deg;C for 30 min. The RNA pellet was washed with 75% ethanol prepared in DEPC-treated water and dissolved in 10 \u0026micro;L nuclease-free water. RNA concentration and purity were determined using Nanodrop 2000 (Thermo Fisher).\u003c/p\u003e \u003cp\u003eThe iScript cDNA Synthesis Kit (1708891EDU, Bio-Rad, Hercules, CA, USA) was used for reverse transcription with 2 \u0026micro;L of RNA as the template. The reaction mixture (total volume: 20 \u0026micro;L) included 4 \u0026micro;L of 5\u0026times; iScript reaction mix, 1 \u0026micro;L of iScript reverse transcriptase, 2 \u0026micro;L of RNA, and 13 \u0026micro;L of nuclease-free water. The reaction was carried out on a PCR system (Applied Biosystems, Foster City, CA, USA) under the following conditions: 25\u0026deg;C for 5 min, 46\u0026deg;C for 20 min, and 95\u0026deg;C for 1 min. The synthesized cDNA samples were preserved at \u0026minus;\u0026thinsp;70\u0026deg;C for subsequent evaluations.\u003c/p\u003e \u003cp\u003eTB Green Premix Ex Taq\u0026trade; (RR420A, Takara, Otsu, Japan) was used to conduct real-time PCR on an ABI 7500 system. The following primers were used:\u003c/p\u003e \u003cp\u003eβ-actin: Forward (5\u0026prime;\u0026rarr;3\u0026prime;): ATCAAGATCATTGCTCCTCC, Reverse (5\u0026prime;\u0026rarr;3\u0026prime;): GTAAAACGCAGCTCAGTAAC;\u003c/p\u003e \u003cp\u003eMMP-9: Forward (5\u0026prime;\u0026rarr;3\u0026prime;): AAAACCTCCAACCTCACGGA, Reverse (5\u0026prime;\u0026rarr;3\u0026prime;): CACAGCGTGGTGTTCGAATG;\u003c/p\u003e \u003cp\u003eβ-tubulin: Forward (5\u0026prime;\u0026rarr;3\u0026prime;): GTATCTCTTTTCTTCCCGGT, Reverse (5\u0026prime;\u0026rarr;3\u0026prime;): CATTGCTCAGTACCATCCTG.\u003c/p\u003e \u003cp\u003eThe analysis of gene expression levels utilized the 2^\u0026minus;ΔΔCt method and employed β-tubulin as the reference gene.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBBB permeability assay\u003c/h3\u003e\n\u003cp\u003eThe bEnd.3 cells were seeded at a density of 5 \u0026times; 10⁵ cells per well onto the upper chamber of the Transwell chamber (with a pore size of 0.4 \u0026micro;m, Corning) and cultured for 6 days until fusion. According to the experimental groups, the cells were treated with 1 \u0026micro;M Jasplakinolide or 1 \u0026micro;M Latrunculin B. 2 mg/mL of 4.4-kDa TRITC-polymer (MS0911, MK, Shanghai, China) or 2 mg/mL of 70-kDa FITC-polymer (MS0905, MK) was added to the upper chamber. The OGD group cells were subjected to OGD treatment for 6 h, while the control group cells were cultured under normal conditions for 6 h. After incubation, the fluorescence intensities of the upper and lower chambers were detected using an enzyme detector. The relative permeability coefficient (Pdextran) was calculated according to the following formula: Pdextran = (RFU of lower chamber/RFU of upper chamber) \u0026times; V \u0026times; (1/t) \u0026times; (1/A), where V is the volume of the solution in the lower chamber, t is the incubation time, and A is the surface area of the Transwell chamber.\u003c/p\u003e\n\u003ch3\u003eCell viability assay\u003c/h3\u003e\n\u003cp\u003eCell viability was determined using the Cell Counting Kit-8 (CCK-8, Beyotime, Shanghai, China). Cells were seeded at a density of 1 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells per well in 96-well plates. After treatment according to experimental groupings, cells were washed with PBS three times, and 100 \u0026micro;L of medium containing 10% CCK-8 working solution was added to each well. After incubation at 37\u0026deg;C for 2 h, the absorbance was measured at 450 nm using a microplate reader.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data were expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Each experiment was independently repeated three times (N\u0026thinsp;=\u0026thinsp;3 biological replicates). For CCK-8 assays, 10 replicates per condition were used in each independent experiment. Statistical comparisons between groups were performed using one-way analysis of variance (ANOVA) followed by post-hoc tests. GraphPad Prism 9 (San Diego, CA, USA) and SPSS 22.0 (SPSS, Inc., Chicago, IL, USA) software were used for data analysis and visualization. * \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eOGD induced time-dependent endothelial cell injury and actin dynamics changes\u003c/h2\u003e \u003cp\u003eBuilding on our previously published time-course characterization of OGD-induced actin dynamics in bEnd.3 cells[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], we extended these observations to include additional time points and functional assessments to establish the optimal window for mechanistic studies. We performed a time-course experiment examining cell viability, actin gene expression, actin release, and F-actin remodeling. The CCK-8 assay showed that cell viability remained relatively stable during the first 3 h of OGD exposure, then moderately decreased at 6 h, and markedly declined at 12 h and 24 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). RT-qPCR analysis indicated that the β-actin mRNA level remained unchanged throughout the entire OGD period (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), suggesting that the observed changes in intracellular actin were not attributable to transcriptional inhibition. ELISA analysis of culture supernatants showed that β-actin concentrations were significantly elevated starting from 3 h of OGD compared with the control group, with further increases at 6, 12, and 24 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Notably, this increase in supernatant β-actin was already evident at time points when cell viability remained above 90% (0\u0026ndash;3 h), indicating that the release of β-actin into the extracellular space was not simply a consequence of cell lysis. F-actin immunofluorescence staining revealed dynamic changes in cytoskeletal organization during OGD exposure. F-actin fluorescence intensity significantly increased at 3 h and 6 h of OGD, consistent with a stress-induced polymerization response. In contrast, F-actin signals declined at 12 h and 24 h, accompanied by disordered redistribution and loss of organized filament structure (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). These results collectively indicate that 6 h represents a critical time point at which endothelial cells remain viable but exhibit significant actin remodeling and early functional impairment, making it an appropriate time window for investigating the molecular mechanisms of early ischemic endothelial injury. Therefore, subsequent experiments focused primarily on the 6-h OGD time point.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eOGD-induced actin remodeling upregulated MMP-9 expression in bEnd.3 cells\u003c/h2\u003e \u003cp\u003eBased on our previous research, it was shown that OGD can induce the reorganization of actin in endothelial cells[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. To further explore the relationship between this process and MMP-9, we first examined the temporal changes in MMP-9 expression during the OGD process. RT-qPCR results showed that MMP-9 mRNA levels remained unchanged at 2 h of OGD, but significantly increased starting from 4 h, with progressively greater upregulation at 6 h and 12 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). This time-dependent increase in MMP-9 expression paralleled the temporal pattern of actin remodeling observed in our time-course study, suggesting a potential temporal association between these two events. To determine whether actin dynamics directly influence MMP-9 expression, we employed pharmacological modulation of actin polymerization at the 6-h OGD time point. Western blot analysis showed that OGD significantly increased MMP-9 protein expression compared with the control group. Jasplakinolide, which stabilizes and promotes F-actin polymerization, further elevated MMP-9 levels under OGD conditions, whereas latrunculin B, which inhibits actin polymerization, significantly reduced MMP-9 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, C). Consistently, ELISA results demonstrated that OGD significantly increased MMP-9 content in cell culture supernatants, and this effect was further enhanced by jasplakinolide and attenuated by latrunculin B (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). These results indicate that OGD-induced actin remodeling is functionally linked to the upregulation of MMP-9 in brain endothelial cells.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eOGD-induced actin remodeling disrupted tight junction and adherens junction proteins\u003c/h2\u003e \u003cp\u003eMMP-9 is a well-recognized mediator of BBB disruption. Given the close association between MMP-9 activation and BBB structural integrity, we examined whether the actin remodeling induced by OGD for 6 h altered the expression and distribution of key TJ and AJ proteins in bEnd.3 cells. Immunofluorescence analysis revealed that under control conditions, occludin, ZO-1, and VE-cadherin exhibited continuous, well-organized distribution along cell-cell borders. OGD for 6 h resulted in decreased fluorescence intensity and disrupted membrane localization of all three junctional proteins, with discontinuous and fragmented staining patterns at cell peripheries. Jasplakinolide further decreased junctional protein levels and exacerbated the loss of organized membrane distribution, while latrunculin B significantly preserved their expression levels and maintained relatively continuous membrane localization patterns (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). These findings collectively indicate that actin remodeling under OGD conditions is closely associated with the destabilization and redistribution of both tight junction and adherens junction proteins in brain endothelial cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eOGD-induced actin remodeling increased BBB permeability in bEnd.3\u003c/h2\u003e \u003cp\u003eTo assess the functional impact of actin remodeling on barrier integrity, we used 4.4-kDa TRITC-dextran and 70-kDa FITC-dextran for BBB permeability detection. Compared with the control group, OGD treatment for 6 h significantly increased the permeability coefficients of both 4.4-kDa TRITC-dextran and 70-kDa FITC-dextran, indicating that OGD-induced barrier disruption was not limited to paracellular gap widening but may also involve structural compromise of the endothelial monolayer. Jasplakinolide further increased the permeability coefficients, while latrunculin B significantly reduced the permeability coefficients compared with the OGD group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA, B). These results indicate that modulation of actin dynamics significantly influenced the barrier function of the endothelial monolayer under OGD conditions.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study demonstrates that actin polymerization in brain endothelial cells under OGD conditions is functionally linked to MMP-9 upregulation, junctional protein destabilization, and increased BBB permeability. Through bidirectional pharmacological modulation, we show that jasplakinolide amplified whereas latrunculin B attenuated these changes, establishing a functional relationship between actin polymerization status and endothelial MMP-9 activation. Importantly, these events occurred within a 6-h window during which cell viability was largely preserved, indicating that barrier dysfunction precedes overt cell death.\u003c/p\u003e \u003cp\u003eA central finding is that actin remodeling is closely associated with endogenous MMP-9 upregulation within endothelial cells during early ischemia. This contrasts with the conventional focus on neutrophil-derived MMP-9 or inflammatory mediator-driven activation[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Our data show that enhancing actin polymerization under OGD amplified both intracellular and secreted MMP-9 levels, while inhibiting polymerization significantly reduced them. These results suggest that actin polymerization is not merely a passive accompaniment to ischemic injury but may actively contribute to MMP-9 upregulation. The underlying signaling may involve mechanotransduction pathways activated by increased cytoskeletal tension, such as RhoA/ROCK-mediated transcription factor regulation[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], though the specific intermediaries remain to be defined. Furthermore, MMP-9 itself can promote actin rearrangement by degrading the extracellular matrix and modulating the F-actin/G-actin ratio[\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], raising the possibility of a positive feedback loop that accelerates endothelial injury.\u003c/p\u003e \u003cp\u003eThe concurrent disruption of occludin, ZO-1, and VE-cadherin observed in this study is consistent with a dual mechanism involving both mechanical and proteolytic components. Under physiological conditions, these junctional proteins are anchored to the cortical actin network: ZO-1 bridges occludin to the cytoskeleton and is essential for junctional continuity, while VE-cadherin relies on actin association through its cytoplasmic tail for adhesion regulation[\u003cspan additionalcitationids=\"CR24 CR25 CR26 CR27\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. OGD-induced pathological stress fiber formation weakens this mechanical anchorage, promoting junctional protein internalization and redistribution, as reflected by the decreased fluorescence intensity and disrupted peripheral patterns in our immunofluorescence analysis[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan additionalcitationids=\"CR30 CR31\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Concurrently, MMP-9 upregulation adds a proteolytic dimension: both occludin and VE-cadherin are established substrates of MMP-9, and their extracellular domains can undergo cleavage during ischemic injury[\u003cspan additionalcitationids=\"CR34 CR35\" citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Thus, in the setting of weakened cytoskeletal support, MMP-9 activation may advance junctional disruption from loss of mechanical anchoring to active proteolytic degradation. The simultaneous impairment of all three proteins likely reflects their shared dependence on actin for structural support and their concurrent exposure to MMP-9-mediated proteolysis.\u003c/p\u003e \u003cp\u003eThe structural disruption described above was directly confirmed by the permeability assay: OGD for 6 h significantly increased transendothelial permeability to both 4.4-kDa and 70-kDa tracers, and pharmacological modulation of actin dynamics bidirectionally regulated this change. The concurrent permeability increase to both small and large molecules can be explained by the combined effects of cytoskeletal destabilization and early MMP-9 activation. Actin remodeling under OGD shifts the cytoskeleton from a physiological, high-turnover state to a low-reversibility, high-tension configuration driven by ATP depletion and RhoA/ROCK activation[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], increasing membrane tension and weakening junctional anchorage to facilitate paracellular leakage. Simultaneously, the early endogenous MMP-9 increase, while perhaps insufficient to completely degrade the basement membrane, may loosen junctional complexes sufficiently to reduce the mechanical resistance to macromolecular diffusion. It should be noted that in vivo BBB opening typically follows a staged pattern, with macromolecular permeability becoming prominent later than small-molecule leakage[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In our in vitro monolayer model, the absence of the neurovascular unit components (pericytes, astrocytes, and basement membrane) likely removes this buffering effect, allowing both small- and large-molecule leakage to occur concurrently. Nevertheless, recent in vivo studies have also demonstrated that BBB opens to macromolecules within hours after ischemia onset[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], suggesting that our in vitro observations may partially reflect the intrinsic vulnerability of endothelial cells to early ischemic stress.\u003c/p\u003e \u003cp\u003eThe protective effect of latrunculin B may appear counterintuitive, as the actin cytoskeleton is generally required for barrier maintenance. However, under OGD conditions, endothelial cells undergo actin remodeling characterized by excessive stress fiber formation. At the concentration used (1 \u0026micro;M), latrunculin B likely attenuates this pathological polymerization rather than abolishing the cytoskeleton entirely. This interpretation is supported by analogous findings: in chronic hypoxia-induced pulmonary hypertension, latrunculin B suppressed ROS-ROCK-dependent pathological vasoconstriction[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], and low-dose latrunculin A prevented dexamethasone-induced aberrant actin reorganization in trabecular meshwork cells[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The concurrent reduction in MMP-9 expression in the latrunculin B group suggests that the protective effect is at least partially mediated through suppression of MMP-9-dependent junctional protein degradation.\u003c/p\u003e \u003cp\u003eThese findings extend our previous observations by revealing that OGD-induced actin remodeling is not merely a structural event but is functionally linked to MMP-9 activation and barrier disruption, suggesting a self-amplifying pathological cascade: increased actin tension promotes MMP-9 expression, while MMP-9-mediated junctional and matrix degradation further destabilizes cytoskeletal architecture. Our earlier clinical finding that serum F-actin correlates with stroke severity may be partially explained by the early BBB structural damage enabling F-actin leakage into the circulation[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSeveral limitations should be acknowledged. First, the current findings were obtained using an in vitro endothelial cell model, and extending these observations to in vivo ischemic models incorporating the full neurovascular unit will be an important next step to further elucidate the pathological significance of actin remodeling in BBB injury. This represents a key direction of our ongoing research. Second, the specific signaling intermediaries linking actin dynamics to MMP-9 transcription remain to be identified, this will be a focus of our future work. Third, validation under ischemia-reperfusion conditions is needed, as reperfusion often exacerbates BBB injury. Fourth, the use of a mouse cell line may limit generalizability, and confirmation in human endothelial models is warranted. Future studies should address these questions using complementary genetic approaches and in vivo ischemic models.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study demonstrates that OGD-induced actin polymerization in brain endothelial cells is functionally linked to MMP-9 upregulation, junctional protein disruption, and increased BBB permeability. Pharmacological inhibition of actin polymerization attenuated these changes, while promoting polymerization exacerbated them. These findings identify endothelial actin dynamics as a functional upstream event associated with endogenous MMP-9 upregulation and early BBB destabilization in vitro. This work provides a basis for further investigation of actin homeostasis as a potential therapeutic target for early barrier protection in ischemic stroke.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eDeclaration of Competing Interest\u003c/h2\u003e \u003cp\u003eThe authors declared no potential conflicts of interest with respect to the research,\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eXiaojing Zhou contributed to conceptualization, funding acquisition, supervision and validation. Yiyin Zhao contributed to methodology and writing-original draft. Songbin He contributed to funding acquisition, data curation and project administration. Yiming Wang contributed to conceptualization, resources. Meng Jin contributed to software and visualization. Yichao Fu contributed to methodology.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors are grateful to Prof. Yuanzheng Xia for insightful guidance and stimulating discussions throughout this work.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMa\u0026iuml;er B, Tsai AS, Einhaus JF et al (2023) Neuroimaging is the new spatial omic: multi-omic approaches to neuro-inflammation and immuno-thrombosis in acute ischemic stroke. Semin Immunopathol 45(1):125\u0026ndash;143. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00281-023-00984-6\u003c/span\u003e\u003cspan address=\"10.1007/s00281-023-00984-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSennf\u0026auml;lt S, Norrving B, Petersson J et al (2019) Long-Term Survival and Function After Stroke: A Longitudinal Observational Study From the Swedish Stroke Register. Stroke 50(1):53\u0026ndash;61. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/strokeaha.118.022913\u003c/span\u003e\u003cspan address=\"10.1161/strokeaha.118.022913\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJi Y, Gao Q, Ma Y et al (2023) An MMP-9 exclusive neutralizing antibody attenuates blood-brain barrier breakdown in mice with stroke and reduces stroke patient-derived MMP-9 activity. Pharmacol Res 190:106720. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phrs.2023.106720\u003c/span\u003e\u003cspan address=\"10.1016/j.phrs.2023.106720\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo P, Li H, Zhang X et al (2025) Matrix metalloproteinase\u0026ndash;9 in hemorrhagic transformation after acute ischemic stroke (Review). Mol Med Rep 32(2). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3892/mmr.2025.13590\u003c/span\u003e\u003cspan address=\"10.3892/mmr.2025.13590\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Wang B, Dai F et al (2024) The predictive value of serum F-actin on the severity and early neurological deterioration of acute ischemic stroke: Predictive value of F-actin in stroke. J Stroke Cerebrovasc Dis 33(6):107727. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jstrokecerebrovasdis.2024.107727\u003c/span\u003e\u003cspan address=\"10.1016/j.jstrokecerebrovasdis.2024.107727\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao B, Geng L, Zhang F et al (2020) Adipocyte fatty acid-binding protein exacerbates cerebral ischaemia injury by disrupting the blood-brain barrier. Eur Heart J 41(33):3169\u0026ndash;3180. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/eurheartj/ehaa207\u003c/span\u003e\u003cspan address=\"10.1093/eurheartj/ehaa207\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcColl BW, Rothwell NJ, Allan SM (2008) Systemic inflammation alters the kinetics of cerebrovascular tight junction disruption after experimental stroke in mice. J Neurosci 28(38):9451\u0026ndash;9462. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://doi.org/10.1523/jneurosci.2674-08.2008\u003c/span\u003e\u003cspan address=\".10.1523/jneurosci.2674-08.2008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu LD, Fang C, Wang YQ et al (2025) MMP-9 inhibitor SB-3CT improves neurological outcomes in ischemic stroke mice by modulation of astrocytic lipid metabolism. Acta Pharmacol Sin 46(8):2120\u0026ndash;2135. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41401-025-01505-x\u003c/span\u003e\u003cspan address=\"10.1038/s41401-025-01505-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJusticia C, Pan\u0026eacute;s J, Sol\u0026eacute; S et al (2003) Neutrophil infiltration increases matrix metalloproteinase-9 in the ischemic brain after occlusion/reperfusion of the middle cerebral artery in rats. J Cereb Blood Flow Metab 23(12):1430\u0026ndash;1440. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://doi.org/10.1097/01.Wcb.0000090680.07515.C8\u003c/span\u003e\u003cspan address=\".10.1097/01.Wcb.0000090680.07515.C8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrause O, Bozinovski S, Anderson GP et al (2004) Increased matrix metalloproteinase-9 concentration and activity after stimulation with interleukin-17 in mouse airways. Thorax 59(4):313\u0026ndash;317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://doi.org/10.1136/thx.2003.008854\u003c/span\u003e\u003cspan address=\".10.1136/thx.2003.008854\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaturvedi M, Kaczmarek L (2014) Mmp-9 inhibition: a therapeutic strategy in ischemic stroke. Mol Neurobiol 49(1):563\u0026ndash;573. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12035-013-8538-z\u003c/span\u003e\u003cspan address=\"10.1007/s12035-013-8538-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDouglas AS, Shearer JA, Okolo A et al (2021) The Relationship Between Cerebral Reperfusion And Regional Expression Of Matrix Metalloproteinase-9 In Rat Brain Following Focal Cerebral Ischemia. Neuroscience 453:256\u0026ndash;265. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuroscience.2020.10.034\u003c/span\u003e\u003cspan address=\"10.1016/j.neuroscience.2020.10.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiao-Yan Y, Qing-Qing L, Xi L et al (2021) Oxymatrine improves blood-brain barrier integrity after cerebral ischemia-reperfusion injury by downregulating CAV1 and MMP9 expression. Phytomedicine 84:153505. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.phymed.2021.153505\u003c/span\u003e\u003cspan address=\"10.1016/j.phymed.2021.153505\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu MB, Wang W, Gao JM et al (2020) Icariside II attenuates cerebral ischemia/reperfusion-induced blood-brain barrier dysfunction in rats via regulating the balance of MMP9/TIMP1. Acta Pharmacol Sin 41(12):1547\u0026ndash;1556. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41401-020-0409-3\u003c/span\u003e\u003cspan address=\"10.1038/s41401-020-0409-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCastillo-Gonz\u0026aacute;lez J, Gonz\u0026aacute;lez-Rey E (2025) Beyond wrecking a wall: revisiting the concept of blood-brain barrier breakdown in ischemic stroke. Neural Regen Res 20(7):1944\u0026ndash;1956. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4103/nrr.Nrr-d-24-00392\u003c/span\u003e\u003cspan address=\"10.4103/nrr.Nrr-d-24-00392\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao Y, Zhou X, He S et al (2025) Oxygen-glucose deprivation induces actin spillover in brain endothelial cells. Tissue Cell 95:102946. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tice.2025.102946\u003c/span\u003e\u003cspan address=\"10.1016/j.tice.2025.102946\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMgrditchian T, Brown-Clay J, Hoffmann C et al (2023) Actin cytoskeleton depolymerization increases matrix metalloproteinase gene expression in breast cancer cells by promoting translocation of cysteine-rich protein 2 to the nucleus. Front Cell Dev Biol 11:1100938. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcell.2023.1100938\u003c/span\u003e\u003cspan address=\"10.3389/fcell.2023.1100938\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu W, Chen Z, Wen J (2023) The role of RhoA/ROCK pathway in the ischemic stroke-induced neuroinflammation. Biomed Pharmacother 165:115141. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2023.115141\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2023.115141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFigiel I, Kruk PK, Zaręba-Kozioł M et al (2021) MMP-9 Signaling Pathways That Engage Rho GTPases in Brain Plasticity. Cells 10(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells10010166\u003c/span\u003e\u003cspan address=\"10.3390/cells10010166\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQorri B, Kalaydina RV, Velickovic A et al (2018) Agonist-Biased Signaling via Matrix Metalloproteinase-9 Promotes Extracellular Matrix Remodeling. Cells 7(9). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells7090117\u003c/span\u003e\u003cspan address=\"10.3390/cells7090117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen K, Xu M, Lu F et al (2023) Development of Matrix Metalloproteinases-Mediated Extracellular Matrix Remodeling in Regenerative Medicine: A Mini Review. Tissue Eng Regen Med 20(5):661\u0026ndash;670. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s13770-023-00536-x\u003c/span\u003e\u003cspan address=\"10.1007/s13770-023-00536-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin LT, Feng RR, Xie XY et al (2023) Matrix metalloproteinase-9 overexpression in the hippocampus reduces alcohol-induced conditioned-place preference by regulating synaptic plasticity in mice. Behav Brain Res 442:114330. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2023.114330\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2023.114330\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOdenwald MA, Choi W, Buckley A et al (2017) ZO-1 interactions with F-actin and occludin direct epithelial polarization and single lumen specification in 3D culture. J Cell Sci 130(1):243\u0026ndash;259. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jcs.188185\u003c/span\u003e\u003cspan address=\"10.1242/jcs.188185\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFanning AS, Jameson BJ, Jesaitis LA et al (1998) The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. J Biol Chem 273(45):29745\u0026ndash;29753. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://doi.org/10.1074/jbc.273.45.29745\u003c/span\u003e\u003cspan address=\".10.1074/jbc.273.45.29745\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSpadaro D, Le S, Laroche T et al (2017) Tension-Dependent Stretching Activates ZO-1 to Control the Junctional Localization of Its Interactors. Curr Biol 27(24):3783\u0026ndash;3795. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ee8.https://doi.org/10.1016/j.cub.2017.11.014\u003c/span\u003e\u003cspan address=\"e8.10.1016/j.cub.2017.11.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKale G, Naren AP, Sheth P et al (2003) Tyrosine phosphorylation of occludin attenuates its interactions with ZO-1, ZO-2, and ZO-3. Biochem Biophys Res Commun 302(2):324\u0026ndash;329. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://doi.org/10.1016/s0006-291x(03)00167-0\u003c/span\u003e\u003cspan address=\".10.1016/s0006-291x(03)00167-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDorland YL, Huveneers S (2017) Cell-cell junctional mechanotransduction in endothelial remodeling. Cell Mol Life Sci 74(2):279\u0026ndash;292. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00018-016-2325-8\u003c/span\u003e\u003cspan address=\"10.1007/s00018-016-2325-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrimsley-Myers CM, Isaacson RH, Cadwell CM et al (2020) VE-cadherin endocytosis controls vascular integrity and patterning during development. J Cell Biol 219(5). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1083/jcb.201909081\u003c/span\u003e\u003cspan address=\"10.1083/jcb.201909081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang J, Kang Y, Zhou Y et al (2023) TIMP2 ameliorates blood-brain barrier disruption in traumatic brain injury by inhibiting Src-dependent VE-cadherin internalization. J Clin Invest 134(3). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1172/jci164199\u003c/span\u003e\u003cspan address=\"10.1172/jci164199\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu J, Yang J, Yu M et al (2020) Lanthanum chloride causes blood-brain barrier disruption through intracellular calcium-mediated RhoA/Rho kinase signaling and myosin light chain kinase. Metallomics 12(12):2075\u0026ndash;2083. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/d0mt00187b\u003c/span\u003e\u003cspan address=\"10.1039/d0mt00187b\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo PL, Wang YJ, Yang YY et al (2018) Hypoxia-induced hyperpermeability of rat glomerular endothelial cells involves HIF-2α mediated changes in the expression of occludin and ZO-1. Braz J Med Biol Res 51(7):e6201. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1590/1414-431x20186201\u003c/span\u003e\u003cspan address=\"10.1590/1414-431x20186201\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, An Q, Wang T et al (2018) Autophagy- and MMP-2/9-mediated Reduction and Redistribution of ZO-1 Contribute to Hyperglycemia-increased Blood-Brain Barrier Permeability During Early Reperfusion in Stroke. Neuroscience 377:126\u0026ndash;137. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuroscience.2018.02.035\u003c/span\u003e\u003cspan address=\"10.1016/j.neuroscience.2018.02.035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIvaldo C, Passalacqua M, Furfaro AL et al (2023) Oxidative stress-induced MMP- and γ-secretase-dependent VE-cadherin processing is modulated by the proteasome and BMP9/10. Sci Rep 13(1):597. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-022-27308-2\u003c/span\u003e\u003cspan address=\"10.1038/s41598-022-27308-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZuo X, Lu J, Manaenko A et al (2019) MicroRNA-132 attenuates cerebral injury by protecting blood-brain-barrier in MCAO mice. Exp Neurol 316:12\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.expneurol.2019.03.017\u003c/span\u003e\u003cspan address=\"10.1016/j.expneurol.2019.03.017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWendt TS, Gonzales RJ (2023) Ozanimod differentially preserves human cerebrovascular endothelial barrier proteins and attenuates matrix metalloproteinase-9 activity following in vitro acute ischemic injury. Am J Physiol Cell Physiol 325(4):C951. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ec971.https://doi.org/10.1152/ajpcell.00342.2023\u003c/span\u003e\u003cspan address=\"c971.10.1152/ajpcell.00342.2023\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi XF, Zhang XJ, Zhang C et al (2018) Ulinastatin protects brain against cerebral ischemia/reperfusion injury through inhibiting MMP-9 and alleviating loss of ZO-1 and occludin proteins in mice. Exp Neurol 302:68\u0026ndash;74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.expneurol.2017.12.016\u003c/span\u003e\u003cspan address=\"10.1016/j.expneurol.2017.12.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo CY, Xiong TQ, Tan BH et al (2019) The temporal and spatial changes of actin cytoskeleton in the hippocampal CA1 neurons following transient global ischemia. Brain Res 1720:146297. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.brainres.2019.06.016\u003c/span\u003e\u003cspan address=\"10.1016/j.brainres.2019.06.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGisselsson L, Toresson H, Ruscher K et al (2010) Rho kinase inhibition protects CA1 cells in organotypic hippocampal slices during in vitro ischemia. Brain Res 1316:92\u0026ndash;100. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.brainres.2009.11.087\u003c/span\u003e\u003cspan address=\"10.1016/j.brainres.2009.11.087\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlase A, di Girasole CG, Benjamin L et al (2025) Phased blood-brain barrier disruption in ischaemic stroke: implications for therapy? Fluids Barriers CNS 22(1):90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12987-025-00701-5\u003c/span\u003e\u003cspan address=\"10.1186/s12987-025-00701-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu W, Chen H, Gr\u0026oacute;f I et al (2024) Antidepressant-induced membrane trafficking regulates blood-brain barrier permeability. Mol Psychiatry 29(11):3590\u0026ndash;3598. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41380-024-02626-1\u003c/span\u003e\u003cspan address=\"10.1038/s41380-024-02626-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKozler P, Marešov\u0026aacute; D, Pokorn\u0026yacute; J (2024) Assessment of Blood-Brain Barrier Permeability in a Cerebral Ischemia-Reperfusion Model in Rats; A Pilot Study. Physiol Res 73(6):1099\u0026ndash;1105. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.33549/physiolres.935432\u003c/span\u003e\u003cspan address=\"10.33549/physiolres.935432\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShiraishi K, Wang Z, Kokuryo D et al (2017) A polymeric micelle magnetic resonance imaging (MRI) contrast agent reveals blood-brain barrier (BBB) permeability for macromolecules in cerebral ischemia-reperfusion injury. J Control Release 253:165\u0026ndash;171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jconrel.2017.03.020\u003c/span\u003e\u003cspan address=\"10.1016/j.jconrel.2017.03.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeise-Cross L, Sands MA, Sheak JR et al (2018) Actin polymerization contributes to enhanced pulmonary vasoconstrictor reactivity after chronic hypoxia. Am J Physiol Heart Circ Physiol 314(5):H1011. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003eh1021.https://doi.org/10.1152/ajpheart.00664.2017\u003c/span\u003e\u003cspan address=\"h1021.10.1152/ajpheart.00664.2017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Wu Z, Sheibani N et al (2003) Low dose latrunculin-A inhibits dexamethasone-induced changes in the actin cytoskeleton and alters extracellular matrix protein expression in cultured human trabecular meshwork cells. Exp Eye Res 77(2):181\u0026ndash;188. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e.https://doi.org/10.1016/s0014-4835(03)00118-0\u003c/span\u003e\u003cspan address=\".10.1016/s0014-4835(03)00118-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Actin, Blood–brain barrier, Oxygen–glucose deprivation, Brain endothelial cells, MMP-9, Tight junction proteins","lastPublishedDoi":"10.21203/rs.3.rs-9032259/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9032259/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBlood\u0026ndash;brain barrier (BBB) disruption is a critical early pathological event in ischemic stroke. Matrix metalloproteinase-9 (MMP-9) is a well-established effector of junctional protein degradation and barrier breakdown. While circulating MMP-9 derived from neutrophils has been extensively studied, the mechanisms underlying endogenous MMP-9 upregulation within brain endothelial cells during early ischemia remain poorly defined. Here, we provide evidence that actin polymerization functionally contributes to endothelial MMP-9 upregulation under ischemic conditions. Using an oxygen\u0026ndash;glucose deprivation (OGD) model in mouse brain microvascular endothelial cells (bEnd.3), time-course analysis identified 6 h as a critical window at which cells remained viable but exhibited significant actin remodeling. At this time point, both intracellular and secreted MMP-9 levels were significantly increased, concurrent with reduced expression and disrupted membrane localization of occludin, ZO-1, and VE-cadherin, as well as increased transendothelial permeability to both 4.4-kDa and 70-kDa tracers. Pharmacological modulation of actin dynamics bidirectionally regulated these changes: jasplakinolide further amplified MMP-9 expression, exacerbated junctional protein loss, and increased barrier permeability, whereas latrunculin B significantly suppressed MMP-9 upregulation, preserved junctional protein integrity, and reduced permeability. These findings indicate that excessive actin polymerization in brain endothelial cells is functionally linked to MMP-9 activation and early BBB destabilization, independent of inflammatory cell infiltration. These in vitro findings suggest an endothelial-autonomous mechanism that may contribute to early BBB dysfunction\u003c/p\u003e","manuscriptTitle":"Actin polymerization drives endogenous MMP-9 upregulation and blood–brain barrier disruption in ischemic brain endothelial cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-16 09:36:44","doi":"10.21203/rs.3.rs-9032259/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-04-16T16:55:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-29T18:07:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"35105484476088745660337136293073312618","date":"2026-03-14T19:20:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"24769570923521130579048349527156146247","date":"2026-03-13T16:19:27+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-03-11T15:40:46+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-06T13:21:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-06T11:33:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular and Cellular Biochemistry","date":"2026-03-04T16:04:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"13795f48-c99b-4613-8f17-431ab8636bf1","owner":[],"postedDate":"March 16th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"in-revision","subjectAreas":[],"tags":[],"updatedAt":"2026-04-16T17:09:38+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-16 09:36:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9032259","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9032259","identity":"rs-9032259","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}