Network pharmacology-based approach for investigating the pharmacological mechanism of Cang Er Zi San active ingredients in treatment of allergic rhinitis

Network pharmacology-based approach for investigating the pharmacological mechanism of Cang Er Zi San active ingredients in treatment of allergic rhinitis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Network pharmacology-based approach for investigating the pharmacological mechanism of Cang Er Zi San active ingredients in treatment of allergic rhinitis Ying Chen, Yujuan Yang, Ting Zuo, Yu Zhang, Limei Cui, Zhen Liu, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7958607/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract Context : Cang Er Zi San (CEZS) is clinically significant for allergic rhinitis (AR) treatment, though its pharmacological mechanism remains unclear. Objective : To elucidate CEZS's anti-AR mechanism through integrated network pharmacology and experimental validation. Materials and Methods : Active CEZS components were screened via the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) with targets predicted using PubChem/SwissTargetPrediction; AR targets were sourced from DrugBank/GeneCards/OMIM. Protein-protein interaction (PPI) networks were constructed (STRING), followed by Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment (DAVID). AR model mice received CEZS aqueous extract, with nasal mucosa expression of key targets quantified by RT-PCR. Molecular docking was performed. Results : We identified 62 CEZS components and 610 potential targets, mapping 157 shared targets from 945 AR-related targets. PPI analysis revealed TNF-α, AKT1, and VEGFA as core targets. CEZS significantly downregulated TNF-α, AKT1, and VEGFA in nasal mucosa. Diosmetin showed stable binding to all three targets. Discussion and Conclusion : CEZS exerts anti-AR effects through multi-target suppression of inflammatory (TNF-α), proliferative (AKT1), and angiogenic (VEGFA) pathways. Conclusion: This study demonstrates CEZS treats AR via multi-target/pathway modulation centered on TNF-α/AKT1/VEGFA, providing a mechanistic foundation for clinical application. Biological sciences/Computational biology and bioinformatics Health sciences/Diseases Biological sciences/Drug discovery Health sciences/Medical research Allergic rhinitis CEZS Network analysis Allergic rhinitis mouse model Hub genes Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Allergic rhinitis (AR) is caused by specific immunoglobulin E (IgE)-mediated, type 2 helper T cell (Th2)-driven responses against inhaled allergens (Bernstein et al., 2016 ). Its main symptoms include nasal congestion, itchiness, sneezing, and runny nose (Schuler Iv and Montejo, 2019 ). AR is a disease that can occur in people of all ages, and its highest incidence is found among adolescents (Greiner et al., 2011 ).AR is not only harmful to health, but also causes a great economic burden. In the United States and Europe, 20–30% of adults suffer from AR (Hoyte and Nelson, 2018 ). Numerous types of medicines are used to treat AR, among which, traditional Chinese medicine (TCM) is a popular medicine that has been widely used to treat allergic diseases (Chan and Ng, 2020 ). CEZS, a famous prescription for treating nasal diseases, is described in “Jisheng Fang · Volume 5” of the Song Dynasty. CEZS is composed of Xanthii Fructus (Cangerzi, CEZ), Magnoliae Flos (Xinyi, XY), Benth. Et Hook (Baizhi, BZ), and Menthae Herba (Bohe, BH). CEZS is widely used in clinical practice and has certain therapeutic effects on upper airway diseases, such as allergic rhinitis and sinusitis. Previous studies have confirmed that Shi-Bi-Lin (SBL), which is a modification of the CEZS formula, can significantly relieve the sneezing and scratchy nose symptoms of allergic rhinitis (Zhao et al., 2006 ). Clinical studies have confirmed that Jia Wei Cang Er Zi San can alleviate the symptoms of nasal congestion and improve the quality of life of patients with perennial allergic rhinitis (Zhao et al., 2009 ). However, the mechanism by which CEZS alleviated allergic rhinitis remains unclear. In the early phase of this study, the potential gene targets of CEZS for treatment of AR were sorted and screened by using a network pharmacology method in conjunction with the Chinese medicine database and various disease target databases. Three targets that were most significantly related to CESZ in treatment of AR were identified. Next, an animal model of allergic rhinitis was established and used to conduct experiments which proved that CEZS could indeed interfere with the occurrence and development of allergic rhinitis by affecting those genes. A work flow chart for treatment of AR with CEZS based on network pharmacology and experimental studies is shown in Fig. 1 . 2. Materials and methods 2.1. Screening of CEZS active ingredients We screened the active components of CEZS as identified by the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) (Ru et al., 2014 ). The cutoff values used for drug-likeness (DL, ≥ 0.18) and oral bioavailability (OB, ≥ 30%) are often used to evaluate the ADME (absorption, distribution, metabolism, and excretion) characteristics of various drugs. 2.2. Searching for the targets of active ingredients in CEZS The PubChem Database (Kim et al., 2016 ) is the world's largest collection of freely accessible chemical information, and three-dimensional models of the active compounds were constructed by using that database. Swiss Target Prediction is a network tool designed to predict the most likely protein targets of small molecules (Daina et al., 2019 ). We input the three-dimensional structures of possible active components into the Swiss Target Prediction database to identify the potential targets of those active compounds. 2.3. Screening for AR-related genes The targets for AR were obtained from various databases on the Internet, including the DrugBank database (Wishart et al., 2018 ), GeneCards database (Stelzer et al., 2016 ), and OMIM database (Amberger and Hamosh, 2017 ). 2.4. Protein-protein interaction(PPI)network analysis A protein interaction network was constructed by conducting an online analysis of information obtained from the String database. The PPI network analysis identified several targets with the strongest interactions according to the degree value. The String database is a web site used for performing a functional enrichment analysis of protein interaction networks (Szklarczyk et al., 2019 ). We input the above acquired intersection targets into the String database to obtain related protein networks that directly or indirectly interact with the common targets of CEZS and AR. A confidence level > 0.4 was considered to be valid, and among them, the top three were designated as hub genes. 2.5. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis The David database is an integrated biological knowledge base and analysis tool, which aims to systematically extract biological meanings from large gene/protein lists. (Huang da et al., 2009). We obtained the biological processes, cellular components, molecular functions, and pathways from the David database by uploading a list of intersection targets. In this way, we obtained a network model of GO and KEGG analysis. 2.6. Experimental animals and the AR model Male BALB/C mice (aged 6 to 8 weeks, with a weight range of 18–22 g) were purchased from the Jinan Pengyue Experimental Animal Breeding Company, (Shandong, China, License Number: SYXK(Lu) 2014-0007) and housed in a SPF level environment in the scientific research building of Yantai Yuhuangding Hospital. The mice were weighed, fed a standard sterile feed, and sterile water was available ad libitum. All experimental animals were dissected after fasting for 12 h. All animal experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and the study protocol was approved by Yantai Yuhuangding Animal Ethics Committee. (2025 − 800) A mouse model of AR was constructed as previously described (Sun et al., 2012 ), and in the following stages: (1) Basic sensitization stage: 40 µg of ovalbumin (OVA) and 2 mg of aluminum hydroxide gel were added to 200 µL of sterilized physiological saline to prepare a mixed solution. Next, the BALB/c mice were intraperitoneally injected with 200 µL of the solution on every other day of Days 1–14. (2) Stimulation stage: On days 21 through 27, the mice were atomized with sterilized physiological saline solution containing 5% OVA for 30 minutes; after which, 20 µL of OVA solution (40 mg/mL) was added dropwise into each nasal cavity every day. (3) Mice in the control group were intraperitoneally injected with 0.9% sterilized physiological saline by using the same method as described above. Scores for scratching, sneezing, and runny nose were recorded at 10 min after the last nasal drip. The observation time was 30 min, and the scoring table is shown in Table 1 . A total score ≥ 5 was considered to indicate success. Table 1 Behavioral scale of allergic symptoms Points/score Sneezing/(times /30min) Running nose Nose Scratching/(time /30min) 1 1–3 runny nose to the anterior naris 1–5 2 4–10 runny nose out of the anterior naris 6–15 3 >11 the face is full of snot >15 2.7 Drug preparation and AR treatment CEZS comprises four different herbs, CEZ (Beijing Materia Medica Fangyuan Pharmaceutical Technology, China), XY (Haozhou City Jing Wan Chinese Medicine Yinpian Factory, China), BZ (Sichuan Xinhehua Chinese Medicine Yinpian Co. LTD, China), and BH (Sichuan Xinhehua Chinese Medicine Yinpian Co. LTD, China), respectively. XF (8 g), XY (9 g), BZ (9 g), and BH (9 g) were added to a 10-fold amount of water and let soak for 1 h. Next, the aqueous mixture was brought to a boil and then fried at medium heat for 15 min. The mixture was then filtered, and the drug filtrate was collected and diluted with an 8-fold amount of water. Finally, the mixture was fried for 20 min, and the filtrate was recombined 2 times. The decoctions (extracted by Beijing Tongrentang Co., LTD, China) were finally concentrated to 22.4 mg/mL and stored at 4℃ for later use. The mice were assigned to 3 groups (6 mice per group). Group A was a normal control group, groups B and group C consisted of AR model mice, and mice in group C were treated with CEZS. In detail, the mice in group C were intragastrically treated with CEZS water decoction at a dose of 11.2 mg/20 g body weight for 14 consecutive days, while the mice in groups A and B were intragastrically administered the same amount of distilled water. In order to maintain intranasal excitation, on days 3, 6, 9 and 12, 5% OVA was instilled into the nasal cavity. After the last administration, the mice were scored based on their symptoms. Next, a blood sample was taken from each mouse via submandibular vein puncture. Finally euthanise each mouse by anaesthesia using 60 mg/ml pentobarbital sodium injection, and the nasal mucosa of each mouse was collected and then dissected under a microscope. 2.8 ELISA The serum was separated from the upper layer of the blood after centrifugation for 20 min at 900g. IL-4, IL-5, IL-13, and IFN-γ ELISA kits were purchased from Jingmei Biotechnology, Guangzhou, China. The concentrations of IL-4, IL-5, IL-13, and IFN-γ in mouse serum were detected by ELISA according to instructions provided by the manufacturer. 2.9 RT-PCR The levels of TNF-α, AKT1, and VEGFA mRNA expression in nasal mucosa were detected by RT-PCR. The total RNA of nasal mucosa was extracted using TRIzol reagent and then reverse transcribed into cDNA. The SYBR Green fluorescent dye method was used to perform RT-PCR under the following conditions: 45 cycles of pre-denaturation at 94 degrees Celsius for 3 min, 94 degrees Celsius for 10 s, and 60 degrees Celsius for 30 s. Actin served as an internal reference. The relative levels of mRNA expressed by each target gene were calculated. The primers used for RT-PCR are shown in Table 2 . TABLE 2 Primer sequences Primer name Primer sequence (5’-3’) TNF-α-F CAGGCGGTGCCTATGTCTC TNF-α-R CGATCACCCCGAAGTTCAGTAG AKT1-F ATGAACGACGTAGCCATTGTG AKT1-R TTGTAGCCAATAAAGGTGCCAT VEGFA-F CTGCCGTCCGATTGAGACC VEGFA-R CCCCTCCTTGTACCACTGTC 2.10 Molecular docking analysis The interactions between active ingredients and the AR/CEZS-related genes were analyzed using Cytoscape. Protein interaction information for the core targets was obtained through the STRING database. Subsequently, 3D structure files (PDB format) of the corresponding target proteins were downloaded using the RCSB PDB database ( https://www.rcsb.org ). The chemical structures of the active ingredients were downloaded from the TCMSP database in *.mol2 file format. Molecular docking calculations were performed on the CB-Dock2 online platform (Liu et al., 2022 ) ( https://cadd.labshare.cn/cb-dock2/php/index.php ) to assess the binding ability of the key active ingredients of CEZS to the core targets to further validate the results of the preliminary network pharmacological analysis. Finally, the optimal binding conformations were visualised in 3D using PyMOL molecular visualisation software. 2.11 Statistical analysis All experimental data were analyzed using GraphPad Prism 8 software. The unpaired t test was used to make comparisons between groups, and double-tailed P -values were calculated to determine the statistical significance of differences between groups. A P -value < 0.05 was considered to be statistically significant. 2.12 Compliance with ARRIVE guidelines All animal experiments were conducted and reported in accordance with the ARRIVE guidelines ( https://arriveguidelines.org ). 3. Results 3.1 The active components of CEZS and their predicted targets Totals of 11 active ingredients for CEZ, 19 for XY, 22 for BZ, and 10 for BH in CEZS were identified in the TCMSP; these ingredients included Moupinamide, Denudatin B, sen-byakangelicol, and Fortunellin. Our investigation yielded a total of 62 active ingredients in CEZS (Table S1 ). Moupinamide is one of the most important active ingredients. Among the active ingredients, 46 were predicted to have targets by Swiss target prediction, including 7 components in CEZ, 13 in XY, 17 in BZ, and 9 in BH. We found a total of 610 potential drug targets for the 46 active ingredients (Table S2 ). 3.2 Screening of AR-related genes A total of 50 AR-related genes were obtained from the DrugBank database, 1312 AR-related targets were obtained from the GeneCards database, and 215 AR-related targets were obtained from the OMIM database. A total of 945 effective target genes obtained from the three databases were integrated and any repeated targets were deleted (Table S3 ). 3.3 Construction of an active ingredient - intersection target network The intersection genes of CEZS active ingredient targets and AR-related genes were identified by using the website bioinformatics ( http://www.bioinformatics.com.cn ), as shown in Fig. 2 A. The 157 intersection genes are shown in Table S4 . Next, we analyzed the regulatory relationships between 46 active ingredients and 157 common targets, and then used Cytoscape software to construct a regulation network (Fig. 2 B). 3.4 PPI network In order to understand the regulation of 157 common genes, the genes were uploaded to the String database to obtain a PPI network diagram, as shown in Fig. 3 . The strength of interaction was judged according to the degree value. The average node degree was 24.9, and we identified the three most interactive targets with a degree value > 82. Those targets were TNF-α, AKT1, and VEGFA, which we designated as Hub genes. The degree values between those nodes are shown in Table S5 . 3.5 GO and KEGG enrichment analyses In order to identify the functions and pathways of the 157 common genes, we uploaded them to the David database. GO and KEGG enrichment analyses ( www.kegg.jp/kegg/kegg1.html ) were performed, and a P -value < 0.05 was considered to be meaningful. The GO function enrichment analysis showed that the 157 genes mainly affected inflammatory response, immune response, response to drug, and positive regulation of NF-kappaB transcription factor activity (Fig. 4 A). The KEGG pathway enrichment analysis showed that the genes were involved in the TNF signaling pathway, Toll-like receptor signaling pathway, Inflammatory mediator regulation of TRP channels, and Chemokine signaling pathway (Fig. 4 B). 3.6 Pathways and a target network The obtained KEGG pathways and their corresponding targets were used to create a database, and a pathway-target network diagram was constructed by using Cytoscape for visual analysis (Fig. 5 ). The results showed that in a total of 100 KEGG pathways, TNF-α participates in 36 pathways, AKT1 participates in 59 pathways, and VEGFA participates in 13 pathways. This network further suggested that CEZS could be used to treat AR via multiple targets and pathways. 3.7 Effect of CEZS decoction on the nasal symptoms of AR mice When compared to mice in the AR model control group, the local allergic symptoms of mice in the CEZS treatment AR group were significantly alleviated (Fig. 6 A). Furthermore, the levels of IL-4, IL-5, IL-13, and IFN-γ in the nasal mucosa from CEZS-treated AR mice were significantly decreased (Fig. 6 B). 3.8 CEZS reduced TNF -α, AKT1, and VEGFA expression in the nasal mucosa of AR model mice The levels of TNF-α, AKT1, and VEGFA expression in the nasal mucosa of mice in the treatment group were significantly decreased when compared to those in the model control group (Fig. 7 ). 3.9 Identifying the docking sites between active ingredients and hub genes In molecular docking experiments, we screened the active ingredients and their core target proteins based on the combined score (OB × DL) of oral bioavailability (OB%) and drug-likeness (DL) and ranked the molecules according to the score. Docking results obtained by CB-Dock2 showed that the binding energies of the screened CEZS active ingredients and their target proteins were all below − 5.0 kcal/mol (Table S6 ). Negative values of the binding energies usually indicate binding activity (< 0 kcal/mol), whereas ≤ -5.0 kcal/mol suggests a strong binding activity, and the lower the negative value, the stronger the interaction. The results indicate that the CEZS active ingredient has high affinity for the three core targets (TNF, AKT1, VEGFA), suggesting that it may act through a spontaneous binding process and play a potentially critical role in the molecular mechanism of CEZS in the treatment of allergic rhinitis (AR). The results showed that diosmetin could bind to TNF-α at Gln-102 and Glu-116 (Fig. 8 A); to AKT1 at Glu-91 and Lys-8 (Fig. 8 B); and to VEGFA at Asp-34, Ser-50, Cys-61 and Asp-63 (Fig. 8 C). Fortunellin was identified to bind to TNF-α at THR-77, THR-79, LYS-90 and SER-95 (Fig. 8 D), Linarin was identified to bind to TNF-α at ARG-103 and GLU-104 (Fig. 8 E). Meanwhile, Genkwanin was identified to bind to AKT1 at LYS-20 and GLU-17 (Fig. 8 F). Naringenin was identified to bind to VEGFR at LEU-66, CYS-61 and SER-50 (Fig. 8 G), Moupinamide was identified to bind to VEGFR at PRO-40 and PHE-36 (Fig. 8 G). 4. Discussion The pathogenesis of AR involves a variety of immunocompetent cells and cytokines. Some components of CEZS have been experimentally proven to have anti-inflammatory effects. Here, we confirmed by ELISA that CEZS could reduce the expression of classic chemokines found in the nasal mucosa of mice with AR, and are closely associated with AR development; these cytokines include IL-4, IL-5 and IL-13. However, the mechanism by which CEZS exerts its therapeutic effect remains unclear. Therefore, a network pharmacology approach was used to explore the therapeutic mechanism by which CEZS alleviates AR. A total of 62 active components were identified in CEZS. One of the key active ingredients in CEZS used for treatment of AR is N-trans-Feruloyltyramine (Moupinamide), which also exists in other Chinese herbal medicines such as Portulacae Herba (Jiang et al., 2018 ). Moupinamide regulates the expression of genes related to immune and inflammatory responses, and has been tested and reported to be an anti-inflammatory molecule (Aswad et al., 2018 ). Studies have shown that Moupinamide can inhibit the expression of iNOS and COX-2 mRNA in mouse mononuclear macrophages treated with LPS, and also reduce the expression and phosphorylation of c-Jun N-terminal kinase (Jiang et al., 2015). AR is a common non-infectious airway disease characterized by inflammation of the nasal mucosa (Gwak et al., 2015 ), with many types of immune active cells and cytokines being involved in the process. Atopy in allergic rhinitis is often associated with an enhanced immune response to common allergens (Fokkens et al., 2020 ). An GO function enrichment analysis revealed that the 157 targets of CEZS involved in treatment of AR mainly participate in the inflammatory response, immune response, response to a drug, and positively regulate the activation of key transcription factors of inflammation and immunity, such as NF-κB transcription factors (Oeckinghaus and Ghosh, 2009 ). Overall, evidence shows that CEZS can treat allergic rhinitis by participating in and regulating the above biological processes. Meanwhile, the KEGG pathway enrichment analysis also showed that CEZS treatment of AR involved several pathways, including inflammation and immunity pathways such as the TNF signaling pathway, TLR signaling pathway, and inflammatory mediator regulation of TRP channels. TNF-α, an inflammatory cytokine produced by macrophages/monocytes during inflammation, is responsible for a wide variety of intracellular signaling events that lead to necrosis or apoptosis (Idriss and Naismith, 2000 ). An Euphorbia hirta Leaf ethanol extract was reported to suppress the TNF-α/IFN-γ-induced inflammatory response (Gil et al., 2022 ). The experiments conducted in our current study also verified that CEZS could reduce TNF-α and IFN-γ expression. Macrophage polarization has been shown to be closely related to inflammation and immunity, and regulate the release of inflammatory factors and occurrence of inflammatory responses. TLR4/NF-κB and Phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) participate in the regulation of macrophage polarization and interact with each other (Hu et al., 2022 ). Our study confirmed that CEZS could reduce the expression of AKT1, which is a direct downstream effector of PI3K in the nasal mucosa of mice with allergic rhinitis. TRP channels exist in most immune cell types (Nam and Kim, 2020 ), and trigger pro-inflammatory or anti-inflammatory mechanisms by directly affecting cation levels in inflammatory diseases. Calcium ions play an important role in controlling the intracellular Ca2 + signaling pathway in immune cells. Each TRP channel has a specific function in regulating Ca2 + signals involved in the body’s immune responses, and especially immune responses related to inflammation (Silverman et al., 2020 ). When taken together, our KEGG pathway enrichment analysis revealed that CEZS can extensively interact with many important inflammation and immunity signaling pathways to exert a therapeutic effect in AR. Moreover, an excessive release of mediators by mast cells can cause allergic reactions. Degranulation of mast cells can lead to the release of TNF-α and VEGFA, which can increase vascular permeability, capillary permeability, and fluid extravasation, all of which lead to airway edema and inflammation. Our PPI network showed that TNF-α, AKT1, and VEGFA had that highest strengths of interaction with AR and CEZS. We also experimentally confirmed that CEZS could reduce the expression of TNF-α, AKT1, and VEGF. Therefore, we speculate that CEZS can treat AR by specifically targeting the hub genes TNF-α , AKT1 , and VEGFA . 5. Conclusion In this study, we explored the mechanism of the active components of CEZS and verified that CEZS can reduce the levels of TNF, AKT1, and VEGFA expression in the nasal mucosa of AR model mice, so as to inhibit the development of AR. CEZS is composed of many different compounds, and the efficacy shown by CEZS in treatment of AR results from the interaction of multiple components, targets, and pathways. Our study is the first to identify specific signaling molecules and their pathways that play important roles in the treatment of AR with CEZS. The results of this study provide a direction for future research into the mechanism of CEZS in treatment of AR. Abbreviations Cang Er Zi San CEZS allergic rhinitis AR tumor necrosis factorα TNF-α RAC-alpha serine/threonine-protein kinase AKT1 Vascular endothelial growth factor A VEGFA traditional Chinese medicines TCMs Xanthii Fructus CEZ Magnoliae Flos XY Benth. Et Hook BZ Menthae Herba BH Gene ontology GO Kyoto Encyclopedia of Genes and Genomes KEGG ovalbumin OVA interleukin IL interferon gamma IFN-γ. Declarations Conflict of Interest The authors declare that this research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Funding The research was supported by the National Natural Science Foundation of China (82271146 and 82271147), the Major Scientific and Technological Innovation Project of Shandong Province (2022CXGC020506) and the Taishan Scholar Project (No.ts20190991) Author Contribution Ying Chen,yujuan yang,Ting Zuo and Xinyue Liu wrote the main manuscript text, Zheying Song and Zhen Liu prepared figures 6-7, Yu Zhang, Limei Cui, Zhen Liu, Yan Hao, Hongfei Zhao and Xicheng Song make useful discussion and insights, and all authors reviewed the manuscript. Acknowledgements The authors thank all the staff of the Department of Allergy of Yantai Yuhuangding Hospital, Qingdao University. Data Availability The datasets generated and analyzed during the current study are available from the corresponding author on reasonable request. References AMBERGER, J. S. & HAMOSH, A. Searching Online Mendelian Inheritance in Man (OMIM): A Knowledgebase of Human Genes and Genetic Phenotypes. Curr Protoc Bioinformatics , 58, 1.2.1–1.2.12. (2017). ASWAD, M. et al. Z. Nature is the best source of anti-inflammatory drugs: indexing natural products for their anti-inflammatory bioactivity. 67 , 67–75. (2018). BERNSTEIN, D. I., SCHWARTZ, G. & BERNSTEIN, J. A. Allergic Rhinitis: Mechanisms and Treatment. Immunol. Allergy Clin. North. Am. 36 , 261–278 (2016). CHAN, H. H. L. & NG, T. Traditional Chinese Medicine (TCM) and Allergic Diseases. Curr. Allergy Asthma Rep. 20 , 67 (2020). DAINA, A., MICHIELIN, O. & ZOETE, V. SwissTargetPrediction: updated data and new features for efficient prediction of protein targets of small molecules. Nucleic Acids Res. 47 , W357–w364 (2019). FOKKENS, W. J. et al. P. M., GRDINIC, B., GRGIC, V., HAMIZAN, A. W., HEINICHEN, J. V., HUSAIN, S., PING, T. I., IVASKA, J., JAKIMOVSKA, F., JOVANCEVIC, L., KAKANDE, E., KAMEL, R., KARPISCHENKO, S., KARIYAWASAM, H. H., KAWAUCHI, H., KJELDSEN, A., KLIMEK, L., KRZESKI, A., KOPACHEVA BARSOVA, G., KIM, S. W., LAL, D., LETORT, J. J.,. European Position Paper on Rhinosinusitis and Nasal Polyps 2020. Rhinology , 58, 1-464. (2020). GIL, T. Y., KANG, S. C., JIN, B. R. & AN, H. J. Euphorbia hirta Leaf Ethanol Extract Suppresses TNF-α/IFN-γ-Induced Inflammatory Response via Down-Regulating JNK or STAT1/3 Pathways (2022). in Human Keratinocytes. 12. GREINER, A. N., ROTIROTI, H. E. L. L. I. N. G. S. P. W., SCADDING, G. K. & G. & Allergic rhinitis. Lancet 378 , 2112–2122 (2011). GWAK, N. G. et al. Xanthii Fructus inhibits allergic response in the ovalbumin-sensitized mouse allergic rhinitis model. Pharmacogn Mag . 11 , S352–S361 (2015). HOYTE, F. C. L. & NELSON, H. S. Recent advances in allergic rhinitis. F1000Res , 7. (2018). HU, X., CHEN, B. & CHEN, Z. [Role of macrophage polarization in the development of sepsis]. Zhonghua Wei Zhong Bing Ji Jiu Yi Xue . 34 , 661–665 (2022). HUANG DA, W., LEMPICKI, R. A. & SHERMAN, B. T. & Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 4 , 44–57 (2009). IDRISS, H. T. & NAISMITH, J. H. TNF alpha and the TNF receptor superfamily: structure-function relationship(s). Microsc Res. Tech. 50 , 184–195 (2000). JIANG, M., ZHANG, W., YANG, X., XU, X. I. U. F., STIEN, D. & H., YING, X. & An isoindole alkaloid from Portulaca oleracea L. Nat. Prod. Res. 32 , 2431–2436 (2018). JIANG, Y., WANG, M. H. & YU, L. & N-trans-feruloyltyramine inhibits LPS-induced NO and PGE2 production in RAW 264.7 macrophages: Involvement of AP-1 and MAP kinase signalling pathways. Chem. Biol. Interact. 235 , 56–62 (2015). KIM, S. et al. S., SHOEMAKER, B. A., WANG, J., YU, B., ZHANG, J. & BRYANT, S. H. PubChem Substance and Compound databases. Nucleic Acids Res , 44, D1202-13. (2016). LIU, Y., YANG, X., CHEN, G. A. N. J., CAO, Y. & S., XIAO, Z. X. & CB-Dock2: improved protein-ligand blind docking by integrating cavity detection, docking and homologous template fitting. Nucleic Acids Res. 50 , W159–w164 (2022). NAM, J. H. & KIM, W. K. The Role of TRP Channels in Allergic Inflammation and its Clinical Relevance. Curr. Med. Chem. 27 , 1446–1468 (2020). OECKINGHAUS, A. & GHOSH, S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb Perspect. Biol. 1 , a000034 (2009). RU, J. et al. TCMSP: a database of systems pharmacology for drug discovery from herbal medicines. J. Cheminform . 6 , 13 (2014). SCHULER IV, C. F. & MONTEJO, J. M. Allergic Rhinitis in Children and Adolescents. Pediatr. Clin. North. Am. 66 , 981–993 (2019). SILVERMAN, H. A., CHEN, A., KRAVATZ, N. L., CHANG, E. H. & CHAVAN, S. S. & Involvement of Neural Transient Receptor Potential Channels in Peripheral Inflammation. Front. Immunol. 11 , 590261 (2020). STELZER, G. et al. Y., KOHN, A., RAPPAPORT, N., SAFRAN, M. The GeneCards Suite: From Gene Data Mining to Disease Genome Sequence Analyses. Curr Protoc Bioinformatics , 54, 1.30.1–1.30.33. (2016). SUN, Y. Q. et al. Human pluripotent stem cell-derived mesenchymal stem cells prevent allergic airway inflammation in mice. Stem Cells . 30 , 2692–2699 (2012). SZKLARCZYK, D. et al. STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 47 , D607–d613 (2019). WISHART, D. S. et al. L., CUMMINGS, R., LE, D., PON, A., KNOX, C. DrugBank 5.0: a major update to the DrugBank database for 2018. Nucleic Acids Res , 46, D1074-d1082. (2018). ZHAO, Y., VAN HASSELT, C. A., CHEN, W. O. O. J. K., WONG, G. G., LEUNG, P. C. & Y. O., WANG, L. H. & Effect of a Chinese herbal formula, Shi-Bi-Lin, on an experimental model of allergic rhinitis. Ann. Allergy Asthma Immunol. 96 , 844–850 (2006). ZHAO, Y. et al. Treatment of perennial allergic rhinitis using Shi-Bi-Lin, a Chinese herbal formula. J. Ethnopharmacol. 122 , 100–105 (2009). Additional Declarations No competing interests reported. Supplementary Files TableS1.docx TableS6.docx TableS4.docx TableS5.docx TableS3.docx TableS2.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 26 Apr, 2026 Reviewers agreed at journal 17 Apr, 2026 Reviewers invited by journal 17 Apr, 2026 Editor assigned by journal 18 Feb, 2026 Editor invited by journal 07 Nov, 2025 Submission checks completed at journal 06 Nov, 2025 First submitted to journal 06 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7958607","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":627608077,"identity":"dd6208b1-aebc-413e-a50a-f9edabaa2c76","order_by":0,"name":"Ying Chen","email":"","orcid":"","institution":"The 2nd School of Clinical Medicine of Binzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Chen","suffix":""},{"id":627608078,"identity":"a6c93073-5b65-4a24-881d-f0c17715a55f","order_by":1,"name":"Yujuan Yang","email":"","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yujuan","middleName":"","lastName":"Yang","suffix":""},{"id":627608079,"identity":"857aa635-0c53-4174-b150-b49a23c44114","order_by":2,"name":"Ting Zuo","email":"","orcid":"","institution":"The 2nd School of Clinical Medicine of Binzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Zuo","suffix":""},{"id":627608080,"identity":"0176c64e-cabf-4161-8470-7e19a82b7bfb","order_by":3,"name":"Yu Zhang","email":"","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Zhang","suffix":""},{"id":627608081,"identity":"80a979e8-3e21-4866-be56-dbfb3e66910a","order_by":4,"name":"Limei Cui","email":"","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":false,"prefix":"","firstName":"Limei","middleName":"","lastName":"Cui","suffix":""},{"id":627608082,"identity":"6cb3f403-bd0f-46af-8133-5b194410723a","order_by":5,"name":"Zhen Liu","email":"","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Liu","suffix":""},{"id":627608083,"identity":"b59c5912-964f-4c13-8130-3f4c74dd9cdb","order_by":6,"name":"Zheying Song","email":"","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zheying","middleName":"","lastName":"Song","suffix":""},{"id":627608084,"identity":"e48c116f-1e74-432d-979a-ef935ff8fcf5","order_by":7,"name":"Yan Hao","email":"","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yan","middleName":"","lastName":"Hao","suffix":""},{"id":627608085,"identity":"d183f1f0-f2dc-4711-8750-c437a37b0e4d","order_by":8,"name":"Hongfei Zhao","email":"","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":false,"prefix":"","firstName":"Hongfei","middleName":"","lastName":"Zhao","suffix":""},{"id":627608086,"identity":"f2209a6f-28d1-4435-8dd7-d137bfc3df31","order_by":9,"name":"Hang Yu","email":"","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":false,"prefix":"","firstName":"Hang","middleName":"","lastName":"Yu","suffix":""},{"id":627608087,"identity":"8db6768b-d048-4a1b-8f09-faa1b44b4521","order_by":10,"name":"Xinyue Liu","email":"","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xinyue","middleName":"","lastName":"Liu","suffix":""},{"id":627608088,"identity":"4ed38778-1332-4034-8f82-9ba9c6ba19f2","order_by":11,"name":"Xicheng Song","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyElEQVRIiWNgGAWjYDCCAwwMzGAGe2Pjww+kaeE53GwsQZoWifQ2AR5idPDdPmP4ueCPTZ585MM2BgkGOzndBgJaJM+lJUvPbEsrNryd2PaggCHZ2OwAAS0GZ5iPMfM2HE7cODux3UCC4UDiNsJaGNuYef4Atcw82CbBQ5wWoC08bIcT50swEqlF8gxbsjRvW1riBp5EYCAbEOEXvjM8hp95/tgkzm8//vDhhwo7OYJaEC4EqzQgVjkIyDeQonoUjIJRMApGFAAAS25DJSseG0QAAAAASUVORK5CYII=","orcid":"","institution":"Department of Otorhinolaryngology, Head and Neck Surgery, Yantai Yuhuangding Hospital","correspondingAuthor":true,"prefix":"","firstName":"Xicheng","middleName":"","lastName":"Song","suffix":""}],"badges":[],"createdAt":"2025-10-27 12:35:58","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7958607/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7958607/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":108006004,"identity":"119e08bc-e101-4daf-9256-8a619da61356","added_by":"auto","created_at":"2026-04-28 12:51:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":689192,"visible":true,"origin":"","legend":"\u003cp\u003eA work flow diagram showing the treatment of allergic rhinitis with CEZS based on network pharmacology and experimental studies.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/b1192d9e5e76d16928ef2f54.png"},{"id":107869202,"identity":"e70756a7-9c40-4a34-8f88-c51328788406","added_by":"auto","created_at":"2026-04-27 07:36:28","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":213965,"visible":true,"origin":"","legend":"\u003cp\u003eVenn diagram analysis of the targets of effective components of CEZS and AR-related genes (A). Compound–common targets of the CEZS/AR network (B). The pink hexagon represents CEZ, XY, BH, and BZ clockwise from the top left. Yellow circles represent active ingredients in CEZ, purple circles represent active ingredients in XY, blue circles represent active ingredients in BZ, red circles represent active ingredients in BH. Green triangle represents common targets of CEZS and AR. Edges represent interactions between ingredients and common targets.\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/745507ddef825b4a862d8b38.jpeg"},{"id":108490775,"identity":"e3f53316-24c5-4261-8772-d783412026f8","added_by":"auto","created_at":"2026-05-05 09:48:13","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":123088,"visible":true,"origin":"","legend":"\u003cp\u003ePPI Network of targets related to the treatment of AR with CEZS. There are 157 nodes in the graph, including 1 free node and 1952 edges. The 1 free node means that this gene has no connection with other genes through edges and is not included in the PPI network.\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/93727cdb21e3ffb66dd23dd6.jpeg"},{"id":107869237,"identity":"854c68d1-5ec1-4495-bcab-cc450e0ca850","added_by":"auto","created_at":"2026-04-27 07:36:35","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":157430,"visible":true,"origin":"","legend":"\u003cp\u003eEnrichment analyses. A: Go functional enrichment analysis. B: KEGG pathway enrichment analysis.\u003c/p\u003e","description":"","filename":"image4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/bc7853d30088d2f0a2ca6d1b.jpeg"},{"id":107869479,"identity":"269531c7-b022-4848-9658-39e9ae02366d","added_by":"auto","created_at":"2026-04-27 07:37:07","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":515340,"visible":true,"origin":"","legend":"\u003cp\u003eTarget-pathway network. Pink squares represent enriched pathways. Blue circles represent common targets that interact with those pathways.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/37b1331a6f30af8a7c76260b.png"},{"id":107868931,"identity":"6ee2da35-fd63-4c1a-a4d1-196a9413dbdc","added_by":"auto","created_at":"2026-04-27 07:35:05","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":148233,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of CEZS decoction on the nasal symptoms of AR mice (A). ****\u003cem\u003eP \u003c/em\u003e＜ 0.0001. Comparisons of IL-4, IL-5, IL-13, and IFN-γ concentrations (Conc.) in the nasal mucosa of mice in the normal control group, AR model control group, and AR treatment group (B). *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/2f0a52b1d7527829525bd404.png"},{"id":108006036,"identity":"807e2e4c-bd1a-4daa-b10e-449e9acfa2df","added_by":"auto","created_at":"2026-04-28 12:52:16","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":209695,"visible":true,"origin":"","legend":"\u003cp\u003eRT-PCR results for TNF-α, AKT1, and VEGFA mRNA expression levels in the normal control group, AR model control group, and AR treatment group. *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/63dbd3e4ab7445b7864b0b89.png"},{"id":108180871,"identity":"ba459ba6-0f26-404f-b942-7354fee9d4b6","added_by":"auto","created_at":"2026-04-30 08:54:35","extension":"jpeg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":360581,"visible":true,"origin":"","legend":"\u003cp\u003eDocking sites of CEZS ingredients with target proteins. (A) Molecular docking of TNF-α and diosmetin. (B) Molecular docking of AKT1 and diosmetin. (C) Molecular docking of VEGFA and diosmetin. (D) Docking sites of TNF-α and fortunellin. (E) Docking sites of TNF-α and Linarin. (F) Docking sites of AKT1 and genkwanin. (G) Docking sites of VEGFA and Naringenin. (H) Docking sites of VEGFA and moupinamide.\u003c/p\u003e","description":"","filename":"image8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/05b2e276f1c8f633e0326d3f.jpeg"},{"id":109204475,"identity":"dec09c24-d2f5-44a5-9f0f-a4cdb8a290b7","added_by":"auto","created_at":"2026-05-13 15:00:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2603353,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/18f3746e-a691-40b2-a2af-fa1bc573e55c.pdf"},{"id":107717985,"identity":"4a34a501-aeb4-468b-adfb-7701f385d8e5","added_by":"auto","created_at":"2026-04-24 10:21:22","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":21059,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/038f98ba956d56d27e690d61.docx"},{"id":109081023,"identity":"6976587f-fa4e-4c0b-8d58-c2c67049d58a","added_by":"auto","created_at":"2026-05-12 11:52:36","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":13968,"visible":true,"origin":"","legend":"","description":"","filename":"TableS6.docx","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/f240029124a874c13e91d73e.docx"},{"id":107868976,"identity":"52f90adf-a036-4d2f-b2f5-20a8a3cac336","added_by":"auto","created_at":"2026-04-27 07:35:27","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":16512,"visible":true,"origin":"","legend":"","description":"","filename":"TableS4.docx","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/82b26e94137133ae12d458b9.docx"},{"id":107869529,"identity":"ccaf79a2-1bc1-436a-ae0d-e2d46c41ee56","added_by":"auto","created_at":"2026-04-27 07:37:15","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":19359,"visible":true,"origin":"","legend":"","description":"","filename":"TableS5.docx","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/e24eec11f93f77ef1876e3a6.docx"},{"id":107868964,"identity":"be56657d-bcd4-4044-939b-a190f99374f1","added_by":"auto","created_at":"2026-04-27 07:35:21","extension":"docx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":59394,"visible":true,"origin":"","legend":"","description":"","filename":"TableS3.docx","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/8e66c0cf343f04980310c641.docx"},{"id":107717995,"identity":"bbec27fb-ca3a-44fb-8d8d-1e8ad5a54983","added_by":"auto","created_at":"2026-04-24 10:21:22","extension":"docx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":316728,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2.docx","url":"https://assets-eu.researchsquare.com/files/rs-7958607/v1/31a1de17be338528902fd739.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Network pharmacology-based approach for investigating the pharmacological mechanism of Cang Er Zi San active ingredients in treatment of allergic rhinitis","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAllergic rhinitis (AR) is caused by specific immunoglobulin E (IgE)-mediated, type 2 helper T cell (Th2)-driven responses against inhaled allergens (Bernstein et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Its main symptoms include nasal congestion, itchiness, sneezing, and runny nose (Schuler Iv and Montejo, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). AR is a disease that can occur in people of all ages, and its highest incidence is found among adolescents (Greiner et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).AR is not only harmful to health, but also causes a great economic burden. In the United States and Europe, 20\u0026ndash;30% of adults suffer from AR (Hoyte and Nelson, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Numerous types of medicines are used to treat AR, among which, traditional Chinese medicine (TCM) is a popular medicine that has been widely used to treat allergic diseases (Chan and Ng, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCEZS, a famous prescription for treating nasal diseases, is described in \u0026ldquo;Jisheng Fang \u0026middot; Volume 5\u0026rdquo; of the Song Dynasty. CEZS is composed of \u003cem\u003eXanthii Fructus\u003c/em\u003e (Cangerzi, CEZ), \u003cem\u003eMagnoliae Flos\u003c/em\u003e (Xinyi, XY), \u003cem\u003eBenth. Et Hook\u003c/em\u003e (Baizhi, BZ), and \u003cem\u003eMenthae Herba\u003c/em\u003e (Bohe, BH). CEZS is widely used in clinical practice and has certain therapeutic effects on upper airway diseases, such as allergic rhinitis and sinusitis. Previous studies have confirmed that Shi-Bi-Lin (SBL), which is a modification of the CEZS formula, can significantly relieve the sneezing and scratchy nose symptoms of allergic rhinitis (Zhao et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Clinical studies have confirmed that Jia Wei Cang Er Zi San can alleviate the symptoms of nasal congestion and improve the quality of life of patients with perennial allergic rhinitis (Zhao et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). However, the mechanism by which CEZS alleviated allergic rhinitis remains unclear.\u003c/p\u003e \u003cp\u003eIn the early phase of this study, the potential gene targets of CEZS for treatment of AR were sorted and screened by using a network pharmacology method in conjunction with the Chinese medicine database and various disease target databases. Three targets that were most significantly related to CESZ in treatment of AR were identified. Next, an animal model of allergic rhinitis was established and used to conduct experiments which proved that CEZS could indeed interfere with the occurrence and development of allergic rhinitis by affecting those genes. A work flow chart for treatment of AR with CEZS based on network pharmacology and experimental studies is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Screening of CEZS active ingredients\u003c/h2\u003e \u003cp\u003eWe screened the active components of CEZS as identified by the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) (Ru et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The cutoff values used for drug-likeness (DL, \u0026ge; 0.18) and oral bioavailability (OB, \u0026ge; 30%) are often used to evaluate the ADME (absorption, distribution, metabolism, and excretion) characteristics of various drugs.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Searching for the targets of active ingredients in CEZS\u003c/h2\u003e \u003cp\u003eThe PubChem Database (Kim et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) is the world's largest collection of freely accessible chemical information, and three-dimensional models of the active compounds were constructed by using that database. Swiss Target Prediction is a network tool designed to predict the most likely protein targets of small molecules (Daina et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). We input the three-dimensional structures of possible active components into the Swiss Target Prediction database to identify the potential targets of those active compounds.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Screening for AR-related genes\u003c/h2\u003e \u003cp\u003eThe targets for AR were obtained from various databases on the Internet, including the DrugBank database (Wishart et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), GeneCards database (Stelzer et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), and OMIM database (Amberger and Hamosh, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.4. Protein-protein interaction(PPI)network analysis\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eA protein interaction network was constructed by conducting an online analysis of information obtained from the String database. The PPI network analysis identified several targets with the strongest interactions according to the degree value. The String database is a web site used for performing a functional enrichment analysis of protein interaction networks (Szklarczyk et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). We input the above acquired intersection targets into the String database to obtain related protein networks that directly or indirectly interact with the common targets of CEZS and AR. A confidence level\u0026thinsp;\u0026gt;\u0026thinsp;0.4 was considered to be valid, and among them, the top three were designated as hub genes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e2.5. Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe David database is an integrated biological knowledge base and analysis tool, which aims to systematically extract biological meanings from large gene/protein lists. (Huang da et al., 2009). We obtained the biological processes, cellular components, molecular functions, and pathways from the David database by uploading a list of intersection targets. In this way, we obtained a network model of GO and KEGG analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Experimental animals and the AR model\u003c/h2\u003e \u003cp\u003eMale BALB/C mice (aged 6 to 8 weeks, with a weight range of 18\u0026ndash;22 g) were purchased from the Jinan Pengyue Experimental Animal Breeding Company, (Shandong, China, License Number: SYXK(Lu) 2014-0007) and housed in a SPF level environment in the scientific research building of Yantai Yuhuangding Hospital. The mice were weighed, fed a standard sterile feed, and sterile water was available ad libitum. All experimental animals were dissected after fasting for 12 h. All animal experiments were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals and the study protocol was approved by Yantai Yuhuangding Animal Ethics Committee. (2025\u0026thinsp;\u0026minus;\u0026thinsp;800)\u003c/p\u003e \u003cp\u003eA mouse model of AR was constructed as previously described (Sun et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2012\u003c/span\u003e), and in the following stages: (1) Basic sensitization stage: 40 \u0026micro;g of ovalbumin (OVA) and 2 mg of aluminum hydroxide gel were added to 200 \u0026micro;L of sterilized physiological saline to prepare a mixed solution. Next, the BALB/c mice were intraperitoneally injected with 200 \u0026micro;L of the solution on every other day of Days 1\u0026ndash;14. (2) Stimulation stage: On days 21 through 27, the mice were atomized with sterilized physiological saline solution containing 5% OVA for 30 minutes; after which, 20 \u0026micro;L of OVA solution (40 mg/mL) was added dropwise into each nasal cavity every day. (3) Mice in the control group were intraperitoneally injected with 0.9% sterilized physiological saline by using the same method as described above. Scores for scratching, sneezing, and runny nose were recorded at 10 min after the last nasal drip. The observation time was 30 min, and the scoring table is shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. A total score\u0026thinsp;\u0026ge;\u0026thinsp;5 was considered to indicate success.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBehavioral scale of allergic symptoms\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePoints/score\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSneezing/(times /30min)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRunning nose\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNose Scratching/(time /30min)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u0026ndash;3\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003erunny nose to the anterior naris\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u0026ndash;5\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u0026ndash;10\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003erunny nose out of the anterior naris\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e6\u0026ndash;15\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003e3\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003e\u0026gt;11\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003ethe face is full of snot\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003e\u0026gt;15\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Drug preparation and AR treatment\u003c/h2\u003e \u003cp\u003eCEZS comprises four different herbs, CEZ (Beijing Materia Medica Fangyuan Pharmaceutical Technology, China), XY (Haozhou City Jing Wan Chinese Medicine Yinpian Factory, China), BZ (Sichuan Xinhehua Chinese Medicine Yinpian Co. LTD, China), and BH (Sichuan Xinhehua Chinese Medicine Yinpian Co. LTD, China), respectively. XF (8 g), XY (9 g), BZ (9 g), and BH (9 g) were added to a 10-fold amount of water and let soak for 1 h. Next, the aqueous mixture was brought to a boil and then fried at medium heat for 15 min. The mixture was then filtered, and the drug filtrate was collected and diluted with an 8-fold amount of water. Finally, the mixture was fried for 20 min, and the filtrate was recombined 2 times. The decoctions (extracted by Beijing Tongrentang Co., LTD, China) were finally concentrated to 22.4 mg/mL and stored at 4℃ for later use.\u003c/p\u003e \u003cp\u003eThe mice were assigned to 3 groups (6 mice per group). Group A was a normal control group, groups B and group C consisted of AR model mice, and mice in group C were treated with CEZS. In detail, the mice in group C were intragastrically treated with CEZS water decoction at a dose of 11.2 mg/20 g body weight for 14 consecutive days, while the mice in groups A and B were intragastrically administered the same amount of distilled water. In order to maintain intranasal excitation, on days 3, 6, 9 and 12, 5% OVA was instilled into the nasal cavity. After the last administration, the mice were scored based on their symptoms. Next, a blood sample was taken from each mouse via submandibular vein puncture. Finally euthanise each mouse by anaesthesia using 60 mg/ml pentobarbital sodium injection, and the nasal mucosa of each mouse was collected and then dissected under a microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 ELISA\u003c/h2\u003e \u003cp\u003eThe serum was separated from the upper layer of the blood after centrifugation for 20 min at 900g. IL-4, IL-5, IL-13, and IFN-γ ELISA kits were purchased from Jingmei Biotechnology, Guangzhou, China. The concentrations of IL-4, IL-5, IL-13, and IFN-γ in mouse serum were detected by ELISA according to instructions provided by the manufacturer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 RT-PCR\u003c/h2\u003e \u003cp\u003eThe levels of TNF-α, AKT1, and VEGFA mRNA expression in nasal mucosa were detected by RT-PCR. The total RNA of nasal mucosa was extracted using TRIzol reagent and then reverse transcribed into cDNA. The SYBR Green fluorescent dye method was used to perform RT-PCR under the following conditions: 45 cycles of pre-denaturation at 94 degrees Celsius for 3 min, 94 degrees Celsius for 10 s, and 60 degrees Celsius for 30 s. Actin served as an internal reference. The relative levels of mRNA expressed by each target gene were calculated. The primers used for RT-PCR are shown in \u003cb\u003eTable\u0026nbsp;2\u003c/b\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTABLE 2 Primer sequences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α-F\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGCGGTGCCTATGTCTC\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTNF-α-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCGATCACCCCGAAGTTCAGTAG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAKT1-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eATGAACGACGTAGCCATTGTG\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAKT1-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTTGTAGCCAATAAAGGTGCCAT\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eVEGFA-F\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCTGCCGTCCGATTGAGACC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eVEGFA-R\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eCCCCTCCTTGTACCACTGTC\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Molecular docking analysis\u003c/h2\u003e \u003cp\u003eThe interactions between active ingredients and the AR/CEZS-related genes were analyzed using Cytoscape. Protein interaction information for the core targets was obtained through the STRING database. Subsequently, 3D structure files (PDB format) of the corresponding target proteins were downloaded using the RCSB PDB database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.rcsb.org\u003c/span\u003e\u003cspan address=\"https://www.rcsb.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The chemical structures of the active ingredients were downloaded from the TCMSP database in *.mol2 file format. Molecular docking calculations were performed on the CB-Dock2 online platform (Liu et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cadd.labshare.cn/cb-dock2/php/index.php\u003c/span\u003e\u003cspan address=\"https://cadd.labshare.cn/cb-dock2/php/index.php\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to assess the binding ability of the key active ingredients of CEZS to the core targets to further validate the results of the preliminary network pharmacological analysis. Finally, the optimal binding conformations were visualised in 3D using PyMOL molecular visualisation software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Statistical analysis\u003c/h2\u003e \u003cp\u003eAll experimental data were analyzed using GraphPad Prism 8 software. The unpaired t test was used to make comparisons between groups, and double-tailed \u003cem\u003eP\u003c/em\u003e-values were calculated to determine the statistical significance of differences between groups. A \u003cem\u003eP\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to be statistically significant.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Compliance with ARRIVE guidelines\u003c/h2\u003e \u003cp\u003eAll animal experiments were conducted and reported in accordance with the ARRIVE guidelines (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://arriveguidelines.org\u003c/span\u003e\u003cspan address=\"https://arriveguidelines.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.1 The active components of CEZS and their predicted targets\u003c/h2\u003e \u003cp\u003eTotals of 11 active ingredients for CEZ, 19 for XY, 22 for BZ, and 10 for BH in CEZS were identified in the TCMSP; these ingredients included Moupinamide, Denudatin B, sen-byakangelicol, and Fortunellin. Our investigation yielded a total of 62 active ingredients in CEZS (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Moupinamide is one of the most important active ingredients. Among the active ingredients, 46 were predicted to have targets by Swiss target prediction, including 7 components in CEZ, 13 in XY, 17 in BZ, and 9 in BH. We found a total of 610 potential drug targets for the 46 active ingredients (Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Screening of AR-related genes\u003c/h2\u003e \u003cp\u003eA total of 50 AR-related genes were obtained from the DrugBank database, 1312 AR-related targets were obtained from the GeneCards database, and 215 AR-related targets were obtained from the OMIM database. A total of 945 effective target genes obtained from the three databases were integrated and any repeated targets were deleted (Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Construction of an active ingredient - intersection target network\u003c/h2\u003e \u003cp\u003eThe intersection genes of CEZS active ingredient targets and AR-related genes were identified by using the website bioinformatics (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.bioinformatics.com.cn\u003c/span\u003e\u003cspan address=\"http://www.bioinformatics.com.cn\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA. The 157 intersection genes are shown in Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e. Next, we analyzed the regulatory relationships between 46 active ingredients and 157 common targets, and then used Cytoscape software to construct a regulation network (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.4 PPI network\u003c/h2\u003e \u003cp\u003eIn order to understand the regulation of 157 common genes, the genes were uploaded to the String database to obtain a PPI network diagram, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The strength of interaction was judged according to the degree value. The average node degree was 24.9, and we identified the three most interactive targets with a degree value\u0026thinsp;\u0026gt;\u0026thinsp;82. Those targets were TNF-α, AKT1, and VEGFA, which we designated as Hub genes. The degree values between those nodes are shown in Table \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5 GO and KEGG enrichment analyses\u003c/h2\u003e \u003cp\u003eIn order to identify the functions and pathways of the 157 common genes, we uploaded them to the David database. GO and KEGG enrichment analyses (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.kegg.jp/kegg/kegg1.html\u003c/span\u003e\u003cspan address=\"http://www.kegg.jp/kegg/kegg1.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) were performed, and a \u003cem\u003eP\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered to be meaningful. The GO function enrichment analysis showed that the 157 genes mainly affected inflammatory response, immune response, response to drug, and positive regulation of NF-kappaB transcription factor activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The KEGG pathway enrichment analysis showed that the genes were involved in the TNF signaling pathway, Toll-like receptor signaling pathway, Inflammatory mediator regulation of TRP channels, and Chemokine signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Pathways and a target network\u003c/h2\u003e \u003cp\u003eThe obtained KEGG pathways and their corresponding targets were used to create a database, and a pathway-target network diagram was constructed by using Cytoscape for visual analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). The results showed that in a total of 100 KEGG pathways, TNF-α participates in 36 pathways, AKT1 participates in 59 pathways, and VEGFA participates in 13 pathways. This network further suggested that CEZS could be used to treat AR via multiple targets and pathways.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.7 Effect of CEZS decoction on the nasal symptoms of AR mice\u003c/h2\u003e \u003cp\u003eWhen compared to mice in the AR model control group, the local allergic symptoms of mice in the CEZS treatment AR group were significantly alleviated (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Furthermore, the levels of IL-4, IL-5, IL-13, and IFN-γ in the nasal mucosa from CEZS-treated AR mice were significantly decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003e3.8 CEZS reduced TNF\u003c/b\u003e-α, \u003cb\u003eAKT1, and VEGFA expression in the nasal mucosa of AR model mice\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe levels of TNF-α, AKT1, and VEGFA expression in the nasal mucosa of mice in the treatment group were significantly decreased when compared to those in the model control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.9 Identifying the docking sites between active ingredients and hub genes\u003c/h2\u003e \u003cp\u003eIn molecular docking experiments, we screened the active ingredients and their core target proteins based on the combined score (OB \u0026times; DL) of oral bioavailability (OB%) and drug-likeness (DL) and ranked the molecules according to the score. Docking results obtained by CB-Dock2 showed that the binding energies of the screened CEZS active ingredients and their target proteins were all below \u0026minus;\u0026thinsp;5.0 kcal/mol (Table \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003e). Negative values of the binding energies usually indicate binding activity (\u0026lt;\u0026thinsp;0 kcal/mol), whereas \u0026le; -5.0 kcal/mol suggests a strong binding activity, and the lower the negative value, the stronger the interaction. The results indicate that the CEZS active ingredient has high affinity for the three core targets (TNF, AKT1, VEGFA), suggesting that it may act through a spontaneous binding process and play a potentially critical role in the molecular mechanism of CEZS in the treatment of allergic rhinitis (AR). The results showed that diosmetin could bind to TNF-α at Gln-102 and Glu-116 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA); to AKT1 at Glu-91 and Lys-8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB); and to VEGFA at Asp-34, Ser-50, Cys-61 and Asp-63 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). Fortunellin was identified to bind to TNF-α at THR-77, THR-79, LYS-90 and SER-95 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD), Linarin was identified to bind to TNF-α at ARG-103 and GLU-104 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). Meanwhile, Genkwanin was identified to bind to AKT1 at LYS-20 and GLU-17 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF). Naringenin was identified to bind to VEGFR at LEU-66, CYS-61 and SER-50 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG), Moupinamide was identified to bind to VEGFR at PRO-40 and PHE-36 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe pathogenesis of AR involves a variety of immunocompetent cells and cytokines. Some components of CEZS have been experimentally proven to have anti-inflammatory effects. Here, we confirmed by ELISA that CEZS could reduce the expression of classic chemokines found in the nasal mucosa of mice with AR, and are closely associated with AR development; these cytokines include IL-4, IL-5 and IL-13. However, the mechanism by which CEZS exerts its therapeutic effect remains unclear. Therefore, a network pharmacology approach was used to explore the therapeutic mechanism by which CEZS alleviates AR.\u003c/p\u003e \u003cp\u003eA total of 62 active components were identified in CEZS. One of the key active ingredients in CEZS used for treatment of AR is N-trans-Feruloyltyramine (Moupinamide), which also exists in other Chinese herbal medicines such as Portulacae Herba (Jiang et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Moupinamide regulates the expression of genes related to immune and inflammatory responses, and has been tested and reported to be an anti-inflammatory molecule (Aswad et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Studies have shown that Moupinamide can inhibit the expression of iNOS and COX-2 mRNA in mouse mononuclear macrophages treated with LPS, and also reduce the expression and phosphorylation of c-Jun N-terminal kinase (Jiang et al., 2015).\u003c/p\u003e \u003cp\u003eAR is a common non-infectious airway disease characterized by inflammation of the nasal mucosa (Gwak et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), with many types of immune active cells and cytokines being involved in the process. Atopy in allergic rhinitis is often associated with an enhanced immune response to common allergens (Fokkens et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). An GO function enrichment analysis revealed that the 157 targets of CEZS involved in treatment of AR mainly participate in the inflammatory response, immune response, response to a drug, and positively regulate the activation of key transcription factors of inflammation and immunity, such as NF-κB transcription factors (Oeckinghaus and Ghosh, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Overall, evidence shows that CEZS can treat allergic rhinitis by participating in and regulating the above biological processes.\u003c/p\u003e \u003cp\u003eMeanwhile, the KEGG pathway enrichment analysis also showed that CEZS treatment of AR involved several pathways, including inflammation and immunity pathways such as the TNF signaling pathway, TLR signaling pathway, and inflammatory mediator regulation of TRP channels. TNF-α, an inflammatory cytokine produced by macrophages/monocytes during inflammation, is responsible for a wide variety of intracellular signaling events that lead to necrosis or apoptosis (Idriss and Naismith, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). An Euphorbia hirta Leaf ethanol extract was reported to suppress the TNF-α/IFN-γ-induced inflammatory response (Gil et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The experiments conducted in our current study also verified that CEZS could reduce TNF-α and IFN-γ expression. Macrophage polarization has been shown to be closely related to inflammation and immunity, and regulate the release of inflammatory factors and occurrence of inflammatory responses. TLR4/NF-κB and Phosphatidylinositol 3-kinase/protein kinase B (PI3K/Akt) participate in the regulation of macrophage polarization and interact with each other (Hu et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Our study confirmed that CEZS could reduce the expression of AKT1, which is a direct downstream effector of PI3K in the nasal mucosa of mice with allergic rhinitis. TRP channels exist in most immune cell types (Nam and Kim, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and trigger pro-inflammatory or anti-inflammatory mechanisms by directly affecting cation levels in inflammatory diseases. Calcium ions play an important role in controlling the intracellular Ca2\u0026thinsp;+\u0026thinsp;signaling pathway in immune cells. Each TRP channel has a specific function in regulating Ca2\u0026thinsp;+\u0026thinsp;signals involved in the body\u0026rsquo;s immune responses, and especially immune responses related to inflammation (Silverman et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). When taken together, our KEGG pathway enrichment analysis revealed that CEZS can extensively interact with many important inflammation and immunity signaling pathways to exert a therapeutic effect in AR.\u003c/p\u003e \u003cp\u003eMoreover, an excessive release of mediators by mast cells can cause allergic reactions. Degranulation of mast cells can lead to the release of TNF-α and VEGFA, which can increase vascular permeability, capillary permeability, and fluid extravasation, all of which lead to airway edema and inflammation. Our PPI network showed that TNF-α, AKT1, and VEGFA had that highest strengths of interaction with AR and CEZS. We also experimentally confirmed that CEZS could reduce the expression of TNF-α, AKT1, and VEGF. Therefore, we speculate that CEZS can treat AR by specifically targeting the hub genes \u003cem\u003eTNF-α\u003c/em\u003e, \u003cem\u003eAKT1\u003c/em\u003e, and \u003cem\u003eVEGFA\u003c/em\u003e.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn this study, we explored the mechanism of the active components of CEZS and verified that CEZS can reduce the levels of TNF, AKT1, and VEGFA expression in the nasal mucosa of AR model mice, so as to inhibit the development of AR. CEZS is composed of many different compounds, and the efficacy shown by CEZS in treatment of AR results from the interaction of multiple components, targets, and pathways. Our study is the first to identify specific signaling molecules and their pathways that play important roles in the treatment of AR with CEZS. The results of this study provide a direction for future research into the mechanism of CEZS in treatment of AR.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCang Er Zi San\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCEZS\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eallergic rhinitis\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAR\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003etumor necrosis factorα\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRAC-alpha serine/threonine-protein kinase\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAKT1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVascular endothelial growth factor A\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eVEGFA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003etraditional Chinese medicines\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTCMs\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eXanthii Fructus\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCEZ\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eMagnoliae Flos\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eXY\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eBenth. Et Hook\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBZ\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cem\u003eMenthae Herba\u003c/em\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBH\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGene ontology\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGO\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eKyoto Encyclopedia of Genes and Genomes\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eKEGG\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eovalbumin\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOVA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003einterleukin\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eIL\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003einterferon gamma\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eIFN-γ.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of Interest\u003c/h2\u003e \u003cp\u003eThe authors declare that this research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThe research was supported by the National Natural Science Foundation of China (82271146 and 82271147), the Major Scientific and Technological Innovation Project of Shandong Province (2022CXGC020506) and the Taishan Scholar Project (No.ts20190991)\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eYing Chen,yujuan yang,Ting Zuo and Xinyue Liu wrote the main manuscript text, Zheying Song and Zhen Liu prepared figures 6-7, Yu Zhang, Limei Cui, Zhen Liu, Yan Hao, Hongfei Zhao and Xicheng Song make useful discussion and insights, and all authors reviewed the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThe authors thank all the staff of the Department of Allergy of Yantai Yuhuangding Hospital, Qingdao University.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated and analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAMBERGER, J. S. \u0026amp; HAMOSH, A. Searching Online Mendelian Inheritance in Man (OMIM): A Knowledgebase of Human Genes and Genetic Phenotypes. \u003cem\u003eCurr Protoc Bioinformatics\u003c/em\u003e, 58, 1.2.1\u0026ndash;1.2.12. (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eASWAD, M. et al. Z. Nature is the best source of anti-inflammatory drugs: indexing natural products for their anti-inflammatory bioactivity. \u003cb\u003e67\u003c/b\u003e, 67\u0026ndash;75. (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBERNSTEIN, D. I., SCHWARTZ, G. \u0026amp; BERNSTEIN, J. A. Allergic Rhinitis: Mechanisms and Treatment. \u003cem\u003eImmunol. Allergy Clin. North. Am.\u003c/em\u003e \u003cb\u003e36\u003c/b\u003e, 261\u0026ndash;278 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCHAN, H. H. L. \u0026amp; NG, T. Traditional Chinese Medicine (TCM) and Allergic Diseases. \u003cem\u003eCurr. Allergy Asthma Rep.\u003c/em\u003e \u003cb\u003e20\u003c/b\u003e, 67 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDAINA, A., MICHIELIN, O. \u0026amp; ZOETE, V. SwissTargetPrediction: updated data and new features for efficient prediction of protein targets of small molecules. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e47\u003c/b\u003e, W357\u0026ndash;w364 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFOKKENS, W. J. et al. P. M., GRDINIC, B., GRGIC, V., HAMIZAN, A. W., HEINICHEN, J. V., HUSAIN, S., PING, T. I., IVASKA, J., JAKIMOVSKA, F., JOVANCEVIC, L., KAKANDE, E., KAMEL, R., KARPISCHENKO, S., KARIYAWASAM, H. H., KAWAUCHI, H., KJELDSEN, A., KLIMEK, L., KRZESKI, A., KOPACHEVA BARSOVA, G., KIM, S. W., LAL, D., LETORT, J. J.,. European Position Paper on Rhinosinusitis and Nasal Polyps 2020. \u003cem\u003eRhinology\u003c/em\u003e, 58, 1-464. (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGIL, T. Y., KANG, S. C., JIN, B. R. \u0026amp; AN, H. J. Euphorbia hirta Leaf Ethanol Extract Suppresses TNF-α/IFN-γ-Induced Inflammatory Response via Down-Regulating JNK or STAT1/3 Pathways (2022). in Human Keratinocytes. 12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGREINER, A. N., ROTIROTI, H. E. L. L. I. N. G. S. P. W., SCADDING, G. K. \u0026amp; G. \u0026amp; Allergic rhinitis. \u003cem\u003eLancet\u003c/em\u003e \u003cb\u003e378\u003c/b\u003e, 2112\u0026ndash;2122 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGWAK, N. G. et al. Xanthii Fructus inhibits allergic response in the ovalbumin-sensitized mouse allergic rhinitis model. \u003cem\u003ePharmacogn Mag\u003c/em\u003e. \u003cb\u003e11\u003c/b\u003e, S352\u0026ndash;S361 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHOYTE, F. C. L. \u0026amp; NELSON, H. S. Recent advances in allergic rhinitis. \u003cem\u003eF1000Res\u003c/em\u003e, 7. (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHU, X., CHEN, B. \u0026amp; CHEN, Z. [Role of macrophage polarization in the development of sepsis]. \u003cem\u003eZhonghua Wei Zhong Bing Ji Jiu Yi Xue\u003c/em\u003e. \u003cb\u003e34\u003c/b\u003e, 661\u0026ndash;665 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHUANG DA, W., LEMPICKI, R. A. \u0026amp; SHERMAN, B. T. \u0026amp; Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. \u003cem\u003eNat. Protoc.\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e, 44\u0026ndash;57 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIDRISS, H. T. \u0026amp; NAISMITH, J. H. TNF alpha and the TNF receptor superfamily: structure-function relationship(s). \u003cem\u003eMicrosc Res. Tech.\u003c/em\u003e \u003cb\u003e50\u003c/b\u003e, 184\u0026ndash;195 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJIANG, M., ZHANG, W., YANG, X., XU, X. I. U. F., STIEN, D. \u0026amp; H., YING, X. \u0026amp; An isoindole alkaloid from Portulaca oleracea L. \u003cem\u003eNat. Prod. Res.\u003c/em\u003e \u003cb\u003e32\u003c/b\u003e, 2431\u0026ndash;2436 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJIANG, Y., WANG, M. H. \u0026amp; YU, L. \u0026amp; N-trans-feruloyltyramine inhibits LPS-induced NO and PGE2 production in RAW 264.7 macrophages: Involvement of AP-1 and MAP kinase signalling pathways. \u003cem\u003eChem. Biol. Interact.\u003c/em\u003e \u003cb\u003e235\u003c/b\u003e, 56\u0026ndash;62 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKIM, S. et al. S., SHOEMAKER, B. A., WANG, J., YU, B., ZHANG, J. \u0026amp; BRYANT, S. H. PubChem Substance and Compound databases. \u003cem\u003eNucleic Acids Res\u003c/em\u003e, 44, D1202-13. (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLIU, Y., YANG, X., CHEN, G. A. N. J., CAO, Y. \u0026amp; S., XIAO, Z. X. \u0026amp; CB-Dock2: improved protein-ligand blind docking by integrating cavity detection, docking and homologous template fitting. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e50\u003c/b\u003e, W159\u0026ndash;w164 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNAM, J. H. \u0026amp; KIM, W. K. The Role of TRP Channels in Allergic Inflammation and its Clinical Relevance. \u003cem\u003eCurr. Med. Chem.\u003c/em\u003e \u003cb\u003e27\u003c/b\u003e, 1446\u0026ndash;1468 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOECKINGHAUS, A. \u0026amp; GHOSH, S. The NF-kappaB family of transcription factors and its regulation. \u003cem\u003eCold Spring Harb Perspect. Biol.\u003c/em\u003e \u003cb\u003e1\u003c/b\u003e, a000034 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRU, J. et al. TCMSP: a database of systems pharmacology for drug discovery from herbal medicines. \u003cem\u003eJ. Cheminform\u003c/em\u003e. \u003cb\u003e6\u003c/b\u003e, 13 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSCHULER IV, C. F. \u0026amp; MONTEJO, J. M. Allergic Rhinitis in Children and Adolescents. \u003cem\u003ePediatr. Clin. North. Am.\u003c/em\u003e \u003cb\u003e66\u003c/b\u003e, 981\u0026ndash;993 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSILVERMAN, H. A., CHEN, A., KRAVATZ, N. L., CHANG, E. H. \u0026amp; CHAVAN, S. S. \u0026amp; Involvement of Neural Transient Receptor Potential Channels in Peripheral Inflammation. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 590261 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSTELZER, G. et al. Y., KOHN, A., RAPPAPORT, N., SAFRAN, M. The GeneCards Suite: From Gene Data Mining to Disease Genome Sequence Analyses. \u003cem\u003eCurr Protoc Bioinformatics\u003c/em\u003e, 54, 1.30.1\u0026ndash;1.30.33. (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSUN, Y. Q. et al. Human pluripotent stem cell-derived mesenchymal stem cells prevent allergic airway inflammation in mice. \u003cem\u003eStem Cells\u003c/em\u003e. \u003cb\u003e30\u003c/b\u003e, 2692\u0026ndash;2699 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSZKLARCZYK, D. et al. STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e47\u003c/b\u003e, D607\u0026ndash;d613 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWISHART, D. S. et al. L., CUMMINGS, R., LE, D., PON, A., KNOX, C. DrugBank 5.0: a major update to the DrugBank database for 2018. \u003cem\u003eNucleic Acids Res\u003c/em\u003e, 46, D1074-d1082. (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHAO, Y., VAN HASSELT, C. A., CHEN, W. O. O. J. K., WONG, G. G., LEUNG, P. C. \u0026amp; Y. O., WANG, L. H. \u0026amp; Effect of a Chinese herbal formula, Shi-Bi-Lin, on an experimental model of allergic rhinitis. \u003cem\u003eAnn. Allergy Asthma Immunol.\u003c/em\u003e \u003cb\u003e96\u003c/b\u003e, 844\u0026ndash;850 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZHAO, Y. et al. Treatment of perennial allergic rhinitis using Shi-Bi-Lin, a Chinese herbal formula. \u003cem\u003eJ. Ethnopharmacol.\u003c/em\u003e \u003cb\u003e122\u003c/b\u003e, 100\u0026ndash;105 (2009).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Allergic rhinitis, CEZS, Network analysis, Allergic rhinitis mouse model, Hub genes","lastPublishedDoi":"10.21203/rs.3.rs-7958607/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7958607/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eContext\u003c/strong\u003e: Cang Er Zi San (CEZS) is clinically significant for allergic rhinitis (AR) treatment, though its pharmacological mechanism remains unclear.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eObjective\u003c/strong\u003e: To elucidate CEZS's anti-AR mechanism through integrated network pharmacology and experimental validation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMaterials and Methods\u003c/strong\u003e: Active CEZS components were screened via the Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform (TCMSP) with targets predicted using PubChem/SwissTargetPrediction; AR targets were sourced from DrugBank/GeneCards/OMIM. Protein-protein interaction (PPI) networks were constructed (STRING), followed by Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment (DAVID). AR model mice received CEZS aqueous extract, with nasal mucosa expression of key targets quantified by RT-PCR. Molecular docking was performed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e: We identified 62 CEZS components and 610 potential targets, mapping 157 shared targets from 945 AR-related targets. PPI analysis revealed TNF-α, AKT1, and VEGFA as core targets. CEZS significantly downregulated TNF-α, AKT1, and VEGFA in nasal mucosa. Diosmetin showed stable binding to all three targets.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDiscussion and Conclusion\u003c/strong\u003e: CEZS exerts anti-AR effects through multi-target suppression of inflammatory (TNF-α), proliferative (AKT1), and angiogenic (VEGFA) pathways. Conclusion: This study demonstrates CEZS treats AR via multi-target/pathway modulation centered on TNF-α/AKT1/VEGFA, providing a mechanistic foundation for clinical application.\u003c/p\u003e","manuscriptTitle":"Network pharmacology-based approach for investigating the pharmacological mechanism of Cang Er Zi San active ingredients in treatment of allergic rhinitis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-24 10:21:16","doi":"10.21203/rs.3.rs-7958607/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-04-26T08:30:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"182392088483213769540768775197352817736","date":"2026-04-17T06:30:25+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-04-17T06:21:25+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-18T09:29:35+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-11-07T17:10:52+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-11-07T01:10:28+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-11-07T01:07:34+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d15b2d85-d457-4b80-89bc-2f578117974a","owner":[],"postedDate":"April 24th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":66797310,"name":"Biological sciences/Computational biology and bioinformatics"},{"id":66797311,"name":"Health sciences/Diseases"},{"id":66797312,"name":"Biological sciences/Drug discovery"},{"id":66797313,"name":"Health sciences/Medical research"}],"tags":[],"updatedAt":"2026-04-24T10:21:17+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-24 10:21:16","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7958607","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7958607","identity":"rs-7958607","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}