hCAIX Expression and Cell Cycle in Cytokine Stimulated Human Colon Cancer Cells

hCAIX Expression and Cell Cycle in Cytokine Stimulated Human Colon Cancer Cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article hCAIX Expression and Cell Cycle in Cytokine Stimulated Human Colon Cancer Cells Rahsan Ilikci Sagkan, Feray Kockar, Ali Sengul, Sukran Yilmaz, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.14730/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: At the aim of this study, we investigated the effects of different kind of cytokines and the combinations of which on human carbonic anhydrase IX ( hCAIX) expression in HT-29 cell selected as colon carcinoma model for different doses and time of exposure to determine role of cytokines for treatment of colon carcinoma cells. Results: To sum up, h CA9 expression in the levels of gene and protein increased in HT-29 cells when stimulated with 1000 U/mL TGF-β for 24 h. The stimulation of HT-29 cells with IL1 α alone and IL1α- TGF-β combination has not revealed any effect on hCA9 expression in both levels of gene and protein in contrast to, 1000 U/mL IL1α-TNFα and especially TGFβ-TNFα have reducing effect on h CA9 expression level in HT-29 cells for time ranges of 24 h, 48 h, 72 h. In addition to this data, it was observed that HT-29 cells at the phase of G0G1 are arrested in cell cycle when stimulated with either of 1000 U/mL IL1α-TNFα and TGFβ-TNFα. Moreover, it was observed that h CA9 expression level in HT-29 cells decreases at the phases of synthesis (S) and G2M. Discussion: We concluded that combination of TNFα-TGFβ has created antagonistic effect on hCA9 expression in HT-29 colon cancer cell model. On the other hand, combination of TNFα-IL1α caused sinergistic effect on h CA9 expression level in this cell model. When these results are demonstrated decrease in the cytokine exposed hCA9 expression is a finding to develop a novel approach for anticancer therapy. Conclusion: Our finding related to the change in the expression of hCA9 following cytokine stimulate to colon cancer cell line gives an idea about the effect of cytokine stimulation on the expression of this gene which will be a hot spot research in colon carcinogenesis. Methods: HT-29 colon cells were chosen as a colorectal adenocarcinoma model. hCA9 gene expression in the level of mRNA was measured in cytokines stimulated HT-29 cells by Quantitative Real-time PCR. Meanwhile, hCAIX expression in the level of protein and cell cycle aassay were detected by flow cytometry. Immunology Carbonic anhydrase IX cytokine colon cancer Figures Figure 1 Figure 2 Background Colorectal cancer is the most common third type of cancer observed in the world. In the world, colorectal cancer causes 395.000 people to die each year [1, 2]. Therefore, enlightment of genes which are responsible for colorectal cancer is crucial to contribute a new dimension to conventional recruitment of colorectal cancer. Human carbonic anhydrase IX ( h CAIX), which is one of the popular transmembrane protein related with tumor progression and metastasis, is a member of transmembrane carbonic anhydrases. Expression of CAIX is so limited in normal cells. However, hypoxic conditions of the tumor cause to increased CAIX expression and hypoxia inducible factor alpha (HIF1-α) in different tumor types. These data provide a h CAIX is a powerful marker in terms of tumor hypoxia [3, 4]. Moreover, this h CAIX enzyme plays a critical function in tumor invasion and metastasis by the way of cell to cell adhesion [5]. Therefore, recent studies about especially h CAIX and various types of cancer attract the attention on this carbonic anhydrase subtype [6]. h CA9 is one of the important genes shown in colorectal tumorigenesis. h CAIX expression in colorectal tumors was first demonstrated by Saarnio and et al. along with Ki-67 antigen which is also a major marker for cell proliferation in colorectal adenocarcinoma [6, 7]. Cytokines are secreted peptides which have multiple roles in regulation of cellular interaction and communication and cell proliferation, differentiation, invasion in cancerogenesis. On the side, since these molecules have been used in immunotherapy, studies about cytokines have been getting worse. The fact that these molecules have immunotherapy potential against malignant diseases is the focus of the researchers [8–10]. Immune effector cells capable of destruction of human tumors should be defined as in vitro [11] . IL-1α is the most potent pro-inflammatory cytokines that is generated by macrophages immediately after confronting the inflammatory stimuli. In addition, molecules from IL1 family are mostly expressed in tumor regions and is effective on each stage of tumorigenesis such as tumor invasion and connection between host and immune system in malign cells [12]. Like IL1α, TGFβ beta has also pleitropic roles in tumor cells. TGFβ supports malign transformation and tumor progression in various types of cell. In studies about colorectal cancer, high level of expression of TGFβ in primary tumor depends on late stages. Divergent effect of TGFβ in carcinogenesis depends on differentiation status and proliferative capacity of epithelium cells. TGFβ has an inhibition effect on well differentiated primary colon carcinoma, TGFβ makes less differentiated cells invase and proliferate [13, 14]. Therefore, the effect of cytokine on the modulation of cancer-related genes needs to be adressed. In this work, we focused on determining the effect of cytokine on h CAIX expressions. There is rather limited study available about cytokines regulation of h CAIX. Yildirim and Kockar in 2009 reported that TGFβ upregulates hCAIX expression in liver cell model, Hep3B. It is crucial to know that the knowledge of this type of interaction might be important for improvement of new therapeutic approaches [15]. We hypothesized that if cytokines acting through caix expression levels alteration and relation with cell cycle phases in HT-29 cancer cell line. To test this hypothesis, cell line treated with different cytokines and these combinations. Untreated cells were used as control . Our research group previously demonstrated that TNFα decreased the h CA9 mRNA anf protein expression along with cell cycle arrest in HT-29 cells [16]. Because of the insufficient research about the relation between cytokines and expression of h CAIX, this study was conducted in order to investigate contribution of the above mentioned cytokines in regulation of h CA9 which is a crucial marker in colorectal cancer. Methods 2.1. Cell culture of HT-29 colon cells HT-29 colon cell line provided by Sukran Yılmaz, Sap Institue, Ankara, Turkey. HT-29 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10 % fetal bovine serum (FBS) and incubated at 37˚C in a humidified atmosphere of 95 air and 5% CO 2 incubator. Then, cells were seeded into a flask of 25 cm 2 and following 24 h, these cells were treated with double combinations of these cytokine (TGFβ, IL1α). TNFα cytokine was also included in combination protocol. 2.2. Cell cycle analysis of HT-29 colon cells by flow cytometry The analysis of the cell cycle phase was performed as described previously [16]. Briefly, cells were washed in PBS and then stained with PI using a commercial kit (Beckman Coulter, USA). Cellular DNA content was measured and analyzed on a flow Cytometry System with CXP software (Beckman Coulter FC500 System, USA). 2.3. Annexin V staining apoptosis test HT-29 colon cells were seeded into a 6-well plate. After 24 h incubation process, each one of 1000U/mL TGFβ, IL1α separately and 1000U/mL various combinations of IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ.were added to the cells. The follow-up protocols were carried out according to the manufacturer protocol of AnnexinV-FITC kit (Beckman Coulter, USA). Samples were analysed by a flow cytometer and analyzed with CXP software (Beckman Coulter FC500 System, USA). 2.4. Total RNA isolation and cDNA synthesis Total RNA isolation from the HT-29 cells was done with RNeasy mini kit (Qiagen GmBH., Germany). Reverse transcription for cDNA synthesis was performed in 20 μl final reaction volume including 50 U MuLV reverse transcriptase (Applied Biosystems, Foster City, CA), 10X PCR buffer, 5 pmol specific antisense primer, 4 U RNase inhibitor (Roche), 4 mmol/L of each dNTPs, 6.25 mmol/L MgCl 2 , and 2 μl (1ug) RNA. The RT step was performed as described previously on a Corbett Research Thermocycler at 42°C for 30 minutes followed by 94°C for 5 minutes [16] . 2.5. h CA9 gene expression h CA9 (target gene) and TATA binding protein (TBP-housekeeping gene) gene expressions were carried out by quantitative Real-time RT-PCR using the Rotorgene system (Qiagen, Germany) [16]. The primers provided by Primer Design (Primer Design, USA) company designed depending on published information about mRNA sequences in GenBank (sequence Accession Nos., h CA9: NM_001216). For 105 bp amplification product, sense primer was “AGCAGAGGTAGCCGAGACT” (position:1.395) and antisense primer was “ATGAGCAGGACAGGACAGTTA” (position:1.499). For TBP gene, sense primer sequence was “CTGTTTAACTTCGCTTCC” and antisense primer sequence was “CTCTTCTCAGCAACTTCC”. The reactions were performed with 5 µL cDNA template in a final volume of 25 µL, containing 12.5 μL Sybr Green master mix (Qiagen, Germany), with 15 pmoL primers for whole genes in a Rotor-Gene Real-time PCR instrument (Qiagen, Germany). Initial denaturation was 1 min at 94°C, 40 cycles of specific annealing temperature for 2 sec, extension at 72°C for 10 sec and denaturation at 94°C. Melting curve analysis was carried out in the temperature range of 55 to 95 °C. We calculated the relative quantification using the ratio between hCA9 and TBP mRNA. Arbitrary copy numbers were analyzed using Rotor-Gene v.5 software (Qiagen, Germany). A melt curve was obtained from 65-99 o C for the specificity of the reaction. Three technical and biological reactions were performed for each transcript and negative control was used. 2.6. h CAIX protein expression Brifly, after cell culture procedures, cells were scraped with cell scraper and then 1x10 5 cells suspended in PBS. Human anti-CAIX antibody was added in each test tube for 45 minutes in ice bath and then washed with PBS to remove unbound antibodies. The assay was carried out in triplicate. The expression of h CAIX was monitored and analyzed on a Beckman Coulter FC500 Flow Cytometry System with CXP software (Beckman Coulter, USA). Statistical analysis Each data was the mean of three independent values. All data were expressed as mean ± S.D. and analyzed one-way ANOVA Test by SPSS 11.5 (SPSS Inc., Chicago, IL, USA) to determine the significance of differences between groups (untreated control cells and treated cells). P< 0.05 was considered statistically significant. Results 4.1. Protein expression HT-29 colon cells were seeded into a 6-well plate and incubated for 24 h. After incubation process, either of 1000 U/mL TGFβ and IL1α and various combinations of 1000 U/mL of IL1α-TGFβ. were seeded to the cells and incubated for 24 h, 48 h and 72 h. We previously demonstrated that TNF-alpha caused the decrease CAIX mRNA, the combinations of TNFα-TGFβ and IL1α-TNFα were included to the analysis. Firstly, we investigated the influence of different doses (100 U/mL, 500 U/mL, 1000 U/mL) and exposure times (24 h, 48 h and 72 h) of TGFβ and IL1α and various combinations of 1000 U/mL IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ on h CA9 protein expression level. In order to determine this stimulation effect in HT-29 cells, flow cytometry technique was utilized. While analyzing experimental data, all results evaluated relative to untreated control group. As a first result, we observed that TGFβ has nearly 26% increase on CAIX protein expression level at a concentration of 1000 U/mL for 24h. Secondly, when the effect of IL1α was investigated, any significant influence has not been detected. As in previous results, we could not observe the effect of 1000 U/mL IL1α-TGFβ combination on h CA9 protein expression. In contrast, the other combinations of cytokines (IL1α-TNFα and TNFα-TGFβ) have revealed decreasing effect on h CA9 protein expression level at the concentration of 1000 U/mL for 24 h, 48 h and 72 h when compared to the untreated control cells. For IL1α-TNFα combination, hCAIX protein expression level decreased nearly 22%, 8% and 16% for 24 h, 48 h and 72 h, respectively. For TNFα-TGFβ combination set, we only observed significant decrease for 72 h incubation time. As shown in figure 2, the level of the h CAIX protein expression dropped nearly 45%, for 72 h. The results were obtained by performing the experiment in triplicate. 4.2. mRNA expression of h CAIX The effect of these cytokines on h CA9 mRNA expression level was evaluated relative to untreated control cell group. Firstly, HT-29 cells were exposed to TGFβ for 24 h, it was observed that h CA9 mRNA expression level pointed out nearly 2.5±0.8-fold increase when compared to untreated control cells as shown in figure 1. This result is consistent with the data mentioned on h CAIX protein expression part. No significant effect of TGFβ on h CA9 mRNA expression was observed in HT-29 cells for 48h and 72 h (data not shown). Secondly, we investigated the effect of IL1 on h CA9 mRNA expression for different doses (100 U/mL, 500 U/mL, 1000 U/mL) and incubation periods (24 h, 48 h, 72 h) in HT-29 cells. However, we could not detect any significant effect of IL1α on h CA9 expression level for different doses and periods. Thirdly, we studied the effect of IL1α-TGFβ combination at 1000 U/mL concentration for different incubation times. However, we could not observe any effect of this combination set on h CA9 expression level as in previous case. Although the use of IL1α alone and together with TGFβ has not revealed any acceptable effect on the h CA9 expression level, the combination of TGFβ-IL1α significantly influenced the h CA9 expression level. 1000U/mL of IL1α-TNFα combination caused to 3.9± 1.2 fold reduction of h CA9 expression level for 48 h. As the incubation time increased to 72h for the same combination set, 15.7±7.9-fold decrease in hCA9 expression level was observed as shown in figure 2. Lastly, the effect of TNFα-TGFβ combination on CA9 expression level was studied for 24 h, 48 h and 72 h. The similar change in CA9 mRNA expression level in terms of incubation time was observed for this combination set of cytokines. As similar to the effect of previous combination, TNFα-TGFβ combination led to 2.4± 0.7, 3.4± 2.1 and 7.0± 0.4-fold decrease in h CA9 expression level for 24 h, 48 h and 72 h, respectively as shown in figure 2. All experiment was performed in triplicate. 4.3. Cell cycle analysis and apoptosis Flow cytometry method is easily used for cell cycle studies. PI staining was used to detect cell cycle phases (G0G1, S, G2M) with or without cytokines (1000 U/mL TGFβ, IL1, IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ) treatment in HT-29 cells. We determined the statistically significant GOG1 arrest with concomitant depletion of S and G2M phases in HT-29 cells for 24 h, 48 h and 72 h at a highest concentration of 1000 U/mL TNFα-TGFβ cytokine combination. For 1000 U/mL IL1α-TNFα combination, we observed similar effect as in cell cycle phases in HT-29 cells for 72 h. The results are shown in table 1. No apoptotic effect was detected for any cytokine set in HT-29 colon cancer cells. All data obtained from three independent assay and p<0.05 value was considered statistically significant for all experiment. Discussion The expanding drugs and inhibitors have been used that inhibition of hCAIX against various cancer and metabolic disorders as a molecule [17–19]. This knowledge prompted us to investigate the effects of different cytokines that crucial proteins for immunotherapy on expression of h CAIX critical proliferation mechanism of cancer cells. HT-29 model colon cells are utilized at many studies about colorectal carcinoma. These cells are important in many studies since they have most of characteristic colonic epithelium [20]. Several investigators reported the h CAIX expression in colon cells. When normal mucosa in which hypoxic response is observed early h CAIX is compared with colorectal cancers, it is observed that there is an increase in h CAIX expression in colorectal cancers [6, 21, 22]. According to the study demonstrated by Adrián (2003), expression of carbonic anhydrase IX was increased under hypoxic conditions in xenograft nude mice model that were created a colorectal tumor using HT-29 colon carcinoma cells [23]. For this purpose, we selected HT-29 colon carcinoma cell line to point out relationship between h CA9 expression and cytokines. In this study, two cytokines (IL1α and TGFβ) were used since these cytokines have been implicated in cancer. TNFα, previously demonstrated decreasing effect on h CA9 gene expression, was also included into the study. This study, the association between cytokines and CA9 which is a gene related with tumor, was investigated due to the lack of information about this subject. The data obtained in our research attracts more attention because there was limited study conducted before about this topic. TGFβ, one of these cytokines, causes malign transformation and tumor progression in various types of cell. Moreover, production of TGFβ tends to increase in various cancer including colon cancer [24] . These cancer cells on which oncogenes are dominant activate transcription of TGF gene [25, 26]. In studies about colon and colorectal cancer, it was shown that high level of expression of TGF in primary tumor depends on late stages. There are various types of mechanisms affecting development of tumor. TGF has inhibition effect on primary colon carcinoma differentiated well and causes the invasion and proliferation of less differentiated cells. Divergent effect of TGF in carcinogenesis depends on differentiation status and proliferative capacity of epithelium cells. After the transformation, TGF supports viability, invasion and metastasis of tumor cells [27]. This interaction is important for improvement of new therapeutic approaches. In the study, we tried to determine whether the level of h CA9 expression in HT-29 cells changes or not when stimulated with different cytokines for different doses (100 U/mL, 500 U/mL, 1000 U/mL) and exposure times (24 h, 48 h, 72 h). Moreover, we investigated cell cycle phases and apoptosis in HT-29 cells at the same conditions. When expression of h CAIX in HT-29 cells exposed to 1000 U/mL TGFβ was investigated for 24 h, the increase in expression of h CAIX was observed in the level of protein and mRNA. The increase in h CA9 expression level in HT-29 colon cancer cells stimulated with TGFβ was shown in this study at first time. This observation can be regarded as significantfinding since many common tumor cells have enhanced levels of TGFβ [28]. In another study, it was observed that the effect of TGFβ on h CAIX also has similar effect on Hep3B cells [15]. The results of these two studies have supported each other. These findings are crucial to develop new approaches for recruitment of cancer. In this context, it is important to investigate expression level of h CAIX used as biomarker. It has also active role in regulation of cell cycle for cell proliferation. In some various types of tumors, because of CA location and the fact that this molecule has a role in regulation of cell growth at other locations h CAIX expression in fast proliferating cells of tumor shows an increase [29] . IL1α and TNFα are pro-inflammatory cytokines and inductions of which by inflammation are effective on expression of lots of genes. Cytokines such as IL1α and TNFα taking place in both of carcinogenesis and development and invasion of tumors which induct chemokines attracting neutrophils playing active role in both of production of reactive types of oxygen and carcinogenesis [30]. There are so many investigation indicating the relation between cancer development and expressions of oncogenes. Besides this, existence of the relation between chronic inflammation and cytokine production brings additional mechanism in the carcinogenesis process. In cancer, NFKβ activation has essential role in various tumor [31]. This activation is also essential for regulation of genes acting on immune response. However, the association between expression of oncogene and pro-inflammatory cytokines could still not have been raised. Molecules from IL1 family are mostly expressed in tumor regions and which are potential cytokines affecting tumorigenesis. IL1 is effective on each stage of tumorigenesis such as tumor invasion and connection between host and immune system in malign cells [12]. Immune effector cells capable of destruction of human tumors are defined as in vitro . Monoclonal antibodies identifying antigens related with tumors were produced in most of vertebrate cells including human being too [11]. Not only the effect of TGFβ on level of h CAIX expression was investigated, but the effect of IL1α and TGFβ combinations of cytokines were also investigated in order to determine synergistic and antagonistic effects of cytokines. Effects of these cytokines on expression of h CAIX in rank both of protein and mRNA were investigated by introducing 1000 U/mL cytokines for different time ranges (24 h, 48 h and 72 h). It was seen that there is no remarkable effect of this combination of IL1α-TGFβ on h CA9 protein and mRNA expression level and on cell cycle phases of colon cancer cells. It could not be found that there is an effect on viability and necrosis. Moreover, the relations among h CAIX, cell cycle and apoptosis in model of colon carcinoma were clarified by considering parameters of cell cycle and apoptosis important for tumor development. When 1000 U/mL IL1α-TNFα and TNFα-TGFβ combinations were introduced into HT-29 cells at 24 h, 48 h and 72 h, it was observed that the expression of h CAIX at the level of protein and mRNA sharply decreases as time dependent manner. This inhibition effect of TNFα combinations is significant and this fact was indicated in this study at first time. Our results have been correlated with the study in which the effect of TNF on histondeasetilase 3 related with tumors was investigated [32]. By considering this results, we can claim that combination of TNFα-TGFβ has created the antagonistic effect on CA9 expression in HT-29 colon cancer cell model. In the other hand, combination of TNFα-IL1α caused synergistic effect on h CA9 expression level in this cells. In addition to this, all TNFα combinations lead to arrest the colon cells in G0/G1 phase of cell cycle at. Furthermore, This combinations caused cell necrosis supported by several literatures [32–35] while colon cells at GOG1 stage, TNFα also lead to decrease in h CAIX expression in colon cells. Conclusions This finding reflects the functionally multiple nature of these cytokines and represent a useful paradigm to study the complex cellular targets such as CAIX that regulate colon cancerogenesis. Therefore, immunotherapy potential of these cytokines against malign disease is always focus for researchers. Abbreviations h CAIX: Human carbonic anhydrase IX TNFα: Tumor necrosis factor alpha IL1α: Interleukin 1 alpha TGFβ: Transforming growth factor beta Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Availability of data and material Not applicable Competing interests The authors declare that they have no competing interest. Funding This study financillay supported by Balikesir University Research Project (2008/15). The content is only the responsibility of the authors and does not necessarily represent the official views. The funding body was not involved in the design of the study, collection or analysis of the data, interpretation of the data, or in the writing of the manuscript. Authors'contributions RIS and FK constructed hypothesis and planned methodology equally for research. They contributed to write equally for manuscript. RIS contributed to all experimental studies, data analysis and presentation of results. SY contributed to cell culture studies. UM and AS contributed to intellectual content. All authors have read and approved this manuscript. Acknowledgements Not applicable References Bray F, Jemal A, Grey N, Ferlay J, Forman D. Global cancer transitions according to the Human Development Index (2008-2030): a population-based study. Lancet Oncol. 2012;13:790–801. Edwards BK, Noone A-M, Mariotto AB, Simard EP, Boscoe FP, Henley SJ, et al. Annual Report to the Nation on the status of cancer, 1975-2010, featuring prevalence of comorbidity and impact on survival among persons with lung, colorectal, breast, or prostate cancer. Cancer. 2014;120:1290–314. Pastorek J, Pastorekova S. Hypoxia-induced carbonic anhydrase IX as a target for cancer therapy: from biology to clinical use. Semin Cancer Biol. 2015;31:52–64. Pastorekova S, Ratcliffe PJ, Pastorek J. Molecular mechanisms of carbonic anhydrase IX-mediated pH regulation under hypoxia. BJU International. 2008;101:8–15. Parkkila S. Significance of pH regulation and carbonic anhydrases in tumour progression and implications for diagnostic and therapeutic approaches. BJU International. 2008;101:16–21. Saarnio J, Parkkila S, Parkkila A-K, Haukipuro K, Pastoreková S, Pastorek J, et al. Immunohistochemical Study of Colorectal Tumors for Expression of a Novel Transmembrane Carbonic Anhydrase, MN/CA IX, with Potential Value as a Marker of Cell Proliferation. Am J Pathol. 1998;153:279–85. Holt PR, Moss SF, Kapetanakis AM, Petrotos A, Wang S. Is Ki-67 a better proliferative marker in the colon than proliferating cell nuclear antigen? Cancer Epidemiol Biomarkers Prev. 1997;6:131–5. Conlon KC, Miljkovic MD, Waldmann TA. Cytokines in the Treatment of Cancer. Journal of Interferon & Cytokine Research. 2018;39:6–21. Dranoff G. Cytokines in cancer pathogenesis and cancer therapy. Nature Reviews Cancer. 2004;4:11–22. Lee S, Margolin K. Cytokines in Cancer Immunotherapy. Cancers (Basel). 2011;3:3856–93. Borden EC, Sondel PM. Lymphokines and cytokines as cancer treatment. Immunotherapy realized. Cancer. 1990;65 3 Suppl:800–14. Apte RN, Dotan S, Elkabets M, White MR, Reich E, Carmi Y, et al. The involvement of IL-1 in tumorigenesis, tumor invasiveness, metastasis and tumor-host interactions. Cancer Metastasis Rev. 2006;25:387–408. Bellam N, Pasche B. Tgf-beta signaling alterations and colon cancer. Cancer Treat Res. 2010;155:85–103. Roman C, Saha D, Beauchamp R. TGF-beta and colorectal carcinogenesis. Microsc Res Tech. 2001;52:450–7. Yildirim H, Köçkar F. TGF-beta upregulates tumor-associated carbonic anhydrase IX gene expression in Hep3B cells. Cell Biol Int. 2009;33:1002–7. Ilikci sagkan R, Kockar F, Sengul A, Yilmaz S, Musabak U. Inhibition effect of TNFα on CAIX expression in HT-29 colon carcinoma cells and the relationship of this cytokine with cell cycle. In: ACADEMIC RESEARCHES IN HEALTH SCIENCES. Ankara: Gece; 2018. p. 63–74. Krasavin M, Shetnev A, Baykov S, Kalinin S, Nocentini A, Sharoyko V, et al. Pyridazinone-substituted benzenesulfonamides display potent inhibition of membrane-bound human carbonic anhydrase IX and promising antiproliferative activity against cancer cell lines. European Journal of Medicinal Chemistry. 2019;168:301–14. Mincione F, Scozzafava A, Supuran CT. The Development of Topically Acting Carbonic Anhydrase Inhibitors as Antiglaucoma Agents. 2008. doi:info:doi/10.2174/138161208783877866. Supuran CT. Diuretics: From Classical Carbonic Anhydrase Inhibitors to Novel Applications of the Sulfonamides. 2008. doi:info:doi/10.2174/138161208783877947. Evans ME, Jones DP, Ziegler TR. Glutamine prevents cytokine-induced apoptosis in human colonic epithelial cells. J Nutr. 2003;133:3065–71. Rasheed S, Harris AL, Tekkis PP, Turley H, Silver A, McDonald PJ, et al. Assessment of microvessel density and carbonic anhydrase-9 (CA-9) expression in rectal cancer. Pathology - Research and Practice. 2009;205:1–9. Rasheed S, McDonald PJ, Northover JM, Guenther T. Angiogenesis and hypoxic factors in colorectal cancer. Pathology - Research and Practice. 2008;204:501–10. Chrastina Adrián, Závada Jan, Parkkila Seppo, Kaluz Štefan, Kaluzová Milota, Rajčáni Július, et al. Biodistribution and pharmacokinetics of 125I‐labeled monoclonal antibody M75 specific for carbonic anhydrase IX, an intrinsic marker of hypoxia, in nude mice xenografted with human colorectal carcinoma. International Journal of Cancer. 2003;105:873–81. Derynck R, Budi EH. Specificity, versatility, and control of TGF-β family signaling. Sci Signal. 2019;12. Birchenall-Roberts MC, Ruscetti FW, Kasper J, Lee HD, Friedman R, Geiser A, et al. Transcriptional regulation of the transforming growth factor beta 1 promoter by v-src gene products is mediated through the AP-1 complex. Mol Cell Biol. 1990;10:4978–83. Geiser AG, Kim SJ, Roberts AB, Sporn MB. Characterization of the mouse transforming growth factor-beta 1 promoter and activation by the Ha-ras oncogene. Mol Cell Biol. 1991;11:84–92. Fabregat I, Fernando J, Mainez J, Sancho P. TGF-beta signaling in cancer treatment. Curr Pharm Des. 2014;20:2934–47. Pasche B. Role of transforming growth factor beta in cancer. J Cell Physiol. 2001;186:153–68. Nógrádi A. The Role of Carbonic Anhydrases in Tumors. The American Journal of Pathology. 1998;153:1–4. Dinarello CA. The paradox of pro-inflammatory cytokines in cancer. Cancer Metastasis Rev. 2006;25:307–13. Balkwill F, Charles KA, Mantovani A. Smoldering and polarized inflammation in the initiation and promotion of malignant disease. Cancer Cell. 2005;7:211–7. Spurling CC, Godman CA, Noonan EJ, Rasmussen TP, Rosenberg DW, Giardina C. HDAC3 overexpression and colon cancer cell proliferation and differentiation. Mol Carcinog. 2008;47:137–47. Munker M, Munker R, Saxton RE, Koeffler HP. Effect of recombinant monokines, lymphokines, and other agents on clonal proliferation of human lung cancer cell lines. Cancer Res. 1987;47:4081–5. Ruggiero V, Latham K, Baglioni C. Cytostatic and cytotoxic activity of tumor necrosis factor on human cancer cells. The Journal of Immunology. 1987;138:2711–7. Sugarman BJ, Aggarwal BB, Hass PE, Figari IS, Palladino MA, Shepard HM. Recombinant human tumor necrosis factor-alpha: effects on proliferation of normal and transformed cells in vitro. Science. 1985;230:943–5. Tables Table 1. Flow cytometry analysis of cell cycle phases of HT-29 colon cells treated with different combinations of cytokines for different times. Cell cycle parameters G0G1 (%) S (%) G2M (%) Control group (24 h) 79,7±1,4 7,5±0,2 13,2±0,8 IL1α-TNFα (24 h) 84,9±0,4 4,9±0,2 10,3±0,2 IL1α-TGFβ (24 h) 83,3±0,8 5,8±0,5 10,9±0,2 TNFα-TGFβ (24 h) 89,7±0,7 3,1±0,2 7,4±0,4 Control group (48 h) 87,0±0,7 6,5±2,8 7,2±3,1 IL1α-TNFα (48 h) 89,4±0,2 3,7±1,1 6,7±0,8 IL1α-TGFβ (48 h) 87,3±4,2 3,8±0,2 6,3±0,8 TNFα-TGFβ (48 h) 90,5±0,4 3,2±1,0 6,3±0,6 Control group (24 h) 75,2±1,0 10,9±0,4 13,4±1,2 IL1α-TNFα (24 h) 82,0±0,9 5,9±0,7 11,9±0,3 IL1α-TGFβ (24 h) 78,9±0,3 5,8±1,3 15,1±1,1 TNFα-TGFβ (24 h) 86,2±5,8 5,7±0,7 11,5±0,2 Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5401","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":158737,"identity":"2a1034d9-8405-4eb4-ae50-fa30be71dc8f","order_by":1,"name":"Rahsan Ilikci Sagkan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYFACHhAhwcMPohIKiNdiISfZANJiQLyWCmODAyCaGC3m7WcPf/i5QyJx8/nViR8eGDDI84sdwK9F5kxemmTvGYnEbTfebpYAOsxw5uwE/FokGHLMGHjbQFrObgBpSTC4TUgL/xvjj3+BWjbPOLv5B3FaJHIMpIG2GBvw924j0haJN2bSsm0SchI3eLdZJBhIEOEX/hzjj2/b6nj4+89uvvmjwkaeX5qAFiTNYJUSxCoHAf4DpKgeBaNgFIyCkQQA3E5A+hVOKZoAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-3844-6158","institution":"University of Usak","correspondingAuthor":true,"prefix":"","firstName":"Rahsan","middleName":"Ilikci","lastName":"Sagkan","suffix":""},{"id":158738,"identity":"37ea366e-0fd9-4af7-b280-bb71f39dd302","order_by":2,"name":"Feray Kockar","email":"","orcid":"","institution":"University of Balıkesir","correspondingAuthor":false,"prefix":"","firstName":"Feray","middleName":"","lastName":"Kockar","suffix":""},{"id":158739,"identity":"253ab968-0ca2-4dcc-8acc-da45a23777b0","order_by":3,"name":"Ali Sengul","email":"","orcid":"","institution":"Medical Park Hospital","correspondingAuthor":false,"prefix":"","firstName":"Ali","middleName":"","lastName":"Sengul","suffix":""},{"id":158740,"identity":"f0ca00a8-69e7-4b1d-b184-923a29190791","order_by":4,"name":"Sukran Yilmaz","email":"","orcid":"","institution":"Foot and Mouth Disease Institute","correspondingAuthor":false,"prefix":"","firstName":"Sukran","middleName":"","lastName":"Yilmaz","suffix":""},{"id":158741,"identity":"f0e13885-5e46-427b-9d2b-ee24ae9fd9bf","order_by":5,"name":"Ugur Musabak","email":"","orcid":"","institution":"University of Baskent","correspondingAuthor":false,"prefix":"","firstName":"Ugur","middleName":"","lastName":"Musabak","suffix":""}],"badges":[],"createdAt":"2019-09-17 13:49:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.2.14730/v1","doiUrl":"https://doi.org/10.21203/rs.2.14730/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94292,"identity":"6d4442c1-16de-4c1e-88a3-6cbac9ae3d11","added_by":"auto","created_at":"2019-09-22 18:32:49","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":23757,"visible":true,"origin":"","legend":"The graph of hCAIX expression level in TGFβ treated and untreated HT-29 cells for 24 h. A: The increase ratio of hCAIX protein expression at the highest concentration of TGFβ (1000 U/mL) exposed HT-29 colon cells for 24 h. B: Fold increase of hCA9 gene expression in 1000 U/mL TGFβ exposed HT-29 colon cells for 24 h.","description":"","filename":"fig1.jpg","url":"https://assets-eu.researchsquare.com/files/c832b0e9-829f-457e-a3d9-2b359c6fb4e0/v1/fig 1.jpg"},{"id":94294,"identity":"ea5708fd-e549-4d1e-aa1b-d8774d025660","added_by":"auto","created_at":"2019-09-22 18:32:49","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":42357,"visible":true,"origin":"","legend":"Flow cytometry analysis of hCAIX expression and Quantitative real time PCR analysis of CA9 gene in cytokine combination treated and untreated HT-29 colon cells. A: The decrease ratio of CA9 protein expression treated with IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ at concentration of 1000 U/mL for 24 h. B. Fold decrease of hCA9 expression in the level of gene treated with IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ at concentration of 1000U/mL for 24 h. C: The decrease ratio of hCA9 protein expression treated with IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ at concentration of 1000 U/mL for 48 h. D: Fold decrease of hCA9 expression in the level of gene treated with IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ at concentration of 1000 U/mL for 48 h. E: The decrease ratio of hCA9 protein expression treated with IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ at concentration of 1000 U/mL for 72 h. F: Fold decrease of CA9 expression in the level of gene treated with IL1α-TNFα, IL1α-TGFβ, TNFα-TGFβ at concentration of 1000 U/mL for 72 h.","description":"","filename":"fig2.jpg","url":"https://assets-eu.researchsquare.com/files/c832b0e9-829f-457e-a3d9-2b359c6fb4e0/v1/fig 2.jpg"},{"id":13474186,"identity":"d2b82fa5-f86f-4662-b1ba-57c1107f6875","added_by":"auto","created_at":"2021-09-16 21:21:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":414678,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5401/v1/66c7645f-d529-424c-84ee-7db35d282176.pdf"}],"financialInterests":"","formattedTitle":"hCAIX Expression and Cell Cycle in Cytokine Stimulated Human Colon Cancer Cells","fulltext":[{"header":"Background","content":"\u003cp\u003eColorectal cancer is the most common third type of cancer observed in the world. In the world, colorectal cancer causes 395.000 people to die each year [1, 2]. Therefore, enlightment of genes which are responsible for colorectal cancer is crucial to contribute a new dimension to conventional recruitment of colorectal cancer.\u003c/p\u003e\n\u003cp\u003eHuman carbonic anhydrase IX (\u003cem\u003eh\u003c/em\u003eCAIX), which is one of the popular transmembrane protein related with tumor progression and metastasis, is a member of transmembrane carbonic anhydrases. Expression of CAIX is so limited in normal cells. However, hypoxic conditions of the tumor cause to increased CAIX expression and hypoxia inducible factor alpha (HIF1-\u0026alpha;) in different tumor types. These data provide a \u003cem\u003eh\u003c/em\u003eCAIX is a powerful marker in terms of tumor hypoxia [3, 4]. Moreover, this \u003cem\u003eh\u003c/em\u003eCAIX enzyme plays a critical function in tumor invasion and metastasis by the way of cell to cell adhesion [5]. Therefore, recent studies about especially \u003cem\u003eh\u003c/em\u003eCAIX and various types of cancer attract the attention on this carbonic anhydrase subtype [6]. \u003cem\u003eh\u003c/em\u003eCA9 is one of the important genes shown in colorectal tumorigenesis. \u003cem\u003eh\u003c/em\u003eCAIX expression in colorectal tumors was first demonstrated by Saarnio and et al. along with Ki-67 antigen which is also a major marker for cell proliferation in colorectal adenocarcinoma [6, 7].\u003c/p\u003e\n\u003cp\u003eCytokines are secreted peptides which have multiple roles in regulation of cellular interaction and communication and cell proliferation, differentiation, invasion in cancerogenesis. On the side, since these molecules have been used in immunotherapy, studies about cytokines have been getting worse. The fact that these molecules have immunotherapy potential against malignant diseases is the focus of the researchers [8\u0026ndash;10].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Immune effector cells capable of destruction of human tumors should be defined as \u003cem\u003ein vitro \u003c/em\u003e[11]\u003cem\u003e.\u003c/em\u003e IL-1\u0026alpha; is the most potent pro-inflammatory cytokines that is generated by macrophages immediately after confronting the inflammatory stimuli.\u0026nbsp; In addition, molecules from IL1 family are mostly expressed in tumor regions and is effective on each stage of tumorigenesis such as tumor invasion and connection between host and immune system in malign cells [12]. Like IL1\u0026alpha;, TGF\u0026beta; beta has also pleitropic roles in tumor cells. TGF\u0026beta; supports malign transformation and tumor progression in various types of cell. In studies about colorectal cancer, high level of expression of TGF\u0026beta; in primary tumor depends on late stages.\u0026nbsp; Divergent effect of TGF\u0026beta; in carcinogenesis depends on differentiation status and proliferative capacity of epithelium cells. TGF\u0026beta; has an inhibition effect on well differentiated primary colon carcinoma, TGF\u0026beta; makes less differentiated cells invase and proliferate [13, 14]. Therefore, the effect of cytokine on the modulation of cancer-related genes needs to be adressed. In this work, we focused on determining the effect of cytokine on \u003cem\u003eh\u003c/em\u003eCAIX expressions. There is rather limited study available about cytokines regulation of \u003cem\u003eh\u003c/em\u003eCAIX. \u0026nbsp;Yildirim and Kockar in 2009 reported that TGF\u0026beta; upregulates hCAIX expression in liver cell model, Hep3B. It is crucial to know that the knowledge of this type of interaction might be important for improvement of new therapeutic approaches [15].\u003c/p\u003e\n\u003cp\u003eWe hypothesized that if cytokines acting through caix expression levels alteration and relation with cell cycle phases in HT-29 cancer cell line. To test this hypothesis, cell line treated with different cytokines and these combinations. Untreated cells were used as control\u003cstrong\u003e. \u003c/strong\u003eOur research group previously demonstrated that TNF\u0026alpha; decreased the \u003cem\u003eh\u003c/em\u003eCA9 mRNA anf protein expression along with cell cycle arrest in HT-29 cells [16]. Because of the insufficient research about the relation between cytokines and expression of \u003cem\u003eh\u003c/em\u003eCAIX, this study was conducted in order to investigate contribution of the above mentioned cytokines in regulation of \u003cem\u003eh\u003c/em\u003eCA9 which is a crucial marker in colorectal cancer.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1. Cell culture of HT-29 colon cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHT-29 colon cell line provided by Sukran Yılmaz, Sap Institue, Ankara, Turkey. \u0026nbsp;HT-29 cells were grown in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM) supplemented with 10 % fetal bovine serum (FBS) and incubated at 37˚C in a humidified atmosphere of 95 air and 5% CO\u003csub\u003e2\u003c/sub\u003e incubator. Then, cells were seeded into a flask of 25 cm\u003csup\u003e2\u003c/sup\u003e and following 24 h, these cells were treated with double combinations of these cytokine (TGF\u0026beta;, IL1\u0026alpha;). TNF\u0026alpha; cytokine was also included in combination protocol.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. Cell cycle analysis of HT-29 colon cells by flow cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe analysis of the cell cycle phase was performed as described previously [16]. Briefly, cells were washed in PBS and then stained with PI using a commercial kit (Beckman Coulter, USA). Cellular DNA content was measured and analyzed on a flow Cytometry System with CXP software (Beckman Coulter FC500 System, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. Annexin V staining apoptosis test\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHT-29 colon cells were seeded into a 6-well plate. After 24 h incubation process, each one of 1000U/mL TGF\u0026beta;, IL1\u0026alpha; separately and 1000U/mL various combinations of IL1\u0026alpha;-TNF\u0026alpha;, IL1\u0026alpha;-TGF\u0026beta;, TNF\u0026alpha;-TGF\u0026beta;.were added to the cells. The follow-up protocols were carried out according to the manufacturer protocol of AnnexinV-FITC kit (Beckman Coulter, USA). Samples were analysed by a flow cytometer and analyzed with CXP software (Beckman Coulter FC500 System, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4. Total RNA isolation and cDNA synthesis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA isolation from the HT-29 cells was done with RNeasy mini kit (Qiagen GmBH., Germany). Reverse transcription for cDNA synthesis was performed in 20 \u0026mu;l final reaction volume including 50 U MuLV reverse transcriptase (Applied Biosystems, Foster City, CA), 10X PCR buffer, 5 pmol specific antisense primer, 4 U RNase inhibitor (Roche), 4 mmol/L of each dNTPs, 6.25 mmol/L MgCl\u003csub\u003e2\u003c/sub\u003e, and 2 \u0026mu;l (1ug) RNA. The RT step was performed as described previously on a Corbett Research Thermocycler at 42\u0026deg;C for 30 minutes followed by 94\u0026deg;C for 5 minutes [16] .\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5. \u003cem\u003eh\u003c/em\u003eCA9 gene expression \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eh\u003c/em\u003eCA9 (target gene) and TATA binding protein (TBP-housekeeping gene) gene expressions were carried out by quantitative Real-time RT-PCR using the Rotorgene system (Qiagen, Germany) [16]. The primers provided by Primer Design (Primer Design, USA) company designed depending on published information about mRNA sequences in GenBank (sequence Accession Nos., \u003cem\u003eh\u003c/em\u003eCA9: NM_001216). For 105 bp amplification product, sense primer was \u0026ldquo;AGCAGAGGTAGCCGAGACT\u0026rdquo; (position:1.395) and antisense primer was \u0026ldquo;ATGAGCAGGACAGGACAGTTA\u0026rdquo; (position:1.499). For TBP gene, sense primer sequence was \u0026ldquo;CTGTTTAACTTCGCTTCC\u0026rdquo; and antisense primer sequence was \u0026ldquo;CTCTTCTCAGCAACTTCC\u0026rdquo;. The reactions were performed with 5 \u0026micro;L cDNA template in a final volume of 25 \u0026micro;L, containing 12.5 \u0026mu;L Sybr Green master mix (Qiagen, Germany), with 15 pmoL primers for whole genes in a Rotor-Gene Real-time PCR instrument (Qiagen, Germany). Initial denaturation was 1 min at 94\u0026deg;C, 40 cycles of specific annealing temperature for 2 sec, extension at 72\u0026deg;C for 10 sec and denaturation at 94\u0026deg;C. Melting curve analysis was carried out in the temperature range of 55 to 95 \u0026deg;C. We calculated the relative quantification using the ratio between hCA9 and TBP mRNA. Arbitrary copy numbers were analyzed using Rotor-Gene v.5 software (Qiagen, Germany). A melt curve was obtained from 65-99\u003csup\u003eo\u003c/sup\u003eC for the specificity of the reaction. Three technical and biological reactions were performed for each transcript and negative control was used.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6.\u003cem\u003e h\u003c/em\u003eCAIX protein expression \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBrifly, after cell culture procedures, cells were scraped with cell scraper and then 1x10\u003csup\u003e5\u003c/sup\u003e cells suspended in PBS. Human anti-CAIX antibody was added in each test tube for 45 minutes in ice bath and then washed with PBS to remove unbound antibodies. The assay was carried out in triplicate. The expression of\u003cem\u003e h\u003c/em\u003eCAIX was monitored and analyzed on a Beckman Coulter FC500 Flow Cytometry System with CXP software (Beckman Coulter, USA).\u003c/p\u003e\n\u003col start=\"3\"\u003e\n\u003cli\u003e\u003cstrong\u003e Statistical analysis\u003c/strong\u003e\u003c/li\u003e\n\u003c/ol\u003e\n\u003cp\u003eEach data was the mean of three independent values. All data were expressed as mean \u0026plusmn; S.D. and analyzed one-way ANOVA Test by SPSS 11.5 (SPSS Inc., Chicago, IL, USA) to determine the significance of differences between groups (untreated control cells and treated cells). P\u0026lt; 0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e4.1. Protein expression \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;HT-29 colon cells were seeded into a 6-well plate and incubated for 24 h. After incubation process, either of 1000 U/mL TGF\u0026beta; and IL1\u0026alpha; and various combinations of 1000 U/mL of IL1\u0026alpha;-TGF\u0026beta;. were seeded to the cells and incubated for 24 h, 48 h and 72 h. We previously demonstrated that TNF-alpha caused the decrease CAIX mRNA, the combinations of TNF\u0026alpha;-TGF\u0026beta; and IL1\u0026alpha;-TNF\u0026alpha; were included to the analysis. Firstly, we investigated the influence of different doses (100 U/mL, 500 U/mL, 1000 U/mL) and exposure times (24 h, 48 h and 72 h) of TGF\u0026beta; and IL1\u0026alpha; and various combinations of 1000 U/mL IL1\u0026alpha;-TNF\u0026alpha;, IL1\u0026alpha;-TGF\u0026beta;, TNF\u0026alpha;-TGF\u0026beta; on \u003cem\u003eh\u003c/em\u003eCA9 protein expression level. In order to determine this stimulation effect in HT-29 cells, flow cytometry technique was utilized. While analyzing experimental data, all results evaluated relative to untreated control group. As a first result, we observed that TGF\u0026beta; has nearly 26% increase on CAIX protein expression level at a concentration of 1000 U/mL for 24h. Secondly, when the effect of IL1\u0026alpha; was investigated, any significant influence has not been detected. As in previous results, we could not observe the effect of 1000 U/mL IL1\u0026alpha;-TGF\u0026beta; combination on \u003cem\u003eh\u003c/em\u003eCA9 protein expression. In contrast, the other combinations of cytokines (IL1\u0026alpha;-TNF\u0026alpha; and TNF\u0026alpha;-TGF\u0026beta;) have revealed decreasing effect on \u003cem\u003eh\u003c/em\u003eCA9 protein expression level at the concentration of 1000 U/mL for 24 h, 48 h and 72 h when compared to the untreated control cells. For IL1\u0026alpha;-TNF\u0026alpha; combination, hCAIX protein expression level decreased nearly 22%, 8% and 16% for 24 h, 48 h and 72 h, respectively. For TNF\u0026alpha;-TGF\u0026beta; combination set, we only observed significant decrease for 72 h incubation time. As shown in figure 2, the level of the \u003cem\u003eh\u003c/em\u003eCAIX protein expression dropped nearly 45%, for 72 h. The results were obtained by performing the experiment in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.2. mRNA expression of \u003cem\u003eh\u003c/em\u003eCAIX\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effect of these cytokines on \u003cem\u003eh\u003c/em\u003eCA9 mRNA expression level was evaluated relative to untreated control cell group. Firstly, HT-29 cells were exposed to TGF\u0026beta; for 24 h, it was observed that \u003cem\u003eh\u003c/em\u003eCA9 mRNA expression level pointed out nearly 2.5\u0026plusmn;0.8-fold increase when compared to untreated control cells as shown in figure 1. This result is consistent with the data mentioned on \u003cem\u003eh\u003c/em\u003eCAIX protein expression part. \u0026nbsp;No significant effect of TGF\u0026beta; on \u003cem\u003eh\u003c/em\u003eCA9 mRNA expression was observed in HT-29 cells for 48h and 72 h (data not shown). Secondly, we investigated the effect of IL1 on \u003cem\u003eh\u003c/em\u003eCA9 mRNA expression for different doses (100 U/mL, 500 U/mL, 1000 U/mL) and incubation periods (24 h, 48 h, 72 h) in HT-29 cells. However, we could not detect any significant effect of IL1\u0026alpha; on \u003cem\u003eh\u003c/em\u003eCA9 expression level for different doses and periods. Thirdly, we studied the effect of IL1\u0026alpha;-TGF\u0026beta; combination at 1000 U/mL concentration for different incubation times. However, we could not observe any effect of this combination set on \u003cem\u003eh\u003c/em\u003eCA9 expression level as in previous case. Although the use of IL1\u0026alpha; alone and together with TGF\u0026beta; has not revealed any acceptable effect on the \u003cem\u003eh\u003c/em\u003eCA9 expression level, the combination of TGF\u0026beta;-IL1\u0026alpha; significantly influenced the \u003cem\u003eh\u003c/em\u003eCA9 expression level. 1000U/mL of IL1\u0026alpha;-TNF\u0026alpha; combination caused to 3.9\u0026plusmn; 1.2 fold reduction of \u003cem\u003eh\u003c/em\u003eCA9 expression level for 48 h. As the incubation time increased to 72h for the same combination set, 15.7\u0026plusmn;7.9-fold decrease in hCA9 expression level was observed as shown in figure 2. Lastly, the effect of TNF\u0026alpha;-TGF\u0026beta; combination on CA9 expression level was studied for 24 h, 48 h and 72 h. The similar change in CA9 mRNA expression level in terms of incubation time was observed for this combination set of cytokines. As similar to the effect of previous combination, TNF\u0026alpha;-TGF\u0026beta; combination led to 2.4\u0026plusmn; 0.7, 3.4\u0026plusmn; 2.1 and 7.0\u0026plusmn; 0.4-fold decrease in \u003cem\u003eh\u003c/em\u003eCA9 expression level for 24 h, 48 h and 72 h, respectively as shown in figure 2. All experiment was performed in triplicate.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e4.3. Cell cycle analysis and apoptosis \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFlow cytometry method is easily used for cell cycle studies. PI staining was used to detect cell cycle phases (G0G1, S, G2M) with or without cytokines (1000 U/mL TGF\u0026beta;, IL1, IL1\u0026alpha;-TNF\u0026alpha;, IL1\u0026alpha;-TGF\u0026beta;, TNF\u0026alpha;-TGF\u0026beta;) treatment in HT-29 cells. We determined the statistically significant GOG1 arrest with concomitant depletion of S and G2M phases in HT-29 cells for 24 h, 48 h and 72 h at a highest concentration of 1000 U/mL TNF\u0026alpha;-TGF\u0026beta; cytokine combination. For 1000 U/mL IL1\u0026alpha;-TNF\u0026alpha; combination, we observed similar effect as in cell cycle phases in HT-29 cells for 72 h. The results are shown in table 1. No apoptotic effect was detected for any cytokine set in HT-29 colon cancer cells. All data obtained from three independent assay and p\u0026lt;0.05 value was considered statistically significant for all experiment.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe expanding drugs and inhibitors have been used that inhibition of hCAIX against various cancer and metabolic disorders as a molecule [17\u0026ndash;19]. This knowledge prompted us to investigate the effects of different cytokines that crucial proteins for immunotherapy on expression of \u003cem\u003eh\u003c/em\u003eCAIX critical proliferation mechanism of cancer cells. HT-29 model colon cells are utilized at many studies about colorectal carcinoma. These cells are important in many studies since they have most of characteristic colonic epithelium [20]. Several investigators reported the \u003cem\u003eh\u003c/em\u003eCAIX expression in colon cells.\u0026nbsp; When normal mucosa in which hypoxic response is observed early \u003cem\u003eh\u003c/em\u003eCAIX is compared with colorectal cancers, it is observed that there is an increase in \u003cem\u003eh\u003c/em\u003eCAIX expression in colorectal cancers [6, 21, 22]. According to the study demonstrated by Adri\u0026aacute;n (2003), expression of carbonic anhydrase IX was increased under hypoxic conditions in xenograft nude mice model that were \u0026nbsp;created a colorectal tumor using HT-29 colon carcinoma cells [23]. For this purpose, we selected HT-29 colon carcinoma cell line to point out relationship between \u003cem\u003eh\u003c/em\u003eCA9 expression and cytokines. In this study, two cytokines (IL1\u0026alpha; and TGF\u0026beta;) were used since these cytokines have been implicated in cancer. TNF\u0026alpha;, previously demonstrated decreasing effect on \u003cem\u003eh\u003c/em\u003eCA9 gene expression, was also included into the study. This study, the association between cytokines and CA9 which is a gene related with tumor, was investigated due to the lack of information about this subject. The data obtained in our research attracts more attention because there was limited study conducted before about this topic. TGF\u0026beta;, one of these cytokines, causes malign transformation and tumor progression in various types of cell. Moreover, production of TGF\u0026beta; tends to increase in various cancer including colon cancer [24] . These cancer cells on which oncogenes are dominant activate transcription of TGF gene [25, 26]. \u0026nbsp;In studies about colon and colorectal cancer, it was shown that high level of expression of TGF in primary tumor depends on late stages. There are various types of mechanisms affecting development of tumor. TGF has inhibition effect on primary colon carcinoma differentiated well and causes the invasion and proliferation of less differentiated cells. Divergent effect of TGF in carcinogenesis depends on differentiation status and proliferative capacity of epithelium cells. After the transformation, TGF supports viability, invasion and metastasis of tumor cells [27]. This interaction is important for improvement of new therapeutic approaches. In the study, we tried to determine whether the level of \u003cem\u003eh\u003c/em\u003eCA9 expression in HT-29 cells changes or not when stimulated with different cytokines for different doses (100 U/mL, 500 U/mL, 1000 U/mL) and exposure times (24 h, 48 h, 72 h). Moreover, we investigated cell cycle phases and apoptosis in HT-29 cells at the same conditions. When expression of \u003cem\u003eh\u003c/em\u003eCAIX in HT-29 cells exposed to 1000 U/mL TGF\u0026beta; was investigated for 24 h, the increase in expression of \u003cem\u003eh\u003c/em\u003eCAIX was observed in the level of protein and mRNA. The increase in \u003cem\u003eh\u003c/em\u003eCA9 expression level in HT-29 colon cancer cells stimulated with TGF\u0026beta; was shown in this study at first time. This observation can be regarded as significantfinding since many common tumor cells have enhanced levels of TGF\u0026beta; [28]. \u0026nbsp;In another study, it was observed that the effect of TGF\u0026beta; on \u003cem\u003eh\u003c/em\u003eCAIX also has similar effect on Hep3B cells [15]. \u0026nbsp;The results of these two studies have supported each other. These findings are crucial to develop new approaches for recruitment of cancer. In this context, it is important to investigate expression level of \u003cem\u003eh\u003c/em\u003eCAIX used as biomarker. It has also active role in regulation of cell cycle for cell proliferation. In some various types of tumors, because of CA location and the fact that this molecule has a role in regulation of cell growth at other locations \u003cem\u003eh\u003c/em\u003eCAIX expression in fast proliferating cells of tumor shows an increase [29] .\u003c/p\u003e\n\u003cp\u003eIL1\u0026alpha; and TNF\u0026alpha; are pro-inflammatory cytokines and inductions of which by inflammation are effective on expression of lots of genes. Cytokines such as IL1\u0026alpha; and TNF\u0026alpha; taking place in both of carcinogenesis and development and invasion of tumors which induct chemokines attracting neutrophils playing active role in both of production of reactive types of oxygen and carcinogenesis [30]. There are so many investigation indicating the relation between cancer development and expressions of oncogenes. Besides this, existence of the relation between chronic inflammation and cytokine production brings additional mechanism in the carcinogenesis process. In cancer, NFK\u0026beta; activation has essential role in various tumor [31]. This activation is also essential for regulation of genes acting on immune response. However, the association between expression of oncogene and pro-inflammatory cytokines could still not have been raised. Molecules from IL1 family are mostly expressed in tumor regions and which are potential cytokines affecting tumorigenesis. IL1 is effective on each stage of tumorigenesis such as tumor invasion and connection between host and immune system in malign cells [12].\u0026nbsp; Immune effector cells capable of destruction of human tumors are defined as \u003cem\u003ein vitro\u003c/em\u003e. Monoclonal antibodies identifying antigens related with tumors were produced in most of vertebrate cells including human being too [11].\u003c/p\u003e\n\u003cp\u003eNot only the effect of TGF\u0026beta; on level of \u003cem\u003eh\u003c/em\u003eCAIX expression was investigated, but the effect of IL1\u0026alpha; and TGF\u0026beta; combinations of cytokines were also investigated in order to determine synergistic and antagonistic effects of cytokines. Effects of these cytokines on expression of \u003cem\u003eh\u003c/em\u003eCAIX in rank both of protein and mRNA were investigated by introducing 1000 U/mL cytokines for different time ranges (24 h, 48 h and 72 h). It was seen that there is no remarkable effect of this combination of IL1\u0026alpha;-TGF\u0026beta; on \u003cem\u003eh\u003c/em\u003eCA9 protein and mRNA expression level and on cell cycle phases of colon cancer cells. It could not be found that there is an effect on viability and necrosis. Moreover, the relations among \u003cem\u003eh\u003c/em\u003eCAIX, cell cycle and apoptosis in model of colon carcinoma were clarified by considering parameters of cell cycle and apoptosis important for tumor development. When 1000 U/mL IL1\u0026alpha;-TNF\u0026alpha; and TNF\u0026alpha;-TGF\u0026beta; combinations were introduced into HT-29 cells at 24 h, 48 h and 72 h, it was observed that the expression of \u003cem\u003eh\u003c/em\u003eCAIX at the level of protein and mRNA sharply decreases as time dependent manner. This inhibition effect of TNF\u0026alpha; combinations is significant and this fact was indicated in this study at first time. Our results have been correlated with the study in which the effect of TNF on histondeasetilase 3 related with tumors was investigated [32]. By considering this results, we can claim that combination of TNF\u0026alpha;-TGF\u0026beta; has created the antagonistic effect on CA9 expression in HT-29 colon cancer cell model. In the other hand, combination of TNF\u0026alpha;-IL1\u0026alpha; caused synergistic effect on \u003cem\u003eh\u003c/em\u003eCA9 expression level in this cells. In addition to this, all TNF\u0026alpha; combinations lead to arrest the colon cells in G0/G1 phase of cell cycle at. Furthermore, This combinations caused cell necrosis supported by several literatures [32\u0026ndash;35] while colon cells at GOG1 stage, TNF\u0026alpha; also lead to decrease in \u003cem\u003eh\u003c/em\u003eCAIX expression in colon cells.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis finding reflects the functionally multiple nature of these cytokines and represent a useful paradigm to study the complex cellular targets such as CAIX that regulate colon cancerogenesis. Therefore, immunotherapy potential of these cytokines against malign disease is always focus for researchers.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eh\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003eCAIX:\u003c/strong\u003e Human carbonic anhydrase IX\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTNF\u0026alpha;:\u003c/strong\u003e Tumor necrosis factor alpha\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIL1\u0026alpha;:\u003c/strong\u003e Interleukin 1 alpha\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTGF\u0026beta;:\u003c/strong\u003e Transforming growth factor beta\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Not applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interest.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study financillay supported by Balikesir University Research Project (2008/15). The content is only the responsibility of the authors and does not necessarily represent the official views. The funding body was not involved in the design of the study, collection or analysis of the data, interpretation of the data, or in the writing of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors'contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRIS and FK constructed hypothesis and planned methodology equally for research. They contributed to write equally for manuscript. RIS contributed to all experimental studies, data analysis and presentation of results. SY contributed to cell culture studies. UM and AS contributed to intellectual content. All authors have read and approved this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBray F, Jemal A, Grey N, Ferlay J, Forman D. Global cancer transitions according to the Human Development Index (2008-2030): a population-based study. Lancet Oncol. 2012;13:790\u0026ndash;801.\u003c/li\u003e\n\u003cli\u003eEdwards BK, Noone A-M, Mariotto AB, Simard EP, Boscoe FP, Henley SJ, et al. Annual Report to the Nation on the status of cancer, 1975-2010, featuring prevalence of comorbidity and impact on survival among persons with lung, colorectal, breast, or prostate cancer. Cancer. 2014;120:1290\u0026ndash;314.\u003c/li\u003e\n\u003cli\u003ePastorek J, Pastorekova S. Hypoxia-induced carbonic anhydrase IX as a target for cancer therapy: from biology to clinical use. Semin Cancer Biol. 2015;31:52\u0026ndash;64.\u003c/li\u003e\n\u003cli\u003ePastorekova S, Ratcliffe PJ, Pastorek J. Molecular mechanisms of carbonic anhydrase IX-mediated pH regulation under hypoxia. BJU International. 2008;101:8\u0026ndash;15.\u003c/li\u003e\n\u003cli\u003eParkkila S. Significance of pH regulation and carbonic anhydrases in tumour progression and implications for diagnostic and therapeutic approaches. BJU International. 2008;101:16\u0026ndash;21.\u003c/li\u003e\n\u003cli\u003eSaarnio J, Parkkila S, Parkkila A-K, Haukipuro K, Pastorekov\u0026aacute; S, Pastorek J, et al. Immunohistochemical Study of Colorectal Tumors for Expression of a Novel Transmembrane Carbonic Anhydrase, MN/CA IX, with Potential Value as a Marker of Cell Proliferation. Am J Pathol. 1998;153:279\u0026ndash;85.\u003c/li\u003e\n\u003cli\u003eHolt PR, Moss SF, Kapetanakis AM, Petrotos A, Wang S. Is Ki-67 a better proliferative marker in the colon than proliferating cell nuclear antigen? Cancer Epidemiol Biomarkers Prev. 1997;6:131\u0026ndash;5.\u003c/li\u003e\n\u003cli\u003eConlon KC, Miljkovic MD, Waldmann TA. Cytokines in the Treatment of Cancer. Journal of Interferon \u0026amp; Cytokine Research. 2018;39:6\u0026ndash;21.\u003c/li\u003e\n\u003cli\u003eDranoff G. Cytokines in cancer pathogenesis and cancer therapy. Nature Reviews Cancer. 2004;4:11\u0026ndash;22.\u003c/li\u003e\n\u003cli\u003eLee S, Margolin K. Cytokines in Cancer Immunotherapy. Cancers (Basel). 2011;3:3856\u0026ndash;93.\u003c/li\u003e\n\u003cli\u003eBorden EC, Sondel PM. Lymphokines and cytokines as cancer treatment. Immunotherapy realized. Cancer. 1990;65 3 Suppl:800\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eApte RN, Dotan S, Elkabets M, White MR, Reich E, Carmi Y, et al. The involvement of IL-1 in tumorigenesis, tumor invasiveness, metastasis and tumor-host interactions. Cancer Metastasis Rev. 2006;25:387\u0026ndash;408.\u003c/li\u003e\n\u003cli\u003eBellam N, Pasche B. Tgf-beta signaling alterations and colon cancer. Cancer Treat Res. 2010;155:85\u0026ndash;103.\u003c/li\u003e\n\u003cli\u003eRoman C, Saha D, Beauchamp R. TGF-beta and colorectal carcinogenesis. Microsc Res Tech. 2001;52:450\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eYildirim H, K\u0026ouml;\u0026ccedil;kar F. TGF-beta upregulates tumor-associated carbonic anhydrase IX gene expression in Hep3B cells. Cell Biol Int. 2009;33:1002\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eIlikci sagkan R, Kockar F, Sengul A, Yilmaz S, Musabak U. Inhibition effect of TNF\u0026alpha; on CAIX expression in HT-29 colon carcinoma cells and the relationship of this cytokine with cell cycle. In: ACADEMIC RESEARCHES IN HEALTH SCIENCES. Ankara: Gece; 2018. p. 63\u0026ndash;74.\u003c/li\u003e\n\u003cli\u003eKrasavin M, Shetnev A, Baykov S, Kalinin S, Nocentini A, Sharoyko V, et al. Pyridazinone-substituted benzenesulfonamides display potent inhibition of membrane-bound human carbonic anhydrase IX and promising antiproliferative activity against cancer cell lines. European Journal of Medicinal Chemistry. 2019;168:301\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eMincione F, Scozzafava A, Supuran CT. The Development of Topically Acting Carbonic Anhydrase Inhibitors as Antiglaucoma Agents. 2008. doi:info:doi/10.2174/138161208783877866.\u003c/li\u003e\n\u003cli\u003eSupuran CT. Diuretics: From Classical Carbonic Anhydrase Inhibitors to Novel Applications of the Sulfonamides. 2008. doi:info:doi/10.2174/138161208783877947.\u003c/li\u003e\n\u003cli\u003eEvans ME, Jones DP, Ziegler TR. Glutamine prevents cytokine-induced apoptosis in human colonic epithelial cells. J Nutr. 2003;133:3065\u0026ndash;71.\u003c/li\u003e\n\u003cli\u003eRasheed S, Harris AL, Tekkis PP, Turley H, Silver A, McDonald PJ, et al. Assessment of microvessel density and carbonic anhydrase-9 (CA-9) expression in rectal cancer. Pathology - Research and Practice. 2009;205:1\u0026ndash;9.\u003c/li\u003e\n\u003cli\u003eRasheed S, McDonald PJ, Northover JM, Guenther T. Angiogenesis and hypoxic factors in colorectal cancer. Pathology - Research and Practice. 2008;204:501\u0026ndash;10.\u003c/li\u003e\n\u003cli\u003eChrastina Adri\u0026aacute;n, Z\u0026aacute;vada Jan, Parkkila Seppo, Kaluz \u0026Scaron;tefan, Kaluzov\u0026aacute; Milota, Rajč\u0026aacute;ni J\u0026uacute;lius, et al. Biodistribution and pharmacokinetics of 125I‐labeled monoclonal antibody M75 specific for carbonic anhydrase IX, an intrinsic marker of hypoxia, in nude mice xenografted with human colorectal carcinoma. International Journal of Cancer. 2003;105:873\u0026ndash;81.\u003c/li\u003e\n\u003cli\u003eDerynck R, Budi EH. Specificity, versatility, and control of TGF-\u0026beta; family signaling. Sci Signal. 2019;12.\u003c/li\u003e\n\u003cli\u003eBirchenall-Roberts MC, Ruscetti FW, Kasper J, Lee HD, Friedman R, Geiser A, et al. Transcriptional regulation of the transforming growth factor beta 1 promoter by v-src gene products is mediated through the AP-1 complex. Mol Cell Biol. 1990;10:4978\u0026ndash;83.\u003c/li\u003e\n\u003cli\u003eGeiser AG, Kim SJ, Roberts AB, Sporn MB. Characterization of the mouse transforming growth factor-beta 1 promoter and activation by the Ha-ras oncogene. Mol Cell Biol. 1991;11:84\u0026ndash;92.\u003c/li\u003e\n\u003cli\u003eFabregat I, Fernando J, Mainez J, Sancho P. TGF-beta signaling in cancer treatment. Curr Pharm Des. 2014;20:2934\u0026ndash;47.\u003c/li\u003e\n\u003cli\u003ePasche B. Role of transforming growth factor beta in cancer. J Cell Physiol. 2001;186:153\u0026ndash;68.\u003c/li\u003e\n\u003cli\u003eN\u0026oacute;gr\u0026aacute;di A. The Role of Carbonic Anhydrases in Tumors. The American Journal of Pathology. 1998;153:1\u0026ndash;4.\u003c/li\u003e\n\u003cli\u003eDinarello CA. The paradox of pro-inflammatory cytokines in cancer. Cancer Metastasis Rev. 2006;25:307\u0026ndash;13.\u003c/li\u003e\n\u003cli\u003eBalkwill F, Charles KA, Mantovani A. Smoldering and polarized inflammation in the initiation and promotion of malignant disease. Cancer Cell. 2005;7:211\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eSpurling CC, Godman CA, Noonan EJ, Rasmussen TP, Rosenberg DW, Giardina C. HDAC3 overexpression and colon cancer cell proliferation and differentiation. Mol Carcinog. 2008;47:137\u0026ndash;47.\u003c/li\u003e\n\u003cli\u003eMunker M, Munker R, Saxton RE, Koeffler HP. Effect of recombinant monokines, lymphokines, and other agents on clonal proliferation of human lung cancer cell lines. Cancer Res. 1987;47:4081\u0026ndash;5.\u003c/li\u003e\n\u003cli\u003eRuggiero V, Latham K, Baglioni C. Cytostatic and cytotoxic activity of tumor necrosis factor on human cancer cells. The Journal of Immunology. 1987;138:2711\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003eSugarman BJ, Aggarwal BB, Hass PE, Figari IS, Palladino MA, Shepard HM. Recombinant human tumor necrosis factor-alpha: effects on proliferation of normal and transformed cells in vitro. Science. 1985;230:943\u0026ndash;5.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cspan style=\"font-size: 10pt; line-height: 115%; font-family: verdana, geneva;\"\u003eTable 1. Flow cytometry analysis of cell cycle phases of HT-29 colon cells treated with different combinations of cytokines for different times. \u003c/span\u003e\u003c/p\u003e\n\u003ctable style=\"border-collapse: collapse; border: none;\"\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 460.6pt; border: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" colspan=\"4\" width=\"614\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eCell cycle parameters\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eG0G1 (%)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eS (%)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eG2M (%)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eControl group (24 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e79,7\u0026plusmn;1,4\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e7,5\u0026plusmn;0,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e13,2\u0026plusmn;0,8\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eIL1\u0026alpha;-TNF\u0026alpha; (24 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e84,9\u0026plusmn;0,4\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e4,9\u0026plusmn;0,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e10,3\u0026plusmn;0,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eIL1\u0026alpha;-TGF\u0026beta; (24 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e83,3\u0026plusmn;0,8\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e5,8\u0026plusmn;0,5\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e10,9\u0026plusmn;0,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 7.7pt;\"\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eTNF\u0026alpha;-TGF\u0026beta; (24 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e89,7\u0026plusmn;0,7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e3,1\u0026plusmn;0,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e7,4\u0026plusmn;0,4\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 7.7pt;\"\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eControl group (48 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e87,0\u0026plusmn;0,7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e6,5\u0026plusmn;2,8\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e7,2\u0026plusmn;3,1\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 10.9pt;\"\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 10.9pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eIL1\u0026alpha;-TNF\u0026alpha; (48 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 10.9pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e89,4\u0026plusmn;0,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 10.9pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e3,7\u0026plusmn;1,1\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 10.9pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e6,7\u0026plusmn;0,8\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 7.7pt;\"\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eIL1\u0026alpha;-TGF\u0026beta; (48 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e87,3\u0026plusmn;4,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e3,8\u0026plusmn;0,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e6,3\u0026plusmn;0,8\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 7.7pt;\"\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eTNF\u0026alpha;-TGF\u0026beta; (48 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e90,5\u0026plusmn;0,4\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e3,2\u0026plusmn;1,0\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e6,3\u0026plusmn;0,6\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 7.7pt;\"\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eControl group (24 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e75,2\u0026plusmn;1,0\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e10,9\u0026plusmn;0,4\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e13,4\u0026plusmn;1,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 7.7pt;\"\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eIL1\u0026alpha;-TNF\u0026alpha; (24 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e82,0\u0026plusmn;0,9\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e5,9\u0026plusmn;0,7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e11,9\u0026plusmn;0,3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 7.7pt;\"\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eIL1\u0026alpha;-TGF\u0026beta; (24 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e78,9\u0026plusmn;0,3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e5,8\u0026plusmn;1,3\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e15,1\u0026plusmn;1,1\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr style=\"height: 7.7pt;\"\u003e\n\u003ctd style=\"width: 115.15pt; border: solid windowtext 1.0pt; border-top: none; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp\u003e\u003cspan style=\"font-size: 10pt; font-family: verdana, geneva;\"\u003e\u003cstrong\u003e\u003cspan style=\"line-height: 107%;\"\u003eTNF\u0026alpha;-TGF\u0026beta; (24 h)\u003c/span\u003e\u003c/strong\u003e\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e86,2\u0026plusmn;5,8\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e5,7\u0026plusmn;0,7\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 115.15pt; border-top: none; border-left: none; border-bottom: solid windowtext 1.0pt; border-right: solid windowtext 1.0pt; padding: 0in 5.4pt 0in 5.4pt; height: 7.7pt;\" width=\"154\"\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e11,5\u0026plusmn;0,2\u003c/span\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cspan style=\"line-height: 107%; font-family: verdana, geneva; font-size: 10pt;\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Carbonic anhydrase IX, cytokine, colon cancer","lastPublishedDoi":"10.21203/rs.2.14730/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.2.14730/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: At the aim of this study, we investigated the effects of different kind of cytokines and the combinations of which on human carbonic anhydrase IX ( hCAIX) expression in HT-29 cell selected as colon carcinoma model for different doses and time of exposure to determine role of cytokines for treatment of colon carcinoma cells. Results: To sum up, h CA9 expression in the levels of gene and protein increased in HT-29 cells when stimulated with 1000 U/mL TGF-β for 24 h. The stimulation of HT-29 cells with IL1 α alone and IL1α- TGF-β combination has not revealed any effect on hCA9 expression in both levels of gene and protein in contrast to, 1000 U/mL IL1α-TNFα and especially TGFβ-TNFα have reducing effect on h CA9 expression level in HT-29 cells for time ranges of 24 h, 48 h, 72 h. In addition to this data, it was observed that HT-29 cells at the phase of G0G1 are arrested in cell cycle when stimulated with either of 1000 U/mL IL1α-TNFα and TGFβ-TNFα. Moreover, it was observed that h CA9 expression level in HT-29 cells decreases at the phases of synthesis (S) and G2M. Discussion:\u0026nbsp;We concluded that combination of TNFα-TGFβ has created antagonistic effect on hCA9 expression in HT-29 colon cancer cell model. On the other hand, combination of TNFα-IL1α caused sinergistic effect on h CA9 expression level in this cell model. When these results are demonstrated decrease in the cytokine exposed hCA9 expression is a finding to develop a novel approach for anticancer therapy. Conclusion: Our finding related to the change in the expression of\u0026nbsp;hCA9\u0026nbsp;following cytokine stimulate to colon cancer cell line gives an idea about the effect of cytokine stimulation on the expression of this gene which will be a hot spot research in colon carcinogenesis. Methods: HT-29 colon cells were chosen as a colorectal adenocarcinoma model. hCA9 gene expression in the level of mRNA was measured in cytokines stimulated HT-29 cells by Quantitative Real-time PCR. Meanwhile, hCAIX expression\u0026nbsp;in the level of protein and cell cycle aassay were\u0026nbsp;detected by flow cytometry.\u003c/p\u003e","manuscriptTitle":"hCAIX Expression and Cell Cycle in Cytokine Stimulated Human Colon Cancer Cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2019-09-22 18:32:48","doi":"10.21203/rs.2.14730/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d1c208af-1aef-45b0-80e3-9eb02c57769b","owner":[],"postedDate":"September 22nd, 2019","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":27019,"name":"Immunology"}],"tags":[],"updatedAt":"","versionOfRecord":[],"versionCreatedAt":"2019-09-22 18:32:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5401","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-5401","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}