Endothelial dysfunction in COVID-19: Insights from bronchoalveolar lavage and molecular markers | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Endothelial dysfunction in COVID-19: Insights from bronchoalveolar lavage and molecular markers Zohreh Arab, Seyed Abdolrahim Rezaee, Fatemeh Sadat Mohammadi, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4942103/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Endothelium play a crucial role in immune responses and inflammatory reactions. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) induces an exaggerated immune response. Therefore, in this study the roles of endothelium in the manifestation of sever Coronavirus disease 2019 (COVID-19) was investigated. The direct effects of SARS-CoV-2 alpha (SCA) and SARS-CoV-2 omicron (SCO), on endothelial function were investigated in bronchoalveolar lavage (BAL), that were obtained by leftover samples of Covid-19 patients who were compared to forty control group to enrich genes and proteins expression of Intracellular Adhesion Molecule-1 (ICAM-1), Vascular cell adhesion molecules 1 (VCAM-1), Nuclear factor erythroid 2–related factor 2 (Nrf2), NADPH oxidase 2 (NOX2), von Willebrand factor (vWF) and Inducible nitric oxide synthases (iNOS). SARS-CoV-2 increased gene and protein expression of ICAM-1. SCA and SCO increase VCAM-1 gene expression. VCAM-1 protein expression in SCO increased too. vWF gene expression increased in SCO. vWF protein expressed highly too. SCO group showed a significant increase in iNOS gene expression. Although, NOX2 gene increased by SCA and SCO and its protein increased too, Nrf2 gene and protein decreased by SARS-CoV-2. Based on our findings, severe COVID-19 can cause damage to vascular endothelium, which is crucial in affecting multiple organ dysfunction. Our research indicates that endothelial dysfunction is a significant factor in the progression of severe COVID-19 in comparison to other respiratory diseases. SARS-CoV-2 COVID-19 Endothelial dysfunction Inflammation Oxidative stress iNOS Figures Figure 1 Figure 2 Figure 3 Introduction COVID-19 caused by the SARS-CoV-2 [ 1 ]. Emerging research suggests that the impact of SARS-CoV-2 extends beyond just the lungs, affecting the entire vascular system through direct virus infection or indirectly by cytokine storm, which can lead to endothelial dysfunction (ED) [ 2 ]. SARS-CoV-2 enters the host cell by its spike protein which attache to the angiotensin-converting enzyme 2 (ACE2) [ 3 ]. Endothelial cells (ECs) and smooth muscle cells in different organs through the body contain ACE2 [ 4 ]. This indicates that if SARS-CoV-2 infiltrates the bloodstream, quickly disseminate throughout the entire body [ 4 ]. The symptoms of SARS-CoV-2 infection mirror those of ED, indicating common pathophysiological mechanisms [ 5 ]. The complex pathophysiology of ED involves a variety of mechanisms, some of which are shared among many conditions [ 5 ]. ED is often described as a condition where ECs fail to release nitric oxide (NO) in response to increased blood flow [ 6 ]. NO production relies on a group of enzymes called nitric oxide synthases (NOSs) [ 7 ]. iNOS is typically inactive in resting cells, but immune-stimulatory cytokines, bacterial products, or infections in various cell types, including ECs, can stimulate it [ 7 ]. Excessive NO production by iNOS can have both protective and harmful effects, depending on the specific cell type [ 8 ]. NO contributes to vasodilation, improve blood flow and oxygen delivery to tissues [ 9 ]. But an excess production of NO can result in tissue damage by interacting with superoxide radicals or forming peroxynitrite, leading to inflammation [ 9 ]. The elevated iNOS expression in ECs may trigger ED, blood clot development during SARS-CoV-2 infection [ 8 ]. Reactive oxygen species (ROS) play a significant role in ED [ 10 ]. These agents neutralize NO by generating peroxynitrite, a toxic oxidant that impairs protein function through protein nitration, consequently leading to ED [ 6 ]. Peroxynitrite also degrades the eNOS cofactor tetrahydrobiopterin, leading to eNOS uncoupling and further ROS formation [ 6 ]. Oxidative stress contributes to a pro-inflammatory state in vessel walls, with ROS increasing adhesion molecules (such as VCAM-1 and ICAM1) expression and inflammatory cytokines through activation of transcription factors NFkB and AP1 [ 11 , 12 ]. Additionally, the release of vWF after vascular inflammatory damage serves as an indicator of endothelial activation [ 11 , 12 ]. vWF plays a role in homeostasis, platelet aggregation, vascular integrity defects, leukocyte proliferation, and tissue and cellular inflammation damage [ 11 , 12 ]. SARS-CoV-2-induced viral pneumonia triggers an excessive immune response in lung tissues affected by virus replication. This process is consistently associated with oxidative stress [ 13 ]. The NOX is a membrane enzyme that is a major source of ROS production (18). Different isoforms of this enzyme include: NOX1, NOX2, NOX3, NOX4 and NOX5 [ 14 ]. Studies on cardiovascular diseases such as hyperlipidemia, high blood pressure, diabetes and arteriosclerosis show that NOX2 expression in the endothelium is more altered [ 14 ]. Inhibition of ACE2 through the activation of NOX increases ROS production, leading to an enhancement in inflammatory responses [ 15 ]. Furthermore, the activation of NOX2 has been linked to a rise in superoxide and hydrogen peroxide levels, leading to an uncoupling of eNOS and decreased vascular function [ 16 ]. Additionally, viruses are capable of activating NADPH oxidase via a mechanism that relies on toll-like receptor 7 [ 17 ]. As the SARS-CoV-2 induced oxidative stress, antioxidant system becomes important [ 18 ]. Nrf2 is a sensor for oxidative stress within cells and a nuclear transcription factor that regulates the activation of genes responsible for antioxidant enzymes (SOD, catalase) in various tissues and cells [ 19 ]. Furthermore, the Nrf2 pathway plays a role in reducing inflammatory cytokines and preventing cytokine storm in COVID-19 [ 20 ]. Therefore, to determine whether endotheliopathy occurs in COVID-19 patients, markers of endotheliopathy such as vWF, ICAM-1, VCAM-1, NOX2, Nrf2, and iNOS were assessed in BAL of infected patients. Materials and methods Study population The Medical Ethics Committee of Mashhad University of Medical Sciences, Mashhad, Iran (IR.MUMS.MEDICAL.REC.1401.500) approved and oversaw this study. All procedures were carried out meticulously following relevant guidelines. This case-control study was performed during April 2021 to May 2021 for Alpha wave and November 2021 to February 2022 for Omicron wave of COVID-19 pandemic in Iran [ 21 ]. The study involved obtaining five milliliters of BAL, which was part of the left-over samples and approved by the local Ethics Committee under the restrictions of the Declaration of Helsinki, from 34 COVID-19 patients (17 with SCA and 17 with SCO) in the ICU, as well as from 40 outpatients in the bronchoscopy department with negative SARS-CoV-2 qRT-PCR tests as the control group at Ghaem Hospitals of Mashhad, Iran. The main criteria for inclusion in the study groups was the absence of diabetes and cardio-vascular diseases, which was confirmed by pulmonologists at admission time. Moreover, the exclusion criteria were age of less than 75 years’ old. The use of medications during hospitalization was considered a confounding variable; efforts were made to minimize their impact on the results without interfering with standard treatments. The Number of samples resulting from prevalence time limitation of each wave of SARS-CoV-2, homogenization of the samples in terms of age and sex, and the inclusion and exclusion criteria of the study. Gene expression BAL samples were collected from all patients in 5 milliliters and centrifuged and extracted cells were stored in TriPure. Quality and purity of RNA measured by nanodrop device (ND1000, Thermo Scientific, Delaware, USA). By using RevertAid™ First Strand cDNA Synthesis kit (Fermentas, Germany) and following the manufacturer's instructions, RNA was reverse transcribed to cDNA. Primer design Primers and probs (TaqMan method for ICAM-1, VCAM-1, vWF, iNOS and β-actin, and SYBR Green for Nrf2, NOX2 and β-actin) were designed by Beacon Designer (PREMIER Biosoft International, Palo Alto,CA; version 7). β-actin was the housekeeping gene. Specificity of oligo-nucleotides was checked by BLAST analysis. In Table 1 , primers and probes sequences are shown. Table 1 The sequences of primers and probes for TaqMan and SYBR Green methods are presented in the following column. Gene Primer Sequences (5'→3') ICAM (TaqMan) Forward: TTCGTGTCCTGTATGGCCC Reverse: AGTCACTGATTCCCCGATGG Probe: FAM-CCAGCAGACTCCAATGTGCCAGGCTTG-BHQ-1 VCAM (TaqMan) Forward: GGAAATGACCTTCATCCCTACCA Reverse: CTCTGGGGGCAACATTGACA Probe: FAM-CGAACCCAAACAAAGGCAGAGTACGCA-BHQ-1 vWF (TaqMan) Forward: ACTTCCTTACCCCCTCTGGG Reverse: TCCTCGGAGAACCTGGTCAT Probe: FAM-CCAGGCGTTCCCGAAGTCCTCCACCC-BHQ-1 iNOS (TaqMan) Forward: CGCATGACCTTGGTGTTTGG Reverse: CATAGACCTTGGGCTTGCCA Probe: FAM-TGCCGCCGCCCAGATGAGGACC-BHQ-1 NOX2 (SYBR Green) Forward: GAGTTGTCATCACGCTGTGC Reverse: CCCACGTACAATTCGTTCAGC Nrf2 (SYBR Green) Forward: ATCCATTCCTGAGTTACAGTGTCT Reverse: AGAGGATGCTGCTGAAGGAATC β2M (TaqMan) Forward: TTGTCTTTCAGCAAGGACTGG Reverse: CCACTTAACTATCTTGGGCTGTG Probe: FAM-TCACATGGTTCACACGGCAGGCAT-BHQ-1 β2M (SYBR Green) Forward: TCACAGCCCAAGATAGTTAAG Reverse: GAGGTTTGAAGATGCCG ICAM-1, Intracellular Adhesion Molecule-1; VCAM-1, Vascular cell adhesion molecules 1; Nrf2, Nuclear factor erythroid –related factor 2; NOX2, NADPH oxidase 2; vWF, von Willebrand factor; iNOS, Inducible nitric oxide synthases; β2M, beta 2 microglobulin. qRT-PCR qRT-PCR was performed by using TaqMan Master Mix (Takara Biotechnology, Otsu and Shiga, Japan) and SYBR Green Master Mix (Pars Tous, Iran). Syber Green and TaqMan methods used to analyze gene expressions by LightCycler (Roche Diagnostics, Mannheim, Germany). The data were analyzed using standard curves for related and reference genes. Afterward, data analysis was done by LightCycler software. Comparative gene expression (fold changes) was calculated using the 2 −ΔΔCT method [ 22 ]. Western blot analysis Protein extracted from BAL samples by using RIPA buffer (Tebu-bio, Boechout, Belgium). Afterward, the total protein amount was loaded onto a 12% SDS-PAGE gel and then transferred to PVDF membranes. Next, the secondary antibody was applied and left to incubate for 1 hour at room temperature, and the bands were visualized using an ECL kit by FluorChem E™ system from Protein and quantified using ImageJ [ 23 ]. Statistics The data analyzed by the SPSS 11.5 statistical software (IBM SPSS, USA) and Excel Software Version 2013. All values were presented as mean ± SD. The distribution of variables in the study groups was found to be normal based on the Kolmogorov-Smirnov test, hence, parametric tests were employed for statistical analysis. Since the variables followed a normal distribution, inferential statistical methods such as one-way ANOVA followed by LSD test analysis were used to compare the differences among the SCA, SCO and the control group. Results were statistically significant if the P-value < 0.05. Results Demographic data Table 2 displays the ages and genders of the 74 individuals in SCA, SCO and control groups. An analysis of the data showed that there were no significant differences in average of age and gender among the groups. Table 2 The three clinical groups employed in this study are presented, dividedly by sex within the number. Then value for age within the years (mean value + SEM (standard error of the mean)) are shown in the following column. SCA, SARS-CoV-2 alpha; SCO, SARS-CoV-2 omicron. ICAM-1 and VCAM-1 genes expression The results of qRT-PCR indicated that, in SCA and SCO groups, ICAM-1 gene expression was significantly increased compared to control (P = 0.004 and P = 0.02 respectively) (Fig. 1 a). In SCA and SCO groups, VCAM-1 gene expression was significantly increased compared to control (P = 0.04 and P = 0.000 respectively). Moreover, VCAM-1 gene expression of SCO was significantly increased compared to SCA (P = 0.04) (Fig. 1 b). vWF and iNOS genes expression vWF gene expression in SCO was significantly increased compared to control and SCA (P = 0.000) (Fig. 1 c). iNOS gene expression in SCO, was significantly increased compared to control and SCA (P = 0.000) (Fig. 1 d). Nrf2 and NOX2 genes expression qRT-PCR indicated that Nrf2 gene expression of SCA and SCO was significantly decreased compared to control (P = 0.04 and P = 0.000 respectively). Furthermore, Nrf2 gene expression in SCO was significantly lower than that in SCA (P = 0.001) (Fig. 1 e). The NOX2 gene expression in SCA and SCO was significantly increased compared to control (P = 0.000 and P = 0.009 respectively) (Fig. 1 f). ICAM-1, VCAM-1 and vWF proteins expression Due to unviability of protein for SCA, the SCO was compared to the control. In order to determine whether there is a difference in the expression of ICAM-1 protein between control and SCO groups, western blot analysis was performed. The expression of ICAM-1 protein increased significantly in SCO compare to the control (P = 0.04) (Fig. 2 a, d). The expression of VCAM-1 protein increased significantly in SCO compare to the control (P = 0.04) (Fig. 2 b, e). Moreover, the expression of vWF protein increased significantly in SCO compare to the control (P = 0.03) (Fig. 2 c, f). Housekeeping β-Actin protein with 43 kDa molecular weight (MW) was used as reference protein. Nrf2 and NOX2 proteins expression Expression of Nrf2 protein decreased significantly in SCO compare to the control (P = 0.001) (Fig. 3 a, c). The expression of NOX2 protein increased significantly in SCO compare to the control group (P = 0.02) (Fig. 3 b, d). Housekeeping β-Actin protein with 43 kDa molecular weight (MW) was used as reference protein. Discussion Immune response in general and inflammation in particular are vascular events, consequently tissue damages are immune cells-endothelium interactions. Our current study focuses on assessing endothelium-related indices in BAL of sever COVID-19 patients upon ICU admission. The finding in the present study showed that ICAM-1 and VCAM-1 genes expression were elevated in COVID-19 patients. Moreover, ICAM-1 and VCAM-1 proteins were higher in SCO group compare to control. Tong et al. informed that serum levels of VCAM-1 and ICAM-1 were increased in mild COVID-19 cases, significantly higher in severe cases, and decreased during recovery phase [ 24 ], thus endothelial cell adhesion molecules could be linked to the severity of the disease which can be a target for therapy [ 24 ]. ICAM-1 is expressed by various types of cells, such as activated ECs; these cells can attract leukocytes and transmit intracellular signals, leading to a sustained state of inflammation [ 25 ]. Thus, the role of ICAM-1 and VCAM-1 in post COVID-19, might be important to identify possible late risk factors [ 24 , 25 ]. A recent study shown that brain microvascular ECs infection with SARS-CoV-2, they show increased expression of pro-inflammatory molecules like TNF-α, IL-1β, ICAM1, and VCAM1, which leads to endothelial activation [ 26 ]. Another study found that the levels of soluble ICAM-1, VCAM-1 and vascular adhesion protein-1 were higher in COVID-19 patients and changed as the disease progressed or improved [ 24 ]. ECs are fundamental components of the coagulation system and are necessary to maintain hemostasis [ 25 ]. ECs injury may cause inflammation and thrombosis [ 25 ]. The results of our study showed that SARS-Cov-2 increased gene and protein of vWF. vWF plays a crucial role in platelet adhesion and aggregation at sites of vascular injury, as well as in stabilizing coagulation factor VIII, which are essential processes for both hemostasis and thrombosis [ 27 ]. In those who did not survive COVID-19, the prominent observation was diffuse alveolar damage, which was also accompanied by widespread microvascular thrombosis in lungs and extra-pulmonary organs [ 28 ]. Severe COVID-19 is also characterized by coagulopathy [ 28 ]. According to Ladikou et al., it has been documented that SARS-CoV-2 induces significant coagulopathy, leading to a substantial rise in vWF and factor VIIIc concentrations in the blood of COVID-19 patients [ 28 ]. This occurrence may be attributed to damage to the endothelium [ 28 ]. One possible explanation for the significant increase in vWF levels among individuals with COVID-19 is the cellular entry of SARS-CoV-2 facilitated by the transmembrane protein ACE2 [ 28 ]. ACE2 is present on the outer layer of alveolar epithelial cells, as well as arterial and venous ECs [ 28 ]. The entry of the virus may lead to inflammation and endothelial damage which lead to release of prothrombotic mediators, primarily vWF, and exposing underlying collagen to vWF binds [ 28 ]. Youn et al. also illustrate significant variations in specific pathways that contribute to ED in patients six months after contracting SARS-CoV-2 [ 29 ]. Patients recovering from COVID-19 exhibited increased arterial stiffness, higher values of vWF, and homocysteine when compared to healthy controls [ 30 ]. Overall, it appears that vWF may play a crucial role in the severity of COVID-19 and even after the clearance of SARS-CoV-2. Hyper inflammation can result in dysfunction of the ECs in blood vessels, leading to a decrease in the production of NO by eNOS [ 31 ]. This reduction in NO levels can cause widespread changes throughout the body, particularly affecting the vascular system [ 31 ]. Nevertheless, in response to combating the virus, there is an increase in iNOS activity and NO production, however, if unregulated, they may play a role in exacerbating lung damage [ 31 ]. In the first wave of SARS-CoV-2, iNOS levels were increased in serum of COVID-19 patients [ 32 ]; consistently, Karki and colleagues consistently observed an increase in iNOS expression in patients with severe COVID-19 [ 33 ]. Barilli et al. demonstrated that when the conditioned medium of macrophages that were exposed to spike S1 of SARS-CoV-2 was applied to alveolar epithelial A549 cells, it effectively triggered iNOS expression [ 33 ]. ED is also caused by NOX2 through the generation of ROS [ 34 ]. In this study, NOX2 gene and protein exhibited an over expression in COVID-19 patients, and less expression of Nrf2 gene and protein. Therefore, these two molecules might be strong differentiation factors for prognosis of SARS-Cov-2 infection, through increasing ROS production and decreasing antioxidant capacity in infected cells. Entry of SARS-CoV-2 into human cells through ACE2 receptors could potentially raise levels of angiotensin II [ 35 ], which may have harmful effects on arteries and leading to dysfunction, which could be facilitated by the activation of NOX2 through the generation of ROS and subsequent damage to the endothelium [ 35 ]. Researchers shown that angiotensin II can exacerbate vascular diseases by inducing inflammatory alterations in the endothelial lining of arteries, promoting infiltration of monocytes, and ultimately causing vascular dysfunction through NOX2-mediated oxidative stress [ 35 ]. Elevated production of ROS related to NOX2 could have a detrimental impact on the availability of NO in ECs by either deactivating eNOS or increasing the consumption of NO due to elevated levels of superoxide, which can have negative effects on the antioxidant properties [ 36 ]. Various factors may play a role in the increase of microvascular endothelial NOX2 [ 36 ]. These factors may include the elevated levels of pro-inflammatory cytokines commonly seen in cases of COVID-19 [ 36 ]. Violi et al. were the first to discover the connection between COVID-19 and NOX2-induced oxidative stress [ 35 ]. Similarly, Jiang et al. research revealed elevated levels of NOX2 in COVID-19 patients [ 36 ]. Additionally, a study was conducted to determine the impact of IL-6 on NOX-dependent oxidative stress in ECs, which involved treating bovine aortic endothelial cells with IL-6 and analyzing the expression of NOX isoforms (NOX1, NOX2, and NOX4) using Western blot [ 29 ]. According to their findings, exposing BAECs to IL-6 led to an increase in NOX2 levels, but not NOX1 or NOX4 [ 29 ]. Additionally, their study showed that the S protein of the SARS-CoV-2 virus notably enhanced the expression of NOX2 [ 29 ]. Oxidative stress is recognized as a contributing factor to the development of COVID-19 [ 37 ], and a lack of protection against oxidative stress-related cellular harm is a key factor in the impairment of endothelial function in various pathological states [ 38 ]. Nrf2 is crucial in safeguarding cells against oxidative stress, as it is particularly responsive to oxidative stress [ 39 ], and interacts with antioxidant response elements in the cell nucleus, facilitating the activation of numerous antioxidant genes [ 38 ]. Nrf2 is typically maintained in an inactive state within the cytosol through its interaction with the inhibitor protein KEAP1, which facilitates the proteasomal degradation of Nrf2 [ 40 ]. In response to oxidative stress, KEAP1 is inactivated and allowing Nrf2 to activate genes that protect against stress-induced cell death [ 40 ]. Nrf2 is considered a crucial controller of tissue damage during infection due to its ability to regulate genes that offer protection against stress [ 40 ]. Additionally, recent research has revealed that Nrf2 plays a significant role in modulating the inflammatory response by acting as a transcriptional repressor of inflammatory genes [ 40 ]. Nrf2 suppresses the activation of NF-κB mediated by oxidative stress by reducing levels of intracellular ROS [ 41 ]. In addition, it is possible that Nrf2 may act as a regulatory factor impacting the expression of cell adhesion molecules [ 41 ]. For example, the plant-derived antioxidant 3-hydroxyanthranilic acid, has been shown to increase HO-1 expression and decrease both VCAM-1 expression and NF-kB activation by facilitating Nrf2 movement to reduce inflammation in atherosclerosis [ 41 ]. Conversely, research on vascular inflammation and atherosclerosis models has found that activated Nrf2 can prevent the pro-inflammatory state of vascular ECs by inhibiting the p38-VCAM-1 signaling pathway [ 41 ]. Deficiency in the expression of the Nrf2 target gene Molecular and Cellular Biochemistry (G6PDH) has been linked to heightened production of ROS and increased viral gene expression and particle production in human coronavirus, typically associated with the common cold and respiratory conditions [ 42 ]. Importantly, research indicates that the Nrf2 pathway is inhibited in lung samples from COVID-19 patients; on the other hand, pharmaceutical agents that activate Nrf2 have been shown to hinder the replication of SARS-CoV2 and reduce the inflammatory reaction [ 42 ]. Accessory proteins of the coronavirus are a group of proteins that have their genes dispersed among or within the genes that encode structural proteins [ 43 ]. For example, ORF3a protein is exclusive to both SARS-CoV and SARS-CoV-2, playing various essential roles in viral pathogenicity [ 43 ]. Research has shown that the distinct functional components of ORF3a in SARS-CoV-2 are linked to its ability to influence virulence, infectivity, and the release of the virus [ 43 ]. In studies involving animals infected with SARS-CoV-2, the absence of ORF3a gene resulted in a lower cytokine storm, decreased virus infection, and less tissue damage in the lungs [ 43 ]. The induction of various types of cell death by ORF3a results in tissue damage that impacts the progression of COVID-19 [ 43 ]. Overall, Nrf2 and the genes under its control defend against cell death caused by stress and manage the body's response to inflammation and tissue damage during infections [ 43 ]. When conditions are normal, Nrf2 within the cytoplasm binds with a protein called Keap1, which acts as a negative regulator and leads to Nrf2's degradation through ubiquitination and the proteasome [ 43 ]. Redox products deactivate Keap1 by altering certain sensor cysteine residues, causing it to separate from Nrf2 [ 43 ]. Subsequently, Nrf2 moves into the nucleus to trigger the body's antioxidant defenses [ 43 ]. Research has shown that the Nrf2 pathway is suppressed in lung samples from COVID-19 patients [ 43 ]. Additionally, a pharmaceutical agent that activates Nrf2 has been found to hinder the replication of SARS-CoV-2 and reduce inflammation [ 43 ]. Typically, ORF3a functions as a molecular linker, by interacting with Keap1 and facilitating its recruitment to Nrf2, resulting in the degradation of Nrf2 by the proteasome [ 43 ]. This degradation of Nrf2 decreases the cellular antioxidant capacity and renders cells more susceptible to ferroptosis [ 43 ]. Liu and colleagues discovered that ORF3a, a unique accessory protein present in both SARS and SARS-CoV-2 coronaviruses, promotes cell sensitivity to ferroptosis through the Keap1-NRF2 axis [ 43 ]. They found that ORF3a induces the breakdown of Nrf2 by enlisting Keap1, resulting in increased levels of lipid ROS and ultimately triggering ferroptosis[ 43 ]. Additionally, the SARS-CoV-2 virus has the potential to disrupt the balance between the NF-κb transcription factor, which regulates cytokine expression, and Nrf2 activation, which controls antioxidant enzyme production [ 37 ]. Nrf2 deficiency could potentially account for the tissue damage associated with COVID-19 [ 39 ]. Furthermore, research conducted by Olagnier et al. reveals that the activity of Nrf2-dependent genes is inhibited in biopsies taken from COVID-19 patients, and that the administration of Nrf2 agonists 4-OI and DMF to cells triggers a robust antiviral response that hinders the replication of SARS-CoV2 [ 40 ]. Additionally, orally administering EGCG, an activator of Nrf2, enhanced survival rates by reducing the incidence of viral pneumonia in the lungs caused by decreased entry and replication of the virus[ 44 ]. Conclusion The continued developments in our knowledge of the pathophysiology of COVID-19 have been essential for improving the treatment of SARS-Cov2 infection. Unlike other respiratory illnesses, our study highlighted the significant role of ED in the development of severe COVID-19. These findings are crucial for understanding the complexities of this multi-organ disease and can aid in patient care and treatment. The study has some limitations, the sample size could be more and finding eligible control group was rare. However, due to the global impact of the pandemic, further well-designed studies are urgently required to apply this information in clinical practice. Declarations Ethics approval and consent to participate The Medical Ethics Committee of Mashhad University of Medical Sciences, Mashhad, Iran (IR.MUMS.MEDICAL.REC.1401.500) approved and oversaw this study. All procedures were carried out meticulously following relevant guidelines. This case-control study was performed during April 2021 to May 2021 for Alpha wave and November 2021 to February 2022 for Omicron wave of COVID-19 pandemic in Iran (Heydarifard, Shafiei-Jandaghi, Safaei, Tavakoli, & Shatizadeh Malekshahi, 2023). The study involved obtaining of BAL, which was part of the left-over samples and approved by the local Ethics Committee under the restrictions of the Declaration of Helsinki, from COVID-19 patients in the ICU, and outpatients in the bronchoscopy department at Ghaem Hospitals of Mashhad, Iran. Authorship contribution statement S.A.R and S.N. designed the study. A.H.A and A.Sh. sampled patients. Z.A. and F.S.M. performed the experiments. S.A.R, M.M. and S.N. supervised experiments. Z.A. and F.S.M. analyzed and interpreted data. Z.A., S.N. and S.A.R wrote the first drafts of the original and revised manuscripts. All authors critically read and revised the manuscript. Declaration of competing interest No conflicts of interest. Funding This work was supported by research Affairs of Mashhad University of Medical Sciences, Mashhad, Iran for their financial support (grant number 89145). Author S.N. has received research support. Author Contribution S.A.R and S.N. designed the study. A.H.A and A.Sh. sampled patients. Z.A. and F.S.M. performed the experiments. S.A.R, M.M. and S.N. supervised experiments. Z.A. and F.S.M. analyzed and interpreted data. Z.A., S.N. and S.A.R wrote the first drafts of the original and revised manuscripts. All authors critically read and revised the manuscript. Acknowledgments We would like to thank Mashhad University of Medical Sciences, Mashhad, Iran for their financial support. References V.O.J.F.E.I.T. The-nCo Q, Li (2020) An Outbreak of NCIP (2019-nCoV) Infection in China - Wuhan, Hubei Province, 2019–2020, China CDC weekly. 2 79–80 Xu SW, Ilyas I, Weng JP (2023) Endothelial dysfunction in COVID-19: an overview of evidence, biomarkers, mechanisms and potential therapies. Acta Pharmacol Sin 44:695–709. https://doi.org/10.1038/s41401-022-00998-0 Sharifkashani S, Bafrani MA, Khaboushan AS, Pirzadeh M, Kheirandish A, Yavarpour Bali H, Hessami A, Saghazadeh A, Rezaei N (2020) Angiotensin-converting enzyme 2 (ACE2) receptor and SARS-CoV-2: Potential therapeutic targeting. Eur J Pharmacol 884:173455. https://doi.org/10.1016/j.ejphar.2020.173455 Huertas A, Montani D, Savale L, Pichon J, Tu L, Parent F, Guignabert C, Humbert M (2020) Endothelial cell dysfunction: a major player in SARS-CoV-2 infection (COVID-19)? Eur Respir J 56. https://doi.org/10.1183/13993003.01634-2020 Gavriilaki E, Anyfanti P, Gavriilaki M, Lazaridis A, Douma S, Gkaliagkousi E (2020) Endothelial Dysfunction in COVID-19: Lessons Learned from Coronaviruses. Curr Hypertens Rep 22:63. https://doi.org/10.1007/s11906-020-01078-6 Endemann DH, Schiffrin EL (2004) Endothelial dysfunction. J Am Soc Nephrol 15:1983–1992 Aktan F (2004) iNOS-mediated nitric oxide production and its regulation. Life Sci 75:639–653. https://doi.org/10.1016/j.lfs.2003.10.042 Xue Q, Yan Y, Zhang R, Xiong H (2018) Regulation of iNOS on Immune Cells and Its Role in Diseases. Int J Mol Sci 19. https://doi.org/10.3390/ijms19123805 Garren MR, Ashcraft M, Qian Y, Douglass M, Brisbois EJ, Handa H (2021) Nitric oxide and viral infection: Recent developments in antiviral therapies and platforms. Appl Mater today 22:100887 Incalza MA, D'Oria R, Natalicchio A, Perrini S, Laviola L, Giorgino F (2018) Oxidative stress and reactive oxygen species in endothelial dysfunction associated with cardiovascular and metabolic diseases. Vascul Pharmacol 100:1–19. https://doi.org/10.1016/j.vph.2017.05.005 Kessel C, Vollenberg R, Masjosthusmann K, Hinze C, Wittkowski H, Debaugnies F, Nagant C, Corazza F, Vely F, Kaplanski G, Girard-Guyonvarc'h C, Gabay C, Schmidt H, Foell D, Tepasse PR (2021) Discrimination of COVID-19 From Inflammation-Induced Cytokine Storm Syndromes Using Disease-Related Blood Biomarkers. Arthritis Rheumatol 73:1791–1799. https://doi.org/10.1002/art.41763 Mancini I, Baronciani L, Artoni A, Colpani P, Biganzoli M, Cozzi G, Novembrino C, Boscolo Anzoletti M, De Zan V, Pagliari MT, Gualtierotti R, Aliberti S, Panigada M, Grasselli G, Blasi F, Peyvandi F (2021) The ADAMTS13-von Willebrand factor axis in COVID-19 patients. J Thromb Haemost 19:513–521. https://doi.org/10.1111/jth.15191 Chernyak BV, Popova EN, Prikhodko AS, Grebenchikov OA, Zinovkina LA, Zinovkin RA (2020) COVID-19 and Oxidative Stress, Biochemistry (Mosc). 85:1543–1553. https://doi.org/10.1134/S0006297920120068 De Lorenzo A, Escobar S, Tibirica E (2020) Systemic endothelial dysfunction: A common pathway for COVID-19, cardiovascular and metabolic diseases. Nutr Metab Cardiovasc Dis 30:1401–1402. https://doi.org/10.1016/j.numecd.2020.05.007 van der Vliet A, Eiserich JP, Shigenaga MK, Cross CE (1999) Reactive nitrogen species and tyrosine nitration in the respiratory tract: epiphenomena or a pathobiologic mechanism of disease? Am J Respir Crit Care Med 160:1–9. https://doi.org/10.1164/ajrccm.160.1.9807044 Chen Q, Xu L, Zhu W, Ge J (2020) Cardiovascular manifestations in severe and critical patients with COVID-19. Clin Cardiol 43:1054. https://doi.org/10.1002/clc.23422 DiNicolantonio JJ, McCarty M (2020) Thrombotic complications of COVID-19 may reflect an upregulation of endothelial tissue factor expression that is contingent on activation of endosomal NADPH oxidase. Open Heart 7. https://doi.org/10.1136/openhrt-2020-001337 Suhail S, Zajac J, Fossum C, Lowater H, McCracken C, Severson N, Laatsch B, Narkiewicz-Jodko A, Johnson B, Liebau J, Bhattacharyya S, Hati S (2020) Role of Oxidative Stress on SARS-CoV (SARS) and SARS-CoV-2 (COVID-19) Infection: A Review. Protein J 39:644–656. https://doi.org/10.1007/s10930-020-09935-8 Kaspar JW, Niture SK, Jaiswal AK (2009) Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic Biol Med 47:1304–1309. https://doi.org/10.1016/j.freeradbiomed.2009.07.035 Al-Kuraishy HM, Al-Gareeb AI, Eldahshan OA, Abdelkhalek YM, El Dahshan M, Ahmed EA, Sabatier JM, Batiha GE (2024) The possible role of nuclear factor erythroid-2-related factor 2 activators in the management of Covid-19. J Biochem Mol Toxicol 38:e23605. https://doi.org/10.1002/jbt.23605 Heydarifard Z, Shafiei-Jandaghi NZ, Safaei M, Tavakoli F, Shatizadeh S, Malekshahi (2023) Comparison of clinical outcomes, demographic, and laboratory characteristics of hospitalized COVID-19 patients during major three waves driven by Alpha, Delta, and Omicron variants in Tehran, Iran, Influenza Other Respir Viruses. 17:e13184. https://doi.org/10.1111/irv.13184 Bafadam S, Mahmoudabady M, Niazmand S, Rezaee SA, Soukhtanloo M (2021) Cardioprotective effects of Fenugreek (Trigonella foenum-graceum) seed extract in streptozotocin induced diabetic rats. J Cardiovasc Thorac Res 13:28–36. https://doi.org/10.34172/jcvtr.2021.01 Mahmoudabady M, Niazmand S, Shafei MN, McEntee K (2013) Investigation of apoptosis in a canine model of chronic heart failure induced by tachycardia. Acta Physiol Hung 100:435–444. https://doi.org/10.1556/APhysiol.100.2013.4.8 Tong M, Jiang Y, Xia D, Xiong Y, Zheng Q, Chen F, Zou L, Xiao W, Zhu Y (2020) Elevated Expression of Serum Endothelial Cell Adhesion Molecules in COVID-19 Patients. J Infect Dis 222:894–898. https://doi.org/10.1093/infdis/jiaa349 Smith-Norowitz TA, Loeffler J, Norowitz YM, Kohlhoff S (2021) Intracellular Adhesion Molecule-1 (ICAM-1) Levels in Convalescent COVID-19 Serum: A Case Report. Ann Clin Lab Sci 51:730–734 Yang RC, Huang K, Zhang HP, Li L, Zhang YF, Tan C, Chen HC, Jin ML, Wang XR (2022) SARS-CoV-2 productively infects human brain microvascular endothelial cells. J Neuroinflammation 19:149. https://doi.org/10.1186/s12974-022-02514-x Ruggeri ZM (2007) The role of von Willebrand factor in thrombus formation. Thromb Res 120 Suppl 1 https://doi.org/10.1016/j.thromres.2007.03.011 . S5-9 Ladikou EE, Sivaloganathan H, Milne KM, Arter WE, Ramasamy R, Saad R, Stoneham SM, Philips B, Eziefula AC, Chevassut T (2020) Von Willebrand factor (vWF): marker of endothelial damage and thrombotic risk in COVID-19? Clin Med (Lond) 20:e178–e182. https://doi.org/10.7861/clinmed.2020-0346 Youn JY, Zhang Y, Wu Y, Cannesson M, Cai H (2021) Therapeutic application of estrogen for COVID-19: Attenuation of SARS-CoV-2 spike protein and IL-6 stimulated, ACE2-dependent NOX2 activation, ROS production and MCP-1 upregulation in endothelial cells. Redox Biol 46:102099. https://doi.org/10.1016/j.redox.2021.102099 Jud P, Gressenberger P, Muster V, Avian A, Meinitzer A, Strohmaier H, Sourij H, Raggam RB, Stradner MH, Demel U, Kessler HH, Eller K, Brodmann M (2021) Evaluation of Endothelial Dysfunction and Inflammatory Vasculopathy After SARS-CoV-2 Infection-A Cross-Sectional Study. Front Cardiovasc Med 8:750887. https://doi.org/10.3389/fcvm.2021.750887 Barilli A, Recchia Luciani G, Visigalli R, Sala R, Soli M, Dall'Asta V, Rotoli BM (2023) Cytokine-Induced iNOS in A549 Alveolar Epithelial Cells: A Potential Role in COVID-19 Lung Pathology, Biomedicines. 11. https://doi.org/10.3390/biomedicines11102699 Gelzo M, Scialo F, Cacciapuoti S, Pinchera B, De Rosa A, Cernera G, Comegna M, Tripodi L, Schiano Moriello N, Mormile M, Fabbrocini G, Parrella R, Corso G, Gentile I, Castaldo G (2022) Inducible Nitric Oxide Synthase (iNOS): Why a Different Production in COVID-19 Patients of the Two Waves? Viruses 14. https://doi.org/10.3390/v14030534 Karki R, Sharma BR, Tuladhar S, Williams EP, Zalduondo L, Samir P, Zheng M, Sundaram B, Banoth B, Malireddi RKS, Schreiner P, Neale G, Vogel P, Webby R, Jonsson CB, Kanneganti TD (2021) Synergism of TNF-alpha and IFN-gamma Triggers Inflammatory Cell Death, Tissue Damage, and Mortality in SARS-CoV-2 Infection and Cytokine Shock Syndromes. Cell 184:149–168e117. https://doi.org/10.1016/j.cell.2020.11.025 Sukumar P, Viswambharan H, Imrie H, Cubbon RM, Yuldasheva N, Gage M, Galloway S, Skromna A, Kandavelu P, Santos CX, Gatenby VK, Smith J, Beech DJ, Wheatcroft SB, Channon KM, Shah AM, Kearney MT (2013) Nox2 NADPH oxidase has a critical role in insulin resistance-related endothelial cell dysfunction. Diabetes 62:2130–2134. https://doi.org/10.2337/db12-1294 Violi F, Oliva A, Cangemi R, Ceccarelli G, Pignatelli P, Carnevale R, Cammisotto V, Lichtner M, Alessandri F, De Angelis M, Miele MC, D'Ettorre G, Ruberto F, Venditti M, Pugliese F, Mastroianni CM (2020) Nox2 activation in Covid-19, Redox Biol. 36:101655. https://doi.org/10.1016/j.redox.2020.101655 Jiang Z, Wu L, van der Leeden B, van Rossum AC, Niessen HWM, Krijnen PAJ (2023) NOX2 and NOX5 are increased in cardiac microvascular endothelium of deceased COVID-19 patients. Int J Cardiol 370:454–462. https://doi.org/10.1016/j.ijcard.2022.10.172 Cecchini R, Cecchini AL (2020) SARS-CoV-2 infection pathogenesis is related to oxidative stress as a response to aggression. Med Hypotheses 143:110102. https://doi.org/10.1016/j.mehy.2020.110102 Chen B, Lu Y, Chen Y, Cheng J (2015) The role of Nrf2 in oxidative stress-induced endothelial injuries. J Endocrinol 225:R83–99. https://doi.org/10.1530/JOE-14-0662 Gumus H, Erat T, Ozturk I, Demir A, Koyuncu I (2022) Oxidative stress and decreased Nrf2 level in pediatric patients with COVID-19. J Med Virol 94:2259–2264. https://doi.org/10.1002/jmv.27640 Olagnier D, Farahani E, Thyrsted J, Blay-Cadanet J, Herengt A, Idorn M, Hait A, Hernaez B, Knudsen A, Iversen MB, Schilling M, Jorgensen SE, Thomsen M, Reinert LS, Lappe M, Hoang HD, Gilchrist VH, Hansen AL, Ottosen R, Nielsen CG, Moller C, van der Horst D, Peri S, Balachandran S, Huang J, Jakobsen M, Svenningsen EB, Poulsen TB, Bartsch L, Thielke AL, Luo Y, Alain T, Rehwinkel J, Alcami A, Hiscott J, Mogensen TH, Paludan SR, Holm CK (2020) SARS-CoV2-mediated suppression of NRF2-signaling reveals potent antiviral and anti-inflammatory activity of 4-octyl-itaconate and dimethyl fumarate. Nat Commun 11:4938. https://doi.org/10.1038/s41467-020-18764-3 Saha S, Buttari B, Panieri E, Profumo E, Saso L (2020) An Overview of Nrf2 Signaling Pathway and Its Role in Inflammation. Molecules 25. https://doi.org/10.3390/molecules25225474 Cuadrado A, Pajares M, Benito C, Jimenez-Villegas J, Escoll M, Fernandez-Gines R, Garcia Yague AJ, Lastra D, Manda G, Rojo AI (2020) Dinkova-Kostova, Can Activation of NRF2 Be a Strategy against COVID-19? Trends Pharmacol Sci 41:598–610. https://doi.org/10.1016/j.tips.2020.07.003 Liu L, Du J, Yang S, Zheng B, Shen J, Huang J, Cao L, Huang S, Liu X, Guo L, Li C, Ke C, Peng X, Guo D, Peng H (2023) SARS-CoV-2 ORF3a sensitizes cells to ferroptosis via Keap1-NRF2 axis. Redox Biol 63:102752. https://doi.org/10.1016/j.redox.2023.102752 Hassan SM, Jawad MJ, Ahjel SW, Singh RB, Singh J, Awad SM, Hadi NR (2020) The Nrf2 Activator (DMF) and Covid-19: Is there a Possible Role? Med Arch 74:134–138. https://doi.org/10.5455/medarh.2020.74.134-138 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4942103","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":346329290,"identity":"0cc8603f-b9b3-4066-bfa8-d9fd486c4d58","order_by":0,"name":"Zohreh Arab","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zohreh","middleName":"","lastName":"Arab","suffix":""},{"id":346329292,"identity":"a5efa8ed-746f-4186-866c-a2841a9fff53","order_by":1,"name":"Seyed Abdolrahim Rezaee","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Seyed","middleName":"Abdolrahim","lastName":"Rezaee","suffix":""},{"id":346329294,"identity":"cce4af26-1268-413e-a28f-1d422d88cadb","order_by":2,"name":"Fatemeh Sadat Mohammadi","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Fatemeh","middleName":"Sadat","lastName":"Mohammadi","suffix":""},{"id":346329295,"identity":"d121196c-bb97-46f1-b3c4-b0fa9199b411","order_by":3,"name":"Amir-Hashem Asna-Ashari","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Amir-Hashem","middleName":"","lastName":"Asna-Ashari","suffix":""},{"id":346329296,"identity":"f738d65f-e57e-408f-b27b-131192654bc4","order_by":4,"name":"Alireza Shariati","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Alireza","middleName":"","lastName":"Shariati","suffix":""},{"id":346329297,"identity":"240834d3-d13a-4698-9ace-ffb10e31be7c","order_by":5,"name":"Maryam Mahmoudabady","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Maryam","middleName":"","lastName":"Mahmoudabady","suffix":""},{"id":346329298,"identity":"52574677-b14b-4ef9-8600-2e07208e5d76","order_by":6,"name":"Saeed Niazmand","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4klEQVRIiWNgGAWjYBACg8MQmrGBvQEmxtiAXS0UWMC18BwgUovNAZgyiQQiHWZznPnxpxs1d2Tnz3ydJnXjD4M8fwNz2wd8WswOsxkY5xx7Zrzhdu426dw2BsMZBxibZ+DXwmCQnMN2OHGDNEhLAwPjBgbGZrwOMz7M/uFwzr/DifNnnt0mnfOHwZ6gFsPDPIbNuW2HExtu8AK1sDEkEqOlmDm377DxhjO5m61z2ySSZxwmoMXg/PHNn3O+HZad33524+2cPza2/e3tj/FqQQcSDAzMJGkYBaNgFIyCUYANAACjXU6H89i54wAAAABJRU5ErkJggg==","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Saeed","middleName":"","lastName":"Niazmand","suffix":""}],"badges":[],"createdAt":"2024-08-20 05:04:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4942103/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4942103/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":66789735,"identity":"d972b18c-ca95-4bd0-8b59-ee4472ecd795","added_by":"auto","created_at":"2024-10-16 13:27:37","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":72750,"visible":true,"origin":"","legend":"\u003cp\u003eqRT‐PCR analysis of (a) ICAM-1, (b) VCAM-1, (c) vWF, (d) iNOS, (e) Nrf2 and (f) NOX2 in BAL samples of control, SCA and SCO groups. The mRNA expression was normalized to β2M expression. Data are expressed as means ± standard deviation (SD) (Control: n=40, SCA: n=17, SCO: n=17). * P\u0026lt;0.05, ** P \u0026lt; 0.01 and *** P \u0026lt; 0.001 compared to control group and + P\u0026lt;0.05 and +++ P\u0026lt;0.001 compare to SCA group.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4942103/v1/a43101e384edec745feb80ff.jpeg"},{"id":66790827,"identity":"ff8095de-62ce-4e13-8d35-3baf007416f1","added_by":"auto","created_at":"2024-10-16 13:35:37","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":78508,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blot analysis of (a) ICAM-1, (c) VCAM-1 and (c) vWF proteins in BAL samples of the control and SCO groups. The densitometric values of (d) ICAM-1, (e) VCAM-1 and (f) vWF in BAL samples of the control and SCO groups. β‐actin was used as internal control (n = 2). Statistical analyses were performed using the One-way ANOVA test and LSD post hoc. Values are expressed as means ± SD. * P\u0026lt;0.05 compare to control group.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4942103/v1/30667f67931691ef856c1ebe.jpeg"},{"id":66789734,"identity":"8f984de0-f887-4d9d-86a9-1f16879b3db6","added_by":"auto","created_at":"2024-10-16 13:27:37","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":55783,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blot analysis of (a) Nrf2 and (b) NOX2 proteins in BAL samples of the control and SCO groups. The densitometric values of (c) Nrf2 and (d) NOX2 in BAL samples of the control and SCO groups. β‐actin was used as internal control (n = 2). Statistical analyses were performed using the One-way ANOVA test and LSD post hoc. Values are expressed as means ± SD. * P\u0026lt;0.05 and ** P\u0026lt;0.01 compare to control group.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-4942103/v1/51aca78db2fc51c93ad5576a.jpeg"},{"id":68138139,"identity":"f5dc7816-d431-4c47-9307-ed83bfcf39fc","added_by":"auto","created_at":"2024-11-04 04:09:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":693397,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4942103/v1/fc1fb528-cc5b-435e-a147-2f79331e4338.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Endothelial dysfunction in COVID-19: Insights from bronchoalveolar lavage and molecular markers","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCOVID-19 caused by the SARS-CoV-2 [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Emerging research suggests that the impact of SARS-CoV-2 extends beyond just the lungs, affecting the entire vascular system through direct virus infection or indirectly by cytokine storm, which can lead to endothelial dysfunction (ED) [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. SARS-CoV-2 enters the host cell by its spike protein which attache to the angiotensin-converting enzyme 2 (ACE2) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Endothelial cells (ECs) and smooth muscle cells in different organs through the body contain ACE2 [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. This indicates that if SARS-CoV-2 infiltrates the bloodstream, quickly disseminate throughout the entire body [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The symptoms of SARS-CoV-2 infection mirror those of ED, indicating common pathophysiological mechanisms [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The complex pathophysiology of ED involves a variety of mechanisms, some of which are shared among many conditions [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eED is often described as a condition where ECs fail to release nitric oxide (NO) in response to increased blood flow [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. NO production relies on a group of enzymes called nitric oxide synthases (NOSs) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. iNOS is typically inactive in resting cells, but immune-stimulatory cytokines, bacterial products, or infections in various cell types, including ECs, can stimulate it [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Excessive NO production by iNOS can have both protective and harmful effects, depending on the specific cell type [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. NO contributes to vasodilation, improve blood flow and oxygen delivery to tissues [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. But an excess production of NO can result in tissue damage by interacting with superoxide radicals or forming peroxynitrite, leading to inflammation [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The elevated iNOS expression in ECs may trigger ED, blood clot development during SARS-CoV-2 infection [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Reactive oxygen species (ROS) play a significant role in ED [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. These agents neutralize NO by generating peroxynitrite, a toxic oxidant that impairs protein function through protein nitration, consequently leading to ED [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Peroxynitrite also degrades the eNOS cofactor tetrahydrobiopterin, leading to eNOS uncoupling and further ROS formation [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Oxidative stress contributes to a pro-inflammatory state in vessel walls, with ROS increasing adhesion molecules (such as VCAM-1 and ICAM1) expression and inflammatory cytokines through activation of transcription factors NFkB and AP1 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Additionally, the release of vWF after vascular inflammatory damage serves as an indicator of endothelial activation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. vWF plays a role in homeostasis, platelet aggregation, vascular integrity defects, leukocyte proliferation, and tissue and cellular inflammation damage [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. SARS-CoV-2-induced viral pneumonia triggers an excessive immune response in lung tissues affected by virus replication. This process is consistently associated with oxidative stress [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The NOX is a membrane enzyme that is a major source of ROS production (18). Different isoforms of this enzyme include: NOX1, NOX2, NOX3, NOX4 and NOX5 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Studies on cardiovascular diseases such as hyperlipidemia, high blood pressure, diabetes and arteriosclerosis show that NOX2 expression in the endothelium is more altered [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Inhibition of ACE2 through the activation of NOX increases ROS production, leading to an enhancement in inflammatory responses [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Furthermore, the activation of NOX2 has been linked to a rise in superoxide and hydrogen peroxide levels, leading to an uncoupling of eNOS and decreased vascular function [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Additionally, viruses are capable of activating NADPH oxidase via a mechanism that relies on toll-like receptor 7 [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. As the SARS-CoV-2 induced oxidative stress, antioxidant system becomes important [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Nrf2 is a sensor for oxidative stress within cells and a nuclear transcription factor that regulates the activation of genes responsible for antioxidant enzymes (SOD, catalase) in various tissues and cells [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Furthermore, the Nrf2 pathway plays a role in reducing inflammatory cytokines and preventing cytokine storm in COVID-19 [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTherefore, to determine whether endotheliopathy occurs in COVID-19 patients, markers of endotheliopathy such as vWF, ICAM-1, VCAM-1, NOX2, Nrf2, and iNOS were assessed in BAL of infected patients.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy population\u003c/h2\u003e \u003cp\u003eThe Medical Ethics Committee of Mashhad University of Medical Sciences, Mashhad, Iran (IR.MUMS.MEDICAL.REC.1401.500) approved and oversaw this study. All procedures were carried out meticulously following relevant guidelines. This case-control study was performed during April 2021 to May 2021 for Alpha wave and November 2021 to February 2022 for Omicron wave of COVID-19 pandemic in Iran [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The study involved obtaining five milliliters of BAL, which was part of the left-over samples and approved by the local Ethics Committee under the restrictions of the Declaration of Helsinki, from 34 COVID-19 patients (17 with SCA and 17 with SCO) in the ICU, as well as from 40 outpatients in the bronchoscopy department with negative SARS-CoV-2 qRT-PCR tests as the control group at Ghaem Hospitals of Mashhad, Iran. The main criteria for inclusion in the study groups was the absence of diabetes and cardio-vascular diseases, which was confirmed by pulmonologists at admission time. Moreover, the exclusion criteria were age of less than 75 years\u0026rsquo; old. The use of medications during hospitalization was considered a confounding variable; efforts were made to minimize their impact on the results without interfering with standard treatments. The Number of samples resulting from prevalence time limitation of each wave of SARS-CoV-2, homogenization of the samples in terms of age and sex, and the inclusion and exclusion criteria of the study.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGene expression\u003c/h2\u003e \u003cp\u003eBAL samples were collected from all patients in 5 milliliters and centrifuged and extracted cells were stored in TriPure. Quality and purity of RNA measured by nanodrop device (ND1000, Thermo Scientific, Delaware, USA). By using RevertAid\u0026trade; First Strand cDNA Synthesis kit (Fermentas, Germany) and following the manufacturer's instructions, RNA was reverse transcribed to cDNA.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePrimer design\u003c/h2\u003e \u003cp\u003ePrimers and probs (TaqMan method for ICAM-1, VCAM-1, vWF, iNOS and β-actin, and SYBR Green for Nrf2, NOX2 and β-actin) were designed by Beacon Designer (PREMIER Biosoft International, Palo Alto,CA; version 7). β-actin was the housekeeping gene. Specificity of oligo-nucleotides was checked by BLAST analysis. In Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, primers and probes sequences are shown.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe sequences of primers and probes for TaqMan and SYBR Green methods are presented in the following column.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer Sequences (5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eICAM\u003c/p\u003e \u003cp\u003e(TaqMan)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: TTCGTGTCCTGTATGGCCC\u003c/p\u003e \u003cp\u003eReverse: AGTCACTGATTCCCCGATGG\u003c/p\u003e \u003cp\u003eProbe: FAM-CCAGCAGACTCCAATGTGCCAGGCTTG-BHQ-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVCAM\u003c/p\u003e \u003cp\u003e(TaqMan)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: GGAAATGACCTTCATCCCTACCA\u003c/p\u003e \u003cp\u003eReverse: CTCTGGGGGCAACATTGACA\u003c/p\u003e \u003cp\u003eProbe: FAM-CGAACCCAAACAAAGGCAGAGTACGCA-BHQ-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003evWF\u003c/p\u003e \u003cp\u003e(TaqMan)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: ACTTCCTTACCCCCTCTGGG\u003c/p\u003e \u003cp\u003eReverse: TCCTCGGAGAACCTGGTCAT\u003c/p\u003e \u003cp\u003eProbe: FAM-CCAGGCGTTCCCGAAGTCCTCCACCC-BHQ-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eiNOS\u003c/p\u003e \u003cp\u003e(TaqMan)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: CGCATGACCTTGGTGTTTGG\u003c/p\u003e \u003cp\u003eReverse: CATAGACCTTGGGCTTGCCA\u003c/p\u003e \u003cp\u003eProbe: FAM-TGCCGCCGCCCAGATGAGGACC-BHQ-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNOX2\u003c/p\u003e \u003cp\u003e(SYBR Green)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: GAGTTGTCATCACGCTGTGC\u003c/p\u003e \u003cp\u003eReverse: CCCACGTACAATTCGTTCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNrf2\u003c/p\u003e \u003cp\u003e(SYBR Green)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: ATCCATTCCTGAGTTACAGTGTCT\u003c/p\u003e \u003cp\u003eReverse: AGAGGATGCTGCTGAAGGAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ2M\u003c/p\u003e \u003cp\u003e(TaqMan)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: TTGTCTTTCAGCAAGGACTGG\u003c/p\u003e \u003cp\u003eReverse: CCACTTAACTATCTTGGGCTGTG\u003c/p\u003e \u003cp\u003eProbe: FAM-TCACATGGTTCACACGGCAGGCAT-BHQ-1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ2M\u003c/p\u003e \u003cp\u003e(SYBR Green)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward: TCACAGCCCAAGATAGTTAAG\u003c/p\u003e \u003cp\u003eReverse: GAGGTTTGAAGATGCCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eICAM-1, Intracellular Adhesion Molecule-1; VCAM-1, Vascular cell adhesion molecules 1; Nrf2, Nuclear factor erythroid \u0026ndash;related factor 2; NOX2, NADPH oxidase 2; vWF, von Willebrand factor; iNOS, Inducible nitric oxide synthases; β2M, beta 2 microglobulin.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eqRT-PCR\u003c/h2\u003e \u003cp\u003eqRT-PCR was performed by using TaqMan Master Mix (Takara Biotechnology, Otsu and Shiga, Japan) and SYBR Green Master Mix (Pars Tous, Iran). Syber Green and TaqMan methods used to analyze gene expressions by LightCycler (Roche Diagnostics, Mannheim, Germany). The data were analyzed using standard curves for related and reference genes. Afterward, data analysis was done by LightCycler software. Comparative gene expression (fold changes) was calculated using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot analysis\u003c/h2\u003e \u003cp\u003eProtein extracted from BAL samples by using RIPA buffer (Tebu-bio, Boechout, Belgium). Afterward, the total protein amount was loaded onto a 12% SDS-PAGE gel and then transferred to PVDF membranes. Next, the secondary antibody was applied and left to incubate for 1 hour at room temperature, and the bands were visualized using an ECL kit by FluorChem E\u0026trade; system from Protein and quantified using ImageJ [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eStatistics\u003c/h2\u003e \u003cp\u003eThe data analyzed by the SPSS 11.5 statistical software (IBM SPSS, USA) and Excel Software Version 2013. All values were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. The distribution of variables in the study groups was found to be normal based on the Kolmogorov-Smirnov test, hence, parametric tests were employed for statistical analysis. Since the variables followed a normal distribution, inferential statistical methods such as one-way ANOVA followed by LSD test analysis were used to compare the differences among the SCA, SCO and the control group. Results were statistically significant if the P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003eDemographic data\u003c/h2\u003e\n \u003cp\u003eTable \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e displays the ages and genders of the 74 individuals in SCA, SCO and control groups. An analysis of the data showed that there were no significant differences in average of age and gender among the groups.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n \u003cp\u003eThe three clinical groups employed in this study are presented, dividedly by sex within the number. Then value for age within the years (mean value + SEM (standard error of the mean)) are shown in the following column.\u003c/p\u003e\n \u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAs0AAADhCAYAAAAzvojlAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAADsMAAA7DAcdvqGQAACjuSURBVHhe7d2/ThTfH8bx5XcZxhgjXIOFEQsK4AIs0MrKBOtvtKGkwVhDYkUFFl4AWliAsfAa0BBjuA1++xzmWT97mNkz+wfYXd6v5DB/d2Z258w5nzlzdlm46OoAAAAAaPS/aggAAACgAUEzAAAAUEDQDAAAABRc6dO8sLBQjQEAAAB3m0NlvggIAAAAFNA9AwAAACggaAYAAAAKCJoBAACAAoJmAAAAoGAiQbN+cSOmT58+pflv3rxJw6Wlpd6y379/p3nzSu9d7/P9+/fVnOHodfEzBIC2XH7E9P3797TM5TEA3La8nKpL11VmKQ71PhSfDmOsoNkFtPz69Sv9JIfS8fFxmu8A+evXr2k4zRSkTiKg//PnTxqenZ2lYYkqNFdq4td5OwDQhsrcd+/edTY3N3tlsdKrV6965TQATIuTk5NURu3s7FRz/sWSKseG1bax8tGjR53Dw8NqajgjB80KMlVAi96kDsJ2d3dHPqDb8uLFi2psPG/fvk0nXJ9BG6rQIr1Or9d2AKANt5aoosnLntPT05EqIAC4LiqTnj59Wk1d1TaGMgXMbRsrxzFy0Ly1tZWGa2trfQGzbWxs1M6fRsM2z0/K+vp6uuEAgFGpAcPlyMuXL9Mw999//1VjAHD72gTFbQPn2Ih73UYKmtWdwIX0yspKGtape8M/f/5MjwqV8qZ0z3eK/XrzftGe9jpxuVK+bR1z3XK9zu9lcXExBbIWt+kuFHE7WjdO61g87r44+X49X6/98uVLGl9eXk770jF5vXj8TccOAPv7+9VYp3Pv3r1qrJ8aMFwe5+WUp1UGWSz74vxYRsXXelriazXP47FsFc9XivsAgJzKj1hmmMog9xTY29tLyxyvxfWVtO7YLkZweHio/yKY0s7OTjW3WTco7a2/trbWN22bm5tpWts+OTm5sjy+RsnraH0dg8Y1jOtpXLyu9iFeLnFfXl/iOt6+l3taSe/H0+L34X11A/HeuPbl8Xicmm/anuZpmzLo2AHAZcYw5YLLKSWNK6msEg013+Wdxr1MvD+XSd6Wp2PZ5nLMZWR8TdxmHAdwt8SYKsZh5jLHsZLLKNH6eRkkntcUUzqOHbbsmcivZwwjb332l+80v3s8qVtHSfcDSH1hvL77ETf1A97e3k7DZ8+epaHWVZK6lhnfjXRPVBo+ePAgDT9//pyG1v2wO0dHR73911ELiu5+1OKiY/b7b9t1ZdCxA0CT2CrslLfoqoxTmaSkvs9qoelWQqlscxmlcc0bpZXm+fPnafjkyZM0VFkoDx8+TNv08WjfAJBTjOin8u4D7XJDZVxTLDVMTDmMkYLmx48fV2Odzrdv36qxydCHoO4KVveLFk2PIFWoq4C38/PzNBy2QPYvV+hEqaJx03/eybzNI0UF1aqY8scGbVGZABgkdpGL5Ut+M7+5uXmlPMkrnL9//1ZjV43ziz6xzFaZrmPb2dlJgbPKRbqcAajjOK5Omy/+tYkphzFS0KyCVgWwKLBsOohhWibcb1cfglqSh6H967Xq26dCOOfgVj+F14ZblhWAu2VXya3Ew1Lg7MpLJ2+YkzbssQO4W+ITtoODg2ps8lwutn1K1sSvd1CvRgV9iWci/Q0B3Bl6YtVknJhykJG7ZyiAdPeF2LorDmJji3SJf3pN3RAGtXbU8RdQ1OJSd1fibau11y0xek1d8Kr5Pu74SFKvG6U1xF8WlMMBP8Pn95Ab5tgB3E1uLFA5MU6rrR5lujuGaVzzmh5zDvodfn3xW9y1zY0tOkYf56iNEQDmn7pkONZ03OMnZrHBwFSuaL1xYsqBunf6Y4kdrJ26BWy19JKm47J8WtxpWymOe3ndayx2Iu9+uH3rWlxHSZ3ALe7PuhVF3/raruTvV9s1dyx30rS2rdfGeZZ3fs+PUfvK11OK2wAAy8sKp6iunMoNKm/rykaPa1txeVzmMlR0nHmZD+DucRkQU115EMsSpSiWOSpbJC9fPK7yLC/Dhil/FvSn+yIAAMamVp5uxZTGu5XT2N05AGBa3PivZwAAAACzhqAZADAxq6ur1djl9138XQwAmHV0zwAAAAAKaGkGAAAACgiaAQAAgAKCZgAAAKCAoBkAAAAoIGgGAAAACgiaAQAAgAKCZgAAAKCAoBkAAAAoIGgGAAAACgiaAQAAgAKCZgAAAKCAoBkAAAAoIGgGAAAACgiaAQAAgAKCZgAAAKCAoBkAAAAoIGgGAAAACgiagTny6dOnzsLCQl+S79+/p2XT6Pfv371jXVpaquZi1sTzqKT81pTv3r9/37euz7tfU2d9fb3z5s2bagqYrLzsVH5WPtUwp7wY13W+rMufmhfXjetjBl0AmAuLi4sXuqTX1taqOZc0T+nw8LCaMzk7OzvV2Hh0bDpGvQfMnl+/fqXzF/PD5uZmbb5zftRy8+uVTk5Oqrn/xOXApLn8iXnP5anynmm582HM1369UuR58bqI68ZtYzbQ0gzMAbV8dAvgTjdg7hwdHVVzL3Wv8zR/0mgtgX3+/DkNnz9/noayu7t7Jd+5RbkbMKfl9ujRo5RPu4FKNaefty/T+sQEs2t/fz/lvadPn1ZzOp3T09Nq7JJanJeXl9N4N/DtbGxspHHRuMrfyHld18Dbt2/TuGhd5X9ZXV1NQ8wOgmZgxulx9pcvX9L4q1ev0jC3tbVVjU2GHlvu7e1VU8ClPOiN+U7BrgOLly9fpmFue3u7Gut3dnbW2/ak8zIgyptqfIh2dnaqsU7nw4cP1dhl4JvTjZ+D4ZjX68rkZ8+epaHW4SZwxqT2ZgAzy4/BlbqFcDV3MHXh8GtiMRAfP2qduG0/utSjRs9z0n79ODOf9mPM/HXxUagfWeo1mD063/Hc1p3HmOeGoXyi/BHzT8w7wLhilwkllXs5L1M+LinlVc3z8rp9YXrR0gzMuLovqgyi1hS1THcL7t4jcX05RfR40q0rWkctIp52K6AeweuRo2iZtqFWlq9fv6Z5om3qkaepZfrdu3e99dUio0edTV/6wmzR+VermWlceUrn3fLH3W0dHByklr3Y9UPzgElR/lKXC9NTNOVfl0/DlrF6MoL5RNAM3CEq/N2Vw/333PcuBjiiwLjpMWSJAnJtXwGytvHx48c0/8mTJ2n48OHDNGx6HI/Z437JvskS3Sjl+WpU2r5v1ugahElTOaX86zwmo97Yu3xrY5h1cfsImoEZt7KyUo11Oj9//qzG6p2fn1djV02ydeTevXvV2KXYChmN2vqI6RK/FKovPcXgwzdM8UtPbQMR9533T3X5hk/oC4pJiflXX6RW/jU91dANm56eScyDTdw4IH///q3G/onz4rqYfgTNwIyL38yOXSIiBSmlR4y30eLB7zLPj7xFWcGHAw3577//qrHm7hV5IPzt27cUwMRkTXkdGJa6luU3cvmNfnwq1nTD5vl6yuabxrp86nlaJ/5iB6YfQTMwB1zAqxUk/yk4BTMq8NVaEgtzB9Fu7Y3B9zDa/PScH9m7hcWt2vwSwvzIu2IoCFG+fP36dZpW/lO3HVHrcR5kKx8dHx9XU5fTdb884LykvE5rMyYl74rhnzn0L72o+4bz3osXL64E2XkDgH/6U/k05nWNu7U6/3lQzIDunTuAORF/7cKpW9BXS//pBs5961j8VrdSvp63Fdfzr2PoFxM8T+M5vdbLlbQN6QZWffP5Nvns0TnTeczPsfNGLs9X+bpxucatbf4GhuE8ludL5ek6cZ3Suvk1oUSenV0L+tM9iQAAAAAa0D0DAAAAKCBoBgAAAAoImgEAAIACgmYAAACggKAZAAAAKCBoBgAAAAoImgEAAIACgmYAAACggKAZAAAAKCBoBgAAAAoImgEAAIACgmYAAACggKAZAAAAKCBoBgAAAAoImgEAAIACgmYAAACgYOGiqxpPFhYWqjEAAADgbnOofCVoBgAAANCP7hkAAABAAUEzAAAAUEDQDAAAABQQNAMAAAAFEwual5aWOu/fv6+mbsb6+nrn06dPad/61Q8nzcv9/v27bx2l79+/V0un35s3b3rHrffreaLPIb6vPEX6bLQ+plOel5WUd0X5Nc53Phhk0PaktHxcMd+2yXcqQ+KxKLlcidtSqrvO0f8ZuoyLn5tSG3H9QZ+1y9ZJlqd5PqirW3RMXt7mWoiUF11+1iktx/h87prKBX3+pTIj5gGneN5imXEd5zPuV6mO3oOXt7lG4vbi+nkMM2yen3bxXMbyJp7DQeWQeL081dVpTfsr0q9njOvk5ES/wHGxuLhYzbl+2t/m5mY1dXFxeHiY5imtra1Vc//Z2dlJx9e0/Dbo+HXcJVpPx22/fv1K0/Hz9jlQ8jbjPL1/07jmYbrE8+XkPO5zrmQaH5SXB21PSsubDJtvtR/vq3Tt+RqNKef5bY7hLonnM17vFsvIEq3j8sXnsenz9jnT/kva5h3ztvP3E9+LU5u8Ky7/mtYvLcd4VAb4nDXx+S2VF3FbTiorxfk2prrrIqfXx7q1ZNB1pePztrzeoOvE24kp5/w5zDFOs1i35decz6G4fGsqP2L5F1Oehwbtr42JtDQfHBykYfdgJtra0ER3bt0PorO7u1vNuaR58uXLl4m2lt22vb29TvfkVlOdzqNHjzrdDFJNNXv69Gmne4Gl8Xfv3vXOzdu3b9NnNW93qrNue3tbpUNfch7//PlzGjqPi8aV15sM2p6Ulo9D15/yrSgfKnUL+XS8TWWE7vbrjgll+kyXl5fTuD4zXeOjcqvu6upqGr58+TINt7a20jDSuir3b9r+/n4vf7hs/Pr1axoOonypsrBJaTnGo7pbZYDqpUHX9osXL6qxZsrzKysrvXzgpPpR51HJ81T2yMePH9PwJuj49F59HT1+/DgNVcbV0bWkel3HG+v3pvJyHugc+dyoHIn1j5apDnGdpzpE6soh+fHjR9qGz7mS8pnyiA3aX1sT79PclCEmRRWrMuKrV6+qOf/EeQ4yRB/UgwcPqqnZpMwTH1EqA/liHOT58+fV2L+bG1HGU6YZ6rEEro3yqPK1Hxflj6Odf7WOz9np6WlfEB2VtldaPq7z8/Nq7B/fpKlwq6NASJWljocbuuG47GtzM11ydnZWjV26d+9eGqq8UL4xVeY3GYREsbJ79uxZGrYpD7WOK806peUYnetulVmDbuoUWLc5B6rPdIPjMix3dHRUjf2LS26yXGkq5/QZ1FFd7cDQQ4nj88ZdZg4PD9PNTvTz589qrF9eDpnyVL4NlU8xBhq0v7bGDpp1Iaglwnf7yhB1byj264nJd1Eaet6gjK2KVXzXFt2/f793HLEwVwC9sbFRTdWLxxSPP/anUdL7sLyvjccnfWH6PbmAcNDU5i4pZozYElO6a8PNijd54nPtvKj864okBpaxYohK2ystn6Q229Q6sTJRwajjmXQwP49UdurzErU263NTGlfpvGlfbVp3r0Ms19wqWSoPVV4reGoqn0vLMR7X3YNu1jWtlsE2N0B+kmXanoOipoAotjpet/zmM6q7tuIx+30ouJtXscx3nabkz+bPnz9pWKeuUSbn7fhzLe2vrbGD5uPj4xSA+RGe5BVy/kjGlb9aRfRaBYEqgBUcarnE4DTym266KHwcqkTaPNbQB6YPTsekfesYfHx6vR8P+Li1/xi0xkDG62jfXieKgbWSth1PnlLdCdR+HDiLX9OWjzHnY8Xt092w8o9SLChj5ZEHKMqLTRd8aXtt9mej5Ftd1853eXnQxMejZArm21zHd5mfILmcclnRVIaWuAwdlL9Uqbep0Ect89rwts2BRh3lIe2nqfGktBzj0Wfrulv1vuudeH1rHTV2telapHVjeeGyRvmrru5VnKJ1mratGyXnR9eLnlYalLdGMSjo0/70PkTXyrxyvaDPW+fQXUnb3DD9/fu3Gmum7b9+/bqaGm9/0VhBszLuw4cP03isJPNHdnqMLH7E7Dt5P77wHagfs2l5XYGdT9eJx6HKRBfkoK4Z/iD9wfn96MLTtvThNrXmRW0qEBXIvsiVVLnpdXFe082AAmctj3RxTUKbzxXXK5535xMX3j4/WidWONJ0wZe212Z/Nmq+9XXvVmxXmk+ePEnDKH+9tulCrekxJ/r5M2wT9A6ics/lmfKEy1MNtQ8HJcoXJaPmnTZivpWmgEnUKDOoHC8tx+Sou4/OubuW+aZPZVnbJxd5nlFZ4zyrADnSNaC84Tijjl7v/KgyUHnK00ptnuoOw12e6mh/Lvtk1JvfWeF40N0o9PmXGkrUq6Dk27dvfV0zbJT9RWMFzR8+fOhViEraueQH4YN0c7srU1eennYLhCvXNk3wdXx3oQtFF+Sgwt2PULSu9q33I/HRgC66+P4GPTaYNO07PsLSBRX7LTZVEqbX+7iHvaPC7YrfD9D1pDwoqjCcB3Ru2wZGpe8blJaPwpWOj1cVpYKyNsb5MttdNqhCbisGu265dv5Q8OHy0gGrKPAcpvKZFNUfPsY6LiN1vEquX/Qe1IJYWo7rEQNf5RuVZcpPOgf67EXnom3QqDwb86Op3lNA3bbcmRQ3wNUp3Siq7Iv1/F2QfyaDGjtLZZzqRJULgz7n0jloMnZLswtWJQdn4rtH0R28CjUH2FpPGcKZ2EG1u2845Zm87Zusu7to4oztR5tOrrB1bL7rrLsgb4IDeYstQSWxM33sQoPpp7tp5Tnle19PLixGqQDi9uqUlo9DAZUM22Kj46lrmcY/fkJXd/M07rlUQKkARuXjoMaH2+bPoE0LFG6e8qHrz7wxbFBwOSzV184Lopse3ew57+oaKTU0TUpTueUW9hKX8ddRHk+DvNE0Uj1X9701aVNH5V0zpLS/1rrB4Ei6J7729wa7wbH6EKTk5Rpq/SbdYLn3GtN2usF1NfWPtqP18mXdILLveLxenNf9sNO8eCxa7n17XW1Lycfl9b2e5pu3qfXrpgfReyytp/fp/UZ+fxbfh7cZXxuP2TRfx4vbl+c1ideAl/s86hzH9b3c57Pt9pqWD9Im35rW1X6U4rZj3lTejdNeT/P9fiOv1/YY7gKXO/rsnDfyz87zlaI875jXjXkkl5/HkmHyjvh9xffi96FtmcbjtI+pbl96P/nro9JyjCY/bz63dbSOlsW8p2kln1NPO98pL8Zz5v3lyeVLEy3Pr4VB4n5yOn5vy+v5ePP3mG9D69Vts+l6nUW+1vRe/X7jOfRnJF7u81/63OvOc2l/bVzdWwvO7PkOfUAx6Y3VzVeKr3VGcPIHk/MHFZfH49G+xOvF8TzpQxN/eE4+rrr5HteyOK2Uv8/SxdlGLAjituMF0/T5KjVdWH5vTZ8zblae1+rOTX6NOK9LXpCWttdmf+OI11zddpWvvVzHIvE6VorvT+ryeVP+vovi5xeDzPhZx+R18rwTP+eSuvM4CXnZ6iR17yfPY03zxe/P5WqutByji+WCUhOf/1gG+DU+p3l5EMuCfD9164yrdF1ZPM54jeTvMX8/8b1LXZmtVJfHZ0l833XXnD+n/L3GcxzpvAw6z6X9lSzoT/fF10r9lfx4NtfNCEM/anYfJ764MTp9hnpMUfeoAgAAAP3G/sm5NvTD+927At0O9FL3biAtG+VLKwqW9QUBvqQxGn1u+vwImAEAANq5kaBZHfHz3+ZcXLz8eatRO7kr8L7JTv2TEN9/U7pu+rz8BU6gjbp8miegTl1eqUvAbarLk3kC5Ea6Z+BSmwuP04FpQ77FqNoGG+Qf3CbKOLRF0AwAAAAU3Ej3DAAAAGCWETQDAAAABQTNAAAAQMGNBs36qTN1uHeq++ULzfPyNj8pF7enFP+VrP6lZr5cSb8bDQAAALQ1kaBZgWgbu7u7A7+BqoBZP02nf3ii9fb29gYGzgqKxeuvra31/r+9gmf/FnSk5cP+MxUAAADcbVPVPWNraysNHdQqCFbgHFuPTa3FDoq9/srKShpq2c+fP3vBtJP+wcrq6mpaBwAAAGhraoLmppZhUQCci/9J0K3RZ2dnaaggemNj40qL8v7+fufly5fVFAAAANDO1ATN5+fn1dhVf/78qcb+0X8S3NzcTONqjVYXEQ3VotxE/zqarhkAAAAY1khB8/r6et8X6yROa/kkuQU5pz7S7sNsTf9WW/MdZAMAAADDGCloPjo66usrLHFayyfp4cOH1dhV6nKhfTp41hcJ6/pAHx8f0zUDAAAAI5ma7hmxj3LuwYMH1Vg/tWr/+PEjjZ+enqah1PWBVtcNumYAAABgFFMTNKuPct7Vwh4/flyN/eNuGDGg1q9t1KFrBgAAAMYxNUGzbG9vp6H/+Yi+uKdgVwG1uly4z7SW379/P62j7hmi5Vpf9MsZEV0zAAAAMI6FC3UIviH6gqADW1Prcuxa4X9wIgqY9WU/UVDslmj9/rK6Wih4Xl5eTvOs7u0o0L7BtwkAAIA5c6NBMwAAADCLpqp7BgAAADCNRmppVneHEhqwAQAAMC9oaQYAAAAK6NMMAAAAFNDSDAAAABQQNAMAAAAFBM0AAABAAUEzAAAAUEDQDAAAABQQNAMAAAAFBM0AAABAAUEzAAAAUEDQDAAAABQQNAMAAAAFBM0AAABAAUEzAAAAUEDQDAAAABQQNAMAAAAFBM0AAABAAUEzAAAAUEDQDAAAABSMFDS/f/++s7CwMDBpnZv26dOn3v7fvHlTzR2NXt/mPXz//r2ztLRUTQHT7/fv333XqqZz6+vrveXK44CpvIv5h3yCaZXn0bqyDvMl1l11MVxc7jRM2TVS0Pz27dvOxcVFNdXpbG5upmmnxcXFasnN2tjYSMcyLlUKurj0PkuePn3a2d7eTh88FySmnfJofn3m0ypUTk9P07V8eHjYWV5eJiBCovzz69evauof5SGVhcC0cGPWyclJKsvW1tZuLTbBzVDd9eXLl2qq03n37l1f3aXyKy4X5Ythyq5r6Z7x9evXamz2uIX66OgoDdtwsM4FiWn34cOHXiWigNj0lEZUwKhQWV1dTdOPHz9OQ90YAj9//uzlHyflI+cXYBqoHPPNnQOilZWVNKQBYD7pvOocu1yyHz9+VGOX9Z/yRSy/hon1ZKJBsw5ale+jR49atdJOGx3/3t5e5/Xr19Wc9v777780vI1uKUBbyqeuRHSz5xu9+/fvp2EsYKL87hx3k/JM3iqzv7/fefnyZTUF3L579+5VY/8aws7OztKQJyLzSec8xp1qQZYnT56koSi+U52nngGjduGdaNDc1BoV+464C0PsF63x2M9E6+gNedqtYKLA1vOdvM0mWh7Xb3JwcJCG8UPOj8PjeT9m3SjoZOhxADCtlE/ruCJxxVKndJ3hbtINFYEIponKOXfVVKCkOlvD2AKJ+RLrNsVqKpeUB1w2xThSnC+GffIwkaDZO89boxysKphUZo1dGHRH4DsBBZpbW1u9TK51nj171nt8rGX26tWrNFQT+87OThofdMegD0Tb0750DBo2fXHP3UriXeru7m7vmF+8eJG2oWntPz8J3i7BBWaB8qnyceymMcj5+Xk1BlxSGehyG5gmse62vM7G/FEDrGI1UWzqoFhdDRW/KamLmek7O8OYSNCsQtMBafT58+c0dH+3hw8fpmGecRX8xpYKbUePAev4C0pNLWY5tx67P5Nep0Ch7u5C8wchuMA8Uf+uQddaLt5MAnJ8fEzXDEwtdR1yQ5comKJRa76pj3JdUBxjRsWbMWYdprV5ot0zYouw+FGvW6LddeHPnz9pOA7dTXh7CqSb+ALRun5EI3///k1D4C7SjauerORfgvCNbZ22N6q4O1Se0jUD00j1vb+jEWMEfZkV881BcUkes7Yx0aBZBxpbrVwBK5rXG3Aa50uC7gutbhrunjGIK3q3hjvVta7lj3KAeaQbSRUWsSLxF1hjf/4of4oE0DUD08pPsx88eJCGQhl29+icD4rr/PR0mBv/iQbNOVfA6uvs5m9l5rx7Rluq7N26rP4pg760ZOobLWoRcauzAoS65nh3Ixm1e4WDEFpeMM2Uz9UVSTefTvGb5Spo3L/frTKj3JFjvtE1A9PKvwak7hmiut/fuWrbHQ2zxT8mEWM7nXPnAcWdWh6/06YuxLErRysXI9jZ2VG795XUrYirNf7pHlDfOpubm2l+vg3Nj9Pdirtv2q/r3jX0zYvjh4eHvWklTUs+X/uu42ONy0vH5fesoaabtg1Mg3j9xORrxWI+13UB5JQ3gGmVxx7k1/lWF5dGjtFiGiVeW9Cf7otR0S9xqJVtUD/pOnqdWrP5OAEAAObPtXbPmEX6mRpRU39b6u6hgFmPvAEAADB/CJprqJVZXyD0l6MGUf+Zjx8/phZmfl0AAABgPtE9AwAAACigpRkAAAAoIGgGAAAACgiaAQAAgAKCZgAAAKCAoBkAAAAoIGgGAAAACgiaAQAAgAKCZgAAAKCAoBkAAAAoIGgGAAAACgiaAQAAgAKCZgAAAKCAoBkAAAAoIGgGAAAACgiaAQAAgAKCZgAAAKCAoBkAAAAoIGgGAAAACkYKmt+/f99ZWFjopfX19WpJP82P671586Za0ixuW+Pj0P7abOPTp0+N7wGYN9+/f++7LussLS31lv/+/buai7soL8eVf3Iqa71c5SkwDWK+pI6/G2J5VRf/xbptpBjzYgx6udOvX7+quZc0vbi42Lh8kLW1tfSanZ2das7wtG9tpy3tS/sE5tnJyUnvmnTStRLFa8fXxTDXL+aPzr/zi/JQtLm5meaL89fh4WGaBm6L86XypPPlMDEBZo9jx5hieeWYVFy3DRtnjtU9o3uA1Vin8/nz52rs0s+fPzurq6vV1M1yi/bR0VEatvH27dv0fnQXAsyr7e3tTjcAUqnR6RYWaZ6m3XqoVkJNr6yspOknT56k4YcPH9IQiPQUYm9vr1cXPH36NA23trbSELgNzpeiPKnUDZg6X758qX1Sgtmn86p6S3Wbkv348SMNXbe5rHr+/Hkavnv3Lg3bGitofvToUe8APn78mIb258+fzsOHD6upm6MPThfL69evqzntqaDXh8rjRcyr3d3ddN2KbhTt3r17aXh8fJyGua9fv1ZjwD9qHKmjcpRuPbgt5+fn1dg/bhBzEIX5ojos1mmOTd3wo5g0cj0ow9xIjf1FQLcoxNYqFZYPHjxI43W0nvuUOJUK2PiaQa3BBwcHaegPSmIfFwXEHs/7ONFKgnkXCwpTC4znN12Hur6BXF4RRXWBC3DTuHm7G2LdpjhPTxU2Nzd7cZ2dnp5WY6MZO2j2Yw9xwKquGhsbG2m8zqtXr9JQFbEfEQ/6kqA+gOXl5fQBuNm9qVO/W8Tcciaxm4YCYm+j7lGN3gsBAu4C5/39/f00LKHywTD+/v1bjQE3K8YleddRzDfFhi9evEjj6nXges7dMWID7yjGDprFXSHch+js7CwNmyjSV+Ba1+pVx5X6s2fP0lAtzQp46yrxUsBLgABcUv/mujvxJm2vV0Du379fjQE3zy2K6rOqJ8uKGSQ+hcb8USPpyclJNdVJDa6i+svzNU95wtrWgTKRoNkRvKjF2MFtie4I3Al7UJO5l+nuIWZ+Hv8Bo/FP7aiPc9QUGLvVBogGdcOLT/uA2+AvhTlYUj/XYQIkzCadY/coiDxfyb0cPGxrIkGzKlp3ulZr86CuGaIKW8Gvumm0OWD3Yda6fsNKdZmfyh0YTI+mvn371tdtyUF00w3vbf0SDqbb48ePq7F+Kod5MoFp4dbGvJEA801xaV1MqDpQDbZaFr882MZEgmZxP2U97h1E3R7cuqwCt9SVQ/zzV/GnQdSiXdeFwpX7qK3Q6t5BgY95pgpET2t04+pkuuFV/ldQLf6m+X///ZeGQKRyUmW+n/65r6C6/gC3zf/cRFS3U6/PL//gQ+yvrHIp75KrRljVgarnRvpS4MUIdqofhXbqZsY0X+P+Ufu43KlbuKZl3YPtmxfH8237h6nz+U0/nq/1tVzrW/duo++1+bT5tfwwP+ZVzPcx+TqzeI36+sbdFPOCk8rQKJbjlJ+4bcqD5Me7JY8RlaJYRo1Tpy3oT3cjc0V3l/oVjWHvInSnoteMdPcBAACAuTWXQbOoCV6p7X8FVKCt/thz+nEAAABgDBPr0zxt1Fqs/kv+gtMg+h1o9Y8mYAYAAECduW1pBgAAACZlbluaAQAAgEkhaAYAAAAKCJoBAACAAoJmAAAAoICgGQAAACggaAYAAAAKCJoBAACAAoJmAAAAoICgGQAAACggaAYAAAAKCJoBAACAAoJmAAAAoICgGQAAACggaAYAAAAKCJoBAACAAoJmAAAAoICgGQAAACgYKWh+//59Z2FhoZh+//5dvWKy4v41Pk2m+diAJsqrS0tL1dQlXb/Oy/ky3C3r6+u9vKD0/fv3asmluCym66oDgJzyZMx7yrPRp0+f+pY3rYfZVXd+lZrKIS1TvhjGyC3Na2trnYuLi5Rsc3MzTf/69aua054OvG0B+/bt27T/aTTNxwbUUWXz7t27auqSrsXFxcXOzs5OuqYVNBM4311HR0eN5XoeQJvKwUePHlVTwPV6+vRpKqsUh9Q5Pj6uxvq9evWqGsMsG7YcGvVmaeSgeXd3txq7SgeoynYYL168qMYA3KS6SuPDhw9p+OTJkzRcWVlJQdOwd+WYfz9+/Eh5w40oSir/lWeAaRLzqJIaBh4/flwtxSwbphxSPfbly5dqajgjBc1qTS21ILRZx2jBAm7HmzdvqrF+X79+rcb6NbXW4O6qK+s/fvzYef78eTUF3L68oU8tk4o92sYpmG5tyyE9Rd3a2qqmhncjXwTM+xrFvr7KtH7sp7s+N5nX9T9qK+5P21Ng4Gk34ce+x1oe9+dAIu+frG15Wh983G5TC5yXK+WPD+Lr/Zlou56nzyZOaxyYFOfZ169fp2HU9CiePIgS5xGCEUwztUzyNGR+NZVDq6urjY1CbVx70KxAcXl5udcH+vDwMPWfdJC4v7+fhqKKWn3nxN019Br3UXIwW6K+Te4eoib4Z8+e9aa3t7fTMO97vLGxcaUvVFxHx6y7E6+jAF/b1fuRujsXvUbH7wBEn4NPpALwvb29zsnJSUpaV0GMTrC3qdfpBHsamCRdY4O6WdU5PT2txoB6nz9/rr0RA6YJT0PmW105pLhT88a5ob/2oPng4CANfUd3//79NPQXj+7du5eGOfdJGZeCXgXE41LQrWDc2mzXgbpOkINvnUgFzu5Po236M4g3EKYgRfvRZ0HLDSZFN226WRsWXalQ8u3bN4IRTDXVwXTNmG95OaQGXM1TY+g4rj1odstqnUHLTBlbLbLSZv1ZcH5+Xo1ddt9Qq7XkrXieD0ySb9r05EP5zzewerLhoLgp71HJYBDlLZVj5BNMMzVe0TVjftWVQ2rAVb3n7q6mJ65N3Wvr3Eif5iaDClb391Xra9NPyIzrJgt2B8T6NYLYuq5Axa3qedAM3BZ1C6qjLklAE7pmYBbQNWO+XWc5dO1Bs/v6np2dpeHfv3/T0F0XcgqW1Yzu1mV1X7ipFuZxOofX0aMA0fErOFbrnd6PgnW35PmnvcRfggSuk/Kfb9SUfC0qT/rG7b///ktDfVlGlJe1fBJdnTC/6JqBaaf6mK4Z862uHNL3d2K9Z/rO2FD1WvfFI+tWttrzldQNEKs1Lp2cnPQt1+uizc3N3jKL68flem2+X20/yve3trbWN+396zjj/Lhe94O8sp94HEr5drVcNF/bjutrXq4bhPS9XvJj8jaB6+J8rvwYxbyYL8PdkpdVSnmZpvxCPsFtUZ2d51GlPD5wDIH51LYccv5QvhnGgv50XwgAAACgwa32aQYAAABmAUEzAAAAUEDQDAAAABQQNAMAAAAFBM0AAABAAUEzAAAAUEDQDAAAABQQNAMAAAAFBM0AAABAAUEzAAAAUEDQDAAAABQQNAMAAAAFBM0AAABAAUEzAAAAUEDQDAAAABQQNAMAAAAFCxdd1XiysLBQjQEAAAB3m0PlK0EzAAAAgH50zwAAAAAKCJoBAACAgTqd/wNPdE8bfaivtQAAAABJRU5ErkJggg==\"\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cp\u003eSCA, SARS-CoV-2 alpha; SCO, SARS-CoV-2 omicron.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eICAM-1 and VCAM-1 genes expression\u003c/h2\u003e\n \u003cp\u003eThe results of qRT-PCR indicated that, in SCA and SCO groups, ICAM-1 gene expression was significantly increased compared to control (P = 0.004 and P = 0.02 respectively) (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea). In SCA and SCO groups, VCAM-1 gene expression was significantly increased compared to control (P = 0.04 and P = 0.000 respectively). Moreover, VCAM-1 gene expression of SCO was significantly increased compared to SCA (P = 0.04) (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003evWF and iNOS genes expression\u003c/h2\u003e\n \u003cp\u003evWF gene expression in SCO was significantly increased compared to control and SCA (P = 0.000) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec). iNOS gene expression in SCO, was significantly increased compared to control and SCA (P = 0.000) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ed).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eNrf2 and NOX2 genes expression\u003c/h2\u003e\n \u003cp\u003eqRT-PCR indicated that Nrf2 gene expression of SCA and SCO was significantly decreased compared to control (P = 0.04 and P = 0.000 respectively). Furthermore, Nrf2 gene expression in SCO was significantly lower than that in SCA (P = 0.001) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ee). The NOX2 gene expression in SCA and SCO was significantly increased compared to control (P = 0.000 and P = 0.009 respectively) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ef).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eICAM-1, VCAM-1 and vWF proteins expression\u003c/h2\u003e\n \u003cp\u003eDue to unviability of protein for SCA, the SCO was compared to the control. In order to determine whether there is a difference in the expression of ICAM-1 protein between control and SCO groups, western blot analysis was performed. The expression of ICAM-1 protein increased significantly in SCO compare to the control (P = 0.04) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea, d). The expression of VCAM-1 protein increased significantly in SCO compare to the control (P = 0.04) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb, e). Moreover, the expression of vWF protein increased significantly in SCO compare to the control (P = 0.03) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ec, f). Housekeeping β-Actin protein with 43 kDa molecular weight (MW) was used as reference protein.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eNrf2 and NOX2 proteins expression\u003c/h2\u003e\n \u003cp\u003eExpression of Nrf2 protein decreased significantly in SCO compare to the control (P = 0.001) (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea, c). The expression of NOX2 protein increased significantly in SCO compare to the control group (P = 0.02) (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb, d). Housekeeping β-Actin protein with 43 kDa molecular weight (MW) was used as reference protein.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eImmune response in general and inflammation in particular are vascular events, consequently tissue damages are immune cells-endothelium interactions. Our current study focuses on assessing endothelium-related indices in BAL of sever COVID-19 patients upon ICU admission. The finding in the present study showed that ICAM-1 and VCAM-1 genes expression were elevated in COVID-19 patients. Moreover, ICAM-1 and VCAM-1 proteins were higher in SCO group compare to control.\u003c/p\u003e \u003cp\u003eTong et al. informed that serum levels of VCAM-1 and ICAM-1 were increased in mild COVID-19 cases, significantly higher in severe cases, and decreased during recovery phase [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], thus endothelial cell adhesion molecules could be linked to the severity of the disease which can be a target for therapy [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. ICAM-1 is expressed by various types of cells, such as activated ECs; these cells can attract leukocytes and transmit intracellular signals, leading to a sustained state of inflammation [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Thus, the role of ICAM-1 and VCAM-1 in post COVID-19, might be important to identify possible late risk factors [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. A recent study shown that brain microvascular ECs infection with SARS-CoV-2, they show increased expression of pro-inflammatory molecules like TNF-α, IL-1β, ICAM1, and VCAM1, which leads to endothelial activation [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Another study found that the levels of soluble ICAM-1, VCAM-1 and vascular adhesion protein-1 were higher in COVID-19 patients and changed as the disease progressed or improved [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eECs are fundamental components of the coagulation system and are necessary to maintain hemostasis [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. ECs injury may cause inflammation and thrombosis [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The results of our study showed that SARS-Cov-2 increased gene and protein of vWF. vWF plays a crucial role in platelet adhesion and aggregation at sites of vascular injury, as well as in stabilizing coagulation factor VIII, which are essential processes for both hemostasis and thrombosis [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In those who did not survive COVID-19, the prominent observation was diffuse alveolar damage, which was also accompanied by widespread microvascular thrombosis in lungs and extra-pulmonary organs [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Severe COVID-19 is also characterized by coagulopathy [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. According to Ladikou et al., it has been documented that SARS-CoV-2 induces significant coagulopathy, leading to a substantial rise in vWF and factor VIIIc concentrations in the blood of COVID-19 patients [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. This occurrence may be attributed to damage to the endothelium [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. One possible explanation for the significant increase in vWF levels among individuals with COVID-19 is the cellular entry of SARS-CoV-2 facilitated by the transmembrane protein ACE2 [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. ACE2 is present on the outer layer of alveolar epithelial cells, as well as arterial and venous ECs [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The entry of the virus may lead to inflammation and endothelial damage which lead to release of prothrombotic mediators, primarily vWF, and exposing underlying collagen to vWF binds [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Youn et al. also illustrate significant variations in specific pathways that contribute to ED in patients six months after contracting SARS-CoV-2 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Patients recovering from COVID-19 exhibited increased arterial stiffness, higher values of vWF, and homocysteine when compared to healthy controls [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Overall, it appears that vWF may play a crucial role in the severity of COVID-19 and even after the clearance of SARS-CoV-2.\u003c/p\u003e \u003cp\u003eHyper inflammation can result in dysfunction of the ECs in blood vessels, leading to a decrease in the production of NO by eNOS [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. This reduction in NO levels can cause widespread changes throughout the body, particularly affecting the vascular system [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Nevertheless, in response to combating the virus, there is an increase in iNOS activity and NO production, however, if unregulated, they may play a role in exacerbating lung damage [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In the first wave of SARS-CoV-2, iNOS levels were increased in serum of COVID-19 patients [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]; consistently, Karki and colleagues consistently observed an increase in iNOS expression in patients with severe COVID-19 [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Barilli et al. demonstrated that when the conditioned medium of macrophages that were exposed to spike S1 of SARS-CoV-2 was applied to alveolar epithelial A549 cells, it effectively triggered iNOS expression [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eED is also caused by NOX2 through the generation of ROS [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In this study, NOX2 gene and protein exhibited an over expression in COVID-19 patients, and less expression of Nrf2 gene and protein. Therefore, these two molecules might be strong differentiation factors for prognosis of SARS-Cov-2 infection, through increasing ROS production and decreasing antioxidant capacity in infected cells. Entry of SARS-CoV-2 into human cells through ACE2 receptors could potentially raise levels of angiotensin II [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], which may have harmful effects on arteries and leading to dysfunction, which could be facilitated by the activation of NOX2 through the generation of ROS and subsequent damage to the endothelium [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Researchers shown that angiotensin II can exacerbate vascular diseases by inducing inflammatory alterations in the endothelial lining of arteries, promoting infiltration of monocytes, and ultimately causing vascular dysfunction through NOX2-mediated oxidative stress [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Elevated production of ROS related to NOX2 could have a detrimental impact on the availability of NO in ECs by either deactivating eNOS or increasing the consumption of NO due to elevated levels of superoxide, which can have negative effects on the antioxidant properties [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Various factors may play a role in the increase of microvascular endothelial NOX2 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. These factors may include the elevated levels of pro-inflammatory cytokines commonly seen in cases of COVID-19 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Violi et al. were the first to discover the connection between COVID-19 and NOX2-induced oxidative stress [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Similarly, Jiang et al. research revealed elevated levels of NOX2 in COVID-19 patients [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Additionally, a study was conducted to determine the impact of IL-6 on NOX-dependent oxidative stress in ECs, which involved treating bovine aortic endothelial cells with IL-6 and analyzing the expression of NOX isoforms (NOX1, NOX2, and NOX4) using Western blot [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. According to their findings, exposing BAECs to IL-6 led to an increase in NOX2 levels, but not NOX1 or NOX4 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Additionally, their study showed that the S protein of the SARS-CoV-2 virus notably enhanced the expression of NOX2 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOxidative stress is recognized as a contributing factor to the development of COVID-19 [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], and a lack of protection against oxidative stress-related cellular harm is a key factor in the impairment of endothelial function in various pathological states [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Nrf2 is crucial in safeguarding cells against oxidative stress, as it is particularly responsive to oxidative stress [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], and interacts with antioxidant response elements in the cell nucleus, facilitating the activation of numerous antioxidant genes [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Nrf2 is typically maintained in an inactive state within the cytosol through its interaction with the inhibitor protein KEAP1, which facilitates the proteasomal degradation of Nrf2 [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In response to oxidative stress, KEAP1 is inactivated and allowing Nrf2 to activate genes that protect against stress-induced cell death [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Nrf2 is considered a crucial controller of tissue damage during infection due to its ability to regulate genes that offer protection against stress [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Additionally, recent research has revealed that Nrf2 plays a significant role in modulating the inflammatory response by acting as a transcriptional repressor of inflammatory genes [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Nrf2 suppresses the activation of NF-κB mediated by oxidative stress by reducing levels of intracellular ROS [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In addition, it is possible that Nrf2 may act as a regulatory factor impacting the expression of cell adhesion molecules [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. For example, the plant-derived antioxidant 3-hydroxyanthranilic acid, has been shown to increase HO-1 expression and decrease both VCAM-1 expression and NF-kB activation by facilitating Nrf2 movement to reduce inflammation in atherosclerosis [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Conversely, research on vascular inflammation and atherosclerosis models has found that activated Nrf2 can prevent the pro-inflammatory state of vascular ECs by inhibiting the p38-VCAM-1 signaling pathway [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Deficiency in the expression of the Nrf2 target gene Molecular and Cellular Biochemistry (G6PDH) has been linked to heightened production of ROS and increased viral gene expression and particle production in human coronavirus, typically associated with the common cold and respiratory conditions [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Importantly, research indicates that the Nrf2 pathway is inhibited in lung samples from COVID-19 patients; on the other hand, pharmaceutical agents that activate Nrf2 have been shown to hinder the replication of SARS-CoV2 and reduce the inflammatory reaction [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAccessory proteins of the coronavirus are a group of proteins that have their genes dispersed among or within the genes that encode structural proteins [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. For example, ORF3a protein is exclusive to both SARS-CoV and SARS-CoV-2, playing various essential roles in viral pathogenicity [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Research has shown that the distinct functional components of ORF3a in SARS-CoV-2 are linked to its ability to influence virulence, infectivity, and the release of the virus [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. In studies involving animals infected with SARS-CoV-2, the absence of ORF3a gene resulted in a lower cytokine storm, decreased virus infection, and less tissue damage in the lungs [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. The induction of various types of cell death by ORF3a results in tissue damage that impacts the progression of COVID-19 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Overall, Nrf2 and the genes under its control defend against cell death caused by stress and manage the body's response to inflammation and tissue damage during infections [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. When conditions are normal, Nrf2 within the cytoplasm binds with a protein called Keap1, which acts as a negative regulator and leads to Nrf2's degradation through ubiquitination and the proteasome [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Redox products deactivate Keap1 by altering certain sensor cysteine residues, causing it to separate from Nrf2 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Subsequently, Nrf2 moves into the nucleus to trigger the body's antioxidant defenses [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Research has shown that the Nrf2 pathway is suppressed in lung samples from COVID-19 patients [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Additionally, a pharmaceutical agent that activates Nrf2 has been found to hinder the replication of SARS-CoV-2 and reduce inflammation [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Typically, ORF3a functions as a molecular linker, by interacting with Keap1 and facilitating its recruitment to Nrf2, resulting in the degradation of Nrf2 by the proteasome [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. This degradation of Nrf2 decreases the cellular antioxidant capacity and renders cells more susceptible to ferroptosis [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Liu and colleagues discovered that ORF3a, a unique accessory protein present in both SARS and SARS-CoV-2 coronaviruses, promotes cell sensitivity to ferroptosis through the Keap1-NRF2 axis [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. They found that ORF3a induces the breakdown of Nrf2 by enlisting Keap1, resulting in increased levels of lipid ROS and ultimately triggering ferroptosis[\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Additionally, the SARS-CoV-2 virus has the potential to disrupt the balance between the NF-κb transcription factor, which regulates cytokine expression, and Nrf2 activation, which controls antioxidant enzyme production [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Nrf2 deficiency could potentially account for the tissue damage associated with COVID-19 [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Furthermore, research conducted by Olagnier et al. reveals that the activity of Nrf2-dependent genes is inhibited in biopsies taken from COVID-19 patients, and that the administration of Nrf2 agonists 4-OI and DMF to cells triggers a robust antiviral response that hinders the replication of SARS-CoV2 [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Additionally, orally administering EGCG, an activator of Nrf2, enhanced survival rates by reducing the incidence of viral pneumonia in the lungs caused by decreased entry and replication of the virus[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe continued developments in our knowledge of the pathophysiology of COVID-19 have been essential for improving the treatment of SARS-Cov2 infection. Unlike other respiratory illnesses, our study highlighted the significant role of ED in the development of severe COVID-19. These findings are crucial for understanding the complexities of this multi-organ disease and can aid in patient care and treatment. The study has some limitations, the sample size could be more and finding eligible control group was rare. However, due to the global impact of the pandemic, further well-designed studies are urgently required to apply this information in clinical practice.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e \u003cp\u003eThe Medical Ethics Committee of Mashhad University of Medical Sciences, Mashhad, Iran (IR.MUMS.MEDICAL.REC.1401.500) approved and oversaw this study. All procedures were carried out meticulously following relevant guidelines. This case-control study was performed during April 2021 to May 2021 for Alpha wave and November 2021 to February 2022 for Omicron wave of COVID-19 pandemic in Iran (Heydarifard, Shafiei-Jandaghi, Safaei, Tavakoli, \u0026amp; Shatizadeh Malekshahi, 2023). The study involved obtaining of BAL, which was part of the left-over samples and approved by the local Ethics Committee under the restrictions of the Declaration of Helsinki, from COVID-19 patients in the ICU, and outpatients in the bronchoscopy department at Ghaem Hospitals of Mashhad, Iran.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eAuthorship contribution statement\u003c/h2\u003e \u003cp\u003eS.A.R and S.N. designed the study. A.H.A and A.Sh. sampled patients. Z.A. and F.S.M. performed the experiments. S.A.R, M.M. and S.N. supervised experiments. Z.A. and F.S.M. analyzed and interpreted data. Z.A., S.N. and S.A.R wrote the first drafts of the original and revised manuscripts. All authors critically read and revised the manuscript.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eDeclaration of competing interest\u003c/h2\u003e \u003cp\u003eNo conflicts of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by research Affairs of Mashhad University of Medical Sciences, Mashhad, Iran for their financial support (grant number 89145). Author S.N. has received research support.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eS.A.R and S.N. designed the study. A.H.A and A.Sh. sampled patients. Z.A. and F.S.M. performed the experiments. S.A.R, M.M. and S.N. supervised experiments. Z.A. and F.S.M. analyzed and interpreted data. Z.A., S.N. and S.A.R wrote the first drafts of the original and revised manuscripts. All authors critically read and revised the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eWe would like to thank Mashhad University of Medical Sciences, Mashhad, Iran for their financial support.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eV.O.J.F.E.I.T. The-nCo Q, Li (2020) An Outbreak of NCIP (2019-nCoV) Infection in China - Wuhan, Hubei Province, 2019\u0026ndash;2020, China CDC weekly. 2 79\u0026ndash;80\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu SW, Ilyas I, Weng JP (2023) Endothelial dysfunction in COVID-19: an overview of evidence, biomarkers, mechanisms and potential therapies. Acta Pharmacol Sin 44:695\u0026ndash;709. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41401-022-00998-0\u003c/span\u003e\u003cspan address=\"10.1038/s41401-022-00998-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharifkashani S, Bafrani MA, Khaboushan AS, Pirzadeh M, Kheirandish A, Yavarpour Bali H, Hessami A, Saghazadeh A, Rezaei N (2020) Angiotensin-converting enzyme 2 (ACE2) receptor and SARS-CoV-2: Potential therapeutic targeting. Eur J Pharmacol 884:173455. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejphar.2020.173455\u003c/span\u003e\u003cspan address=\"10.1016/j.ejphar.2020.173455\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuertas A, Montani D, Savale L, Pichon J, Tu L, Parent F, Guignabert C, Humbert M (2020) Endothelial cell dysfunction: a major player in SARS-CoV-2 infection (COVID-19)? Eur Respir J 56. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1183/13993003.01634-2020\u003c/span\u003e\u003cspan address=\"10.1183/13993003.01634-2020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGavriilaki E, Anyfanti P, Gavriilaki M, Lazaridis A, Douma S, Gkaliagkousi E (2020) Endothelial Dysfunction in COVID-19: Lessons Learned from Coronaviruses. Curr Hypertens Rep 22:63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11906-020-01078-6\u003c/span\u003e\u003cspan address=\"10.1007/s11906-020-01078-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEndemann DH, Schiffrin EL (2004) Endothelial dysfunction. J Am Soc Nephrol 15:1983\u0026ndash;1992\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAktan F (2004) iNOS-mediated nitric oxide production and its regulation. Life Sci 75:639\u0026ndash;653. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.lfs.2003.10.042\u003c/span\u003e\u003cspan address=\"10.1016/j.lfs.2003.10.042\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue Q, Yan Y, Zhang R, Xiong H (2018) Regulation of iNOS on Immune Cells and Its Role in Diseases. Int J Mol Sci 19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms19123805\u003c/span\u003e\u003cspan address=\"10.3390/ijms19123805\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarren MR, Ashcraft M, Qian Y, Douglass M, Brisbois EJ, Handa H (2021) Nitric oxide and viral infection: Recent developments in antiviral therapies and platforms. Appl Mater today 22:100887\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIncalza MA, D'Oria R, Natalicchio A, Perrini S, Laviola L, Giorgino F (2018) Oxidative stress and reactive oxygen species in endothelial dysfunction associated with cardiovascular and metabolic diseases. Vascul Pharmacol 100:1\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.vph.2017.05.005\u003c/span\u003e\u003cspan address=\"10.1016/j.vph.2017.05.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKessel C, Vollenberg R, Masjosthusmann K, Hinze C, Wittkowski H, Debaugnies F, Nagant C, Corazza F, Vely F, Kaplanski G, Girard-Guyonvarc'h C, Gabay C, Schmidt H, Foell D, Tepasse PR (2021) Discrimination of COVID-19 From Inflammation-Induced Cytokine Storm Syndromes Using Disease-Related Blood Biomarkers. Arthritis Rheumatol 73:1791\u0026ndash;1799. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/art.41763\u003c/span\u003e\u003cspan address=\"10.1002/art.41763\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMancini I, Baronciani L, Artoni A, Colpani P, Biganzoli M, Cozzi G, Novembrino C, Boscolo Anzoletti M, De Zan V, Pagliari MT, Gualtierotti R, Aliberti S, Panigada M, Grasselli G, Blasi F, Peyvandi F (2021) The ADAMTS13-von Willebrand factor axis in COVID-19 patients. J Thromb Haemost 19:513\u0026ndash;521. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jth.15191\u003c/span\u003e\u003cspan address=\"10.1111/jth.15191\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChernyak BV, Popova EN, Prikhodko AS, Grebenchikov OA, Zinovkina LA, Zinovkin RA (2020) COVID-19 and Oxidative Stress, Biochemistry (Mosc). 85:1543\u0026ndash;1553. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1134/S0006297920120068\u003c/span\u003e\u003cspan address=\"10.1134/S0006297920120068\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Lorenzo A, Escobar S, Tibirica E (2020) Systemic endothelial dysfunction: A common pathway for COVID-19, cardiovascular and metabolic diseases. Nutr Metab Cardiovasc Dis 30:1401\u0026ndash;1402. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.numecd.2020.05.007\u003c/span\u003e\u003cspan address=\"10.1016/j.numecd.2020.05.007\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Vliet A, Eiserich JP, Shigenaga MK, Cross CE (1999) Reactive nitrogen species and tyrosine nitration in the respiratory tract: epiphenomena or a pathobiologic mechanism of disease? Am J Respir Crit Care Med 160:1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1164/ajrccm.160.1.9807044\u003c/span\u003e\u003cspan address=\"10.1164/ajrccm.160.1.9807044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Q, Xu L, Zhu W, Ge J (2020) Cardiovascular manifestations in severe and critical patients with COVID-19. Clin Cardiol 43:1054. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/clc.23422\u003c/span\u003e\u003cspan address=\"10.1002/clc.23422\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiNicolantonio JJ, McCarty M (2020) Thrombotic complications of COVID-19 may reflect an upregulation of endothelial tissue factor expression that is contingent on activation of endosomal NADPH oxidase. Open Heart 7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1136/openhrt-2020-001337\u003c/span\u003e\u003cspan address=\"10.1136/openhrt-2020-001337\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuhail S, Zajac J, Fossum C, Lowater H, McCracken C, Severson N, Laatsch B, Narkiewicz-Jodko A, Johnson B, Liebau J, Bhattacharyya S, Hati S (2020) Role of Oxidative Stress on SARS-CoV (SARS) and SARS-CoV-2 (COVID-19) Infection: A Review. Protein J 39:644\u0026ndash;656. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10930-020-09935-8\u003c/span\u003e\u003cspan address=\"10.1007/s10930-020-09935-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaspar JW, Niture SK, Jaiswal AK (2009) Nrf2:INrf2 (Keap1) signaling in oxidative stress. Free Radic Biol Med 47:1304\u0026ndash;1309. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.freeradbiomed.2009.07.035\u003c/span\u003e\u003cspan address=\"10.1016/j.freeradbiomed.2009.07.035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl-Kuraishy HM, Al-Gareeb AI, Eldahshan OA, Abdelkhalek YM, El Dahshan M, Ahmed EA, Sabatier JM, Batiha GE (2024) The possible role of nuclear factor erythroid-2-related factor 2 activators in the management of Covid-19. J Biochem Mol Toxicol 38:e23605. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jbt.23605\u003c/span\u003e\u003cspan address=\"10.1002/jbt.23605\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeydarifard Z, Shafiei-Jandaghi NZ, Safaei M, Tavakoli F, Shatizadeh S, Malekshahi (2023) Comparison of clinical outcomes, demographic, and laboratory characteristics of hospitalized COVID-19 patients during major three waves driven by Alpha, Delta, and Omicron variants in Tehran, Iran, Influenza Other Respir Viruses. 17:e13184. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/irv.13184\u003c/span\u003e\u003cspan address=\"10.1111/irv.13184\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBafadam S, Mahmoudabady M, Niazmand S, Rezaee SA, Soukhtanloo M (2021) Cardioprotective effects of Fenugreek (Trigonella foenum-graceum) seed extract in streptozotocin induced diabetic rats. J Cardiovasc Thorac Res 13:28\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.34172/jcvtr.2021.01\u003c/span\u003e\u003cspan address=\"10.34172/jcvtr.2021.01\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahmoudabady M, Niazmand S, Shafei MN, McEntee K (2013) Investigation of apoptosis in a canine model of chronic heart failure induced by tachycardia. Acta Physiol Hung 100:435\u0026ndash;444. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1556/APhysiol.100.2013.4.8\u003c/span\u003e\u003cspan address=\"10.1556/APhysiol.100.2013.4.8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTong M, Jiang Y, Xia D, Xiong Y, Zheng Q, Chen F, Zou L, Xiao W, Zhu Y (2020) Elevated Expression of Serum Endothelial Cell Adhesion Molecules in COVID-19 Patients. J Infect Dis 222:894\u0026ndash;898. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/infdis/jiaa349\u003c/span\u003e\u003cspan address=\"10.1093/infdis/jiaa349\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith-Norowitz TA, Loeffler J, Norowitz YM, Kohlhoff S (2021) Intracellular Adhesion Molecule-1 (ICAM-1) Levels in Convalescent COVID-19 Serum: A Case Report. Ann Clin Lab Sci 51:730\u0026ndash;734\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang RC, Huang K, Zhang HP, Li L, Zhang YF, Tan C, Chen HC, Jin ML, Wang XR (2022) SARS-CoV-2 productively infects human brain microvascular endothelial cells. J Neuroinflammation 19:149. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12974-022-02514-x\u003c/span\u003e\u003cspan address=\"10.1186/s12974-022-02514-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRuggeri ZM (2007) The role of von Willebrand factor in thrombus formation. Thromb Res 120 Suppl 1\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.thromres.2007.03.011\u003c/span\u003e\u003cspan address=\"10.1016/j.thromres.2007.03.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. S5-9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLadikou EE, Sivaloganathan H, Milne KM, Arter WE, Ramasamy R, Saad R, Stoneham SM, Philips B, Eziefula AC, Chevassut T (2020) Von Willebrand factor (vWF): marker of endothelial damage and thrombotic risk in COVID-19? Clin Med (Lond) 20:e178\u0026ndash;e182. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7861/clinmed.2020-0346\u003c/span\u003e\u003cspan address=\"10.7861/clinmed.2020-0346\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoun JY, Zhang Y, Wu Y, Cannesson M, Cai H (2021) Therapeutic application of estrogen for COVID-19: Attenuation of SARS-CoV-2 spike protein and IL-6 stimulated, ACE2-dependent NOX2 activation, ROS production and MCP-1 upregulation in endothelial cells. Redox Biol 46:102099. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.redox.2021.102099\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2021.102099\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJud P, Gressenberger P, Muster V, Avian A, Meinitzer A, Strohmaier H, Sourij H, Raggam RB, Stradner MH, Demel U, Kessler HH, Eller K, Brodmann M (2021) Evaluation of Endothelial Dysfunction and Inflammatory Vasculopathy After SARS-CoV-2 Infection-A Cross-Sectional Study. Front Cardiovasc Med 8:750887. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fcvm.2021.750887\u003c/span\u003e\u003cspan address=\"10.3389/fcvm.2021.750887\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarilli A, Recchia Luciani G, Visigalli R, Sala R, Soli M, Dall'Asta V, Rotoli BM (2023) Cytokine-Induced iNOS in A549 Alveolar Epithelial Cells: A Potential Role in COVID-19 Lung Pathology, Biomedicines. 11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/biomedicines11102699\u003c/span\u003e\u003cspan address=\"10.3390/biomedicines11102699\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGelzo M, Scialo F, Cacciapuoti S, Pinchera B, De Rosa A, Cernera G, Comegna M, Tripodi L, Schiano Moriello N, Mormile M, Fabbrocini G, Parrella R, Corso G, Gentile I, Castaldo G (2022) Inducible Nitric Oxide Synthase (iNOS): Why a Different Production in COVID-19 Patients of the Two Waves? Viruses 14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/v14030534\u003c/span\u003e\u003cspan address=\"10.3390/v14030534\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarki R, Sharma BR, Tuladhar S, Williams EP, Zalduondo L, Samir P, Zheng M, Sundaram B, Banoth B, Malireddi RKS, Schreiner P, Neale G, Vogel P, Webby R, Jonsson CB, Kanneganti TD (2021) Synergism of TNF-alpha and IFN-gamma Triggers Inflammatory Cell Death, Tissue Damage, and Mortality in SARS-CoV-2 Infection and Cytokine Shock Syndromes. Cell 184:149\u0026ndash;168e117. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2020.11.025\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2020.11.025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSukumar P, Viswambharan H, Imrie H, Cubbon RM, Yuldasheva N, Gage M, Galloway S, Skromna A, Kandavelu P, Santos CX, Gatenby VK, Smith J, Beech DJ, Wheatcroft SB, Channon KM, Shah AM, Kearney MT (2013) Nox2 NADPH oxidase has a critical role in insulin resistance-related endothelial cell dysfunction. Diabetes 62:2130\u0026ndash;2134. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.2337/db12-1294\u003c/span\u003e\u003cspan address=\"10.2337/db12-1294\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVioli F, Oliva A, Cangemi R, Ceccarelli G, Pignatelli P, Carnevale R, Cammisotto V, Lichtner M, Alessandri F, De Angelis M, Miele MC, D'Ettorre G, Ruberto F, Venditti M, Pugliese F, Mastroianni CM (2020) Nox2 activation in Covid-19, Redox Biol. 36:101655. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.redox.2020.101655\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2020.101655\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Z, Wu L, van der Leeden B, van Rossum AC, Niessen HWM, Krijnen PAJ (2023) NOX2 and NOX5 are increased in cardiac microvascular endothelium of deceased COVID-19 patients. Int J Cardiol 370:454\u0026ndash;462. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ijcard.2022.10.172\u003c/span\u003e\u003cspan address=\"10.1016/j.ijcard.2022.10.172\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCecchini R, Cecchini AL (2020) SARS-CoV-2 infection pathogenesis is related to oxidative stress as a response to aggression. Med Hypotheses 143:110102. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.mehy.2020.110102\u003c/span\u003e\u003cspan address=\"10.1016/j.mehy.2020.110102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen B, Lu Y, Chen Y, Cheng J (2015) The role of Nrf2 in oxidative stress-induced endothelial injuries. J Endocrinol 225:R83\u0026ndash;99. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1530/JOE-14-0662\u003c/span\u003e\u003cspan address=\"10.1530/JOE-14-0662\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGumus H, Erat T, Ozturk I, Demir A, Koyuncu I (2022) Oxidative stress and decreased Nrf2 level in pediatric patients with COVID-19. J Med Virol 94:2259\u0026ndash;2264. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jmv.27640\u003c/span\u003e\u003cspan address=\"10.1002/jmv.27640\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOlagnier D, Farahani E, Thyrsted J, Blay-Cadanet J, Herengt A, Idorn M, Hait A, Hernaez B, Knudsen A, Iversen MB, Schilling M, Jorgensen SE, Thomsen M, Reinert LS, Lappe M, Hoang HD, Gilchrist VH, Hansen AL, Ottosen R, Nielsen CG, Moller C, van der Horst D, Peri S, Balachandran S, Huang J, Jakobsen M, Svenningsen EB, Poulsen TB, Bartsch L, Thielke AL, Luo Y, Alain T, Rehwinkel J, Alcami A, Hiscott J, Mogensen TH, Paludan SR, Holm CK (2020) SARS-CoV2-mediated suppression of NRF2-signaling reveals potent antiviral and anti-inflammatory activity of 4-octyl-itaconate and dimethyl fumarate. Nat Commun 11:4938. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-020-18764-3\u003c/span\u003e\u003cspan address=\"10.1038/s41467-020-18764-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaha S, Buttari B, Panieri E, Profumo E, Saso L (2020) An Overview of Nrf2 Signaling Pathway and Its Role in Inflammation. Molecules 25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/molecules25225474\u003c/span\u003e\u003cspan address=\"10.3390/molecules25225474\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCuadrado A, Pajares M, Benito C, Jimenez-Villegas J, Escoll M, Fernandez-Gines R, Garcia Yague AJ, Lastra D, Manda G, Rojo AI (2020) Dinkova-Kostova, Can Activation of NRF2 Be a Strategy against COVID-19? Trends Pharmacol Sci 41:598\u0026ndash;610. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tips.2020.07.003\u003c/span\u003e\u003cspan address=\"10.1016/j.tips.2020.07.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu L, Du J, Yang S, Zheng B, Shen J, Huang J, Cao L, Huang S, Liu X, Guo L, Li C, Ke C, Peng X, Guo D, Peng H (2023) SARS-CoV-2 ORF3a sensitizes cells to ferroptosis via Keap1-NRF2 axis. Redox Biol 63:102752. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.redox.2023.102752\u003c/span\u003e\u003cspan address=\"10.1016/j.redox.2023.102752\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHassan SM, Jawad MJ, Ahjel SW, Singh RB, Singh J, Awad SM, Hadi NR (2020) The Nrf2 Activator (DMF) and Covid-19: Is there a Possible Role? Med Arch 74:134\u0026ndash;138. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5455/medarh.2020.74.134-138\u003c/span\u003e\u003cspan address=\"10.5455/medarh.2020.74.134-138\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"SARS-CoV-2, COVID-19, Endothelial dysfunction, Inflammation, Oxidative stress, iNOS","lastPublishedDoi":"10.21203/rs.3.rs-4942103/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4942103/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEndothelium play a crucial role in immune responses and inflammatory reactions. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) induces an exaggerated immune response. Therefore, in this study the roles of endothelium in the manifestation of sever Coronavirus disease 2019 (COVID-19) was investigated. The direct effects of SARS-CoV-2 alpha (SCA) and SARS-CoV-2 omicron (SCO), on endothelial function were investigated in bronchoalveolar lavage (BAL), that were obtained by leftover samples of Covid-19 patients who were compared to forty control group to enrich genes and proteins expression of Intracellular Adhesion Molecule-1 (ICAM-1), Vascular cell adhesion molecules 1 (VCAM-1), Nuclear factor erythroid 2\u0026ndash;related factor 2 (Nrf2), NADPH oxidase 2 (NOX2), von Willebrand factor (vWF) and Inducible nitric oxide synthases (iNOS). SARS-CoV-2 increased gene and protein expression of ICAM-1. SCA and SCO increase VCAM-1 gene expression. VCAM-1 protein expression in SCO increased too. vWF gene expression increased in SCO. vWF protein expressed highly too. SCO group showed a significant increase in iNOS gene expression. Although, NOX2 gene increased by SCA and SCO and its protein increased too, Nrf2 gene and protein decreased by SARS-CoV-2. Based on our findings, severe COVID-19 can cause damage to vascular endothelium, which is crucial in affecting multiple organ dysfunction. Our research indicates that endothelial dysfunction is a significant factor in the progression of severe COVID-19 in comparison to other respiratory diseases.\u003c/p\u003e","manuscriptTitle":"Endothelial dysfunction in COVID-19: Insights from bronchoalveolar lavage and molecular markers","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-16 13:27:32","doi":"10.21203/rs.3.rs-4942103/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"238c2836-ab10-4e4b-9d74-9f559b7ca700","owner":[],"postedDate":"October 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-11-04T04:08:47+00:00","versionOfRecord":[],"versionCreatedAt":"2024-10-16 13:27:32","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4942103","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4942103","identity":"rs-4942103","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.