Chemokine receptor 1 pathway mediagtes the progression of airway inflammation in a smoking-induced chronic obstructive pulmonary disease mouse model

Chemokine receptor 1 pathway mediagtes the progression of airway inflammation in a smoking-induced chronic obstructive pulmonary disease mouse model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Chemokine receptor 1 pathway mediagtes the progression of airway inflammation in a smoking-induced chronic obstructive pulmonary disease mouse model Kaishun Zhao, Ran Dong, Wei Wei, Suzhen Ju, Chunlin Tu, Yanfang Yu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4383943/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract To investigate the role of chemokine receptor 1 (CCR1) and mechanisms underlying airway inflammation in smoking-related chronic obstructive pulmonary disease (COPD), we established a mouse model of smoking-induced COPD. Pathological changes in the bronchial mucosa were assessed using hematoxylin and eosin staining, CCR1 expression and cell apoptosis were detected via immunofluorescence and TUNEL, and the expression of the CCR1 downstream pathway was detected via real-time quantitative PCR and western blotting. The expression of the chemokine MIP-1β and the inflammatory factors IL-6 and TNF-α in bronchoalveolar lavage fluid was detected using enzyme-linked immunosorbent assays. The bronchial mucosa of the COPD model mice transfected with the vector showed apoptosis, inflammatory cell infiltration, airway remodeling, and emphysema. Furthermore, the COPD model mice exhibited significantly increased CCR1 signaling and chemokine concentrations, which were further aggravated by overexpressed-CCR1 lentiviral transfection but inhibited by shRNA-CCR1 lentiviral transfection or BX471 pretreatment. These results, combined with our previous findings, elucidate the role of and mechanisms underlying CCR1 signaling in the progression of COPD, both in vivo and in vitro. This study has the potential to provide theoretical evidence for the diagnosis and therapeutic strategies of cigarette smoke-induced inflammation in COPD patients. Chemokine receptor 1 (CCR1) Chronic obstructive pulmonary disease (COPD) Bronchial mucosa Inflammation Mouse model shRNA-CCR1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION Chronic obstructive pulmonary disease (COPD) is a major public health concern that causes morbidity and mortality and a substantial economic burden [ 1 , 2 ] . COPD is characterized by irreversible airflow limitation and persistent respiratory symptoms [ 3 , 4 ] . Smoking, which is the primary risk factor for COPD, elicits abnormal inflammatory responses including airway remodeling, emphysema, acceleration of lung function decline, airflow limitation, and chronic respiratory symptoms that are difficult to reverse and may periodically manifest as exacerbations [ 5 , 6 ] . C-C chemokine receptor 1 (CCR1) is expressed in the eosinophils, macrophages, dendritic cells, neutrophils, and natural killer T cells [ 7 ] . Previous studies have reported that CCR1 contains ligands such as MIP-1α/β, RANTES, and MCP-3, which are upregulated in patients with COPD [ 8 – 10 ] . CCR1 ligands play a key role in the pathogenesis of COPD, indicating that CCR1 is a potentially promising target in developing therapies for COPD. We previously reported that CCR1 plays a critical role in smoking-induced inflammation via regulating the JAK/STAT/NF-κB signaling in vitro . In the present study, to elucidate the mechanisms underlying CCR1 signaling and its role in the progression of COPD, we investigated CCR1 expression and chemokine levels in an animal model of COPD that either overexpressed CCR1 or displayed deficient expression. MATERIALS AND METHODS Reagents All chemicals (except for the antibodies and antagonists) were purchased from Sigma-Aldrich (St. Louis, MO, USA). The CCR1 antagonist BX417 was purchased from Enzo Life Sciences (Farmingdale, NY, USA). Mouse anti-rabbit IgG monoclonal antibodies (HRP- or FITC-conjugated) and goat anti-mouse IgG monoclonal antibodies (HRP-conjugated) were purchased from Abcam (Cambridge, MA, USA). Primary antibodies against CCR1, JAK2, MIP-1β, RANTES, STAT3, NF-κB p65, TLR4 IKK, and β-actin were purchased from Cell Signaling Technology (Beverly, MA, USA). CCR1-overexpressing and shRNA-CCR1 lentiviruses were purchased from Ambion (Life Technology, Foster City, CA, USA). Animals SPF male BALB/c mice (18–22 g) were obtained from Jiesijie Laboratory Animal Center (Shanghai, China), quarantined at the Animal Experimental Center of Jiading Central Hospital, Shanghai, China, maintained at 22°C ± 2°C and 50% ± 20% humidity with a 12:12 h light–dark cycle, and allowed free access to water and standard food for ≥ 1 week before the experiments. All procedures were approved by the Ethics Committee for the Care and Use of Laboratory Animals of Jiading Central Hospital and were conducted in strict accordance with the principles and guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Experimental design and the COPD model After a week of adaptive feeding, the mice were randomly classified into five groups: normal mice (control group, n = 10), COPD model mice transfected with the CCR1 vector (COPD + Vector, n = 10), COPD model mice transfected with CCR1-overexpressing lentivirus (COPD + CCR1 +/+ , n = 10), COPD model mice transfected with shRNA-CCR1 lentivirus (COPD + CCR1 −/− , n = 10), and COPD model mice treated with the CCR1 antagonist BX 471 (30 mg/kg) (COPD + BX 471, n = 10). To establish a COPD model, smoking was combined with intratracheal injection of LPS over 28 days, which was considered the model establishment period. The COPD model mice were placed in a fumigation box prepared in advance, a lit cigarette was placed on one side of the smoke inlet hole, and a suction pump on the other side ensured that the mice smoked passively. The model mice were anesthetized via intraperitoneal injection of 10% chloral hydrate (3.5 mL/kg), and LPS (30 µg/6 µL) was injected into the trachea on the 1st and 14th days. Exposure to cigarette smoke occurred from the 2nd to the 28th day, except for the 14th day, as smoking was suspended on the day of LPS infusion. Smoke exposure occurred once a day, and each mouse was exposed to one cigarette for 1 h. On the first day after the establishment of the model, the model group was injected with approximately 100 µL of the vector, CCR1-overexpressing lentivirus, or shRNA-CCR1 lentivirus (5×10^8 TU/mL) through the tail vein. The control group was injected with an equal volume of saline. Specimen processing On the 28th day, the animals were euthanized with an overdose of pentobarbital and placed in a supine position. The trachea was exposed via a midline incision in the neck and cannulated with a polyethylene tube (inner diameter 0.2 mm, length 1 cm). Bronchoalveolar lavage fluid (BALF) was collected by slowly injecting 0.8 mL of sterile pre-cooled phosphate-buffered saline (PBS) into the lungs, followed by withdrawal via an intratracheal cannula with gentle suction. The collected material was immediately centrifuged at 3000 rpm (4°C, 10 min) (Thermo Fisher, Waltham, MA, USA). Cell-free supernatants were stored at -80°C prior to analysis. Immediately after BALF collection, the lungs and bronchia were excised and fixed overnight in 4% paraformaldehyde at 4°C. Samples of the lungs and bronchia were embedded in paraffin. The tissue was then sliced into 5-mm thick sections for hematoxylin and eosin (HE) staining and observed using an Olympus light microscope. The remaining lung tissues were frozen using OCT and coronally sliced into 40-mm sections using a freezing microtome (CM1520; Leica Biosystems, Shanghai, China) for immunohistochemistry and immunofluorescence, respectively. Detection of IL-6, IFN-β, TNF-α, and MIP-1β in BALF The concentrations of IL-6, IFN-β, TNF-α, and MIP-1β in BALF were determined in duplicate via enzyme-linked immunosorbent assays (ELISAs) using DuoSet ELISA kits (R&D System, Minneapolis, MN, USA), in accordance with the manufacturer’s instructions. Western blotting Lung tissue samples (100 mg each) were ground and lysed in 1 mL of pyrolysis liquid. Protein concentrations in a 20-µL aliquot were measured using a bicinchoninic acid assay kit (Thermo Fisher, Waltham, MA, USA), in accordance with the manufacturer’s protocol. Equal amounts of protein (30 µg) were subjected to 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis at 80 V for 30 min and then at 120 V for 1 h. Subsequently, the proteins were transferred onto polyvinylidene fluoride membranes (Millipore, Burlington, MA, USA); blocked with 5% nonfat milk in PBS (2 h, 25°C); and incubated overnight at 4℃ with the following mouse monoclonal antibodies: GAPDH (1:1000), MIP-1β (1:1000), RANTES (1:500), CCR1 (1:500), p65 (1:1000), p-p65 (1:1000), p-IKK (1:1000), IKK (1:1000), STAT3 (1:1000), p-JAK2 (1:1000), or JAK2 (1:1000). All antibodies were purchased from Abcam. The samples were then washed with Tris-buffered saline and Tween 20 (thrice, for 5 min each) and incubated with HRP-conjugated goat anti-mouse IgG antibody (1:5000, for 1 h at room temperature). Thereafter, 1 mL of chemiluminescent substrate (Thermo Fisher) was added, and signals were detected and quantified using an enhanced chemiluminescence system (Image Quant LAS-4000 MINI; GE Healthcare Bio-Sciences, Pittsburgh, PA, USA). RNA extraction and fluorescent real-time quantitative PCR (RT-qPCR) Total RNA was extracted from the lung tissues using TRIzol reagent (Invitrogen, Waltham, MA, USA), in accordance with the manufacturer’s instructions. Single-stranded cDNA was synthesized using oligo (dT) primers and a RevertAid First Strand cDNA Synthesis Kit (Invitrogen) according to the manufacturer’s protocol. cDNA synthesized from 500 ng of total RNA was analyzed in a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using FastStart Universal SYBR Green (Roche, Indianapolis, IN, USA). The PCR conditions were as follows: initial denaturation at 50°C for 2 min and 95°C for 10 min, followed by 40 cycles of 95°C for 30 s and 60°C for 30 s. Fold-changes in gene expression were calculated using the 2 −ΔΔCt method relative to the expression of the internal reference gene GAPDH. The mouse primers used are listed in Table 1 . Table 1 The mouse gene primers sequence. A Primer Sequence Size Mus GAPDH Forward 5'- ATGGGTGTGAACCACGAGA − 3' 229 bp Reverse 5'- CAGGGATGATGTTCTGGGCA − 3' MusCCR1 Forward 5'- AGTGAGAAGAAGGTCAAAGCCG − 3' 316 bp Reverse 5'- GTTGGTCCACAGAGAGGAAGGG − 3' Mus NF-kB P65 Forward 5'- CACCGGATTGAAGAGAAGCG − 3' 194 bp Reverse 5'- AAGTTGATGGTGCTGAGGGA-3' MusJAK2 Forward 5'- AGTGGCGGCATGATTTTGTT − 3' 181 bp Reverse 5'-GCTCGAACGCACTTTGGTAA − 3' MusSTAT3 Forward 5'-GACCCGCCAACAAATTAAGA − 3' 215 bp Reverse 5'- TCGTGGTAAACTGGACACCA − 3' Mus RANTES Forward 5'-TGCTGCTTTGCCTACCTCTC-3' 150 bp Reverse 5'-TTGAACCCACTTCTTCTCTG-3' Mus MIP-1β Forward 5'-CCTTACCCTGCTGAGTGACA-3' 201 bp Reverse 5'-AGGTATTGCAGAGTCCCCAC-3' Mus IKK Forward 5'- CCTCTCTCTCCTCTTGCTCG-3' 197 bp Reverse 5'-TCTGTCTGCCTCTTTTGGTCA-3' Immunofluorescence and laser-scanning confocal microscopy Frozen tracheal tissue was cut into 4-µm sections on a freezing microtome, maintained at room temperature for 30 min, washed thrice (5 min for each wash) with PBS, and incubated with 3% hydrogen peroxide (5–10 min) to eliminate endogenous peroxidase activity. The sections were then washed twice with PBS (5 min for each wash) and incubated with blocking solution (10% goat serum) for 1 h, followed by incubation with mouse monoclonal anti-CCR1 receptor antibody (Abcam, 1:1000) for 30 min and FITC-conjugated goat anti-mouse IgG antibody (Jackson; 1:5000) for 30 min at 37°C. After nuclear staining with DAPI (1:1000; Thermo Fisher), the sections were observed and analyzed using a laser-scanning confocal microscope (Nikon Eclipse TI; Nikon, Tokyo, Japan). Subsequently, the slides were coded and analyzed by a technician who did not have prior knowledge of the experimental procedures. For each of the five animals in each group, one section was randomly chosen, and five fields were randomly selected from each section. The Image Pro Plus 6.0 system (Media Cybernetics, MD, USA) was used to detect the integral optical density (IOD) of positive sections (red fluorescence) and identify CCR1 in each field within an area of 25 mm 2 . The total area of the region of interest (epithelial layer) in each field and IOD were measured objectively. This software-assisted measurement of the positively stained area containing CCR1 was used to calculate the positive immunostaining (IOD/entire positive area). The average quantitative values of the five fields were used for the statistical analysis. All data from each group were collected simultaneously under the same conditions. Detection of cell apoptosis using TUNEL Fixed lung specimens were embedded in paraffin, and 5-µm-thick sections were prepared, dewaxed in xylene, and rehydrated. Subsequently, 100 drops of Proteinase K (20 µg/mL) were added to each section and maintained at 25–28°C for 20 min, followed by a 60-minute incubation with TdT buffer at 4°C. After three 5-minute washes with PBS and nuclear staining with DAPI (1:1000; Thermo Fisher), the sections were observed and analyzed using a laser-scanning confocal microscope (Nikon Eclipse TI; Nikon) at 400× magnification. Statistical analysis Data are presented as mean ± SD, based on normal distributions, as confirmed by the Shapiro–Wilk test. Comparisons among multiple groups were performed using one-way analysis of variance (ANOVA). Statistical analyses were performed using the GraphPad Prism 7.0 software (GraphPad Software, CA, USA). p < 0.05 was considered significant. RESULTS Histological changes in bronchial mucosa of COPD mice following CCR1 overexpression or interference HE staining revealed histological changes in the bronchial mucosa. Specifically, we detected inflammatory cell infiltration, airway remodeling, and emphysema in COPD model animals following vector transfection compared with the control group (Fig. 1 A-B). Furthermore, aggravation of inflammation and emphysema was observed in COPD model animals after CCR1 overexpression (Fig. 1 C). In contrast, alleviation of inflammation and emphysema was observed in the CCR1-deficient and BX471-treated groups (Fig. 1 D-E). These results indicated that CCR1 deficiency or BX471 treatment could relieve the progression of COPD. Apoptosis in lung tissue of COPD mice following CCR1 overexpression or interference We observed tissue apoptosis in the bronchial mucosa of COPD model animals (Fig. 2 ); furthermore, a statistically significant increase in apoptosis was observed after CCR1 overexpression (Fig. 2 C). Notably, apoptosis was inhibited following shRNA-CCR1 transfection and BX471 treatment (Fig. 2 D-E). CCR1 expression in bronchial mucosa of COPD mice following CCR1 overexpression or interference Immunohistochemistry showed the presence of CCR1 protein primarily in the airway epithelial cells (Fig. 3 ). The expression of CCR1 in the bronchial mucosa was significantly increased in COPD model animals transfected with the vector compared with those of the control group and further increased following CCR1 overexpression, then inhibited by shRNA-CCR1 transfection, and BX471 treatment. Expression of CCR1 and the downstream pathways in bronchial mucosa of COPD mice following CCR1 overexpression or interference RT-qPCR revealed that the CCR1/JAK/ STAT3/NF-κB signaling was increased significantly after CCR1 overexpression and decreased when CCR1 expression was inhibited following shRNA-CCR1 transfection and BX471 treatment (Fig. 4 A-F); nevertheless, RANTES mRNA expression remained unaltered following CCR1-overexpressing or shRNA-CCR1 lentiviral transfection or BX471 treatment (Fig. 4 G). The results of western blotting analysis for detection of protein expression were consistent with the RT-qPCR results, and the protein expression of CCR1, MIP-1β, and STAT3 was significantly increased in the COPD model group transfected with the vector, further increased after CCR1-overexpressing lentiviral transfection, and inhibited after CCR1-shRNA lentiviral transfection or BX471 pretreatment (Fig. 5 A-C). Furthermore, the protein expression of RANTES was significantly increased in the COPD model group transfected with the vector but remained unaltered following CCR1-overexpressing or CCR1-shRNA lentiviral transfection or BX471 pretreatment (Fig. 5 D). Additionally, the protein expression of the CCR1 downstream pathway components, such as phosphorylated IKK, JAK2, and p65, was significantly increased in the COPD model group transfected with the vector, further increased after CCR1-overexpressing lentiviral transfection, and inhibited after CCR1-shRNA lentiviral transfection or BX471 pretreatment (Fig. 6 D-F). Notably, the protein expression of non-phosphorylated IKK, JAK2, and p65 was not significantly affected by CCR1-shRNA lentiviral transfection or BX471 pretreatment (Fig. 6 A-C). Chemokine and cytokine levels in the BALF of COPD mice following CCR1 overexpression or interference The secretion of TNF-α, IL-6, MIP-1β, and RANTES was significantly increased in the BALF of COPD model animals transfected with the vector compared with those of the control group. Furthermore, the secretions of only TNF-α, IL-6, and MIP-1β were further increased after CCR1 overexpression and inhibited by shRNA-CCR1 transfection or BX471-treatment (Fig. 7 A-C); the concentration of RANTES remained unaltered following CCR1-overexpressing or shRNA-CCR1 lentiviral transfection or BX471-treatment (Fig. 7 D). DISCUSSION Mouse models are increasingly being used to understand smoking-induced inflammation [ 11 ] and provide a rationale for drug development. Here, we developed a cigarette-smoke exposure model to investigate potential targets for COPD pathogenesis. We hypothesized a role for CCR1 in modulating cigarette-smoke-induced inflammation. Our study used a vector transfected COPD mouse model and found inflammatory cell infiltration, airway remodeling, emphysema, and apoptosis. Noticeably, the expression of CCR1, JAK2, and STAT3 in the lung tissues and MIP-1β, IL-6, and TNF-α in the BALF were significantly increased. Further, overexpressed-CCR1 lentiviral transfection in COPD mice led to aggravated inflammatory cell infiltration, airway remodeling, emphysema, and apoptosis, however, the lung tissue expression of CCR1, JAK2, and STAT3 and BALF levels of MIP-1β, IL-6, and TNF-α were increased. Importantly, shRNA-CCR1 lentiviral transfection or BX471 pretreatment alleviated airway inflammation, emphysema, and apoptosis, and lung tissue expression of CCR1, JAK2, and STAT3; and BALF levels of MIP-1β, IL-6, and TNF-α were inhibited. Numerous studies have attempted to identify novel anti-inflammatory drugs for COPD treatment using mouse models. In multiple smoking models, the severity of the inflammatory response is determined by the pathological changes induced by emphysema in the lungs [ 12 , 13 ] . In agreement, our study found that pathological changes such as emphysema and inflammatory infiltration in the lung tissue of cigarette-induced COPD model were significantly higher than those in the control group. COPD pathogenesis involves an abnormal response to cellular stress caused by cigarette smoke exposure. A previous study reported cigarette smoke-induced increased susceptibility to apoptosis in COPD mouse models, including apoptosis of alveolar type II epithelial cells, thereby promoting emphysema [ 14 ] . This study noticed that small RNAs played an important role in the regulation of the DNA damage response. Another COPD mice study noticed that cigarette smoke induces emphysema, bronchial mucus cell proliferation, and pulmonary fibrosis by promoting airway inflammation, oxidative stress injury, and apoptosis [ 15 ] . Further, human studies have demonstrated that cigarette smoke extract (CSE) promotes apoptosis, including in the lung tissue of COPD patients [ 16 , 17 ] . Our TUNEL results of increased CCR1 expression and cell apoptosis in the lungs of COPD mice are consistent with these previous studies. CCR1 is primarily expressed in T lymphocytes, monocytes/macrophages, basophils, dendritic cells, eosinophils, and neutrophils. Previous studies using a perturbation approach involving exposure of CCR1 knockout mice to cigarette smoke have reported a significantly reduced inflammatory response compared to wild-type mice. Furthermore, CCR1 knockout mice also show reduced levels of IL-1 and MIP-1β in BALF [ 18 ] . Thus, CCR1 appears to play central role in the inflammation induced by cigarette smoke. In agreement, we noticed elevated CCR1 ligand concentrations in the BALF of smoke-exposed animals. These findings suggest that future therapeutic strategies for treating cigarette smoke-induced inflammation can be built around blocking CCR1 signaling. In addition to CCR1, the expression of STAT3 and MIP-1β, and the level of chemokines in BALF was further increased in COPD mice when CCR1 overexpression lentivirus was transfected. Furthermore, the alleviation of airway inflammation was inhibited upon transfection with the shRNA-CCR1 lentivirus. Furthermore, pretreatment with the CCR1 antagonist BX471 led to results similar to shRNA-CCR1 lentiviral transfection. BX471 may inhibit the release of inflammatory factors and recruitment of inflammatory cells via the CCR1 pathway [ 19 ] . Thus, BX471 is a potential target for the treatment of chronic airway inflammation in COPD. BX471 is a small molecule non-peptide antagonist of CCR1, which can replace MIP-1α and MCP-3, inhibit Ca2 + mobilization, extracellular acidification, and leukocyte migration by directly binding to CCR1 [ 20 ] . While BX471 co-treated with CSE did not reduce the expression of CCR1 in vitro, in vivo experiments revealed reduction in airway mucosal CCR1 expression in COPD model mice pre-treated with BX471. We speculate that BX471 is a small-molecule compound, which is affected by temperature, solution concentration, and other conditions in vitro; thus, the results of animal experiments are more accurate. Moreover, an increased frequency of MIP-1β-positive epithelial cells in the bronchial mucosa was observed in COPD patients, and the frequency of MIP-1β-expressing cells was correlated with decreased lung function [ 21 ] . Thus, our results from experiments involving CCR1 overexpression, shRNA-CCR1 lentivirus, and pretreatment with the CCR1 antagonist BX471 in a COPD mouse model further support the argument that future therapeutic strategies for treating cigarette smoke-induced inflammation should involve targeting of CCR1 signaling. Our in vivo results revealed were similar to those of our previous study where tissue and cells were obtained from COPD patients [ 22 ] . CCR1 ligands (MIP-1A, RANTES, and MCP-3) are expressed in lung tissue, BALF, and sputum of COPD patients [ 23 ] . However, RANTES plays a minor role in the smoke-induced inflammatory response, suggesting that RANTES is not a downstream pathway component of the CCR1 pathway. RANTES acts as a major eosinophil chemotactic protein, resulting in activation and accumulation of eosinophils at sites of allergic airway inflammation [ 24 , 25 ] . In addition, RANTES regulates mast cell migration into the nasal epithelium, stimulates eosinophil histamine release, and mediates eosinophil infiltration into the nasal mucosa [ 26 ] . Considering RANTES is mainly involved in eosinophil-mediated allergic reactions, our results indicate that cigarette-induced airway inflammation is not eosinophilic. Further, MIP-1α and MIP-1β belong to the CC subfamily, which are produced by lymphocytes, macrophages, and other immune cells, and have a chemotactic effect by binding to the surface receptors CCR1, CCR3, and CCR5 on T cells [ 27 ] . The mechanism of MIP-1α/β production by T cells is related to Toll-like receptor (TLR) 2 and/or TLR4, initiating nuclear factor-κB (NF-κB) signaling [ 28 , 29 ] . Notably, p65 (a subunit of NF-κB) expression is enhanced in lesion tissues and lymphocytes [ 30 – 32 ] . NF-κB is a transcription factor that regulates cytokine activity during oxidative stress and inflammation in the airways [ 33 ] . Recent studies have indicated that inhibition of the JAK/STAT pathway may downregulate the expression of NF-κB, and thus interfere with CCR1 expression leading to significant inhibition of cigarette smoke induced JAK/STAT/NF-κB activation [ 34 ] . Our study also showed that the expression of JAK2/STAT3/NF-κB signaling and the release of TNF-α decreased after CCR1 expression was blocked. Thus, CCR1 is an attractive therapeutic target for regulating leukocyte infiltration and reducing tissue damage associated with many autoimmune diseases, which has potential benefits in reducing airway inflammation and protecting lung function in patients with smoking-related COPD [ 35 – 37 ] . Conclusively, CCR1 expression was significantly increased in the bronchial mucosa of COPD model mice and further increased after CCR1-overexpressing lentiviral transfection. This trend was abolished after shRNA-CCR1 lentiviral transfection or pretreatment with the selective CCR1 inhibitor BX471. Furthermore, we found the critical role of CCR1 in the regulation of smoke-induced inflammation via JAK/STAT3/NF-κB signaling in COPD model animals and that blocking the CCR1 signal could relieve the progression of COPD. These results along with previous findings support our hypothesis that CCR1 mediates cigarette smoke-induced inflammation. Overall, findings from experiments involving CCR1 overexpression, shRNA-CCR1 lentivirus and pretreatment with the CCR1 antagonist BX471 in a COPD mouse model indicate that therapeutic strategies for treating and managing cigarette smoke-induced inflammation in COPD patients should involve targeting of CCR1 signaling. Declarations Funding This work was supported by [Scientific Research Project of Jiading District Science and Technology Commission, Shanghai, China] (Grant numbers: (JDKW-2023-0040)). Competing Interests The authors have no relevant financial or non-financial interests to disclose. Author Contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Kaishun Zhao, Ran Dong and Wei Wei. The first draft of the manuscript was written by Ran Dong and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Ethics Approval This study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of University Shanghai University of Medicine and Health Sciences. Data Availability The data in this study was not availability. References Bellou, V., et al., Prognostic models for outcome prediction in patients with chronic obstructive pulmonary disease: systematic review and critical appraisal. BMJ (Clinical research ed.), 2019. 367 : p. l5358. Soriano, J. and R. Rodríguez-Roisin, Chronic obstructive pulmonary disease overview: epidemiology, risk factors, and clinical presentation. Proceedings of the American Thoracic Society, 2011. 8 (4): p. 363-7. Halpin, D., et al., Global Initiative for the Diagnosis, Management, and Prevention of Chronic Obstructive Lung Disease. The 2020 GOLD Science Committee Report on COVID-19 and Chronic Obstructive Pulmonary Disease. American journal of respiratory and critical care medicine, 2021. 203 (1): p. 24-36. Moll, M., et al., Chronic obstructive pulmonary disease and related phenotypes: polygenic risk scores in population-based and case-control cohorts. The Lancet. Respiratory medicine, 2020. 8 (7): p. 696-708. Agustí, A. and J. Hogg, Update on the Pathogenesis of Chronic Obstructive Pulmonary Disease. The New England journal of medicine, 2019. 381 (13): p. 1248-1256. Alter, P., et al., Update in Chronic Obstructive Pulmonary Disease 2019. American journal of respiratory and critical care medicine, 2020. 202 (3): p. 348-355. Velazquez, J. and L. Teran, Chemokines and their receptors in the allergic airway inflammatory process. Clinical reviews in allergy & immunology, 2011. 41 (1): p. 76-88. Blease, K., et al., Airway remodeling is absent in CCR1-/- mice during chronic fungal allergic airway disease. Journal of immunology (Baltimore, Md. : 1950), 2000. 165 (3): p. 1564-72. Hartl, D., et al., Infiltrated neutrophils acquire novel chemokine receptor expression and chemokine responsiveness in chronic inflammatory lung diseases. Journal of immunology (Baltimore, Md. : 1950), 2008. 181 (11): p. 8053-67. Schumann, D., et al., Stability of the Blood Eosinophilic Phenotype in Stable and Exacerbated COPD. Chest, 2019. 156 (3): p. 456-465. Shapiro, S.D., D.L. Demeo, and E.K. Silverman, Smoke and mirrors: Mouse models as a reflection of human chronic obstructive pulmonary disease. Am J Respir Crit Care Med, 2004. 170 (9): p. 929-31. Kumar, R.K., C. Herbert, and P.S. Foster, Mouse models of acute exacerbations of allergic asthma. Respirology, 2016. 21 (5): p. 842-9. Johnston, S.L., Experimental models of rhinovirus-induced exacerbations of asthma: where to now? Am J Respir Crit Care Med, 2003. 168 (10): p. 1145-6. Nouws, J., et al., MicroRNA miR-24-3p reduces DNA damage responses, apoptosis, and susceptibility to chronic obstructive pulmonary disease. JCI Insight, 2021. 6 (2). Wang, X., Z. Wang, and D. Tang, Aerobic Exercise Alleviates Inflammation, Oxidative Stress, and Apoptosis in Mice with Chronic Obstructive Pulmonary Disease. Int J Chron Obstruct Pulmon Dis, 2021. 16 : p. 1369-1379. Sun, Y., et al., miRNA-206 regulates human pulmonary microvascular endothelial cell apoptosis via targeting in chronic obstructive pulmonary disease. J Cell Biochem, 2019. 120 (4): p. 6223-6236. Hosaka, Y., et al., Chaperone-Mediated Autophagy Suppresses Apoptosis via Regulation of the Unfolded Protein Response during Chronic Obstructive Pulmonary Disease Pathogenesis. J Immunol, 2020. 205 (5): p. 1256-1267. Onnervik, P.O., et al., The role of the CCR1 receptor in the inflammatory response to tobacco smoke in a mouse model. Inflamm Res, 2010. 59 (10): p. 817-25. Feng, S., et al., Therapeutic Effect of C-C Chemokine Receptor Type 1 (CCR1) Antagonist BX471 on Allergic Rhinitis. J Inflamm Res, 2020. 13 : p. 343-356. Liang, M., et al., Identification and characterization of a potent, selective, and orally active antagonist of the CC chemokine receptor-1. J Biol Chem, 2000. 275 (25): p. 19000-8. Di Stefano, A., et al., Severity of airflow limitation is associated with severity of airway inflammation in smokers. Am J Respir Crit Care Med, 1998. 158 (4): p. 1277-85. Zhao, K., et al., Cigarette smoke-induced lung inflammation in COPD mediated via CCR1/JAK/STAT /NF-kappaB pathway. Aging (Albany NY), 2020. 12 (10): p. 9125-9138. Fujimoto, K., et al., Airway inflammation during stable and acutely exacerbated chronic obstructive pulmonary disease. Eur Respir J, 2005. 25 (4): p. 640-6. Lukacs, N.W., et al., C-C chemokine-induced eosinophil chemotaxis during allergic airway inflammation. J Leukoc Biol, 1996. 60 (5): p. 573-8. Alam, R., et al., RANTES is a chemotactic and activating factor for human eosinophils. J Immunol, 1993. 150 (8 Pt 1): p. 3442-8. Kuna, P., et al., RANTES induces nasal mucosal inflammation rich in eosinophils, basophils, and lymphocytes in vivo. Am J Respir Crit Care Med, 1998. 157 (3 Pt 1): p. 873-9. Menten, P., A. Wuyts, and J. Van Damme, Macrophage inflammatory protein-1. Cytokine Growth Factor Rev, 2002. 13 (6): p. 455-81. Biswas, A., P. Banerjee, and T. Biswas, Porin of Shigella dysenteriae directly promotes toll-like receptor 2-mediated CD4+ T cell survival and effector function. Mol Immunol, 2009. 46 (15): p. 3076-85. Kochumon, S., et al., Palmitate Activates CCL4 Expression in Human Monocytic Cells via TLR4/MyD88 Dependent Activation of NF-kappaB/MAPK/ PI3K Signaling Systems. Cell Physiol Biochem, 2018. 46 (3): p. 953-964. Zhu, X., et al., Upregulation of CCL3/MIP-1alpha regulated by MAPKs and NF-kappaB mediates microglial inflammatory response in LPS-induced brain injury. Acta Neurobiol Exp (Wars), 2016. 76 (4): p. 304-317. Ohno, S., et al., Enhanced expression of Toll-like receptor 2 in lesional tissues and peripheral blood monocytes of patients with oral lichen planus. J Dermatol, 2011. 38 (4): p. 335-44. Yang, J.Y., et al., T cell-derived exosomes induced macrophage inflammatory protein-1alpha/beta drive the trafficking of CD8(+) T cells in oral lichen planus. J Cell Mol Med, 2020. 24 (23): p. 14086-14098. Schuliga, M., NF-kappaB Signaling in Chronic Inflammatory Airway Disease. Biomolecules, 2015. 5 (3): p. 1266-83. Bar-Shai, M., et al., The role of reactive nitrogen species and cigarette smoke in activation of transcription factor NF-kappaB and implication to inflammatory processes. J Physiol Pharmacol, 2006. 57 Suppl 4 : p. 39-44. Barnes, P.J., Inflammatory mechanisms in patients with chronic obstructive pulmonary disease. J Allergy Clin Immunol, 2016. 138 (1): p. 16-27. Gladue, R.P., et al., CP-481,715, a potent and selective CCR1 antagonist with potential therapeutic implications for inflammatory diseases. J Biol Chem, 2003. 278 (42): p. 40473-80. Robinson, S.C., K.A. Scott, and F.R. Balkwill, Chemokine stimulation of monocyte matrix metalloproteinase-9 requires endogenous TNF-alpha. Eur J Immunol, 2002. 32 (2): p. 404-12. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4383943","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":302017280,"identity":"98766579-6e9d-49ae-86f5-801bd026c7d4","order_by":0,"name":"Kaishun Zhao","email":"","orcid":"","institution":"Shanghai University of Medicine and Health Sciences","correspondingAuthor":false,"prefix":"","firstName":"Kaishun","middleName":"","lastName":"Zhao","suffix":""},{"id":302017281,"identity":"1d513356-6243-4b61-b8ff-c73ec7180e14","order_by":1,"name":"Ran Dong","email":"","orcid":"","institution":"Tongji University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ran","middleName":"","lastName":"Dong","suffix":""},{"id":302017282,"identity":"9327becd-6eb3-4bb6-900b-6e3471ddf21a","order_by":2,"name":"Wei Wei","email":"","orcid":"","institution":"Shanghai University of Medicine and Health Sciences","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Wei","suffix":""},{"id":302017283,"identity":"499846bb-89f7-4f1c-bbb8-991a19a1c029","order_by":3,"name":"Suzhen Ju","email":"","orcid":"","institution":"Shanghai University of Medicine and Health Sciences","correspondingAuthor":false,"prefix":"","firstName":"Suzhen","middleName":"","lastName":"Ju","suffix":""},{"id":302017284,"identity":"35803e33-9d92-4d2d-8e66-588f202abdcb","order_by":4,"name":"Chunlin Tu","email":"","orcid":"","institution":"Shanghai University of Medicine and Health Sciences","correspondingAuthor":false,"prefix":"","firstName":"Chunlin","middleName":"","lastName":"Tu","suffix":""},{"id":302017285,"identity":"1093f4fd-90d2-4bfe-826f-b3d3d5ce343e","order_by":5,"name":"Yanfang Yu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsUlEQVRIie3PMQrCQBCF4Q0LqSZsmwUPMZUiiLnKSCCVYCcpVwI5Q8R7WE+wsAmxs9lLJI2NFlraCJPOYr/6/cVTKgj+kr4+X+UKjHHiJKYUumJmGxYngGlSX1boSBjgnRFtfQNUHA3jVpJ4IsLew0I7bY9nQTL3xEx7D0vHsU5kyebwGfeATOIk15GreUKS+SLWqsvBNm0l+2JPu4dW5TozpmqHUZJ8idy0fRAEQfDbGx1JN6ZlcmzFAAAAAElFTkSuQmCC","orcid":"","institution":"Shanghai University of Medicine and Health Sciences","correspondingAuthor":true,"prefix":"","firstName":"Yanfang","middleName":"","lastName":"Yu","suffix":""}],"badges":[],"createdAt":"2024-05-07 15:23:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4383943/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4383943/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":56678870,"identity":"b4d1a90a-3af2-4a20-9ece-6afdf9d9db66","added_by":"auto","created_at":"2024-05-17 16:39:51","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5202283,"visible":true,"origin":"","legend":"\u003cp\u003eHistological changes in bronchial mucosa of COPD mice following CCR1 overexpression or interference. The HE staining revealed pathological changes in the airway mucosa of normal control mice (A). The airway of COPD model mice transfected with the vector shows inflammatory cell infiltration, widened alveolar septum, and emphysema, consistent with the airway pathological changes in COPD (B). Infiltration of airway inflammatory cells, widening of alveolar septa, and emphysema were further aggravated in CCR1-overexpressing lentiviral-transfected COPD model mice (C). Infiltration of airway inflammatory cells, alveolar septa, and emphysema were alleviated in CCR1-shRNA lentiviral-transfected (D) and BX471-pretreated (E) COPD model mice. (\u003cem\u003en\u003c/em\u003e = 10, magnification: 100× and 200×)\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4383943/v1/cfad020fff3a998bfffde8ac.png"},{"id":56678875,"identity":"0b6a5959-c50c-4559-aaa7-ec4aec301c44","added_by":"auto","created_at":"2024-05-17 16:39:52","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1092803,"visible":true,"origin":"","legend":"\u003cp\u003eApoptosis in the lung tissue of COPD mice with CCR1 overexpression or interference. Apoptosis in the lung tissue of normal mice (A). Apoptosis was increased in the lung tissues of vector transfected COPD mice (B). Apoptosis was further aggravated in CCR1-overexpressing lentiviral-transfected COPD model mice (C). Apoptosis was alleviated in CCR1-shRNA lentiviral-transfected (D) and BX471-pretreated (E) COPD model mice. Quantification data are presented in F. Data are presented as mean ± SD (\u003cem\u003en\u003c/em\u003e = 10). Original magnification 400×. ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001 compared with control groups, ####\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001 compared with vector transfection COPD groups. Apoptotic cells shown as red fluorescence, nuclei shown as blue fluorescence.\u003c/p\u003e","description":"","filename":"figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4383943/v1/4a775f32d78efdc0013ea2dd.png"},{"id":56678769,"identity":"8a91e9b6-4325-4e47-8fe9-e244aa67c3bb","added_by":"auto","created_at":"2024-05-17 16:39:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2706695,"visible":true,"origin":"","legend":"\u003cp\u003eImmunofluorescence depicting CCR1 distribution and expression in the lung tissue of COPD mice with CCR1 overexpression or interference. The expression of CCR1 in the airway mucosa of control mice (A). CCR1 expression was increased in the lung tissue of vector-transfected COPD mice (B). CCR1 expression was further increased in CCR1-overexpressing lentiviral-transfected COPD model mice (C). CCR1 expression was inhibited in CCR1-shRNA lentiviral-transfected (D) and BX471-pretreated (E) COPD model mice. Quantification data are presented in F. Data are presented as mean ± SD (n = 10). Original magnification 400×. ****p \u0026lt; 0.0001 compared with control groups, ####p \u0026lt; 0.0001 compared with vector transfection COPD groups. CCR1 expression shown as red fluorescence, nuclei shown as blue fluorescence.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4383943/v1/218568265dbcda1dd4921452.png"},{"id":56678780,"identity":"450c966e-e1f6-44a6-bb3c-1ec27a65c688","added_by":"auto","created_at":"2024-05-17 16:39:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":433411,"visible":true,"origin":"","legend":"\u003cp\u003eThe transcript-level expression of molecules of CCR1 downstream pathways in lung tissue of COPD mice with CCR1 overexpression or interference. Compared with the control group, the transcript-level expression of CCR1, IKK, JAK2, MIP-1β, NF-κB, and STAT3 was significantly increased in the COPD model group with vector transfection, and further increased after CCR1 overexpression and inhibited after CCR1 knockdown or BX471 pretreatment (A-F). The transcript-level expression of RANTES was significantly increased in the COPD model group transfected with the vector but remained unaltered following CCR1 overexpression or CCR1 knockdown or BX471 pretreatment (G). Data are presented as mean ± SD (n = 10). *p \u0026lt; 0.05, **p \u0026lt; 0.01 compared with control groups, #p \u0026lt; 0.05 compared with vector transfection COPD groups.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4383943/v1/1b48333b13be23424ea8128c.png"},{"id":56678777,"identity":"a3de82c5-677e-409f-8a5d-e6450e6dbb51","added_by":"auto","created_at":"2024-05-17 16:39:34","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":911343,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of CCR1 and downstream pathways in bronchial mucosa detected by western blotting. Compared with that in the control group, the expression of CCR1, MIP-1β, and STAT3 was significantly increased in the COPD model group with vector transfection, and further increased after CCR1 overexpression, and inhibited after CCR1 knockdown or BX471 pretreatment (A-C). The expression of RANTES was significantly increased in the COPD model group with vector transfection, but had no changes after CCR1-overexpression or CCR1 knockdown or BX471 pretreatment (D). Data are presented as mean ± SD (n = 10). *p \u0026lt; 0.05, **p \u0026lt; 0.01 compared with control groups, #p \u0026lt; 0.05, ##p \u0026lt; 0.01, ###p \u0026lt; 0.001 compared with vector transfection COPD groups.\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4383943/v1/7d31b55e1c0363da41b8e15b.png"},{"id":56678773,"identity":"1a55331e-9a8a-4350-811b-3da86922bf9a","added_by":"auto","created_at":"2024-05-17 16:39:32","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":871331,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of IKK, JAK2, p65, and phosphorylation in bronchial mucosa detected by western blotting. Compared with the control group, the expression of CCR1 downstream pathway proteins IKK and JAK2 and p65 phosphorylation in the COPD model group was significantly increased, and further increased after CCR1-overexpression and inhibited after CCR1 knockdown or BX471 pretreatment (D-F). The expression of non-phosphorylated IKK, JAK2, and p65 was not significantly affected by CCR1 knockdown or BX471 pretreatment (A-C). Data are presented as mean ± SD (n = 10). **p \u0026lt; 0.01 compared with control groups, #p \u0026lt; 0.05, ##p \u0026lt; 0.01 compare with vector transfection COPD groups.\u003c/p\u003e","description":"","filename":"figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-4383943/v1/34883865f2e4d2fa197f59f2.png"},{"id":56678783,"identity":"ae9049f6-926c-440c-bdf7-f21338684380","added_by":"auto","created_at":"2024-05-17 16:39:37","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":321616,"visible":true,"origin":"","legend":"\u003cp\u003eLevels of chemokines and cytokines in the BALF of COPD model animals with CCR1 overexpression or interference. Compared with the control group, the levels of TNF-α, IL-6, and MIP-1β were significantly increased in the COPD model group with vector transfection, further increased after CCR1 overexpression, and inhibited after CCR1 knockdown or BX471 pretreatment (A-C). The concentration of RANTES was significantly increased in the COPD model group with vector transfection expression, but was not changed after CCR1 overexpression or CCR1 knockdown or BX471 pretreatment (D). Data are presented as mean ± SD (n = 10). **p \u0026lt; 0.01, ***p \u0026lt; 0.001 compared with control groups, #p \u0026lt; 0.05, ##p \u0026lt; 0.01, ###p \u0026lt; 0.001 compared with vector transfection COPD groups.\u003c/p\u003e","description":"","filename":"figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-4383943/v1/b0584894cd5192e3a27283b4.png"},{"id":58533078,"identity":"242cb8c1-f33e-4944-a9a9-e3ba6d1c8281","added_by":"auto","created_at":"2024-06-18 01:31:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":15615947,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4383943/v1/7947e68f-1099-4549-9329-e66a0155161f.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Chemokine receptor 1 pathway mediagtes the progression of airway inflammation in a smoking-induced chronic obstructive pulmonary disease mouse model","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eChronic obstructive pulmonary disease (COPD) is a major public health concern that causes morbidity and mortality and a substantial economic burden \u003csup\u003e[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]\u003c/sup\u003e. COPD is characterized by irreversible airflow limitation and persistent respiratory symptoms \u003csup\u003e[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e. Smoking, which is the primary risk factor for COPD, elicits abnormal inflammatory responses including airway remodeling, emphysema, acceleration of lung function decline, airflow limitation, and chronic respiratory symptoms that are difficult to reverse and may periodically manifest as exacerbations \u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eC-C chemokine receptor 1 (CCR1) is expressed in the eosinophils, macrophages, dendritic cells, neutrophils, and natural killer T cells \u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]\u003c/sup\u003e. Previous studies have reported that CCR1 contains ligands such as MIP-1α/β, RANTES, and MCP-3, which are upregulated in patients with COPD \u003csup\u003e[\u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. CCR1 ligands play a key role in the pathogenesis of COPD, indicating that CCR1 is a potentially promising target in developing therapies for COPD. We previously reported that CCR1 plays a critical role in smoking-induced inflammation via regulating the JAK/STAT/NF-κB signaling \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn the present study, to elucidate the mechanisms underlying CCR1 signaling and its role in the progression of COPD, we investigated CCR1 expression and chemokine levels in an animal model of COPD that either overexpressed CCR1 or displayed deficient expression.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eReagents\u003c/h2\u003e \u003cp\u003eAll chemicals (except for the antibodies and antagonists) were purchased from Sigma-Aldrich (St. Louis, MO, USA). The CCR1 antagonist BX417 was purchased from Enzo Life Sciences (Farmingdale, NY, USA). Mouse anti-rabbit IgG monoclonal antibodies (HRP- or FITC-conjugated) and goat anti-mouse IgG monoclonal antibodies (HRP-conjugated) were purchased from Abcam (Cambridge, MA, USA). Primary antibodies against CCR1, JAK2, MIP-1β, RANTES, STAT3, NF-κB p65, TLR4 IKK, and β-actin were purchased from Cell Signaling Technology (Beverly, MA, USA). CCR1-overexpressing and shRNA-CCR1 lentiviruses were purchased from Ambion (Life Technology, Foster City, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eSPF male BALB/c mice (18\u0026ndash;22 g) were obtained from Jiesijie Laboratory Animal Center (Shanghai, China), quarantined at the Animal Experimental Center of Jiading Central Hospital, Shanghai, China, maintained at 22\u0026deg;C\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C and 50% \u0026plusmn; 20% humidity with a 12:12 h light\u0026ndash;dark cycle, and allowed free access to water and standard food for \u0026ge;\u0026thinsp;1 week before the experiments. All procedures were approved by the Ethics Committee for the Care and Use of Laboratory Animals of Jiading Central Hospital and were conducted in strict accordance with the principles and guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eExperimental design and the COPD model\u003c/h2\u003e \u003cp\u003eAfter a week of adaptive feeding, the mice were randomly classified into five groups: normal mice (control group, n\u0026thinsp;=\u0026thinsp;10), COPD model mice transfected with the CCR1 vector (COPD\u0026thinsp;+\u0026thinsp;Vector, n\u0026thinsp;=\u0026thinsp;10), COPD model mice transfected with CCR1-overexpressing lentivirus (COPD\u0026thinsp;+\u0026thinsp;CCR1\u003csup\u003e+/+\u003c/sup\u003e, n\u0026thinsp;=\u0026thinsp;10), COPD model mice transfected with shRNA-CCR1 lentivirus (COPD\u0026thinsp;+\u0026thinsp;CCR1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e, n\u0026thinsp;=\u0026thinsp;10), and COPD model mice treated with the CCR1 antagonist BX 471 (30 mg/kg) (COPD\u0026thinsp;+\u0026thinsp;BX 471, n\u0026thinsp;=\u0026thinsp;10).\u003c/p\u003e \u003cp\u003eTo establish a COPD model, smoking was combined with intratracheal injection of LPS over 28 days, which was considered the model establishment period. The COPD model mice were placed in a fumigation box prepared in advance, a lit cigarette was placed on one side of the smoke inlet hole, and a suction pump on the other side ensured that the mice smoked passively. The model mice were anesthetized via intraperitoneal injection of 10% chloral hydrate (3.5 mL/kg), and LPS (30 \u0026micro;g/6 \u0026micro;L) was injected into the trachea on the 1st and 14th days. Exposure to cigarette smoke occurred from the 2nd to the 28th day, except for the 14th day, as smoking was suspended on the day of LPS infusion. Smoke exposure occurred once a day, and each mouse was exposed to one cigarette for 1 h. On the first day after the establishment of the model, the model group was injected with approximately 100 \u0026micro;L of the vector, CCR1-overexpressing lentivirus, or shRNA-CCR1 lentivirus (5\u0026times;10^8 TU/mL) through the tail vein. The control group was injected with an equal volume of saline.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eSpecimen processing\u003c/h2\u003e \u003cp\u003eOn the 28th day, the animals were euthanized with an overdose of pentobarbital and placed in a supine position. The trachea was exposed via a midline incision in the neck and cannulated with a polyethylene tube (inner diameter 0.2 mm, length 1 cm). Bronchoalveolar lavage fluid (BALF) was collected by slowly injecting 0.8 mL of sterile pre-cooled phosphate-buffered saline (PBS) into the lungs, followed by withdrawal via an intratracheal cannula with gentle suction. The collected material was immediately centrifuged at 3000 rpm (4\u0026deg;C, 10 min) (Thermo Fisher, Waltham, MA, USA). Cell-free supernatants were stored at -80\u0026deg;C prior to analysis. Immediately after BALF collection, the lungs and bronchia were excised and fixed overnight in 4% paraformaldehyde at 4\u0026deg;C. Samples of the lungs and bronchia were embedded in paraffin. The tissue was then sliced into 5-mm thick sections for hematoxylin and eosin (HE) staining and observed using an Olympus light microscope. The remaining lung tissues were frozen using OCT and coronally sliced into 40-mm sections using a freezing microtome (CM1520; Leica Biosystems, Shanghai, China) for immunohistochemistry and immunofluorescence, respectively.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eDetection of IL-6, IFN-β, TNF-α, and MIP-1β in BALF\u003c/h2\u003e \u003cp\u003eThe concentrations of IL-6, IFN-β, TNF-α, and MIP-1β in BALF were determined in duplicate via enzyme-linked immunosorbent assays (ELISAs) using DuoSet ELISA kits (R\u0026amp;D System, Minneapolis, MN, USA), in accordance with the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eLung tissue samples (100 mg each) were ground and lysed in 1 mL of pyrolysis liquid. Protein concentrations in a 20-\u0026micro;L aliquot were measured using a bicinchoninic acid assay kit (Thermo Fisher, Waltham, MA, USA), in accordance with the manufacturer\u0026rsquo;s protocol. Equal amounts of protein (30 \u0026micro;g) were subjected to 10% sodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis at 80 V for 30 min and then at 120 V for 1 h. Subsequently, the proteins were transferred onto polyvinylidene fluoride membranes (Millipore, Burlington, MA, USA); blocked with 5% nonfat milk in PBS (2 h, 25\u0026deg;C); and incubated overnight at 4℃ with the following mouse monoclonal antibodies: GAPDH (1:1000), MIP-1β (1:1000), RANTES (1:500), CCR1 (1:500), p65 (1:1000), p-p65 (1:1000), p-IKK (1:1000), IKK (1:1000), STAT3 (1:1000), p-JAK2 (1:1000), or JAK2 (1:1000). All antibodies were purchased from Abcam. The samples were then washed with Tris-buffered saline and Tween 20 (thrice, for 5 min each) and incubated with HRP-conjugated goat anti-mouse IgG antibody (1:5000, for 1 h at room temperature). Thereafter, 1 mL of chemiluminescent substrate (Thermo Fisher) was added, and signals were detected and quantified using an enhanced chemiluminescence system (Image Quant LAS-4000 MINI; GE Healthcare Bio-Sciences, Pittsburgh, PA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and fluorescent real-time quantitative PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from the lung tissues using TRIzol reagent (Invitrogen, Waltham, MA, USA), in accordance with the manufacturer\u0026rsquo;s instructions. Single-stranded cDNA was synthesized using oligo (dT) primers and a RevertAid First Strand cDNA Synthesis Kit (Invitrogen) according to the manufacturer\u0026rsquo;s protocol. cDNA synthesized from 500 ng of total RNA was analyzed in a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using FastStart Universal SYBR Green (Roche, Indianapolis, IN, USA). The PCR conditions were as follows: initial denaturation at 50\u0026deg;C for 2 min and 95\u0026deg;C for 10 min, followed by 40 cycles of 95\u0026deg;C for 30 s and 60\u0026deg;C for 30 s. Fold-changes in gene expression were calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method relative to the expression of the internal reference gene GAPDH. The mouse primers used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe mouse gene primers sequence.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'- ATGGGTGTGAACCACGAGA \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e229 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'- CAGGGATGATGTTCTGGGCA \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMusCCR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'- AGTGAGAAGAAGGTCAAAGCCG \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e316 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'- GTTGGTCCACAGAGAGGAAGGG \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus NF-kB P65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'- CACCGGATTGAAGAGAAGCG \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e194 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'- AAGTTGATGGTGCTGAGGGA-3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMusJAK2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'- AGTGGCGGCATGATTTTGTT \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e181 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-GCTCGAACGCACTTTGGTAA \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMusSTAT3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-GACCCGCCAACAAATTAAGA \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e215 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'- TCGTGGTAAACTGGACACCA \u0026minus;\u0026thinsp;3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus RANTES\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-TGCTGCTTTGCCTACCTCTC-3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e150 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-TTGAACCCACTTCTTCTCTG-3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus MIP-1β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-CCTTACCCTGCTGAGTGACA-3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e201 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-AGGTATTGCAGAGTCCCCAC-3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eMus IKK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'- CCTCTCTCTCCTCTTGCTCG-3'\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e197 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e5'-TCTGTCTGCCTCTTTTGGTCA-3'\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence and laser-scanning confocal microscopy\u003c/h2\u003e \u003cp\u003eFrozen tracheal tissue was cut into 4-\u0026micro;m sections on a freezing microtome, maintained at room temperature for 30 min, washed thrice (5 min for each wash) with PBS, and incubated with 3% hydrogen peroxide (5\u0026ndash;10 min) to eliminate endogenous peroxidase activity. The sections were then washed twice with PBS (5 min for each wash) and incubated with blocking solution (10% goat serum) for 1 h, followed by incubation with mouse monoclonal anti-CCR1 receptor antibody (Abcam, 1:1000) for 30 min and FITC-conjugated goat anti-mouse IgG antibody (Jackson; 1:5000) for 30 min at 37\u0026deg;C. After nuclear staining with DAPI (1:1000; Thermo Fisher), the sections were observed and analyzed using a laser-scanning confocal microscope (Nikon Eclipse TI; Nikon, Tokyo, Japan). Subsequently, the slides were coded and analyzed by a technician who did not have prior knowledge of the experimental procedures. For each of the five animals in each group, one section was randomly chosen, and five fields were randomly selected from each section. The Image Pro Plus 6.0 system (Media Cybernetics, MD, USA) was used to detect the integral optical density (IOD) of positive sections (red fluorescence) and identify CCR1 in each field within an area of 25 mm\u003csup\u003e2\u003c/sup\u003e. The total area of the region of interest (epithelial layer) in each field and IOD were measured objectively. This software-assisted measurement of the positively stained area containing CCR1 was used to calculate the positive immunostaining (IOD/entire positive area). The average quantitative values of the five fields were used for the statistical analysis. All data from each group were collected simultaneously under the same conditions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eDetection of cell apoptosis using TUNEL\u003c/h2\u003e \u003cp\u003eFixed lung specimens were embedded in paraffin, and 5-\u0026micro;m-thick sections were prepared, dewaxed in xylene, and rehydrated. Subsequently, 100 drops of Proteinase K (20 \u0026micro;g/mL) were added to each section and maintained at 25\u0026ndash;28\u0026deg;C for 20 min, followed by a 60-minute incubation with TdT buffer at 4\u0026deg;C. After three 5-minute washes with PBS and nuclear staining with DAPI (1:1000; Thermo Fisher), the sections were observed and analyzed using a laser-scanning confocal microscope (Nikon Eclipse TI; Nikon) at 400\u0026times; magnification.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD, based on normal distributions, as confirmed by the Shapiro\u0026ndash;Wilk test. Comparisons among multiple groups were performed using one-way analysis of variance (ANOVA). Statistical analyses were performed using the GraphPad Prism 7.0 software (GraphPad Software, CA, USA). p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eHistological changes in bronchial mucosa of COPD mice following CCR1 overexpression or interference\u003c/h2\u003e \u003cp\u003eHE staining revealed histological changes in the bronchial mucosa. Specifically, we detected inflammatory cell infiltration, airway remodeling, and emphysema in COPD model animals following vector transfection compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-B). Furthermore, aggravation of inflammation and emphysema was observed in COPD model animals after CCR1 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). In contrast, alleviation of inflammation and emphysema was observed in the CCR1-deficient and BX471-treated groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-E). These results indicated that CCR1 deficiency or BX471 treatment could relieve the progression of COPD.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eApoptosis in lung tissue of COPD mice following CCR1 overexpression or interference\u003c/h2\u003e \u003cp\u003eWe observed tissue apoptosis in the bronchial mucosa of COPD model animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e); furthermore, a statistically significant increase in apoptosis was observed after CCR1 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Notably, apoptosis was inhibited following shRNA-CCR1 transfection and BX471 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eCCR1 expression in bronchial mucosa of COPD mice following CCR1 overexpression or interference\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eImmunohistochemistry showed the presence of CCR1 protein primarily in the airway epithelial cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The expression of CCR1 in the bronchial mucosa was significantly increased in COPD model animals transfected with the vector compared with those of the control group and further increased following CCR1 overexpression, then inhibited by shRNA-CCR1 transfection, and BX471 treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression of CCR1 and the downstream pathways in bronchial mucosa of COPD mice following CCR1 overexpression or interference\u003c/b\u003e \u003c/p\u003e \u003cp\u003eRT-qPCR revealed that the CCR1/JAK/ STAT3/NF-κB signaling was increased significantly after CCR1 overexpression and decreased when CCR1 expression was inhibited following shRNA-CCR1 transfection and BX471 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-F); nevertheless, RANTES mRNA expression remained unaltered following CCR1-overexpressing or shRNA-CCR1 lentiviral transfection or BX471 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe results of western blotting analysis for detection of protein expression were consistent with the RT-qPCR results, and the protein expression of CCR1, MIP-1β, and STAT3 was significantly increased in the COPD model group transfected with the vector, further increased after CCR1-overexpressing lentiviral transfection, and inhibited after CCR1-shRNA lentiviral transfection or BX471 pretreatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-C). Furthermore, the protein expression of RANTES was significantly increased in the COPD model group transfected with the vector but remained unaltered following CCR1-overexpressing or CCR1-shRNA lentiviral transfection or BX471 pretreatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Additionally, the protein expression of the CCR1 downstream pathway components, such as phosphorylated IKK, JAK2, and p65, was significantly increased in the COPD model group transfected with the vector, further increased after CCR1-overexpressing lentiviral transfection, and inhibited after CCR1-shRNA lentiviral transfection or BX471 pretreatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-F). Notably, the protein expression of non-phosphorylated IKK, JAK2, and p65 was not significantly affected by CCR1-shRNA lentiviral transfection or BX471 pretreatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-C).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eChemokine and cytokine levels in the BALF of COPD mice following CCR1 overexpression or interference\u003c/h2\u003e \u003cp\u003eThe secretion of TNF-α, IL-6, MIP-1β, and RANTES was significantly increased in the BALF of COPD model animals transfected with the vector compared with those of the control group. Furthermore, the secretions of only TNF-α, IL-6, and MIP-1β were further increased after CCR1 overexpression and inhibited by shRNA-CCR1 transfection or BX471-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-C); the concentration of RANTES remained unaltered following CCR1-overexpressing or shRNA-CCR1 lentiviral transfection or BX471-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eMouse models are increasingly being used to understand smoking-induced inflammation \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e and provide a rationale for drug development. Here, we developed a cigarette-smoke exposure model to investigate potential targets for COPD pathogenesis. We hypothesized a role for CCR1 in modulating cigarette-smoke-induced inflammation. Our study used a vector transfected COPD mouse model and found inflammatory cell infiltration, airway remodeling, emphysema, and apoptosis. Noticeably, the expression of CCR1, JAK2, and STAT3 in the lung tissues and MIP-1β, IL-6, and TNF-α in the BALF were significantly increased. Further, overexpressed-CCR1 lentiviral transfection in COPD mice led to aggravated inflammatory cell infiltration, airway remodeling, emphysema, and apoptosis, however, the lung tissue expression of CCR1, JAK2, and STAT3 and BALF levels of MIP-1β, IL-6, and TNF-α were increased. Importantly, shRNA-CCR1 lentiviral transfection or BX471 pretreatment alleviated airway inflammation, emphysema, and apoptosis, and lung tissue expression of CCR1, JAK2, and STAT3; and BALF levels of MIP-1β, IL-6, and TNF-α were inhibited.\u003c/p\u003e \u003cp\u003eNumerous studies have attempted to identify novel anti-inflammatory drugs for COPD treatment using mouse models. In multiple smoking models, the severity of the inflammatory response is determined by the pathological changes induced by emphysema in the lungs \u003csup\u003e[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. In agreement, our study found that pathological changes such as emphysema and inflammatory infiltration in the lung tissue of cigarette-induced COPD model were significantly higher than those in the control group. COPD pathogenesis involves an abnormal response to cellular stress caused by cigarette smoke exposure. A previous study reported cigarette smoke-induced increased susceptibility to apoptosis in COPD mouse models, including apoptosis of alveolar type II epithelial cells, thereby promoting emphysema \u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. This study noticed that small RNAs played an important role in the regulation of the DNA damage response. Another COPD mice study noticed that cigarette smoke induces emphysema, bronchial mucus cell proliferation, and pulmonary fibrosis by promoting airway inflammation, oxidative stress injury, and apoptosis \u003csup\u003e[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]\u003c/sup\u003e. Further, human studies have demonstrated that cigarette smoke extract (CSE) promotes apoptosis, including in the lung tissue of COPD patients \u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Our TUNEL results of increased CCR1 expression and cell apoptosis in the lungs of COPD mice are consistent with these previous studies.\u003c/p\u003e \u003cp\u003eCCR1 is primarily expressed in T lymphocytes, monocytes/macrophages, basophils, dendritic cells, eosinophils, and neutrophils. Previous studies using a perturbation approach involving exposure of CCR1 knockout mice to cigarette smoke have reported a significantly reduced inflammatory response compared to wild-type mice. Furthermore, CCR1 knockout mice also show reduced levels of IL-1 and MIP-1β in BALF \u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Thus, CCR1 appears to play central role in the inflammation induced by cigarette smoke. In agreement, we noticed elevated CCR1 ligand concentrations in the BALF of smoke-exposed animals. These findings suggest that future therapeutic strategies for treating cigarette smoke-induced inflammation can be built around blocking CCR1 signaling. In addition to CCR1, the expression of STAT3 and MIP-1β, and the level of chemokines in BALF was further increased in COPD mice when CCR1 overexpression lentivirus was transfected. Furthermore, the alleviation of airway inflammation was inhibited upon transfection with the shRNA-CCR1 lentivirus. Furthermore, pretreatment with the CCR1 antagonist BX471 led to results similar to shRNA-CCR1 lentiviral transfection. BX471 may inhibit the release of inflammatory factors and recruitment of inflammatory cells via the CCR1 pathway \u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Thus, BX471 is a potential target for the treatment of chronic airway inflammation in COPD. BX471 is a small molecule non-peptide antagonist of CCR1, which can replace MIP-1α and MCP-3, inhibit Ca2\u0026thinsp;+\u0026thinsp;mobilization, extracellular acidification, and leukocyte migration by directly binding to CCR1 \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. While BX471 co-treated with CSE did not reduce the expression of CCR1 in vitro, in vivo experiments revealed reduction in airway mucosal CCR1 expression in COPD model mice pre-treated with BX471. We speculate that BX471 is a small-molecule compound, which is affected by temperature, solution concentration, and other conditions in vitro; thus, the results of animal experiments are more accurate. Moreover, an increased frequency of MIP-1β-positive epithelial cells in the bronchial mucosa was observed in COPD patients, and the frequency of MIP-1β-expressing cells was correlated with decreased lung function \u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Thus, our results from experiments involving CCR1 overexpression, shRNA-CCR1 lentivirus, and pretreatment with the CCR1 antagonist BX471 in a COPD mouse model further support the argument that future therapeutic strategies for treating cigarette smoke-induced inflammation should involve targeting of CCR1 signaling.\u003c/p\u003e \u003cp\u003eOur in vivo results revealed were similar to those of our previous study where tissue and cells were obtained from COPD patients \u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. CCR1 ligands (MIP-1A, RANTES, and MCP-3) are expressed in lung tissue, BALF, and sputum of COPD patients \u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. However, RANTES plays a minor role in the smoke-induced inflammatory response, suggesting that RANTES is not a downstream pathway component of the CCR1 pathway. RANTES acts as a major eosinophil chemotactic protein, resulting in activation and accumulation of eosinophils at sites of allergic airway inflammation \u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. In addition, RANTES regulates mast cell migration into the nasal epithelium, stimulates eosinophil histamine release, and mediates eosinophil infiltration into the nasal mucosa \u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Considering RANTES is mainly involved in eosinophil-mediated allergic reactions, our results indicate that cigarette-induced airway inflammation is not eosinophilic. Further, MIP-1α and MIP-1β belong to the CC subfamily, which are produced by lymphocytes, macrophages, and other immune cells, and have a chemotactic effect by binding to the surface receptors CCR1, CCR3, and CCR5 on T cells \u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. The mechanism of MIP-1α/β production by T cells is related to Toll-like receptor (TLR) 2 and/or TLR4, initiating nuclear factor-κB (NF-κB) signaling \u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e. Notably, p65 (a subunit of NF-κB) expression is enhanced in lesion tissues and lymphocytes \u003csup\u003e[\u003cspan additionalcitationids=\"CR31\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e. NF-κB is a transcription factor that regulates cytokine activity during oxidative stress and inflammation in the airways \u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. Recent studies have indicated that inhibition of the JAK/STAT pathway may downregulate the expression of NF-κB, and thus interfere with CCR1 expression leading to significant inhibition of cigarette smoke induced JAK/STAT/NF-κB activation \u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e. Our study also showed that the expression of JAK2/STAT3/NF-κB signaling and the release of TNF-α decreased after CCR1 expression was blocked. Thus, CCR1 is an attractive therapeutic target for regulating leukocyte infiltration and reducing tissue damage associated with many autoimmune diseases, which has potential benefits in reducing airway inflammation and protecting lung function in patients with smoking-related COPD \u003csup\u003e[\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eConclusively, CCR1 expression was significantly increased in the bronchial mucosa of COPD model mice and further increased after CCR1-overexpressing lentiviral transfection. This trend was abolished after shRNA-CCR1 lentiviral transfection or pretreatment with the selective CCR1 inhibitor BX471. Furthermore, we found the critical role of CCR1 in the regulation of smoke-induced inflammation via JAK/STAT3/NF-κB signaling in COPD model animals and that blocking the CCR1 signal could relieve the progression of COPD. These results along with previous findings support our hypothesis that CCR1 mediates cigarette smoke-induced inflammation. Overall, findings from experiments involving CCR1 overexpression, shRNA-CCR1 lentivirus and pretreatment with the CCR1 antagonist BX471 in a COPD mouse model indicate that therapeutic strategies for treating and managing cigarette smoke-induced inflammation in COPD patients should involve targeting of CCR1 signaling.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by [Scientific Research Project of Jiading District Science and Technology Commission, Shanghai, China] (Grant numbers: (JDKW-2023-0040)).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Kaishun Zhao, Ran Dong and Wei Wei. The first draft of the manuscript was written by Ran Dong and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eEthics Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was performed in line with the principles of the Declaration of Helsinki. Approval was granted by the Ethics Committee of University Shanghai University of Medicine and Health Sciences.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data in this study was not availability.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBellou, V., et al., \u003cem\u003ePrognostic models for outcome prediction in patients with chronic obstructive pulmonary disease: systematic review and critical appraisal.\u003c/em\u003e BMJ (Clinical research ed.), 2019. \u003cstrong\u003e367\u003c/strong\u003e: p. l5358.\u003c/li\u003e\n\u003cli\u003eSoriano, J. and R. Rodr\u0026iacute;guez-Roisin, \u003cem\u003eChronic obstructive pulmonary disease overview: epidemiology, risk factors, and clinical presentation.\u003c/em\u003e Proceedings of the American Thoracic Society, 2011. \u003cstrong\u003e8\u003c/strong\u003e(4): p. 363-7.\u003c/li\u003e\n\u003cli\u003eHalpin, D., et al., \u003cem\u003eGlobal Initiative for the Diagnosis, Management, and Prevention of Chronic Obstructive Lung Disease. The 2020 GOLD Science Committee Report on COVID-19 and Chronic Obstructive Pulmonary Disease.\u003c/em\u003e American journal of respiratory and critical care medicine, 2021. \u003cstrong\u003e203\u003c/strong\u003e(1): p. 24-36.\u003c/li\u003e\n\u003cli\u003eMoll, M., et al., \u003cem\u003eChronic obstructive pulmonary disease and related phenotypes: polygenic risk scores in population-based and case-control cohorts.\u003c/em\u003e The Lancet. Respiratory medicine, 2020. \u003cstrong\u003e8\u003c/strong\u003e(7): p. 696-708.\u003c/li\u003e\n\u003cli\u003eAgust\u0026iacute;, A. and J. Hogg, \u003cem\u003eUpdate on the Pathogenesis of Chronic Obstructive Pulmonary Disease.\u003c/em\u003e The New England journal of medicine, 2019. \u003cstrong\u003e381\u003c/strong\u003e(13): p. 1248-1256.\u003c/li\u003e\n\u003cli\u003eAlter, P., et al., \u003cem\u003eUpdate in Chronic Obstructive Pulmonary Disease 2019.\u003c/em\u003e American journal of respiratory and critical care medicine, 2020. \u003cstrong\u003e202\u003c/strong\u003e(3): p. 348-355.\u003c/li\u003e\n\u003cli\u003eVelazquez, J. and L. Teran, \u003cem\u003eChemokines and their receptors in the allergic airway inflammatory process.\u003c/em\u003e Clinical reviews in allergy \u0026amp; immunology, 2011. \u003cstrong\u003e41\u003c/strong\u003e(1): p. 76-88.\u003c/li\u003e\n\u003cli\u003eBlease, K., et al., \u003cem\u003eAirway remodeling is absent in CCR1-/- mice during chronic fungal allergic airway disease.\u003c/em\u003e Journal of immunology (Baltimore, Md. : 1950), 2000. \u003cstrong\u003e165\u003c/strong\u003e(3): p. 1564-72.\u003c/li\u003e\n\u003cli\u003eHartl, D., et al., \u003cem\u003eInfiltrated neutrophils acquire novel chemokine receptor expression and chemokine responsiveness in chronic inflammatory lung diseases.\u003c/em\u003e Journal of immunology (Baltimore, Md. : 1950), 2008. \u003cstrong\u003e181\u003c/strong\u003e(11): p. 8053-67.\u003c/li\u003e\n\u003cli\u003eSchumann, D., et al., \u003cem\u003eStability of the Blood Eosinophilic Phenotype in Stable and Exacerbated COPD.\u003c/em\u003e Chest, 2019. \u003cstrong\u003e156\u003c/strong\u003e(3): p. 456-465.\u003c/li\u003e\n\u003cli\u003eShapiro, S.D., D.L. Demeo, and E.K. Silverman, \u003cem\u003eSmoke and mirrors: Mouse models as a reflection of human chronic obstructive pulmonary disease.\u003c/em\u003e Am J Respir Crit Care Med, 2004. \u003cstrong\u003e170\u003c/strong\u003e(9): p. 929-31.\u003c/li\u003e\n\u003cli\u003eKumar, R.K., C. Herbert, and P.S. Foster, \u003cem\u003eMouse models of acute exacerbations of allergic asthma.\u003c/em\u003e Respirology, 2016. \u003cstrong\u003e21\u003c/strong\u003e(5): p. 842-9.\u003c/li\u003e\n\u003cli\u003eJohnston, S.L., \u003cem\u003eExperimental models of rhinovirus-induced exacerbations of asthma: where to now?\u003c/em\u003e Am J Respir Crit Care Med, 2003. \u003cstrong\u003e168\u003c/strong\u003e(10): p. 1145-6.\u003c/li\u003e\n\u003cli\u003eNouws, J., et al., \u003cem\u003eMicroRNA miR-24-3p reduces DNA damage responses, apoptosis, and susceptibility to chronic obstructive pulmonary disease.\u003c/em\u003e JCI Insight, 2021. \u003cstrong\u003e6\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eWang, X., Z. Wang, and D. Tang, \u003cem\u003eAerobic Exercise Alleviates Inflammation, Oxidative Stress, and Apoptosis in Mice with Chronic Obstructive Pulmonary Disease.\u003c/em\u003e Int J Chron Obstruct Pulmon Dis, 2021. \u003cstrong\u003e16\u003c/strong\u003e: p. 1369-1379.\u003c/li\u003e\n\u003cli\u003eSun, Y., et al., \u003cem\u003emiRNA-206 regulates human pulmonary microvascular endothelial cell apoptosis via targeting in chronic obstructive pulmonary disease.\u003c/em\u003e J Cell Biochem, 2019. \u003cstrong\u003e120\u003c/strong\u003e(4): p. 6223-6236.\u003c/li\u003e\n\u003cli\u003eHosaka, Y., et al., \u003cem\u003eChaperone-Mediated Autophagy Suppresses Apoptosis via Regulation of the Unfolded Protein Response during Chronic Obstructive Pulmonary Disease Pathogenesis.\u003c/em\u003e J Immunol, 2020. \u003cstrong\u003e205\u003c/strong\u003e(5): p. 1256-1267.\u003c/li\u003e\n\u003cli\u003eOnnervik, P.O., et al., \u003cem\u003eThe role of the CCR1 receptor in the inflammatory response to tobacco smoke in a mouse model.\u003c/em\u003e Inflamm Res, 2010. \u003cstrong\u003e59\u003c/strong\u003e(10): p. 817-25.\u003c/li\u003e\n\u003cli\u003eFeng, S., et al., \u003cem\u003eTherapeutic Effect of C-C Chemokine Receptor Type 1 (CCR1) Antagonist BX471 on Allergic Rhinitis.\u003c/em\u003e J Inflamm Res, 2020. \u003cstrong\u003e13\u003c/strong\u003e: p. 343-356.\u003c/li\u003e\n\u003cli\u003eLiang, M., et al., \u003cem\u003eIdentification and characterization of a potent, selective, and orally active antagonist of the CC chemokine receptor-1.\u003c/em\u003e J Biol Chem, 2000. \u003cstrong\u003e275\u003c/strong\u003e(25): p. 19000-8.\u003c/li\u003e\n\u003cli\u003eDi Stefano, A., et al., \u003cem\u003eSeverity of airflow limitation is associated with severity of airway inflammation in smokers.\u003c/em\u003e Am J Respir Crit Care Med, 1998. \u003cstrong\u003e158\u003c/strong\u003e(4): p. 1277-85.\u003c/li\u003e\n\u003cli\u003eZhao, K., et al., \u003cem\u003eCigarette smoke-induced lung inflammation in COPD mediated via CCR1/JAK/STAT /NF-kappaB pathway.\u003c/em\u003e Aging (Albany NY), 2020. \u003cstrong\u003e12\u003c/strong\u003e(10): p. 9125-9138.\u003c/li\u003e\n\u003cli\u003eFujimoto, K., et al., \u003cem\u003eAirway inflammation during stable and acutely exacerbated chronic obstructive pulmonary disease.\u003c/em\u003e Eur Respir J, 2005. \u003cstrong\u003e25\u003c/strong\u003e(4): p. 640-6.\u003c/li\u003e\n\u003cli\u003eLukacs, N.W., et al., \u003cem\u003eC-C chemokine-induced eosinophil chemotaxis during allergic airway inflammation.\u003c/em\u003e J Leukoc Biol, 1996. \u003cstrong\u003e60\u003c/strong\u003e(5): p. 573-8.\u003c/li\u003e\n\u003cli\u003eAlam, R., et al., \u003cem\u003eRANTES is a chemotactic and activating factor for human eosinophils.\u003c/em\u003e J Immunol, 1993. \u003cstrong\u003e150\u003c/strong\u003e(8 Pt 1): p. 3442-8.\u003c/li\u003e\n\u003cli\u003eKuna, P., et al., \u003cem\u003eRANTES induces nasal mucosal inflammation rich in eosinophils, basophils, and lymphocytes in vivo.\u003c/em\u003e Am J Respir Crit Care Med, 1998. \u003cstrong\u003e157\u003c/strong\u003e(3 Pt 1): p. 873-9.\u003c/li\u003e\n\u003cli\u003eMenten, P., A. Wuyts, and J. Van Damme, \u003cem\u003eMacrophage inflammatory protein-1.\u003c/em\u003e Cytokine Growth Factor Rev, 2002. \u003cstrong\u003e13\u003c/strong\u003e(6): p. 455-81.\u003c/li\u003e\n\u003cli\u003eBiswas, A., P. Banerjee, and T. Biswas, \u003cem\u003ePorin of Shigella dysenteriae directly promotes toll-like receptor 2-mediated CD4+ T cell survival and effector function.\u003c/em\u003e Mol Immunol, 2009. \u003cstrong\u003e46\u003c/strong\u003e(15): p. 3076-85.\u003c/li\u003e\n\u003cli\u003eKochumon, S., et al., \u003cem\u003ePalmitate Activates CCL4 Expression in Human Monocytic Cells via TLR4/MyD88 Dependent Activation of NF-kappaB/MAPK/ PI3K Signaling Systems.\u003c/em\u003e Cell Physiol Biochem, 2018. \u003cstrong\u003e46\u003c/strong\u003e(3): p. 953-964.\u003c/li\u003e\n\u003cli\u003eZhu, X., et al., \u003cem\u003eUpregulation of CCL3/MIP-1alpha regulated by MAPKs and NF-kappaB mediates microglial inflammatory response in LPS-induced brain injury.\u003c/em\u003e Acta Neurobiol Exp (Wars), 2016. \u003cstrong\u003e76\u003c/strong\u003e(4): p. 304-317.\u003c/li\u003e\n\u003cli\u003eOhno, S., et al., \u003cem\u003eEnhanced expression of Toll-like receptor 2 in lesional tissues and peripheral blood monocytes of patients with oral lichen planus.\u003c/em\u003e J Dermatol, 2011. \u003cstrong\u003e38\u003c/strong\u003e(4): p. 335-44.\u003c/li\u003e\n\u003cli\u003eYang, J.Y., et al., \u003cem\u003eT cell-derived exosomes induced macrophage inflammatory protein-1alpha/beta drive the trafficking of CD8(+) T cells in oral lichen planus.\u003c/em\u003e J Cell Mol Med, 2020. \u003cstrong\u003e24\u003c/strong\u003e(23): p. 14086-14098.\u003c/li\u003e\n\u003cli\u003eSchuliga, M., \u003cem\u003eNF-kappaB Signaling in Chronic Inflammatory Airway Disease.\u003c/em\u003e Biomolecules, 2015. \u003cstrong\u003e5\u003c/strong\u003e(3): p. 1266-83.\u003c/li\u003e\n\u003cli\u003eBar-Shai, M., et al., \u003cem\u003eThe role of reactive nitrogen species and cigarette smoke in activation of transcription factor NF-kappaB and implication to inflammatory processes.\u003c/em\u003e J Physiol Pharmacol, 2006. \u003cstrong\u003e57 Suppl 4\u003c/strong\u003e: p. 39-44.\u003c/li\u003e\n\u003cli\u003eBarnes, P.J., \u003cem\u003eInflammatory mechanisms in patients with chronic obstructive pulmonary disease.\u003c/em\u003e J Allergy Clin Immunol, 2016. \u003cstrong\u003e138\u003c/strong\u003e(1): p. 16-27.\u003c/li\u003e\n\u003cli\u003eGladue, R.P., et al., \u003cem\u003eCP-481,715, a potent and selective CCR1 antagonist with potential therapeutic implications for inflammatory diseases.\u003c/em\u003e J Biol Chem, 2003. \u003cstrong\u003e278\u003c/strong\u003e(42): p. 40473-80.\u003c/li\u003e\n\u003cli\u003eRobinson, S.C., K.A. Scott, and F.R. Balkwill, \u003cem\u003eChemokine stimulation of monocyte matrix metalloproteinase-9 requires endogenous TNF-alpha.\u003c/em\u003e Eur J Immunol, 2002. \u003cstrong\u003e32\u003c/strong\u003e(2): p. 404-12.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Chemokine receptor 1 (CCR1), Chronic obstructive pulmonary disease (COPD), Bronchial mucosa, Inflammation, Mouse model, shRNA-CCR1","lastPublishedDoi":"10.21203/rs.3.rs-4383943/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4383943/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTo investigate the role of chemokine receptor 1 (CCR1) and mechanisms underlying airway inflammation in smoking-related chronic obstructive pulmonary disease (COPD), we established a mouse model of smoking-induced COPD. Pathological changes in the bronchial mucosa were assessed using hematoxylin and eosin staining, CCR1 expression and cell apoptosis were detected via immunofluorescence and TUNEL, and the expression of the CCR1 downstream pathway was detected via real-time quantitative PCR and western blotting. The expression of the chemokine MIP-1β and the inflammatory factors IL-6 and TNF-α in bronchoalveolar lavage fluid was detected using enzyme-linked immunosorbent assays. The bronchial mucosa of the COPD model mice transfected with the vector showed apoptosis, inflammatory cell infiltration, airway remodeling, and emphysema. Furthermore, the COPD model mice exhibited significantly increased CCR1 signaling and chemokine concentrations, which were further aggravated by overexpressed-CCR1 lentiviral transfection but inhibited by shRNA-CCR1 lentiviral transfection or BX471 pretreatment. These results, combined with our previous findings, elucidate the role of and mechanisms underlying CCR1 signaling in the progression of COPD, both in vivo and in vitro. This study has the potential to provide theoretical evidence for the diagnosis and therapeutic strategies of cigarette smoke-induced inflammation in COPD patients.\u003c/p\u003e","manuscriptTitle":"Chemokine receptor 1 pathway mediagtes the progression of airway inflammation in a smoking-induced chronic obstructive pulmonary disease mouse model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-17 16:39:06","doi":"10.21203/rs.3.rs-4383943/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"fbd365e1-bee5-4d8e-b147-6429a5a156f8","owner":[],"postedDate":"May 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-06-18T01:23:36+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-17 16:39:06","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4383943","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4383943","identity":"rs-4383943","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}