The Antibacterial and Antibiofilm Properties of Different Strains of Lactobacillus spp. Isolated from Traditional Kefir Dough on Oral Pathogens with Real Time PCR

The Antibacterial and Antibiofilm Properties of Different Strains of Lactobacillus spp. Isolated from Traditional Kefir Dough on Oral Pathogens with Real Time PCR | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Antibacterial and Antibiofilm Properties of Different Strains of Lactobacillus spp. Isolated from Traditional Kefir Dough on Oral Pathogens with Real Time PCR khatereh sadat ekhteraei, Tahmineh Narimani, farkhondeh poursina, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1654174/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Oral illnesses such as dental caries and gingivitis are frequent. In these kinds of infection, the bacteria are thought to use biofilm formation as a pathogenic mechanism. Today, due to the side effects of chemical medications and resistance to antibiotics, the use of probiotics is of great importance as a suitable alternative way for infection treatment. Probiotics have shown favourable properties in terms of maintaining oral health. Kefir, which is made up of complex microbiota mainly Lactobacillus spp., has been suggested as a potential reservoir for probiotic. The present research aimed to isolate and identify lactic acid bacteria from traditional kefir dough as a probiotic that suppresses S. mutans and P. gingivalis growth, biofilm formation, and gene expression. In this study, Lactobacillus spp. was tested for antibacterial (well agar diffusion technique) and antibiofilm (crystal violet assay) properties against Streptococcus mutans (ATCC 35668) and Porphyromonas gingivalis (ATCC 33277). Through the use of real-time polymerase chain reaction, we explored whether Lactobacillus plantarum and Lactobacillus rhamnosus inhibited expression of Streptococcus mutans genes involved in biofilm formation and stress survival. Additionally, Lactobacillus plantarum and Lactobacillus rhamnosus dramatically inhibited the expression of gtfB and brpA . Antibacterial Kefir dough Lactobacillus strains Oral pathogens Real time PCR gene expression Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Tooth caries and periodontal disorders are common oral infectious illnesses linked to a dysbiosis of the bacteria that live in dental plaque biofilms and can affect adults and children's health [ 1 ]. Streptococcus mutans is a gram-positive anaerobic coccus, one of the most common main colonizing bacteria causing demineralization of the tooth structure by producing acids and resists acidic conditions. Moreover, Porphyromonas gingivalis is a non-motile anaerobic gram-negative bacterium that causes periodontal diseases [ 2 ]. The incidence of these illnesses is associated with a number of variable factors. Bacterial biofilms, on the other hand, are now widely regarded as the primary pathogenic mechanism. Bacterial biofilms are collections of microorganisms encased in an extracellular polymeric viscosity produced by themselves [ 3 ]. In fact, several disorders are caused through the interactions between common oral microbiota, host susceptibility, and environmental factors including nutrition, smoking, and oral hygiene. Biofilms are a physical barrier to the host's immunological response and act as a reservoir for prolonged infections [ 4 ]. A particular enzyme called glucosyltransferase is required for the formation of these biofilms. The GTF gene encodes this enzyme, which belongs to the GH70 enzymatic family of glycosides hydrolases [ 5 ]. The brpA gene codes a predicted surface-associated protein that appears to be involved in biofilm formation, autolysis, and cell division [ 6 ]. Probiotics are believed to limit the proliferation of cariogenic bacteria and the creation of biofilms in order to provide anti-caries effects. Probiotics inhibit growth and biofilm formation of cariogenic bacteria by exerting anti-caries effects. They are "live microorganisms that, when administered in sufficient amounts, confer a health benefit on the host and have shown favorable properties in maintaining oral health," according to the WHO/FAO [ 7 ]. Fermented dairy and non-dairy products, such as meat, fruits, cheese, and fermented milks, such as kefir, can potentially provide novel bacterial strains with possible probiotic properties [ 8 ]. Kefir is manufactured by fermenting milk with various bacteria, and is one of the most common probiotic sources. Kefir consists of over than 50 different species of LAB, yeasts, and acetic acid bacteria, as well as their metabolites including lactic acid, exopolysaccharides, and peptides, which have a variety of health benefits. The word kefir comes from the Turkish word keyif, which means "pleasant feeling" for the feelings experienced after drinking it [ 9 ]. Antimicrobial, antihypertensive, anti-inflammatory, anti-cariogenic, anti-allergic, and antioxidant properties were found in kefir [ 10 ]. Probiotic strains commonly belong to the Lactobacillus and Bifidobacterium. Lactobacillus is divided into three groups: namely obligatory homofermentative, facultative homofermentative, and obligate heterofermentative Lactobacillus (7). Some Lactobacillus species were introduced as potential probiotics in caries prevention owing to their inhibitory action against cariogenic S. mutans and P. gingivalis (2) The current of this study was conducted to determine the antibacterial effect of Lactobacillus plantarum and Lactobacillus rhamnosus Supernatant on S. mutans and P. gingivalis , furthermore, inhibition of biofilm formation and the effect of these LAB on gtfB and brpA , which are involved in biofilm formation were investigated. Materials And Methods Isolation and identification Isfahan University of Medical Sciences' microbiology lab received five samples of traditional kefir dough from the local sources. Lyophilized Standard strains S. mutans (ATCC 35668) and P. gingivalis (ATCC 33277) were prepared from the Iranian industrial microbial collection. Examination of morphological characteristics of LAB LAB strains were identified morphologically using the catalase test, gram staining, temperature growth at 15°C and 45°C and pH levels using the procedures in Bergey's book. The physical properties of each colony, as well as the cell appearance characteristics were examined via gram staining. To perform the catalase test and confirm the lactobacillus genus, colonies identical to Lactobacillus with bacterial features of rod-shape, gram positive and without spores were sampled. Each strain was cultivated several times in MRS medium to ensure the purity of MRS culture bacterial [11]. Fermentation of carbohydrates of LAB The bacteria were cultivated on MRS in order so that fermentation and acid generation tests could be performed. The grown isolate was inoculated in a- tube containing fermentation liquid medium (1% of the desired sugar and phenol red reagent). The tubes were incubated at 37 ° C under 5% carbon dioxide for 72 hours. Sugar consumption and acid production were attributed to the red color change of the culture media to yellow and the formation of bubbles in the tubes [12]. Molecular identification of LAB To begin with, Murray and Thomson procedures were used to extract the isolate's DNA, with minor modifications. This procedure involved centrifuging 10 mL of bacterial solution (from a 24-hour culture) for 10 minutes at 13,000 rpm. Sediments were transferred into the micro tube. A milliliter of TBE lubricating buffer was added to them after half an hour. Subsequently, at a temperature of 60°C (on a hot plate), chloroform isoamyl alcohol (1:24) was added and well mixed. The materials were again centrifuged at 13,000 rpm for 5 minutes. The supernatant was transferred to new vials and the same volume of pure isopropanol was added. After completely mixing the contents of each vial, they were placed on ice for 10 minutes. The materials were centrifuged at 13,000 rpm for 10 minutes to precipitate, following which 500 µl of 70% ethanol was added. The samples were centrifuged for 5 minutes at 5,000 rpm, with the supernatant removed gently. The DNA vials were then left to dry for an hour at the room temperature. After the sediment dried, each microtube was filled with 100 liters of sterile deionized distilled water. A 1% agarose gel was used to validate the quality of the extracted DNA through electrophoresis[13]. For checking the specificity of the selected primers in genus and species, they were blasted at NCBI. Afterwards the primers were purchased from Gene Technologies. Table 1 Optimized primer Reference Product Size Sequence Target Gene Bacteria [14] 245 F:CTCAAAACTAAACAAAGTTTC R:CTTGTACACACCGCCCGTCA Lacto genus 12) ) 176 F:CGAGACAGCAATTCCTGCACTCG CCTCAGAAACAGTCCGGTTGA : R apbE2 Lactobacillus plantarum 12) ) 124 F:ATTTAACCGCAAGTGGCAGC AAATTGTGTGAACCGGCGTA : R aes Lactobacillus rhamnosus Probiotic Lactobacilli preparation: Lactic acid bacteria (LAB) were cultured on MRS broth and incubated at 37° C for 18-24 hours under anaerobic conditions. The bacterial growth was then centrifuged for 15 minutes at 13000 rpm/min. The supernatant was collected and filtered through a Millipore 0.22 m filter after being adjusted to a pH of 7.5 with NaOH[14]. Assay for sensitivity to lactobacillus Sensitivity of pathogenic bacteria to different strains of lactobacillus was determined via the minimum inhibitory concentration (MIC) assay. The assay was done using the method described by Andrews [16]. According to this method, stock solutions containing 20 mg/ml of 10 different selected Lactobacillus were prepared. For preparation of the test inoculums the 48 h active cultures of pathogenic bacteria were adjusted to 0.5 McFarland standards (10 7 to 10 8 cfu/ml of bacteria) by adding several dilution of each probiotic powder in each well and microtiter plate incubated for 48 h at 37°C[15, 16]. The well agar diffusion method for antimicrobial screening: Using well diffusion technique proposed by Cadirci and Citak, the antibacterial activity of Lactobacillus spp. on and Porphyromonas gingivalis was tested. P. gingivalis was cultured on blood agar enriched with vitamin K1 and hemin (at a concentration equivalent to McFarland 1 standard) and S. mutans suspension (at a concentration comparable to McFarland 0.5 standard) was cultured on blood agar complete with 5% defibrinated blood sheep medium. A number of the wells were drilled in the culture media. The wells were filled with100 µl of SCS. For Porphyromonas gingivalis and Streptococcus mutans , inhibition zones were determined in millimeters after 72 hours of anaerobic incubation at 37°C and 48 hours of aerobic incubation at 37°C (14)[15]. The effect of Lactobacillus species on formation of biofilm: For biofilm assays Streptococcus mutans was grown in BHI containing 2% sucrose, Porphyromonas gingivalis was grown in BHI containing vitamin K and hemin while Lactobacillus species were grown in deMan Rogosa and Sharpe (MRS) broth without sucrose. All the microorganisms were incubated at 37°C in an anaerobic jar for 48h. To evaluate the effect of Lactobacillus spp. on formation of the biofilm of Streptococcus mutans , the suspensions of each isolate were prepared as stated above. The suspensions were adjusted with their respected broth to 0.5 McFarland turbidity standards and several dilutions. Formation of S. mutans and P. gingivalis biofilm was assayed in the presence or absence of Lactobacillus strains in a 96-well polystyrene culture plate . Lactobacillus strains and pathogenic bacteria were mixed at an equal ratio (1:1). Blank wells contained culture medium instead of probiotic strains. The plates were incubated at 37° C for 48 hrs. Quantitation of biofilms was performed using crystal violet based microtiter plate assay [17]. Gas chromatography-mass spectrometry: The selected strains were inoculated in MRS broth and incubated at 30°C for 4 days. Subsequently the samples were centrifuged at 4000 rpm for 20 minutes. Equal amounts of ethyl acetate were added to the broth and incubated in a rotary shaker for 1 h. The downer layer of the broth was separated. The samples were analyzed with a Hewlett Packard 6850 Gas chromatograph, 5973 mass selective detector, and 7683B series injector (Agilent Technologies, Palo Alto, CA, USA) with helium as the carrier gas at a flow of 1.0 mL/min. One microliter of each sample was injected with 1 min of split flow delay and resolved on a 30 m × 0.25 mm × 0.25 µm DB5MS column (Agilent Technologies, Palo Alto, CA, USA). Inlet, interface, and ion source temperatures were 300 ◦C. Oven starting and final temperatures were within the rate of 5 ◦C/min for 36 min and then for 2 min at a constant temperature. Metabolite annotation was achieved by mass spectra comparison with analytical standards, in house library and the NIST14 database (National Institute of Standards and Technology, Gaithersburg, MD, USA)To prepare dried probiotic powder the upper layer of the broth was incubated, and allowed to dry [18]. Streptococcus gene expression : We used reverse transcription real-time PCR to evaluated the mRNA levels of S. mutans genes encoding virulence proteins related to carbohydrate metabolism ( gtfB ) and biofilm formation ( brpA ) to examine the anti-biofilm formation mechanism, as described previously. For growth curve analysis, the reagent Pars Tous kit was used to extract total RNA and cDNA. A Nanodrop ND-2000 spectrophotometer utilized to assess RNA concentration (ThermoFisher Scientific). The cDNA was amplified with SYBR Premix Taq and the primer sets are given in Table 2 on an ABI 7500 system (Applied Biosystems, Foster City, CA, USA). For gtfB and brpA , the following real-time PCR conditions were used: 95°C for 10 minutes, followed by 40 cycles of 95°C for 30 seconds, 52°C for gtfB, 55° for brpA, and 60°C for 1 minute. The temperature was reduced at a rate of 0.1°C/s from 95°C to 60°C for melting curve analysis, while the fluorescence signal intensity was continuously measured. After adjusting to the 16SrRNA level, variations in mRNA expression levels were determined using ABI 7500 v.2.2 software (Applied Biosystems). The results are reported as a fold change compared to the control group, and fold changes were taken into account. Table2 Group-specific primer sets used for quantitative reverse transcription real-time PCR : Reference Sequence(5ˊ–3) Primers Target gene Function [19] ACGAACTTTGCCGTTATTGTCA AGCAATGCAGCCAATCTACAA For Rev gtfB Carbohydrate metabolism-promoting genes [20] CGTGAGGTCATCAGCAAGGTC CGCTGTACCCCAAAAGTTTAGG For Rev brpA Regulatory protein-encoding genes [21] ATGTTGGGTTAAGTCCCG CTAGCGATTCCRRCTTCA For Rev 16SrRNA Housekeeping gene Results Bacterial culture: Streptococcus mutans and Porphyromonas gingivalis were taken from the Department of Iranian industrial microbial collection and validated using Gram staining, biochemical and molecular analysis with particular primers. Five Lactobacillus plantarum strains and five Lactobacillus rhamnosus strains were identified from traditional kefir dough in Different areas of Isfahan. According to the methods recommended by Bergey in manual of systematic bacteriology and Wood & Holzapfel in the genera of lactic acid bacteria, all isolates were studied for their morphological identification of strains using gram staining, catalase, oxidase and sugar fermentation test, grown at temperatures of 15° and 45 ° C and different pHs[11].The results are shown in Table 3. All the isolates are Gram-positive, and polymorphic, but often filamentous with short-chain. Oxidase, catalase, nitrate reduction and VP (Voges Proskauer) were negative. Based on the tests described five isolates were Lactobacillus plantarum and five were Lactobacillus rhamnosus . They all grew at NaCl %4 and %6.5, pH of 3.8 and 7.8. Lactobacillus plantarum grew at 15°C and 45°C, but the Lactobacillus rhamnosus grow at 15°.Elevation of Lactobacillus plantarum was convex and flat whereas that of Lactobacillus rhamnosus was flat. Colony color of Lactobacillus plantarum were creamy shine and creamy white but Lactobacillus rhamnosus were off white and white. Fermentation of carbohydrates: All the isolates of Lactobacillus plantarum were able to ferment Arabinose, Cellobiose, Mannitol, Gluconate, Raffinose, Ribose, Sorbitol, Sucrose and Xylose. All the isolates of Lactobacillus rhamnosus were able to ferment Arabinose, Cellobiose, Mannitol, Gluconate, Ribose, Sorbitol and Sucrose but not Raffinose and Xylose. Table 3 Fermentation of different carbohydrates Carbohydrate Bacteria Xylose Sucrose Sorbitol Ribose Raffinose Gluconate Mannitol Cellobiose Arabinose Lactobacillus plantarum d + + + + + + + d Lactobacillus rhamnosus - + + + - + + + d Molecular identification of Lactobacillus strains: The results of the PCR assays were 200 bp for the genus of Lactobacillus ,176 bp for L. plantarum and 124 bp for the L. rhamnosus (Fig1,2). Antimicrobial susceptibility: The MICs of 10 antimicrobials of Lactobacillus were determined for all the strains. The MIC for Streptococcus mutans was 5 mg/ml and for Porphyromonas gingivalis , it was 20 mg/ml. Antimicrobial assay: Lactobacilli were tested for their antibacterial properties against cariogenic ( S. mutans ) and periodontal pathogenic ( P. gingivalis ) bacteria (Table4). After 48 hours, all of the Lactobacilli strains tested displayed an antibacterial activity against S. mutans and P. gingivalis , according to the results of the disk diffusion method. Table 4 Antibacterial efficacy of probiotic supernatant against oral infections Number of isolate LAB Lactobacillus isolated L.p1 * L.p2 L.p3 L.p4 L.p5 L.r1 * L.r2 L.r3 L.r4 L.r5 Pathogenic bacteria Streptococcus mutans 13mm 15mm 17mm 12mm 21mm 14mm 12mm 15mm 17mm 12mm Porphyromonas gingivalis 13mm 15mm 19mm 15mm 19mm 15mm 14mm 17mm 20mm 16mm *L.r= Lactobacillus rhamnosus * L.p= Lactobacillus plantarum Overall, the mean diameter of the growth inhibition halo for Lactobacillus plantarum vs. Streptococcus mutans was 15.60 mm, which was 14 mm for Lactobacillus rhamnosus vs. Streptococcus mutans . Moreover, the mean diameter of the growth inhibition halo for Lactobacillus plantarum vs. Porphyromonas gingivalis was 15.60 mm and that for Lactobacillus rhamnosus vs. Porphyromonas gingivalis was 16.40. Reduced biofilm formation of supernatant of Lactobacillus against two oral pathogens: Biofilm formation of Streptococcus mutans and Porphyromonas gingivalis was compared in the absence and presence of Lactobacillus species. Oral pathogens biofilm production was inhibited considerably by all the Lactobacillus species utilized in this experiment which were significantly (Fig3, 4). Different concentrations of both genera of Lactobacillus had a decreasing effect on oral pathogens, but from a concentration of 10 -5 down, a greater decreasing effect was observed. Decrease in gtfB and brpA expression of S. mutans by L. plantarum and L. rhamnosus : The expression of the genes involved in S. mutans pathogenicity was studied in order to assess the effect of L. rhamnosus and L. plantarum supernatants on S. mutans . The signal transduction system was regulated by the brpA genes, and the representative genes involved in glucan synthesis included gtfB . Both genes were suppressed by L. rhamnosus and L. plantarum . Gas chromatography-mass spectrometry analysis: Antimicrobial compounds detected in the culture supernatant of five L. plantarum fermentations in kefir dough (table 5). Table 5 Isolated antimicrobial compounds of five Lactobacillus plantarum in kefir dough Xylene 3 methyl 3 pyrazoline-5-one 2(5H) Furanone-3 methyl Eicosane Benzene 1.3 dimethyl 2,4 dimethylcyclopent-4-ENE-1,3 O-Cyanobenzoic acid 2-Pyrrolidione Benzene 1.4 dimethyl (3,4-Dimethoxybenzyl)-3,4-dihydro6,7dimethoxyisoquinolinium chloride N-hexadecanioc acid Heptacosane 9-octadecenamide Tridecane Nonadecane Cyclotridecane Tetradecane Cycloheptasiloxane Antimicrobial compounds detected in the culture supernatant of five Lactobacillus rhamnosus fermentations in kefir dough (Table6). Table 6 Isolated antimicrobial compounds of five Lactobacillus rhamnosus in kefir dough P-xylene Cyclotrisiloxane-hexamethyl Cycloheptasiloxane Tetracosamethyl-cyclododecasiloxane Benzene,1,3 dimethyl Tetradecane Hexadecane Gamma terpinene Gibberellic acid Cycloheptasiloxane Eicosane Beta-Pinene In general, several compounds were common in both species of Lactobacillus including Xylene, Benzene 1,3 dimethyl, Tetradecane, Cycloheptasiloxane, hexadecane and Eicosane. Discussion Oral diseases are among the most prevalent diseases globally and have serious health threatening effects because one of the predisposing factors for systemic diseases, diagnosis and treatment of this disease is important. Two frequent human infectious illnesses are dental caries and periodontitis [ 22 ]. Today, due to the various side effects of chemical drugs and antibiotics, researchers have come up with new methods and utilization of beneficial microorganisms for treating and controlling diseases [ 23 ]. Probiotics have been studied for their importance in the treatment of a variety of illnesses. Kefir grains include lactic acid bacteria, acetic acid bacteria, yeasts, and potentially other microbes, and have been connected with health benefits for decades [ 24 ]Certain Lactobacillus strains have been demonstrated to have the capacity to disrupt oral ecology by suppressing pathogenic microbes such as S. mutans and P. gingivalis [ 10 ]. Due to the fact that there are no complete details on the separation of lactic acid bacteria from traditional kefir dough, studies have been performed to identify lactic acid bacteria from these kefir doughs. Lactic acid bacteria are found in a wide range of foods and are abundant in a wide range geographical conditions [ 25 ]. This variety in dairy products in the world is also very complex and can be an incentive to screen these products with the goal of achieving to suitable strains with special functional and technological characteristics[ 14 ] In 2002 Comeli al. studied the effect of bacterial strains of Lactobacillus lactis and Bacillus stearothermophilus in dairy products on oral health, They concluded that dairy strains were able to alter some of the characteristics of some oral bacteria, especially Streptococcus oralis colony count was significantly reduced in the presence of probiotics used [ 26 ]. In the study by Tahmourespour and et al. in 2011 the effect of a biosurfactant isolated from L. acidophilus on the formation of biofilm of S. mutans ATCC35668 and S. mutans isolated from dental plaque was investigated. The effect of the mentioned biosurfactant on the expression level of gtfA / B genes in these two strains was also shown. It was found that the derived biosurfactant was effective on the surface properties of biofilm formation, the ability to bind and express these genes[ 27 ]. In 2012 Zezhang T. Wen et al. studied the brpA gene, and concluded that brpA plays an important role in the pathophysiology of S.mutans and could be a potential target in modulating its virulence factors[ 28 ]. In 2014, Hoon Lee Sung et al. reported that Lactobacillus acidophilus can inhibit the effect of gtfB / gtfC / gtfD genes involved in tooth decay in their research on investigating the effect of probiotics on cariogenic biofilm model[ 29 ]. In 2018, DANA JEONG et al. isolated Lactobacillus kefiranofaciens from kefir and examined its inhibitory effect on eight genes in Streptococcus mutans ,They concluded that Lactobacillus could reduce the expression of genes involved in tooth decay caused by Streptococcus mutans [ 8 ]. In 2020, the derivatives of Nonadecanoic acid, benzoic acid, hexadecanoic acid and pyrrol were separated from the Lactobacillus plantarum . The results of this research are in line with those reported here in [ 30 ]. We extracted LAB from kefir dough and tested its antibacterial properties against S. mutans and P. gingivalis biofilms. After treatment with probiotic supernatant, the biofilm generated by Streptococcus mutans and Porphyromonas gingivalis decreased significantly, while the inhibitory zone around colonies of Streptococcus mutans and Porphyromonas gingivalis increased. The impact of Lactobacillus plantarum and Lactobacillus rhamnosus on the expression of the gtfB and brpA genes in S. mutans was also investigated in this study. gtfB is a key virulence factor for Streptococcus mutans which is responsible for the synthesis of insoluble glucans, that form dental plaque, Furthermore, it might be a selective therapeutic target for cariogenic biofilm avoidance[ 19 , 20 ]. brpA ( lytR ) encoding brpA regulatory protein has been described as an important regulator of biofilm formation. Furthermore this gene encodes a putative surface-associated protein that has a role in biofilm formation, autolysis, and cell division [ 6 ]. The obtained findings here in demonstrated the considerable antimicrobial and antibiofilm activity of probiotic bacteria L.plantarum and L.rhamnosus against S. mutans and P. gingivalis biofilms. The culture supernatant could also suppress the expression of virulence factors involved in polysaccharide synthesis and those that integrate external signals in a regulatory network composed of expression levels of gtfB and brpA , which are also involved in biofilm formation and play a key role in stress response regulation. Probiotic Lactobacilli can be used instead of antibiotics as a therapeutic alternative to inhibit growth and biofilms formation in Streptococcus mutans causing dental diseases, and Porphyromonas gingivalis causing gingivitis. Generally, Lactobacillus Plantarum has further inhibitory effects on both oral pathogens in comparison with Lactobacillus rhamnosus . Finally, Lactobacillus plantarum and Lactobacillus rhamnosus reduce the expression of critical regulatory factors, which limits S. mutans and P. gingivalis biofilm development and stability. Declarations Authors' contributions KSE: Data curation; Formal analysis; Investigation; Methodology; Writing - original draft, TN: Funding acquisition; Formal analysis; Project administration; Supervision; Validation; Writing - review & editing. FP: Data curation, AM and MSD: Investigation. Funding This work was funded by Medical Sciences University of Isfahan (Grant number: 399075). Statements and Declarations Competing Interests: The authors declare that they have no competing interests. Ethics Approval: The Ethics Committee of Isfahan University of Medical Sciences approved the ethical aspect of this study (IR. MUI.MED.REC.1399.260 ). This article does not contain any studies with human or animal subjects. Consent to Participate: Not applicable. Consent for Publication: Not applicable. References Wasfi R, Abd El‐Rahman OA, Zafer MM, Ashour HM: Probiotic Lactobacillus sp. inhibit growth, biofilm formation and gene expression of caries ‐ inducing Streptococcus mutans . Journal of cellular and molecular medicine 2018, 22 (3):1972-1983. Samot J, Belkhelfa H, Haddioui L, Badet C: Probiotic Properties of Lactobacilli That Could Be Used Against Periodontitis . Probiotics Heal 2017, 5 (3). Manmontri C, Nirunsittirat A, Piwat S, Wattanarat O, Pahumunto N, Makeudom A, Sastraruji T, Krisanaprakornkit S, Teanpaisan R: Reduction of Streptococcus mutans by probiotic milk: a multicenter randomized controlled trial . Clinical oral investigations 2019:1-12. Rossoni RD, dos Santos Velloso M, de Barros PP, de Alvarenga JA, Dos Santos JD, dos Santos Prado ACC, de Camargo Ribeiro F, Anbinder AL, Junqueira JC: Inhibitory effect of probiotic Lactobacillus supernatants from the oral cavity on Streptococcus mutans biofilms . Microbial pathogenesis 2018, 123 :361-367. Wang Z, Zhou Y, Han Q, Ye X, Chen Y, Sun Y, Liu Y, Zou J, Qi G, Zhou X: Synonymous point mutation of gtfB gene caused by therapeutic X-rays exposure reduced the biofilm formation and cariogenic abilities of Streptococcus mutans . Cell & bioscience 2021, 11 (1):1-13. Alves-Barroco C, Roma-Rodrigues C, Balasubramanian N, Guimarães MA, Ferreira-Carvalho BT, Muthukumaran J, Nunes D, Fortunato E, Martins R, Santos-Silva T: Biofilm development and computational screening for new putative inhibitors of a homolog of the regulatory protein BrpA in Streptococcus dysgalactiae subsp. dysgalactiae . International Journal of Medical Microbiology 2019, 309 (3-4):169-181. Jiang Q, Stamatova I, Kainulainen V, Korpela R, Meurman JH: Interactions between Lactobacillus rhamnosus GG and oral micro-organisms in an in vitro biofilm model . BMC microbiology 2016, 16 (1):1-11. Jeong D, Kim D-H, Song K-Y, Seo K-H: Antimicrobial and anti-biofilm activities of Lactobacillus kefiranofaciens DD2 against oral pathogens . Journal of oral microbiology 2018, 10 (1):1472985. Slattery C, Cotter PD, W O’Toole P: Analysis of health benefits conferred by Lactobacillus species from kefir . Nutrients 2019, 11 (6):1252. Leite AM, Miguel M, Peixoto R, Ruas-Madiedo P, Paschoalin V, Mayo B, Delgado S: Probiotic potential of selected lactic acid bacteria strains isolated from Brazilian kefir grains . Journal of dairy science 2015, 98 (6):3622-3632. Vos P, Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer K-H, Whitman WB: Bergey's manual of systematic bacteriology: Volume 3: The Firmicutes , vol. 3: Springer Science & Business Media; 2011. Gemechu T: Review on lactic acid bacteria function in milk fermentation and preservation . African Journal of Food Science 2015, 9 (4):170-175. Barnett R, Larson G: A phenol–chloroform protocol for extracting DNA from ancient samples . In: Ancient DNA. Springer; 2012: 13-19. Mantzourani I, Chondrou P, Bontsidis C, Karolidou K, Terpou A, Alexopoulos A, Bezirtzoglou E, Galanis A, Plessas S: Assessment of the probiotic potential of lactic acid bacteria isolated from kefir grains: evaluation of adhesion and antiproliferative properties in in vitro experimental systems . Annals of Microbiology 2019, 69 (7):751-763. Pangsomboon K, Kaewnopparat S, Pitakpornpreecha T, Srichana T: Antibacterial activity of a bacteriocin from Lactobacillus paracasei HL32 against Porphyromonas gingivalis . Archives of oral biology 2006, 51 (9):784-793. Hoque M, Akter F, Hossain K, Rahman M, Billah M, Islam K: Isolation, identification and analysis of probiotic properties of Lactobacillus spp. from selective regional yoghurts . World J Dairy Food Sci 2010, 5 (1):39-46. Ahmed A, Dachang W, Lei Z, Jianjun L, Juanjuan Q, Yi X: Effect of Lactobacillus species on Streptococcus mutans biofilm formation . Pakistan journal of pharmaceutical sciences 2014, 27 . Scano P, Pisano MB, Murgia A, Cosentino S, Caboni P: GC-MS metabolomics and antifungal characteristics of autochthonous Lactobacillus strains . Dairy 2021, 2 (3):326-335. Bowen W, Koo H: Biology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms . Caries research 2011, 45 (1):69-86. Bitoun J, Liao S, Yao X, Ahn S-J, Isoda R, Nguyen A, Brady L, Burne R, Abranches J, Wen Z: BrpA is involved in regulation of cell envelope stress responses in Streptococcus mutans . Applied and environmental microbiology 2012, 78 (8):2914-2922. Aboutalebian S, Ahmadikia K, Fakhim H, Chabavizadeh J, Okhovat A, Nikaeen M, Mirhendi H: Direct detection and identification of the most common bacteria and fungi causing otitis externa by a stepwise multiplex PCR . Frontiers in cellular and infection microbiology 2021, 11 :210. Peres MA, Macpherson LM, Weyant RJ, Daly B, Venturelli R, Mathur MR, Listl S, Celeste RK, Guarnizo-Herreño CC, Kearns C: Oral diseases: a global public health challenge . The Lancet 2019, 394 (10194):249-260. Minguez M, Ennibi O, Perdiguero P, Lakhdar L, Abdellaoui L, Sanchez M, Sanz M, Herrera D: Antimicrobial susceptibilities of Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis strains from periodontitis patients in Morocco . Clinical Oral Investigations 2019, 23 (3):1161-1170. Diosma G, Romanin DE, Rey-Burusco MF, Londero A, Garrote GL: Yeasts from kefir grains: isolation, identification, and probiotic characterization . World Journal of Microbiology and Biotechnology 2014, 30 (1):43-53. Plessas S, Kiousi DE, Rathosi M, Alexopoulos A, Kourkoutas Y, Mantzourani I, Galanis A, Bezirtzoglou E: Isolation of a Lactobacillus paracasei Strain with Probiotic Attributes from Kefir Grains . Biomedicines 2020, 8 (12):594. Comelli EM, Guggenheim B, Stingele F, Neeser JR: Selection of dairy bacterial strains as probiotics for oral health . European journal of oral sciences 2002, 110 (3):218-224. Tahmourespour A, Salehi R, Kermanshahi RK: Lactobacillus acidophilus-derived biosurfactant effect on gtfB and gtfC expression level in Streptococcus mutans biofilm cells . Brazilian Journal of Microbiology 2011, 42 :330-339. Wen ZT, Scott‐Anne K, Liao S, De A, Luo M, Kovacs C, Narvaez BS, Faustoferri RC, Yu Q, Taylor CM: Deficiency of BrpA in Streptococcus mutans reduces virulence in rat caries model . Molecular oral microbiology 2018, 33 (5):353-363. Lee S-H, Kim Y-J: A comparative study of the effect of probiotics on cariogenic biofilm model for preventing dental caries . Archives of microbiology 2014, 196 (8):601-609. Tan YN, Zhang JH, Chen WN: GC-MS-Based Metabolomics Analysis of Prawn Shell Waste Co-Fermentation by Lactobacillus plantarum and Bacillus subtilis . Polysaccharides 2020, 1 (1):31-50. Additional Declarations No competing interests reported. Supplementary Files Fig5.png Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1654174","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":111300484,"identity":"7b6c15cc-b0ca-47c0-80c9-1f24e520fca9","order_by":0,"name":"khatereh sadat ekhteraei","email":"","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"khatereh","middleName":"sadat","lastName":"ekhteraei","suffix":""},{"id":111300486,"identity":"40afadda-990a-48f6-a014-26fd537ecf0c","order_by":1,"name":"Tahmineh Narimani","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYJCCA0DMww8kJEAMsFACMVokG0jRAgYGByBaCANz9rMPD92ouSNjfO3wwRuMOYdlGNgPP2B4uAe3FsuedIPDOcee8ZjdTku2YNx2mIeBJ82AIeEZPvekMRzOYTsM1JJjJgHWwpAD9MsBPFrOPwNq+XeYx3h2/jeIFv43BLTcANqS23aYx0A6hw2iRYKQLTeAtuT2HeaRuJ1mbJG4LZ2HTeKZwQH8Dktj/pzz7bA9/+zkhzc+brO25+dPfvjwBx4tqCABiNkYIJE7CkbBKBgFo4ACAABUYE+g5TbImwAAAABJRU5ErkJggg==","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Tahmineh","middleName":"","lastName":"Narimani","suffix":""},{"id":111300487,"identity":"32cbe034-223c-46a3-8a8a-f38a9fa71441","order_by":2,"name":"farkhondeh poursina","email":"","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"farkhondeh","middleName":"","lastName":"poursina","suffix":""},{"id":111300489,"identity":"c7e50696-bf02-4121-a259-bab439fcd07b","order_by":3,"name":"Arezoo Mirzaei","email":"","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Arezoo","middleName":"","lastName":"Mirzaei","suffix":""},{"id":111300490,"identity":"054357c8-558d-41ed-92bd-67eeff546955","order_by":4,"name":"Mohammad Sadegh Damavandi","email":"","orcid":"","institution":"Isfahan University of Medical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"Sadegh","lastName":"Damavandi","suffix":""}],"badges":[],"createdAt":"2022-05-13 17:44:09","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1654174/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1654174/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":22412557,"identity":"b28e50fd-c12f-4b0f-a113-83c70a4e2dee","added_by":"auto","created_at":"2022-06-08 15:02:48","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":184161,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of \u003cem\u003eLactobacillus \u003c/em\u003egenus\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-1654174/v1/3761e5b2c4f219cfad71ea98.png"},{"id":22412555,"identity":"ebf05ef1-f220-412b-b170-3d4f0ba687f3","added_by":"auto","created_at":"2022-06-08 15:02:48","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":131865,"visible":true,"origin":"","legend":"\u003cp\u003eAgarose gel electrophoresis of A) \u003cem\u003eLactobacillus plantarum\u003c/em\u003e\u0026nbsp;\u0026nbsp;B)\u003cem\u003e Lactobacillus rhamnosus\u003c/em\u003e\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-1654174/v1/7a04d7193888883393d0be08.png"},{"id":22412558,"identity":"64965dde-82e6-4a47-80f8-6da4172d46db","added_by":"auto","created_at":"2022-06-08 15:02:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":283599,"visible":true,"origin":"","legend":"\u003cp\u003eBiofilm reduction analysis A) Biofilm formation by \u003cem\u003eStreptococcus mutans\u003c/em\u003e in the presence of several dilutions of \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e and B) \u003cem\u003eLactobacillus plantarum \u003c/em\u003eafter 48 hours.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-1654174/v1/b5b8f6cd16aea9455ae1925d.png"},{"id":22413208,"identity":"46291324-acd6-4c5d-bf1f-70596757bdad","added_by":"auto","created_at":"2022-06-08 15:07:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":268349,"visible":true,"origin":"","legend":"\u003cp\u003eBiofilm reduction. A) Biofilm formation by \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e in the presence of several dilutions of \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e and B) \u003cem\u003eLactobacillus plantarum\u003c/em\u003e after 48 hours.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-1654174/v1/2c402140a3101c7d190939eb.png"},{"id":23651885,"identity":"52b46ae4-5518-42a0-9359-d7b607125c08","added_by":"auto","created_at":"2022-07-08 20:59:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1818308,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1654174/v1/75533586-f3a9-4c8f-b0af-1a9ebd227b74.pdf"},{"id":22412556,"identity":"3fe7334d-d22d-4da6-b766-976dcdb58105","added_by":"auto","created_at":"2022-06-08 15:02:48","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":29763,"visible":true,"origin":"","legend":"","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-1654174/v1/bdfa7b196eb61ff9227995da.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Antibacterial and Antibiofilm Properties of Different Strains of Lactobacillus spp. Isolated from Traditional Kefir Dough on Oral Pathogens with Real Time PCR","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTooth caries and periodontal disorders are common oral infectious illnesses linked to a dysbiosis of the bacteria that live in dental plaque biofilms and can affect adults and children's health [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. \u003cem\u003eStreptococcus mutans\u003c/em\u003e is a gram-positive anaerobic coccus, one of the most common main colonizing bacteria causing demineralization of the tooth structure by producing acids and resists acidic conditions. Moreover, \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e is a non-motile anaerobic gram-negative bacterium that causes periodontal diseases [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The incidence of these illnesses is associated with a number of variable factors. Bacterial biofilms, on the other hand, are now widely regarded as the primary pathogenic mechanism. Bacterial biofilms are collections of microorganisms encased in an extracellular polymeric viscosity produced by themselves [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. In fact, several disorders are caused through the interactions between common oral microbiota, host susceptibility, and environmental factors including nutrition, smoking, and oral hygiene. Biofilms are a physical barrier to the host's immunological response and act as a reservoir for prolonged infections [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. A particular enzyme called glucosyltransferase is required for the formation of these biofilms. The GTF gene encodes this enzyme, which belongs to the GH70 enzymatic family of glycosides hydrolases [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The \u003cem\u003ebrpA\u003c/em\u003e gene codes a predicted surface-associated protein that appears to be involved in biofilm formation, autolysis, and cell division [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Probiotics are believed to limit the proliferation of cariogenic bacteria and the creation of biofilms in order to provide anti-caries effects.\u003c/p\u003e \u003cp\u003eProbiotics inhibit growth and biofilm formation of cariogenic bacteria by exerting anti-caries effects. They are \"live microorganisms that, when administered in sufficient amounts, confer a health benefit on the host and have shown favorable properties in maintaining oral health,\" according to the WHO/FAO [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFermented dairy and non-dairy products, such as meat, fruits, cheese, and fermented milks, such as kefir, can potentially provide novel bacterial strains with possible probiotic properties [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Kefir is manufactured by fermenting milk with various bacteria, and is one of the most common probiotic sources. Kefir consists of over than 50 different species of LAB, yeasts, and acetic acid bacteria, as well as their metabolites including lactic acid, exopolysaccharides, and peptides, which have a variety of health benefits. The word kefir comes from the Turkish word keyif, which means \"pleasant feeling\" for the feelings experienced after drinking it [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Antimicrobial, antihypertensive, anti-inflammatory, anti-cariogenic, anti-allergic, and antioxidant properties were found in kefir [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Probiotic strains commonly belong to the Lactobacillus and Bifidobacterium. Lactobacillus is divided into three groups: namely obligatory homofermentative, facultative homofermentative, and obligate heterofermentative Lactobacillus (7). Some Lactobacillus species were introduced as potential probiotics in caries prevention owing to their inhibitory action against cariogenic \u003cem\u003eS. mutans\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e (2) The current of this study was conducted to determine the antibacterial effect of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e Supernatant on \u003cem\u003eS. mutans\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e, furthermore, inhibition of biofilm formation and the effect of these LAB on \u003cem\u003egtfB\u003c/em\u003e and \u003cem\u003ebrpA\u003c/em\u003e, which are involved in biofilm formation were investigated.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eIsolation and identification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIsfahan University of Medical Sciences\u0026apos; microbiology lab received five samples of traditional kefir dough from the local sources. Lyophilized Standard strains \u003cem\u003eS. mutans\u003c/em\u003e (ATCC 35668) and \u003cem\u003eP. gingivalis\u003c/em\u003e (ATCC 33277) were prepared from the Iranian industrial microbial collection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExamination of morphological characteristics of LAB\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLAB strains were identified morphologically using the catalase test, gram staining, temperature growth at 15\u0026deg;C and 45\u0026deg;C and pH levels using the procedures in Bergey\u0026apos;s book. The physical properties of each colony, as well as the cell appearance characteristics were examined via gram staining. To perform the catalase test and confirm the \u003cem\u003elactobacillus\u0026nbsp;\u003c/em\u003egenus, colonies identical to \u003cem\u003eLactobacillus\u0026nbsp;\u003c/em\u003ewith bacterial features of rod-shape, gram positive and without spores were sampled. Each strain was cultivated several times in MRS medium to ensure the purity of MRS culture bacterial\u0026nbsp;[11].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFermentation of carbohydrates of LAB\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe bacteria were cultivated on MRS in order so that fermentation and acid generation tests could be performed. The grown isolate was inoculated in a- tube containing fermentation liquid medium (1% of the desired sugar and phenol red reagent). The tubes were incubated at 37 \u0026deg; C under 5% carbon dioxide for 72 hours. Sugar consumption and acid production were attributed to the red color change of the culture media to yellow and the formation of bubbles in the tubes\u0026nbsp;[12].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular identification of LAB\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo begin with, Murray and Thomson procedures were used to extract the isolate\u0026apos;s DNA, with minor modifications. This procedure involved centrifuging 10 mL of bacterial solution (from a 24-hour culture) for 10 minutes at 13,000 rpm. Sediments were transferred into the micro tube. A milliliter of TBE lubricating buffer was added to them after half an hour. Subsequently, at a temperature of 60\u0026deg;C (on a hot plate), chloroform isoamyl alcohol (1:24) was added and well mixed. The materials were again centrifuged at 13,000 rpm for 5 minutes. The supernatant was transferred to new vials and the same volume of pure isopropanol was added. After completely mixing the contents of each vial, they were placed on ice for 10 minutes. The materials were centrifuged at 13,000 rpm for 10 minutes to precipitate, following which 500 \u0026micro;l of 70% ethanol was added. The samples were centrifuged for 5 minutes at 5,000 rpm, with the supernatant removed gently. The DNA vials were then left to dry for an hour at the room temperature. After the sediment dried, each microtube was filled with 100 liters of sterile deionized distilled water. A 1% agarose gel was used to validate the quality of the extracted \u0026nbsp;DNA through electrophoresis[13]. For checking the specificity of the selected primers in genus and species, they were blasted at NCBI. Afterwards the primers were purchased from Gene Technologies.\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u0026nbsp; \u003cstrong\u003eTable 1\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003eOptimized primer\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" dir=\"rtl\" style=\"border-collapse: collapse; margin: 0px auto;\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"15.064102564102564%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eReference\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.782051282051283%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eProduct Size\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"41.18589743589744%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSequence\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.14102564102564%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eTarget Gene\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.826923076923077%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eBacteria\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"15.064102564102564%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e[14]\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.782051282051283%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e245\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"41.18589743589744%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eF:CTCAAAACTAAACAAAGTTTC\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eR:CTTGTACACACCGCCCGTCA\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.14102564102564%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.826923076923077%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cem\u003e\u003cspan dir=\"LTR\"\u003eLacto\u003c/span\u003e\u003c/em\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;genus\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"15.064102564102564%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e12)\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.782051282051283%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e176\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"41.18589743589744%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eF:CGAGACAGCAATTCCTGCACTCG\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eCCTCAGAAACAGTCCGGTTGA\u003c/span\u003e:\u003cspan dir=\"LTR\"\u003eR\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.14102564102564%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cem\u003e\u003cspan dir=\"LTR\"\u003eapbE2\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.826923076923077%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cem\u003e\u003cspan dir=\"LTR\"\u003eLactobacillus plantarum\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"15.064102564102564%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003e12)\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.782051282051283%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e124\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"41.18589743589744%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eF:ATTTAACCGCAAGTGGCAGC\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eAAATTGTGTGAACCGGCGTA\u003c/span\u003e:\u003cspan dir=\"LTR\"\u003eR\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"13.14102564102564%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cem\u003e\u003cspan dir=\"LTR\"\u003eaes\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.826923076923077%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cem\u003e\u003cspan dir=\"LTR\"\u003eLactobacillus rhamnosus\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eProbiotic Lactobacilli preparation:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLactic acid bacteria (LAB) were cultured on MRS broth and incubated at 37\u0026deg; C for 18-24 hours under anaerobic conditions. The bacterial growth was then centrifuged for 15 minutes at 13000 rpm/min. The supernatant was collected and filtered through a Millipore 0.22 m filter after being adjusted to a pH of 7.5 with NaOH[14]. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAssay for sensitivity to \u003cem\u003elactobacillus\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSensitivity of pathogenic bacteria to different strains of \u003cem\u003elactobacillus\u003c/em\u003e was determined via the minimum inhibitory concentration (MIC) assay. The assay was done using the method described by Andrews [16]. According to this method, stock solutions containing 20 mg/ml of 10 different selected \u003cem\u003eLactobacillus\u003c/em\u003e were prepared. For preparation of the test inoculums the 48 h active cultures of pathogenic bacteria were adjusted to 0.5 McFarland standards (10\u003csup\u003e7\u003c/sup\u003e to 10\u003csup\u003e8\u003c/sup\u003e cfu/ml of bacteria) by adding several dilution of each probiotic powder in each well and microtiter plate\u0026nbsp;incubated for\u0026nbsp;48 h at 37\u0026deg;C[15, 16].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe well agar diffusion method for antimicrobial screening:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eUsing well diffusion technique proposed by Cadirci and Citak, the antibacterial activity of \u003cem\u003eLactobacillus\u003c/em\u003e spp. on and \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e was tested. \u003cem\u003eP. gingivalis\u003c/em\u003e was cultured on blood agar enriched with vitamin K1 and hemin (at a concentration equivalent to McFarland 1 standard) and \u003cem\u003eS. mutans\u003c/em\u003e suspension (at a concentration comparable to McFarland 0.5 standard) was cultured on blood agar complete with 5% defibrinated blood sheep medium. A number of the wells were drilled in the culture media. The wells were filled with100 \u0026micro;l of SCS.\u0026nbsp;For \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e and \u003cem\u003eStreptococcus mutans\u003c/em\u003e, inhibition zones were determined in millimeters after 72 hours of anaerobic incubation at 37\u0026deg;C and 48 hours of aerobic incubation at 37\u0026deg;C (14)[15].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe effect of Lactobacillus species on formation of biofilm:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor biofilm assays Streptococcus mutans was grown in BHI containing 2% sucrose, \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e was grown in BHI containing vitamin K and hemin while \u003cem\u003eLactobacillus\u003c/em\u003e species were grown in deMan Rogosa and Sharpe (MRS) broth without sucrose. All the microorganisms were incubated at 37\u0026deg;C in an anaerobic jar for 48h. To evaluate the effect of \u003cem\u003eLactobacillus\u003c/em\u003e spp. on formation of the biofilm of \u003cem\u003eStreptococcus mutans\u003c/em\u003e, the suspensions of each isolate were prepared as stated above. The suspensions were adjusted with their respected broth to 0.5 McFarland turbidity standards and several dilutions. Formation of \u003cem\u003eS. mutans\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e biofilm was assayed in the presence or absence of \u003cem\u003eLactobacillus\u003c/em\u003e strains in a 96-well polystyrene culture plate\u003cem\u003e. Lactobacillus\u003c/em\u003e strains and pathogenic bacteria were mixed at an equal ratio (1:1). Blank wells contained culture medium instead of probiotic strains. The plates were incubated at 37\u0026deg; C for 48 hrs. Quantitation of biofilms was performed using crystal violet based microtiter plate assay\u0026nbsp;[17].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGas chromatography-mass spectrometry:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe selected strains were inoculated in MRS broth and incubated at 30\u0026deg;C for 4 days.\u0026nbsp;Subsequently\u0026nbsp;the samples were centrifuged at 4000 rpm for 20 minutes. Equal amounts of ethyl acetate were added to the broth and incubated in a rotary shaker for 1 h. The downer layer of the broth was separated. The samples were analyzed with a Hewlett Packard 6850 Gas chromatograph, 5973 mass selective detector, and 7683B series injector (Agilent Technologies, Palo Alto, CA, USA) with helium as the carrier gas at a flow of 1.0 mL/min. One microliter of each sample was injected with 1 min of split flow delay and resolved on a 30 m \u0026times; 0.25 mm \u0026times; 0.25 \u0026micro;m DB5MS column (Agilent Technologies, Palo Alto, CA, USA). Inlet, interface, and ion source temperatures were 300 ◦C. Oven starting and final temperatures were within the rate of 5 ◦C/min for 36 min and then for 2 min at a constant temperature. Metabolite annotation was achieved by mass spectra comparison with analytical standards, in house library and the NIST14 database (National Institute of Standards and Technology, Gaithersburg, MD, USA)To prepare dried probiotic powder the upper layer of the broth was incubated, and allowed to dry\u0026nbsp;[18].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStreptococcus gene expression\u003c/strong\u003e:\u003c/p\u003e\n\u003cp\u003eWe used reverse transcription real-time PCR to evaluated the mRNA levels of \u003cem\u003eS. mutans\u003c/em\u003e genes encoding virulence proteins related to carbohydrate metabolism (\u003cem\u003egtfB\u003c/em\u003e) and biofilm formation (\u003cem\u003ebrpA\u003c/em\u003e) to examine the anti-biofilm formation mechanism, as described previously. For growth curve analysis, the reagent Pars Tous kit was used to extract total RNA and cDNA. A Nanodrop ND-2000 spectrophotometer utilized to assess RNA concentration (ThermoFisher Scientific). The cDNA was amplified with SYBR Premix Taq and the primer sets are given in Table 2 on an ABI 7500 system (Applied Biosystems, Foster City, CA, USA). For\u003cem\u003e\u0026nbsp;gtfB\u003c/em\u003e and \u003cem\u003ebrpA\u003c/em\u003e, the following real-time PCR conditions were used: 95\u0026deg;C for 10 minutes, followed by 40 cycles of 95\u0026deg;C for 30 seconds, 52\u0026deg;C for gtfB, 55\u0026deg; for brpA, and 60\u0026deg;C for 1 minute. The temperature was reduced at a rate of 0.1\u0026deg;C/s from 95\u0026deg;C to 60\u0026deg;C for melting curve analysis, while the fluorescence signal intensity was continuously measured. After adjusting to the \u003cem\u003e16SrRNA\u003c/em\u003e level, variations in mRNA expression levels were determined using ABI 7500 v.2.2 software (Applied Biosystems). The results are reported as a fold change compared to the control group, and fold changes were taken into account.\u0026nbsp;\u003c/p\u003e\n\u003cp dir=\"\" style=\"text-align: center;\"\u003e\u003cspan dir=\"\"\u003e\u003cstrong style='font-weight: 700; color: rgb(0, 0, 0); font-family: \"Times New Roman\"; font-size: medium; font-style: normal; font-variant-ligatures: normal; font-variant-caps: normal; letter-spacing: normal; orphans: 2; text-align: start; text-indent: 0px; text-transform: none; white-space: normal; widows: 2; word-spacing: 0px; -webkit-text-stroke-width: 0px; text-decoration-style: initial; text-decoration-color: initial;'\u003e\u003cspan dir=\"\"\u003eTable2\u003c/span\u003e\u003c/strong\u003e \u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp dir=\"\" style=\"text-align: center;\"\u003e\u003cspan dir=\"\"\u003eGroup-specific primer sets used for quantitative reverse transcription real-time PCR\u003c/span\u003e \u003cspan dir=\"\"\u003e:\u003c/span\u003e\u003c/p\u003e\n\u003cdiv align=\"\"\u003e\n \u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" dir=\"rtl\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.673805601317957%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eReference\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.96375617792422%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eSequence(5ˊ\u0026ndash;3)\u003c/span\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.532125205930807%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003ePrimers\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"12.355848434925864%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eTarget gene\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.474464579901152%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cstrong\u003e\u003cspan dir=\"LTR\"\u003eFunction\u003c/span\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.673805601317957%\"\u003e\n \u003cp dir=\"RTL\"\u003e[19]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.96375617792422%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eACGAACTTTGCCGTTATTGTCA\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eAGCAATGCAGCCAATCTACAA\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.532125205930807%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eFor\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eRev\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"12.355848434925864%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cem\u003e\u003cspan dir=\"LTR\"\u003egtfB\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.474464579901152%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eCarbohydrate metabolism-promoting genes\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.673805601317957%\"\u003e\n \u003cp dir=\"RTL\"\u003e[20]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.96375617792422%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eCGTGAGGTCATCAGCAAGGTC\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eCGCTGTACCCCAAAAGTTTAGG\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.532125205930807%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eFor\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eRev\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"12.355848434925864%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cem\u003e\u003cspan dir=\"LTR\"\u003ebrpA\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.474464579901152%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eRegulatory protein-encoding genes\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.673805601317957%\"\u003e\n \u003cp dir=\"RTL\"\u003e[21]\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"45.96375617792422%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eATGTTGGGTTAAGTCCCG\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eCTAGCGATTCCRRCTTCA\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.532125205930807%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eFor\u003c/span\u003e\u003c/p\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eRev\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"12.355848434925864%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cem\u003e\u003cspan dir=\"LTR\"\u003e16SrRNA\u003c/span\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.474464579901152%\"\u003e\n \u003cp dir=\"RTL\"\u003e\u003cspan dir=\"LTR\"\u003eHousekeeping gene\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eBacterial culture:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStreptococcus mutans\u003c/em\u003e and \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e were taken from the Department of Iranian industrial microbial collection and validated using Gram staining, biochemical and molecular analysis with particular primers. Five \u003cem\u003eLactobacillus plantarum\u003c/em\u003e strains and five \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e strains were identified from traditional kefir dough in\u0026nbsp;Different areas of Isfahan. According to the methods recommended by Bergey in manual of systematic bacteriology and Wood \u0026amp; Holzapfel in the genera of lactic acid bacteria, all isolates were studied for their morphological identification of strains using gram staining, catalase, oxidase and sugar fermentation test, grown at temperatures of 15\u0026deg; and 45 \u0026deg; C and different pHs[11].The results are shown in Table 3. All the isolates are Gram-positive, and polymorphic, but often filamentous with short-chain. Oxidase, catalase, nitrate reduction and VP (Voges Proskauer) were negative.\u0026nbsp;Based on the tests described five isolates were \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and five were \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e. They all grew at NaCl %4 and %6.5, pH of 3.8 and 7.8.\u003cem\u003e\u0026nbsp;Lactobacillus plantarum\u0026nbsp;\u003c/em\u003egrew at 15\u0026deg;C and 45\u0026deg;C, but the \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e grow at 15\u0026deg;.Elevation of \u003cem\u003eLactobacillus plantarum\u0026nbsp;\u003c/em\u003ewas convex and flat whereas that of \u003cem\u003eLactobacillus rhamnosus\u0026nbsp;\u003c/em\u003ewas flat. Colony color of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e were creamy shine and creamy white but \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e were off white and white.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFermentation of carbohydrates:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the isolates of \u003cem\u003eLactobacillus plantarum\u0026nbsp;\u003c/em\u003ewere able to ferment Arabinose, Cellobiose, Mannitol, Gluconate, Raffinose, Ribose, Sorbitol, Sucrose and Xylose.\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003eAll the isolates of \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e were able to ferment Arabinose, Cellobiose, Mannitol, Gluconate, Ribose, Sorbitol and Sucrose but not Raffinose and Xylose.\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 3\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u0026nbsp;Fermentation of different carbohydrates \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.530326594090202%\"\u003e\n \u003cp\u003eCarbohydrate\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;Bacteria\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.087091757387247%\"\u003e\n \u003cp\u003eXylose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.864696734059098%\"\u003e\n \u003cp\u003eSucrose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.864696734059098%\"\u003e\n \u003cp\u003eSorbitol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.9315707620528775%\"\u003e\n \u003cp\u003eRibose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.26438569206843%\"\u003e\n \u003cp\u003eRaffinose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.73094867807154%\"\u003e\n \u003cp\u003eGluconate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.797822706065318%\"\u003e\n \u003cp\u003eMannitol\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.19751166407465%\"\u003e\n \u003cp\u003eCellobiose\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.73094867807154%\"\u003e\n \u003cp\u003eArabinose\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.530326594090202%\"\u003e\n \u003cp\u003e\u003cem\u003eLactobacillus plantarum\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.087091757387247%\"\u003e\n \u003cp\u003ed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.864696734059098%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.864696734059098%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.9315707620528775%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.26438569206843%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.73094867807154%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.797822706065318%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.19751166407465%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.73094867807154%\"\u003e\n \u003cp\u003ed\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"13.530326594090202%\"\u003e\n \u003cp\u003e\u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.087091757387247%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.864696734059098%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.864696734059098%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.9315707620528775%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.26438569206843%\"\u003e\n \u003cp\u003e-\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.73094867807154%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"9.797822706065318%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"11.19751166407465%\"\u003e\n \u003cp\u003e+\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"10.73094867807154%\"\u003e\n \u003cp\u003ed\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMolecular identification of Lactobacillus strains:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe results of the PCR assays were 200 bp for the genus of \u003cem\u003eLactobacillus\u003c/em\u003e,176 bp for \u003cem\u003eL. plantarum\u003c/em\u003e and 124 bp for the \u003cem\u003eL. rhamnosus\u0026nbsp;\u003c/em\u003e(Fig1,2).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial susceptibility:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe MICs of 10 antimicrobials of \u003cem\u003eLactobacillus\u003c/em\u003e were determined for all the strains. The MIC for \u003cem\u003eStreptococcus mutans\u003c/em\u003e was 5 mg/ml and for \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e, it was 20 mg/ml.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntimicrobial assay:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eLactobacilli\u003c/em\u003e were tested for their antibacterial properties against cariogenic (\u003cem\u003eS. mutans\u003c/em\u003e) and periodontal pathogenic (\u003cem\u003eP. gingivalis\u003c/em\u003e) bacteria (Table4). After 48 hours, all of the \u003cem\u003eLactobacilli\u0026nbsp;\u003c/em\u003estrains tested displayed an antibacterial activity against \u003cem\u003eS. mutans\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e, according to the results of the disk diffusion method.\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 4\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003eAntibacterial efficacy of probiotic supernatant against oral infections\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"11.278195488721805%\"\u003e\n \u003cp\u003e\u003cem\u003eNumber of isolate LAB\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.037593984962406%\"\u003e\n \u003cp\u003e\u003cem\u003eLactobacillus isolated\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.p1\u003csup\u003e*\u003c/sup\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.p2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.p3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.p4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.p5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.r1\u003csup\u003e*\u003c/sup\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.r2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.r3\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.r4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e\u003cem\u003eL.r5\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" width=\"11.278195488721805%\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003ePathogenic bacteria\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"15.037593984962406%\"\u003e\n \u003cp\u003e\u003cem\u003eStreptococcus mutans\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e13mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e15mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e17mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e12mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e21mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e14mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e12mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e15mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e17mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"7.368421052631579%\"\u003e\n \u003cp\u003e12mm\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"16.949152542372882%\"\u003e\n \u003cp\u003e\u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e13mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e15mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e19mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e15mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e19mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e15mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e14mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e17mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e20mm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"8.305084745762711%\"\u003e\n \u003cp\u003e16mm\u003c/p\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e*L.r= \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; * L.p= \u003cem\u003eLactobacillus plantarum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eOverall, the mean diameter of the growth inhibition halo for \u003cem\u003eLactobacillus plantarum\u003c/em\u003e vs. \u003cem\u003eStreptococcus mutans\u003c/em\u003e was 15.60 mm, which was 14 mm for \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e vs. \u003cem\u003eStreptococcus mutans\u003c/em\u003e. Moreover, the mean diameter of the growth inhibition halo for Lactobacillus plantarum vs. \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e was 15.60 mm and that for \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e vs. \u003cem\u003ePorphyromonas\u003c/em\u003e \u003cem\u003egingivalis\u003c/em\u003e was 16.40.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReduced biofilm formation of supernatant of \u003cem\u003eLactobacillus\u003c/em\u003e against two oral pathogens:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBiofilm formation of \u003cem\u003eStreptococcus mutans\u003c/em\u003e and \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e was compared in the absence and presence of \u003cem\u003eLactobacillus\u003c/em\u003e species.\u0026nbsp;Oral pathogens biofilm production was inhibited considerably by all the\u003cem\u003e\u0026nbsp;Lactobacillus\u003c/em\u003e species utilized in this experiment which were significantly (Fig3, 4). Different concentrations of both genera of \u003cem\u003eLactobacillus\u003c/em\u003e had a decreasing effect on oral pathogens, but from a concentration of 10\u003csup\u003e-5\u003c/sup\u003e down, a greater decreasing effect was observed.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDecrease in \u003cem\u003egtfB\u003c/em\u003e and \u003cem\u003ebrpA\u003c/em\u003e expression of \u003cem\u003eS. mutans\u003c/em\u003e by \u003cem\u003eL. plantarum\u003c/em\u003e and \u003cem\u003eL. rhamnosus\u003c/em\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression of the genes involved in \u003cem\u003eS. mutans\u003c/em\u003e pathogenicity was studied in order to assess the effect of \u003cem\u003eL. rhamnosus\u003c/em\u003e and \u003cem\u003eL. plantarum\u003c/em\u003e supernatants on \u003cem\u003eS. mutans\u003c/em\u003e. The signal transduction system was regulated by the \u003cem\u003ebrpA\u003c/em\u003e genes, and the representative genes involved in glucan synthesis included \u003cem\u003egtfB\u003c/em\u003e. Both genes were suppressed by \u003cem\u003eL. rhamnosus\u003c/em\u003e and \u003cem\u003eL. plantarum\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGas chromatography-mass spectrometry analysis:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAntimicrobial compounds detected in the culture supernatant of five \u003cem\u003eL. plantarum\u003c/em\u003e fermentations in kefir dough (table 5).\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 5\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003eIsolated\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eantimicrobial compounds of five \u003cem\u003eLactobacillus plantarum\u0026nbsp;\u003c/em\u003ein kefir dough\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"25.59726962457338%\"\u003e\n \u003cp\u003e\u003cstrong\u003eXylene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"36.86006825938566%\"\u003e\n \u003cp\u003e\u003cstrong\u003e3 methyl 3 pyrazoline-5-one\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.331058020477816%\"\u003e\n \u003cp\u003e\u003cstrong\u003e2(5H) Furanone-3 methyl\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.21160409556314%\"\u003e\n \u003cp\u003e\u003cstrong\u003eEicosane\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"25.59726962457338%\"\u003e\n \u003cp\u003e\u003cem\u003eBenzene 1.3 \u0026nbsp; \u0026nbsp; dimethyl\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"36.86006825938566%\"\u003e\n \u003cp\u003e2,4 dimethylcyclopent-4-ENE-1,3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.331058020477816%\"\u003e\n \u003cp\u003eO-Cyanobenzoic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.21160409556314%\"\u003e\n \u003cp\u003e2-Pyrrolidione\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"25.59726962457338%\"\u003e\n \u003cp\u003e\u003cem\u003eBenzene 1.4 dimethyl\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"36.86006825938566%\"\u003e\n \u003cp\u003e(3,4-Dimethoxybenzyl)-3,4-dihydro6,7dimethoxyisoquinolinium chloride\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.331058020477816%\"\u003e\n \u003cp\u003eN-hexadecanioc acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.21160409556314%\"\u003e\n \u003cp\u003eHeptacosane\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"25.59726962457338%\"\u003e\n \u003cp\u003e\u003cem\u003e9-octadecenamide\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"36.86006825938566%\"\u003e\n \u003cp\u003eTridecane\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"21.331058020477816%\"\u003e\n \u003cp\u003eNonadecane\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"16.21160409556314%\"\u003e\n \u003cp\u003eCyclotridecane\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"25.59726962457338%\"\u003e\n \u003cp\u003e\u003cem\u003eTetradecane\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"36.86006825938566%\"\u003e\n \u003cp\u003eCycloheptasiloxane\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" width=\"37.54266211604096%\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAntimicrobial compounds detected in the culture supernatant of five \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e fermentations in kefir dough (Table6).\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e\u003cstrong\u003eTable 6\u003c/strong\u003e\u003c/p\u003e\n\u003cp style=\"text-align: center;\"\u003e Isolated\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eantimicrobial compounds of five \u003cem\u003eLactobacillus\u0026nbsp;\u003c/em\u003e\u003cem\u003erhamnosus\u0026nbsp;\u003c/em\u003ein kefir dough\u003c/p\u003e\n\u003ctable border=\"0\" cellpadding=\"0\" cellspacing=\"0\" style=\"border-collapse: collapse; margin: 0px auto;\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.961948249619482%\"\u003e\n \u003cp\u003e\u003cstrong\u003eP-xylene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.549467275494674%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCyclotrisiloxane-hexamethyl\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"22.526636225266362%\"\u003e\n \u003cp\u003e\u003cstrong\u003eCycloheptasiloxane\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.961948249619482%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTetracosamethyl-cyclododecasiloxane\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.961948249619482%\"\u003e\n \u003cp\u003eBenzene,1,3 dimethyl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.549467275494674%\"\u003e\n \u003cp\u003eTetradecane\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"22.526636225266362%\"\u003e\n \u003cp\u003eHexadecane\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.961948249619482%\"\u003e\n \u003cp\u003eGamma terpinene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" width=\"24.961948249619482%\"\u003e\n \u003cp\u003eGibberellic acid\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"27.549467275494674%\"\u003e\n \u003cp\u003eCycloheptasiloxane\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"22.526636225266362%\"\u003e\n \u003cp\u003eEicosane\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" width=\"24.961948249619482%\"\u003e\n \u003cp\u003eBeta-Pinene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;In general, several compounds were common in both species of \u003cem\u003eLactobacillus\u003c/em\u003e including Xylene, Benzene 1,3 dimethyl, Tetradecane, Cycloheptasiloxane, hexadecane and Eicosane.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOral diseases are among the most prevalent diseases globally and have serious health threatening effects because one of the predisposing factors for systemic diseases, diagnosis and treatment of this disease is important. Two frequent human infectious illnesses are dental caries and periodontitis [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Today, due to the various side effects of chemical drugs and antibiotics, researchers have come up with new methods and utilization of beneficial microorganisms for treating and controlling diseases [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Probiotics have been studied for their importance in the treatment of a variety of illnesses. Kefir grains include lactic acid bacteria, acetic acid bacteria, yeasts, and potentially other microbes, and have been connected with health benefits for decades [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]Certain \u003cem\u003eLactobacillus\u003c/em\u003e strains have been demonstrated to have the capacity to disrupt oral ecology by suppressing pathogenic microbes such as \u003cem\u003eS. mutans\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Due to the fact that there are no complete details on the separation of lactic acid bacteria from traditional kefir dough, studies have been performed to identify lactic acid bacteria from these kefir doughs. Lactic acid bacteria are found in a wide range of foods and are abundant in a wide range geographical conditions [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This variety in dairy products in the world is also very complex and can be an incentive to screen these products with the goal of achieving to suitable strains with special functional and technological characteristics[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] In 2002 Comeli al. studied the effect of bacterial strains of \u003cem\u003eLactobacillus lactis\u003c/em\u003e and \u003cem\u003eBacillus stearothermophilus\u003c/em\u003e in dairy products on oral health, They concluded that dairy strains were able to alter some of the characteristics of some oral bacteria, especially \u003cem\u003eStreptococcus oralis\u003c/em\u003e colony count was significantly reduced in the presence of probiotics used [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the study by Tahmourespour and et al. in 2011 the effect of a biosurfactant isolated from \u003cem\u003eL. acidophilus\u003c/em\u003e on the formation of biofilm of \u003cem\u003eS. mutans\u003c/em\u003e ATCC35668 and \u003cem\u003eS. mutans\u003c/em\u003e isolated from dental plaque was investigated. The effect of the mentioned biosurfactant on the expression level of \u003cem\u003egtfA / B\u003c/em\u003e genes in these two strains was also shown. It was found that the derived biosurfactant was effective on the surface properties of biofilm formation, the ability to bind and express these genes[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In 2012 Zezhang T. Wen et al. studied the \u003cem\u003ebrpA\u003c/em\u003e gene, and concluded that \u003cem\u003ebrpA\u003c/em\u003e plays an important role in the pathophysiology of \u003cem\u003eS.mutans\u003c/em\u003e and could be a potential target in modulating its virulence factors[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In 2014, Hoon Lee Sung et al. reported that \u003cem\u003eLactobacillus acidophilus\u003c/em\u003e can inhibit the effect of \u003cem\u003egtfB / gtfC / gtfD\u003c/em\u003e genes involved in tooth decay in their research on investigating the effect of probiotics on cariogenic biofilm model[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In 2018, DANA JEONG et al. isolated \u003cem\u003eLactobacillus kefiranofaciens\u003c/em\u003e from kefir and examined its inhibitory effect on eight genes in \u003cem\u003eStreptococcus mutans\u003c/em\u003e,They concluded that \u003cem\u003eLactobacillus\u003c/em\u003e could reduce the expression of genes involved in tooth decay caused by \u003cem\u003eStreptococcus mutans\u003c/em\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. In 2020, the derivatives of Nonadecanoic acid, benzoic acid, hexadecanoic acid and pyrrol were separated from the \u003cem\u003eLactobacillus plantarum\u003c/em\u003e. The results of this research are in line with those reported here in [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. We extracted LAB from kefir dough and tested its antibacterial properties against \u003cem\u003eS. mutans\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e biofilms. After treatment with probiotic supernatant, the biofilm generated by \u003cem\u003eStreptococcus mutans\u003c/em\u003e and \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e decreased significantly, while the inhibitory zone around colonies of \u003cem\u003eStreptococcus mutans\u003c/em\u003e and \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e increased. The impact of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e on the expression of the \u003cem\u003egtfB\u003c/em\u003e and \u003cem\u003ebrpA\u003c/em\u003e genes in \u003cem\u003eS. mutans\u003c/em\u003e was also investigated in this study. \u003cem\u003egtfB\u003c/em\u003e is a key virulence factor for \u003cem\u003eStreptococcus mutans\u003c/em\u003e which is responsible for the synthesis of insoluble glucans, that form dental plaque, Furthermore, it might be a selective therapeutic target for cariogenic biofilm avoidance[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. \u003cem\u003ebrpA\u003c/em\u003e (\u003cem\u003elytR\u003c/em\u003e) encoding \u003cem\u003ebrpA\u003c/em\u003e regulatory protein has been described as an important regulator of biofilm formation. Furthermore this gene encodes a putative surface-associated protein that has a role in biofilm formation, autolysis, and cell division [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The obtained findings here in demonstrated the considerable antimicrobial and antibiofilm activity of probiotic bacteria \u003cem\u003eL.plantarum\u003c/em\u003e and \u003cem\u003eL.rhamnosus\u003c/em\u003e against \u003cem\u003eS. mutans\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e biofilms. The culture supernatant could also suppress the expression of virulence factors involved in polysaccharide synthesis and those that integrate external signals in a regulatory network composed of expression levels of \u003cem\u003egtfB\u003c/em\u003e and \u003cem\u003ebrpA\u003c/em\u003e, which are also involved in biofilm formation and play a key role in stress response regulation. Probiotic \u003cem\u003eLactobacilli\u003c/em\u003e can be used instead of antibiotics as a therapeutic alternative to inhibit growth and biofilms formation in \u003cem\u003eStreptococcus mutans\u003c/em\u003e causing dental diseases, and \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e causing gingivitis. Generally, \u003cem\u003eLactobacillus Plantarum\u003c/em\u003e has further inhibitory effects on both oral pathogens in comparison with \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eFinally, \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e reduce the expression of critical regulatory factors, which limits \u003cem\u003eS. mutans\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e biofilm development and stability.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eKSE: Data curation; Formal analysis; Investigation; Methodology; Writing - original draft, TN: Funding acquisition; Formal analysis; Project administration; Supervision; Validation; Writing - review \u0026amp; editing. FP: Data curation, AM and MSD: Investigation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by Medical Sciences University of Isfahan (Grant number: 399075).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatements and Declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Ethics Committee of Isfahan University of Medical Sciences approved the ethical aspect of this\u0026nbsp;study\u0026nbsp;(IR. MUI.MED.REC.1399.260\u003cstrong\u003e).\u003c/strong\u003e This article does not contain any studies with human or animal subjects.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWasfi R, Abd El‐Rahman OA, Zafer MM, Ashour HM: \u003cstrong\u003eProbiotic Lactobacillus sp. inhibit growth, biofilm formation and gene expression of caries\u003c/strong\u003e\u003cstrong\u003e‐\u003c/strong\u003e\u003cstrong\u003einducing Streptococcus mutans\u003c/strong\u003e. \u003cem\u003eJournal of cellular and molecular medicine \u003c/em\u003e2018, \u003cstrong\u003e22\u003c/strong\u003e(3):1972-1983.\u003c/li\u003e\n\u003cli\u003eSamot J, Belkhelfa H, Haddioui L, Badet C: \u003cstrong\u003eProbiotic Properties of Lactobacilli That Could Be Used Against Periodontitis\u003c/strong\u003e. \u003cem\u003eProbiotics Heal \u003c/em\u003e2017, \u003cstrong\u003e5\u003c/strong\u003e(3).\u003c/li\u003e\n\u003cli\u003eManmontri C, Nirunsittirat A, Piwat S, Wattanarat O, Pahumunto N, Makeudom A, Sastraruji T, Krisanaprakornkit S, Teanpaisan R: \u003cstrong\u003eReduction of Streptococcus mutans by probiotic milk: a multicenter randomized controlled trial\u003c/strong\u003e. \u003cem\u003eClinical oral investigations \u003c/em\u003e2019:1-12.\u003c/li\u003e\n\u003cli\u003eRossoni RD, dos Santos Velloso M, de Barros PP, de Alvarenga JA, Dos Santos JD, dos Santos Prado ACC, de Camargo Ribeiro F, Anbinder AL, Junqueira JC: \u003cstrong\u003eInhibitory effect of probiotic Lactobacillus supernatants from the oral cavity on Streptococcus mutans biofilms\u003c/strong\u003e. \u003cem\u003eMicrobial pathogenesis \u003c/em\u003e2018, \u003cstrong\u003e123\u003c/strong\u003e:361-367.\u003c/li\u003e\n\u003cli\u003eWang Z, Zhou Y, Han Q, Ye X, Chen Y, Sun Y, Liu Y, Zou J, Qi G, Zhou X: \u003cstrong\u003eSynonymous point mutation of gtfB gene caused by therapeutic X-rays exposure reduced the biofilm formation and cariogenic abilities of Streptococcus mutans\u003c/strong\u003e. \u003cem\u003eCell \u0026amp; bioscience \u003c/em\u003e2021, \u003cstrong\u003e11\u003c/strong\u003e(1):1-13.\u003c/li\u003e\n\u003cli\u003eAlves-Barroco C, Roma-Rodrigues C, Balasubramanian N, Guimar\u0026atilde;es MA, Ferreira-Carvalho BT, Muthukumaran J, Nunes D, Fortunato E, Martins R, Santos-Silva T: \u003cstrong\u003eBiofilm development and computational screening for new putative inhibitors of a homolog of the regulatory protein BrpA in Streptococcus dysgalactiae subsp. dysgalactiae\u003c/strong\u003e. \u003cem\u003eInternational Journal of Medical Microbiology \u003c/em\u003e2019, \u003cstrong\u003e309\u003c/strong\u003e(3-4):169-181.\u003c/li\u003e\n\u003cli\u003eJiang Q, Stamatova I, Kainulainen V, Korpela R, Meurman JH: \u003cstrong\u003eInteractions between Lactobacillus rhamnosus GG and oral micro-organisms in an in vitro biofilm model\u003c/strong\u003e. \u003cem\u003eBMC microbiology \u003c/em\u003e2016, \u003cstrong\u003e16\u003c/strong\u003e(1):1-11.\u003c/li\u003e\n\u003cli\u003eJeong D, Kim D-H, Song K-Y, Seo K-H: \u003cstrong\u003eAntimicrobial and anti-biofilm activities of Lactobacillus kefiranofaciens DD2 against oral pathogens\u003c/strong\u003e. \u003cem\u003eJournal of oral microbiology \u003c/em\u003e2018, \u003cstrong\u003e10\u003c/strong\u003e(1):1472985.\u003c/li\u003e\n\u003cli\u003eSlattery C, Cotter PD, W O\u0026rsquo;Toole P: \u003cstrong\u003eAnalysis of health benefits conferred by Lactobacillus species from kefir\u003c/strong\u003e. \u003cem\u003eNutrients \u003c/em\u003e2019, \u003cstrong\u003e11\u003c/strong\u003e(6):1252.\u003c/li\u003e\n\u003cli\u003eLeite AM, Miguel M, Peixoto R, Ruas-Madiedo P, Paschoalin V, Mayo B, Delgado S: \u003cstrong\u003eProbiotic potential of selected lactic acid bacteria strains isolated from Brazilian kefir grains\u003c/strong\u003e. \u003cem\u003eJournal of dairy science \u003c/em\u003e2015, \u003cstrong\u003e98\u003c/strong\u003e(6):3622-3632.\u003c/li\u003e\n\u003cli\u003eVos P, Garrity G, Jones D, Krieg NR, Ludwig W, Rainey FA, Schleifer K-H, Whitman WB: \u003cstrong\u003eBergey\u0026apos;s manual of systematic bacteriology: Volume 3: The Firmicutes\u003c/strong\u003e, vol. 3: Springer Science \u0026amp; Business Media; 2011.\u003c/li\u003e\n\u003cli\u003eGemechu T: \u003cstrong\u003eReview on lactic acid bacteria function in milk fermentation and preservation\u003c/strong\u003e. \u003cem\u003eAfrican Journal of Food Science \u003c/em\u003e2015, \u003cstrong\u003e9\u003c/strong\u003e(4):170-175.\u003c/li\u003e\n\u003cli\u003eBarnett R, Larson G: \u003cstrong\u003eA phenol\u0026ndash;chloroform protocol for extracting DNA from ancient samples\u003c/strong\u003e. In: \u003cem\u003eAncient DNA.\u003c/em\u003e Springer; 2012: 13-19.\u003c/li\u003e\n\u003cli\u003eMantzourani I, Chondrou P, Bontsidis C, Karolidou K, Terpou A, Alexopoulos A, Bezirtzoglou E, Galanis A, Plessas S: \u003cstrong\u003eAssessment of the probiotic potential of lactic acid bacteria isolated from kefir grains: evaluation of adhesion and antiproliferative properties in in vitro experimental systems\u003c/strong\u003e. \u003cem\u003eAnnals of Microbiology \u003c/em\u003e2019, \u003cstrong\u003e69\u003c/strong\u003e(7):751-763.\u003c/li\u003e\n\u003cli\u003ePangsomboon K, Kaewnopparat S, Pitakpornpreecha T, Srichana T: \u003cstrong\u003eAntibacterial activity of a bacteriocin from Lactobacillus paracasei HL32 against Porphyromonas gingivalis\u003c/strong\u003e. \u003cem\u003eArchives of oral biology \u003c/em\u003e2006, \u003cstrong\u003e51\u003c/strong\u003e(9):784-793.\u003c/li\u003e\n\u003cli\u003eHoque M, Akter F, Hossain K, Rahman M, Billah M, Islam K: \u003cstrong\u003eIsolation, identification and analysis of probiotic properties of Lactobacillus spp. from selective regional yoghurts\u003c/strong\u003e. \u003cem\u003eWorld J Dairy Food Sci \u003c/em\u003e2010, \u003cstrong\u003e5\u003c/strong\u003e(1):39-46.\u003c/li\u003e\n\u003cli\u003eAhmed A, Dachang W, Lei Z, Jianjun L, Juanjuan Q, Yi X: \u003cstrong\u003eEffect of Lactobacillus species on Streptococcus mutans biofilm formation\u003c/strong\u003e. \u003cem\u003ePakistan journal of pharmaceutical sciences \u003c/em\u003e2014, \u003cstrong\u003e27\u003c/strong\u003e.\u003c/li\u003e\n\u003cli\u003eScano P, Pisano MB, Murgia A, Cosentino S, Caboni P: \u003cstrong\u003eGC-MS metabolomics and antifungal characteristics of autochthonous Lactobacillus strains\u003c/strong\u003e. \u003cem\u003eDairy \u003c/em\u003e2021, \u003cstrong\u003e2\u003c/strong\u003e(3):326-335.\u003c/li\u003e\n\u003cli\u003eBowen W, Koo H: \u003cstrong\u003eBiology of Streptococcus mutans-derived glucosyltransferases: role in extracellular matrix formation of cariogenic biofilms\u003c/strong\u003e. \u003cem\u003eCaries research \u003c/em\u003e2011, \u003cstrong\u003e45\u003c/strong\u003e(1):69-86.\u003c/li\u003e\n\u003cli\u003eBitoun J, Liao S, Yao X, Ahn S-J, Isoda R, Nguyen A, Brady L, Burne R, Abranches J, Wen Z: \u003cstrong\u003eBrpA is involved in regulation of cell envelope stress responses in Streptococcus mutans\u003c/strong\u003e. \u003cem\u003eApplied and environmental microbiology \u003c/em\u003e2012, \u003cstrong\u003e78\u003c/strong\u003e(8):2914-2922.\u003c/li\u003e\n\u003cli\u003eAboutalebian S, Ahmadikia K, Fakhim H, Chabavizadeh J, Okhovat A, Nikaeen M, Mirhendi H: \u003cstrong\u003eDirect detection and identification of the most common bacteria and fungi causing otitis externa by a stepwise multiplex PCR\u003c/strong\u003e. \u003cem\u003eFrontiers in cellular and infection microbiology \u003c/em\u003e2021, \u003cstrong\u003e11\u003c/strong\u003e:210.\u003c/li\u003e\n\u003cli\u003ePeres MA, Macpherson LM, Weyant RJ, Daly B, Venturelli R, Mathur MR, Listl S, Celeste RK, Guarnizo-Herre\u0026ntilde;o CC, Kearns C: \u003cstrong\u003eOral diseases: a global public health challenge\u003c/strong\u003e. \u003cem\u003eThe Lancet \u003c/em\u003e2019, \u003cstrong\u003e394\u003c/strong\u003e(10194):249-260.\u003c/li\u003e\n\u003cli\u003eMinguez M, Ennibi O, Perdiguero P, Lakhdar L, Abdellaoui L, Sanchez M, Sanz M, Herrera D: \u003cstrong\u003eAntimicrobial susceptibilities of Aggregatibacter actinomycetemcomitans and Porphyromonas gingivalis strains from periodontitis patients in Morocco\u003c/strong\u003e. \u003cem\u003eClinical Oral Investigations \u003c/em\u003e2019, \u003cstrong\u003e23\u003c/strong\u003e(3):1161-1170.\u003c/li\u003e\n\u003cli\u003eDiosma G, Romanin DE, Rey-Burusco MF, Londero A, Garrote GL: \u003cstrong\u003eYeasts from kefir grains: isolation, identification, and probiotic characterization\u003c/strong\u003e. \u003cem\u003eWorld Journal of Microbiology and Biotechnology \u003c/em\u003e2014, \u003cstrong\u003e30\u003c/strong\u003e(1):43-53.\u003c/li\u003e\n\u003cli\u003ePlessas S, Kiousi DE, Rathosi M, Alexopoulos A, Kourkoutas Y, Mantzourani I, Galanis A, Bezirtzoglou E: \u003cstrong\u003eIsolation of a Lactobacillus paracasei Strain with Probiotic Attributes from Kefir Grains\u003c/strong\u003e. \u003cem\u003eBiomedicines \u003c/em\u003e2020, \u003cstrong\u003e8\u003c/strong\u003e(12):594.\u003c/li\u003e\n\u003cli\u003eComelli EM, Guggenheim B, Stingele F, Neeser JR: \u003cstrong\u003eSelection of dairy bacterial strains as probiotics for oral health\u003c/strong\u003e. \u003cem\u003eEuropean journal of oral sciences \u003c/em\u003e2002, \u003cstrong\u003e110\u003c/strong\u003e(3):218-224.\u003c/li\u003e\n\u003cli\u003eTahmourespour A, Salehi R, Kermanshahi RK: \u003cstrong\u003eLactobacillus acidophilus-derived biosurfactant effect on gtfB and gtfC expression level in Streptococcus mutans biofilm cells\u003c/strong\u003e. \u003cem\u003eBrazilian Journal of Microbiology \u003c/em\u003e2011, \u003cstrong\u003e42\u003c/strong\u003e:330-339.\u003c/li\u003e\n\u003cli\u003eWen ZT, Scott‐Anne K, Liao S, De A, Luo M, Kovacs C, Narvaez BS, Faustoferri RC, Yu Q, Taylor CM: \u003cstrong\u003eDeficiency of BrpA in Streptococcus mutans reduces virulence in rat caries model\u003c/strong\u003e. \u003cem\u003eMolecular oral microbiology \u003c/em\u003e2018, \u003cstrong\u003e33\u003c/strong\u003e(5):353-363.\u003c/li\u003e\n\u003cli\u003eLee S-H, Kim Y-J: \u003cstrong\u003eA comparative study of the effect of probiotics on cariogenic biofilm model for preventing dental caries\u003c/strong\u003e. \u003cem\u003eArchives of microbiology \u003c/em\u003e2014, \u003cstrong\u003e196\u003c/strong\u003e(8):601-609.\u003c/li\u003e\n\u003cli\u003eTan YN, Zhang JH, Chen WN: \u003cstrong\u003eGC-MS-Based Metabolomics Analysis of Prawn Shell Waste Co-Fermentation by Lactobacillus plantarum and Bacillus subtilis\u003c/strong\u003e. \u003cem\u003ePolysaccharides \u003c/em\u003e2020, \u003cstrong\u003e1\u003c/strong\u003e(1):31-50.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Antibacterial, Kefir dough, Lactobacillus strains, Oral pathogens, Real time PCR, gene expression","lastPublishedDoi":"10.21203/rs.3.rs-1654174/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1654174/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOral illnesses such as dental caries and gingivitis are frequent. In these kinds of infection, the bacteria are thought to use biofilm formation as a pathogenic mechanism. Today, due to the side effects of chemical medications and resistance to antibiotics, the use of probiotics is of great importance as a suitable alternative way for infection treatment. Probiotics have shown favourable properties in terms of maintaining oral health. Kefir, which is made up of complex microbiota mainly \u003cem\u003eLactobacillus\u003c/em\u003e spp., has been suggested as a potential reservoir for probiotic. The present research aimed to isolate and identify lactic acid bacteria from traditional kefir dough as a probiotic that suppresses \u003cem\u003eS. mutans\u003c/em\u003e and \u003cem\u003eP. gingivalis\u003c/em\u003e growth, biofilm formation, and gene expression. In this study, \u003cem\u003eLactobacillus\u003c/em\u003e spp. was tested for antibacterial (well agar diffusion technique) and antibiofilm (crystal violet assay) properties against \u003cem\u003eStreptococcus mutans\u003c/em\u003e (ATCC 35668) and \u003cem\u003ePorphyromonas gingivalis\u003c/em\u003e (ATCC 33277). Through the use of real-time polymerase chain reaction, we explored whether \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e inhibited expression of \u003cem\u003eStreptococcus mutans\u003c/em\u003e genes involved in biofilm formation and stress survival. Additionally, \u003cem\u003eLactobacillus plantarum\u003c/em\u003e and \u003cem\u003eLactobacillus rhamnosus\u003c/em\u003e dramatically inhibited the expression of \u003cem\u003egtfB\u003c/em\u003e and \u003cem\u003ebrpA\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"The Antibacterial and Antibiofilm Properties of Different Strains of Lactobacillus spp. Isolated from Traditional Kefir Dough on Oral Pathogens with Real Time PCR","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-06-08 15:02:47","doi":"10.21203/rs.3.rs-1654174/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"703a5117-c4ca-4baa-ad54-0965ae5f5e53","owner":[],"postedDate":"June 8th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2022-07-08T20:59:10+00:00","versionOfRecord":[],"versionCreatedAt":"2022-06-08 15:02:47","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1654174","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1654174","identity":"rs-1654174","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}