Formulation of Paeonia lactiflora root extract can induce atrophy of endometriotic lesions and accelerate embryo implantation following in vitro fertilization in endometriosis: An experimental study

article OA: gold CC0
AI-generated summary by gemini-2.5-flash-lite, 2026-06-08

Paeonia lactiflora root extract reduced inflammation and angiogenesis in endometriosis, causing lesion atrophy and improving embryo implantation rates after IVF in mice.

One-sentence paraphrase of the abstract; not a substitute for reading it. No clinical advice. How this works

AI-generated deep summary by claude@2026-06, 2026-06-13 · read from full text

This experimental study evaluated the anti-endometriosis effects of a formulation of Paeonia lactiflora (PL) root extract in female NMRI mice with induced endometriosis, followed by in vitro fertilization and embryo transfer to assess lesion and implantation outcomes. Mice were allocated to four groups (Endo/PL/IVF, Endo/NS/IVF, Endo/PL/mating, Endo/NS/mating), received oral PL during the post-induction period, and were analyzed 10 days after implantation for endometriotic lesion size, embryo implantation counts, IP cytokines (TNF-α and VEGF) by ELISA, and uterine LIF gene expression by qPCR. The paper reports that PL formulation induced atrophy of endometriotic lesions and accelerated embryo implantation, with associated changes in measured cytokines and LIF expression, while a major limitation is the small sample size (n=8 per group) typical of such animal experiments. This paper is centrally about endometriosis — it tests Paeonia lactiflora extract as an anti-endometriotic intervention and evaluates effects on endometriotic lesion regression and implantation after IVF.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Abstract

OBJECTIVE: Endometriosis (Endo) involves inflammation and angiogenesis within lesions, potentially causing embryo implantation failure. Paeonia lactiflora (PL) root exhibits anti-angiogenic and anti-inflammatory properties. This experiment investigated the therapeutic effects of PL on endometriotic lesion atrophy and embryo implantation following in vitro fertilization (IVF). METHODS: Female mice (n=32) were allocated into treatment and sham groups. Endo was induced through xenograft transplantation of rat endometrium to anterior abdominal walls of recipient (Endo) mice. PL root was extracted, phytochemically characterized, and orally administered (1.06 mg PL/20 g mouse) for 17 consecutive days. Through IVF, cultured mouse embryos were implanted into Endo mouse uteri. Ten days post-IVF, samples were collected, including intra-abdominal fluid for measurement of vascular endothelial growth factor (VEGF) and tumor necrosis factor α (TNF-α) using enzyme-linked immunosorbent assay. Embryo-containing uteri underwent trypan blue staining, while uterus fragments were stained with hematoxylin and eosin and analyzed for leukemia inhibitory factor (LIF) gene expression using quantitative polymerase chain reaction. The number of embryo implantation sites and diameter of endometriotic lesions were recorded. Data were analyzed using SPSS ver. 19, with p-values <0.05 considered to indicate statistical significance. RESULTS: Following Endo induction, TNF-α and VEGF levels and lesion diameter increased (p<0.05). LIF gene expression and embryo implantation rate decreased (p<0.05). After PL extract administration to Endo mice, TNF-α levels, VEGF levels, and lesion diameter decreased (p<0.05), while LIF gene expression and implantation rate increased (p<0.05). CONCLUSION: PL extract (1.06 mg/20 g mouse) decreases TNF-α and VEGF levels, suppressing inflammation and angiogenesis and causing endometriotic lesion atrophy. Furthermore, PL increases uterine LIF gene expression, promoting successful implantation post-IVF in Endo mice.
Full text 23,962 characters · extracted from pmc-nxml · 4 sections · click to expand

Intro

The endometrium, which is the inner lining of the uterus, thickens during pregnancy to prepare for embryo implantation and is shed, along with blood and tissue, during menstruation. Endometriosis (Endo) is a gynecological condition characterized by the growth of tissue resembling the endometrium outside the uterus, most commonly within the abdominal cavity [ 1 ]. Although the exact pathophysiology of Endo remains elusive, its symptoms can include pelvic pain, dysmenorrhea, dyspareunia, pain during bowel movements or urination, excessive bleeding, and, notably, infertility [ 2 ]. Four primary tissue responses are observed in the pathology of Endo: inflammation, attachment, angiogenesis, and proliferation [ 3 ]. Phytomedicine involves using herbal formulations to treat or alleviate human ailments. It plays a key role in modern medicine, contributing to drug development and healthcare. Research has indicated that phytomedicine can provide substantial therapeutic benefits and lead to the discovery of new drugs. Paeonia lactiflora (PL), commonly known as the Chinese peony, is an herbaceous perennial flowering plant native to central and eastern Asia. PL is known for its anti-inflammatory and anti-angiogenic properties [ 4 ]. It exerts anti-inflammatory effects by inhibiting the production of inflammatory mediators such as prostaglandin E2, leukotriene B4, and nitric oxide [ 5 ]. Furthermore, this herb possesses immunomodulatory properties, affecting lymphocyte proliferation, the differentiation of T h /T s lymphocytes, and the production of proinflammatory cytokines [ 6 ]. PL also demonstrates anti-angiogenic properties by inhibiting angiogenesis [ 7 ]. In vitro fertilization (IVF) is a widely used laboratory technique that can assist women experiencing infertility related to Endo. IVF enables the circumvention of potential disruptions in reproductive function attributed to Endo, including ovulatory dysfunction, impaired oocyte maturation, altered embryo cleavage, implantation difficulties, or extensive pathological adhesions from endometriotic lesions [ 8 ]. The efficacy of IVF as a treatment for Endo-associated infertility is well-established in the scientific community, helping many women with this condition achieve pregnancy. Accordingly, in this experimental study, the authors sought to evaluate the anti-Endo effects of PL in female Navar Medical Research Institute (NMRI) mice with induced Endo (termed Endo mice) and subsequent IVF.

Methods

This experimental study was conducted at Kermanshah University of Medical Sciences in Kermanshah, Iran. All experimental procedures were carried out under the supervision of the university’s ethics committee (IR.KUMS.REC.1399.994). Animal handling was performed in accordance with the ethical principles outlined in the Declaration of Helsinki of 1975 and revised in 2000 [ 9 ]. This study utilized 32 female NMRI mice (n=8 per group, aged 8–12 weeks, weighing approximately 30 g). The protocol involved a 30-day period for Endo induction and successful transplantation, followed by a 17-day course of drug administration and subsequent IVF induction. Tissue samples were collected 10 days after IVF. The animals were divided into four groups: treatment (Endo/PL/IVF), Sham 1 (Endo/normal saline [NS]/IVF), Sham 2 (Endo/PL/natural mating [Mate]), and Sham 3 (Endo/NS/Mate). A fresh sample of PL was obtained from the Center of Herbal Medicine and Medicinal Plants (No. PL.1398/AS125). The PL root was separated and cleaned. The root fragments were then shade-dried for 1 week and subsequently ground using an industrial grinder (product SKU: 51879, Iran). Following this, 100 g of the PL root powder was boiled in water for 2 hours. The resulting sediments were discarded, and the supernatant was centrifuged twice at 4,000 rpm for 15 minutes each time. This solution was then mixed with 70% ethanol in a 1:5 ratio of PL to ethanol. The mixture was incubated at 4 °C for 72 hours. After incubation, the solution was centrifuged again twice under the same conditions. The solution, containing the active ingredients of PL, was incubated for an additional 7 days at 37 °C to allow for alcohol evaporation. The final sediment was collected as the PL extract for oral administration [ 10 ]. PL powder was percolated with 80% ethanol. Thin-layer chromatography (TLC) on silica gel (Merck) was employed to identify compounds in the ethanol extract. The Liebermann-Burchard reagent and a hexane/ethyl acetate mixture (1:1 ratio) were used to detect terpenes and sterols. Classical acid/base extraction was employed for alkaloid analysis, using TLC in a chloroform/methanol/ammonia solution (25%) with a ratio of 8:2:0.5. For flavonoid detection, TLC was developed in a n -butanol/acetic acid/water mixture (4:1:5 ratio). A 1% aluminum chloride solution in methanol was used for the identification of tannins and saponins [ 11 ]. The calculation of the lethal dose 50 (LD50) value for PL was performed in accordance with the guidelines provided by the Organisation for Economic Co-operation and Development. PL was administered in a range of doses, with nine different levels (n=5 mice per group) including 0.1, 0.25, 0.5, 0.75, 1, 1.25, 1.5, 1.75, and 2 mg of PL per 20 g mouse daily for 17 days. Mortality was documented, and a probit table was utilized for regression analysis as per the established protocol [ 12 ]. Transplant donor rats, which had experienced at least one pregnancy, were housed in a specially designed cage with a metal barrier allowing indirect contact with male rats, maintaining a ratio of two females to one male. This arrangement was sustained for 2 weeks to induce high serum levels of estrous cycle hormones, promoting endometrial thickening. Subsequently, the transplant donors were anesthetized with an intraperitoneal (IP) injection of 50 IU of a diazepam-ketamine mixture (90 IU of diazepam and 10 IU of ketamine; ketamine hydrochloride, 50 mg/mL, Rotexmedica; diazepam, 10 mg/2 mL, Caspian Tamin Pharmaceutical Co.). Laparotomy was performed along the midline of each donor rat, and the uterus was excised and placed in a dish with phosphate-buffered saline solution. The endometrium was separated from the myometrium and perimetrium, and 5-mm diameter fragments were prepared using a vernier caliper (code 200-1205; INSIZE Co. Ltd.) and a dermal punch (AlMasoom Co.). The recipient mice were then anesthetized, and the uterine fragments were grafted onto the anterior abdominal wall using non-absorbable sutures, following a previously published protocol that placed the luminal surface of the endometrium in direct contact with the peritoneal surface of the abdominal wall. The abdominal incision was closed with polyvinylidene fluoride sutures (5.0 USP; BARTAR). To stimulate estrogen secretion, which is essential for the successful induction of endometrial lesions, the recipient mice were placed in a cage adjacent to male mice, separated by a metal barrier, for 30 days. All aforementioned protocols were conducted in accordance with a study by Abdolmaleki et al. [ 13 ] ( Figure 1 ). Starting 1 day after Endo surgery (day 31 post-induction), the animals received an oral dose of 1.06 mg PL per 20 g of mouse body weight at 10:00 AM daily for 17 consecutive days [ 14 ]. T6 cell culture (Sigma-Aldrich) containing bovine serum albumin (BSA; SKU: 10735078001, 50 g; Sigma-Aldrich) was prepared at a ratio of T6 to BSA of 1:6 and sterilized using a filter membrane (13 mm, 0.22 μm) for embryo culture and injection. This was done using a mineral oil-based dropping method. Pregnant mare serum gonadotropin (PMSG, 5,000 IU; HIPRA) and human chorionic gonadotropin (hCG, 5,000 IU) hormones were procured. For ovarian hyperstimulation, PMSG was administered at a concentration of 10 IU/mL via IP injection. Forty-eight hours later, hCG was injected at the same concentration and by the same route. Oocyte retrieval occurred 14 hours after the hCG injection. During this procedure, laparotomy was performed, and pre-ovulatory oocytes (metaphase II) were collected using mouth pipetting. For sperm preparation, male NMRI mice were euthanized by cervical dislocation after being anesthetized. The epididymides were excised, and the sperm was released into dishes. Subsequently, the IVF process was carried out according to standard protocols. Blastocysts were assessed daily, and embryos were graded using the Gardner protocol [ 15 ]. Pseudopregnancy was induced in recipient mice 60 hours prior to embryo transfer. Blastocysts were then transferred into the intrauterine cavity of the recipient mice using an embryo transfer catheter and a mouth pipette, with 10 embryos transferred per mouse [ 16 ]. Ten days after blastocyst implantation, the animals were anesthetized and euthanized via cervical dislocation. Trypan blue (2 μL, 0.4%) was injected into the tail vein to stain the uterus and facilitate counting of embryo implantation sites. NS (1 cc) was injected into the peritoneal cavity, then aspirated 3 minutes later for an enzyme-linked immunosorbent assay (ELISA) to measure IP cytokines, specifically tumor necrosis factor α (TNF-α) and vascular endothelial growth factor (VEGF). Midline laparotomy was performed, and the transplanted endometriotic lesions were excised and their diameters measured. The samples were then fixed in formalin solution (Cat. No. 104402; Merck) for histopathological evaluation, including hematoxylin and eosin (H&E) staining. The uterus was dissected to count the implantation sites, and the right uterine horn was placed in liquid nitrogen for genetic expression analysis of the leukemia inhibitory factor (LIF) gene [ 17 ]. After fixation in 10% formalin, the samples underwent processing using a tissue processor machine (TP120; DID SABZ Co.). During this process, the samples were dehydrated in ascending concentrations of ethyl alcohol. Xylene (Cat. No. 108633; AvecinaShimi Co.) was utilized to clear the samples, and paraffin was employed for tissue impregnation. The samples were then embedded in paraffin and sectioned with a microtome. H&E staining (SinaClon Co.) was performed, and the samples were subsequently prepared for microscopic examination [ 18 ]. The uterine samples were processed using micropestles, and RNA was subsequently extracted from the tissues using an RNA extraction kit (RNX-PLUS solution, Cat. No. EX6101; SinaClon Co.). The quality of the extracted RNA was assessed using NanoDrop spectrophotometry (Synergy H1; BioTek) at 260 nm. The integrity of the RNA was evaluated on a 1% agarose gel. Additionally, RNA purification was performed to eliminate any genomic DNA contamination. Complementary DNA (cDNA) was synthesized using a first-strand cDNA synthesis kit (Cat. No. RT5201; SinaClon Co.) following the manufacturer’s instructions on a thermal cycler (K160 Mini-PCR; Heal Force). Subsequently, quantitative polymerase chain reaction (qPCR) was conducted using SyberBlue (SinaClon Co.) and specific primers for the LIF gene (qPCR machine: StepOne; Applied Biosystems); LIF: F: AAGCCAAGATGATGCCACAG , R: GAGCCCAGAGAGTCCAAGT ) [ 19 ]. actin beta ( ACTB ) was used as the internal control (F: TGACCCAGATCATGTTTGAGACC , R: CTCGTAGATGGGCACAGTGTGGG ). The data were expressed as fold changes calculated using the 2 −ΔΔct method [ 20 ]. To quantify the IP cytokines TNF-α and VEGF, standard solutions were prepared in accordance with ELISA kit instructions (Diaclone Co., Cat. No. 950.090.096, supplied by PadGin Teb Co.). Levels of TNF-α and VEGF were measured using an ELISA reader (NanoDrop spectrophotometer, Gen5 software; BioTek) at 450 nm. The standard curve was plotted, and the concentrations of the cytokines were determined. The data were reported in picograms per milliliter (pg/mL) [ 21 ]. The normal distribution of the extracted data was evaluated using the Kolmogorov-Smirnov test. To investigate significant differences among groups, the unpaired t -test and analysis of variance were employed. Data were reported as mean±standard error of the mean, and p -values less than 0.05 were considered to indicate statistical significance. All statistical analyses were performed using SPSS ver. 16 (SPSS Inc.), and graphs were created with GraphPad Prism ver. 9 (GraphPad Software Inc.).

Results

For dose determination, concentrations of the PL plant extract were set to range from 0.1 to 2 mg PL per 20 g mouse. No animal mortality was observed at doses from 0.1 to 1 mg PL per 20 g mouse. However, at doses of 1.25, 1.5, 1.75, and 2 mg PL per 20 g mouse, respective mortality rates of 20%, 20%, 60%, and 100% were recorded. The LD50 was precisely determined to be 1.68 mg PL per 20 g mouse. Therefore, in accordance with the study by Choi et al. [ 14 ], a therapeutic dose of 1.06 mg PL per 20 g mouse was administered ( Table 1 ). Biochemically, the PL extract was found to be rich in 9-octadecenoic acid (Z), methyl ester, dodecanoic acid, saponins, and tannins. Additionally, phytochemicals such as flavonoids, phlobatannins, and anthraquinones were detected ( Table 2 ). The size of endometriotic lesions was significantly reduced ( p <0.05) in the treatment and Sham 2 groups compared to the Sham 1 and Sham 3 groups, respectively. This significant reduction suggests the therapeutic effects of PL extract in promoting the atrophy of endometriotic lesions. No significant changes ( p >0.05) were observed in the other groups ( Figure 2 ). The number of implantation sites after the IVF procedure and mating was significantly higher ( p <0.05) in the treatment and Sham 2 groups compared to the Sham 1 and Sham 3 groups, respectively. This finding suggests that PL extract may increase the rate of successful embryo implantation in Endo mice following IVF or mating ( Figure 3 ). Endometrial tissue samples, characterized by a typical endometrial layer of single cylindrical epithelium ( Figure 4A , black arrow) and underlying lamina propria ( Figure 4A , yellow arrow), were dissected from the uteri of donor rats in accordance with the published protocol. The lamina propria ( Figure 4A , yellow arrow), a form of loose connective tissue, contained various blood vessels ( Figure 4A , red arrow) and endometrial glands ( Figure 4A , blue arrow). Other uterine tissues, such as the myometrium and perimetrium, were removed during tissue graft preparation. This specific tissue graft ( Figure 4A ) was utilized for xenograft transplantation to induce Endo. After successful induction, the endometrial layer of the graft underwent proliferation ( Figure 4B , yellow arrow), with visible angiogenesis ( Figure 4B , red arrow). The inner cavity of the lesions was filled with pus, indicating successful induction of the condition. Upon administering PL extract to the mice with Endo, the blood vessel sections disappeared ( Figure 4C ), and the diameter of the lamina propria ( Figure 4C , yellow arrow) decreased. The routine histological features were altered, leaving only a scar of loose connective tissue ( Figure 4C ). Consequently, the endometrium layer, lamina propria, and secretory glands were no longer visible. Additionally, partial lymphocytic infiltration was observed ( Figure 4C , black arrow). The space between the grafted Endo lesions and the abdominal wall narrowed, leaving only the abdominal muscles of the mice discernible ( Figure 4C , 4D , red arrow). In the Sham 1 and Sham 3 groups, which did not receive PL extract, the diameter of the Endo lesions increased markedly ( Figure 4E , 4F , yellow arrows) with various sections of blood vessels ( Figure 4E , 4F , red arrows). The loose connective layers (lamina propria) of the lesions were replaced by an abnormal, thick scar layer with extensive lymphocytic infiltration ( Figure 4E , 4F , black arrows). The inner cavities of the Endo cysts were filled with purulent secretions ( Figure 4E , 4F , red bullets). Genetic evaluations revealed that after administering PL extract to mice with Endo, a significant increase ( p <0.05) occurred in the expression of the LIF gene in the treatment and Sham 2 groups compared to the Sham 1 and Sham 3 groups, respectively. This result suggests that PL extract stimulates LIF gene expression, potentially increasing the rate of embryo implantation in Endo mice. Additionally, no significant difference ( p >0.05) was observed between the Sham 1 and Sham 3 groups, indicating that the method of pregnancy (natural mating or IVF) did not significantly impact LIF gene expression ( Figure 5 ). The laboratory investigation into cytokines governing inflammation (TNF-α) and vascular growth (VEGF) in peritoneal fluid revealed that after the administration of PL plant extract, significant reductions ( p <0.05) were observed in the levels of TNF-α and VEGF in the treatment and Sham 2 groups compared to the Sham 1 and Sham 3 groups, respectively. These results suggest that PL extract can effectively diminish inflammation and angiogenesis in Endo mice, leading to the atrophy of endometriotic lesions ( Figure 6 ).

Discussion

Endo is a pathological condition characterized by the retrograde flow of endometrial fragments from the uterus into the peritoneal cavity, followed by the attachment and growth of distinct lesions. These lesions lead to inflammation and angiogenesis in the peritoneum. These two phenomena result in the lesions adhering to the peritoneal layer, representing an environment conducive to the growth of endometrial lesions and causing partial or total infertility. Assisted reproductive technologies such as IVF are often required to treat infertility in these cases [ 22 ]. In traditional medicine, the root of the PL plant is widely used to treat various diseases, including rheumatoid arthritis, gastrointestinal disorders, and burns, based on its anti-inflammatory and anti-angiogenic properties [ 7 ]. One study explicitly demonstrated that PL extract increases the expression of the LIF gene in the endometrium [ 14 ]. This finding is noteworthy because Endo-associated infertility has been linked to reduced LIF gene expression in the endometrium [ 23 ]. Given the established role of PL root in reducing endometriotic inflammation and inhibiting angiogenesis, it may be possible to mitigate the pathological effects of Endo caused by these processes. Furthermore, the capacity of this plant to increase LIF gene expression in the endometrium suggests that PL extract could also improve the rate of embryo implantation in individuals with Endo. Thus, this research plan was focused on establishing a laboratory model of Endo using xenograft transplantation, followed by treatment with PL root extract at a dosage of 1.06 mg PL per 20 g mouse weight. To assess the impact of this extract on embryo implantation, an IVF protocol was employed, which is a common treatment for individuals with infertility related to Endo. Choi et al. [ 14 ] determined that an effective dose of PL that can inhibit inflammation and increase the implantation rate is 1.06 mg PL per 20 g mouse. In the present study, the authors defined the LD50 dose as 1.68 mg per 20 g animal. However, in a study conducted by Wu et al. [ 24 ] for the treatment of arthritis, the effective substance extracted from the PL was effective in the dose of 0.4 mg/20 g animal. Although the nutritional content of PL root varies depending on the season in which the plant is harvested, several studies have documented certain constituents. The root of PL is known to contain monoterpenes, monoterpene glycosides (including paeoniflorin and albiflorin), triterpenoids (such as β-sitosterol), daucosterol, benzoic acid, and a variety of vitamins and minerals, including potassium, calcium, phosphorus, magnesium, manganese, iron, copper, and zinc [ 25 ]. Paeoniflorin, a type of monoterpene glycoside, exhibits anticancer properties against a range of cancers, including those of the liver, stomach, breast, lung, and pancreas, as well as colorectal cancer, glioma, and leukemia [ 26 ]. This compound also possesses anti-inflammatory characteristics [ 27 ]. The anticancer effects of paeoniflorin are attributed to its capacity to inhibit cellular proliferation and induce apoptosis [ 26 ]. In terms of the reproductive system, this substance exhibits an inhibitory effect on the growth of endometrial carcinoma by activating the mitogen-activated protein kinase (MAPK) and nuclear factor-κB (NF-κB) signaling pathways [ 28 ]. Angiogenesis is a fundamental process in the adhesion, growth, and proliferation of endometriotic lesions within the peritoneal cavity [ 29 ]. The presence of inflammation during Endo leads to the release of numerous cytokines that affect adjacent blood vessels. Consequently, pericytes, which are normally passively present around the vessels and represent endothelial progenitors, become activated and form new tubular structures, creating new blood vessels [ 30 ]. The presence of peritoneal macrophages around and within Endo lesions is also considered a critical factor in the initiation of inflammation. Through various molecular mechanisms, VEGF is secreted by peritoneal macrophages (as well as by transplanted endometrial cells), and then binds to its receptor (kinase insert domain receptor/fetal liver kinase 1 [KDR/Flk-1]) on the surface of vascular endothelial cells, inducing angiogenesis [ 31 ]. Vascular endothelial cells possess gap junction communication channels that facilitate cytoplasmic communication with adjacent endothelial cells. During angiogenesis, the morphology, cytoplasmic content, and numerous intracellular activities of endothelial cells are altered. Pro-angiogenic factors regulate and modulate the activity of connexin-like channels. Consequently, connexins are involved in the morphological changes, migration, and connection of endothelial cells during angiogenesis [ 32 ]. When the cytokine VEGF is secreted by macrophages, it binds to the VEGF-R2 receptor on vascular endothelial cells and, through a secondary signaling cascade, leads to the closure of connexin channels via the Cx43 signaling pathway. This action results in an increased intracellular level of plasminogen activator inhibitor-1 (PAI-1) and von Willebrand factor (VWF), prompting the endothelial cell to initiate angiogenesis [ 32 ]. Based on high-performance liquid chromatography and phytochemical investigations of PL plant root extract, numerous active compounds have been identified that possess cell proliferation inhibitory properties. These include paeoniflorin, pentagalloyl glucose, daucosterol, and catechin. These substances inhibit lesion growth through various mechanisms such as inducing apoptosis via the MAPK signaling pathway and NF-κB, promoting autophagy by increasing intracellular reactive oxygen species, or inhibiting cell proliferation by arresting the cell cycle in the G1 or S phase [ 5 ]. To contextualize the findings of this research within the broader scientific literature, it is important to recognize that after transplantation of endometriotic lesions to the abdominal wall, an inflammatory response is initiated, which stimulates angiogenesis. These processes collectively contribute to the proliferation of endometriotic cells. Thus, angiogenesis, inflammation, and endometriotic cell proliferation are the principal factors implicated in the pathogenesis of Endo. In conclusion, PL root extract contains a variety of effective substances that exhibit anti-angiogenic effects on endometriotic lesions. After the administration of PL root extract, reduced IP levels of the cytokines TNF-α and VEGF were evident. Additionally, the researchers noted degeneration of endometriotic lesions, as well as an increase in LIF gene expression within the uterus. Moreover, a higher rate of successful embryo implantation was found in Endo animals following PL administration. However, further clinical validation is necessary before recommending PL root extract for use in IVF treatments for women with Endo.

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: pmc-nxml

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Condition tags

endometriosis

Citation neighborhood

Papers in the corpus that this work cites (lower rings, blue) and that cite this one (upper rings, green). Dot size scales with the paper's in-corpus citation count — bigger dot = more influential within the endo/adeno field. Click a dot to open that paper. [ expand to 2 hops ] — adds papers reached through this work's immediate citers/citees. Heavier; up to 60 extra dots.

References (30)

Source provenance

europepmc
last seen: 2026-08-13T06:15:24.848197+00:00
openalex
last seen: 2026-06-10T17:14:06.276822+00:00
pmc
last seen: 2026-05-13T20:22:03.195721+00:00
pubmed
last seen: 2026-08-13T06:12:08.792002+00:00
License: CC0 · commercial use OK