Terfezia claveryi MAT locus characterization uncovers evolutionary insights about sexual reproduction of Pezizomycetes and reveals mating type dynamics in mycorrhizal plants. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Terfezia claveryi MAT locus characterization uncovers evolutionary insights about sexual reproduction of Pezizomycetes and reveals mating type dynamics in mycorrhizal plants. Laura Andreu-Ardil, Ángel Guarnizo, Alfonso Navarro-Ródenas, Francisco Arenas, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8367999/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Terfezia claveryi is a hypogeous fungus that forms desert truffles through ectendomycorrhizal symbiosis with Cistaceae plants in arid and semiarid environments. The study presented herein elucidates the organization and structure of the the mating type ( MAT ) locus in this species and the spatio-temporal dynamics of T. claveryi strains in H. almeriense mychorrizal plants and rhizospheric soil from nursery to field. MAT genes are the master loci controlling sexual reproduction and development in fungi. Our findings demonstrate that T. claveryi is a haploid and heterothallic species as its strains harbor and express either TcMAT1-1-1 or TcMAT1-2-1 genes as revealed by genome sequencing and RNAseq analyses. DNA-binding motifs located in their respective promoter regions appear to play a major role in the regulation of reproductive processes. The α-box and HMG-box domains are highly conserved along the Pezizomycetes and their strong structural similarity despite its poor sequence similarity supports a common evolutionary origin. Moreover, we set out a PCR-based approach to monitor the dynamics of T. claveryi strains of opposite mating type on mychorrizal plants and soil. T. claveryi mycorrhizal plants at the nursery stage present strains of both mating types, whereas a notable dominance of strains with the TcMAT1-1-1 gene was observed in field stage. Altogether, this research provides insights about genetic regulation and evolution of the MAT locus within the Pezizomycetes, and the reproductive biology of this important desert truffle, along with reliable markers to track the spatio-temporal distribution of strains of opposite mating types. Ascomycota desert truffle mycorrhiza arid ecosystems heterothallism sexual reproductive system Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 INTRODUCTION Terfezia claveryi Chatin is a filamentous fungus belonging to the Pezizaceae family of the Ascomycota phylum, which typically forms ectendomycorrhizal symbiosis with perennial and annual plants of the Cistaceae family (e.g. Helianthemum spp.) (Gutiérrez et al. 2003 ; Zitouni-Haouar et al. 2014 ; Guarnizo et al. 2025 ). The completion of the sexual reproduction cycle of this fungus leads to the development of edible hypogeous fruit bodies, commonly referred to as ‘desert truffles’ (Morte et al. 2000 ). Desert truffles comprise a group of phylogenetically closely related Ascomycota genera, including the aforementioned Terfezia but also Tirmania , Kalaharituber , Mattirolomyces and Picoa . This term arises from their natural distribution in arid and semi-arid regions of the Mediterranean basin, mainly found in Spain, the Middle East, Morocco, Algeria, and Tunisia (Zambonelli et al. 2014 ). These truffles contribute to rural economic development, especially due to their highly appreciated nutritional and culinary value (Martínez-Tomé et al. 2014 ; Shavit 2014 ; Tejedor-Calvo et al. 2021 ), as well as their antioxidant and antimicrobial properties used in traditional medicine (Shavit and Shavit, 2014 ). The Helianthemum almeriense x T. clavery i mutualistic symbiosis plays a crucial role in enhancing plant survival during drought stress by facilitating the exchange of water and key nutrients (N, P, and K) with the host plant (Morte et al. 2000 ; Andrino et al. 2025 ). Mycorrhizal associations, such as those of Cistaceae plants with desert truffle species, constitute a potential ecological tool not only to prevent desertification in Mediterranean regions, but also to enrich soil fungal and bacterial communities without relying on chemicals (Morte et al. 2009 ; Berrios et al. 2023 ). Despite its adaptations, the adverse climatic conditions caused by relentless global warming have resulted in a significant decline in truffle yields, in both natural areas and cultivated plantations (Morte et al. 2021 ). Thus, understanding the reproductive mode and life cycle of T. claveryi is relevant for enhancing desert truffle production in both wild areas and cultivated orchards. Promoting desert truffle yield may in turn facilitate fungal spread within the soil and increase plant colonization levels, thereby helping alleviating the adverse effects of climate change on the symbiotic partners. Despite the considerable ecological and economic repercussions, the life cycle and reproductive biology of the fungi responsible for producing these truffles remain largely unexplored. Life cycle in Ascomycota initiates once the haploid ascospores germinate. In heterothallic (self-sterile) species, the ascogonium (female partner) and antheridium (male partner) interact in a process called plasmogamy, which leads to the formation of a fruiting body with nuclei of opposite mating types. After karyogamy and meiosis, asci containing a variable number of haploid ascospores are formed. In homothallic (self-fertile) species, the process is similar but does not require a mating partner (Bennett and Turgeon, 2016 ). The regulation of sexual identity in fungal cells is governed by both mating pheromones and the mating-type ( MAT ) locus, commonly known as MAT1 , since all ascomycetes possess at least one copy of this genomic region (Yoder et al. 1986 ). The MAT1 locus harbours two different idiomorphs, MAT1-1 and MAT1-2 , which primarily include the MAT1-1-1 and MAT1-2-1 genes, respectively (Yoder et al. 1986 ; Debuchy et al. 2010 ). These sequences are considered idiomorphic because they occupy the same locus although are highly divergent and non-homologous. In homothallic species, both MAT1-1 and MAT1-2 idiomorphs are present within the same haploid genome, eliminating the requirement for mating between genetically distinct types. In contrast, in heterothallic species, each haploid spore contains only one of the two idiomorphs, and sexual reproduction requires the combination of complementary idiomorphs from separate individuals (Fraser et al. 2007 ). Specifically for mycorrhizal heterothallic species, successful reproduction occurs only when (i) strains of opposite mating types interact, allowing the fusion of compatible hyphae and subsequent development of reproductive structures and (ii) at least one of the mating partners uses mycorrhizae to obtain nutrients from the host plants to sustain the growth of developing fruit bodies (Paolocci et at. 2006; Rubini et al. 2011a ; Le Tacon et al. 2013 ; Wilson et al. 2021 ). This system promotes genetic diversity by ensuring outcrossing between genetically distinct partners. MAT1-1-1 and MAT1-2-1 genes, which encode an α-box domain protein and HMG-box domain protein, respectively, play crucial roles in fungal reproduction, including: (i) acting as master regulators of fertilization by encoding key transcription factors that control sex-related genes, (ii) facilitating mating partner recognition by regulating the release of mating pheromones, and (iii) contributing to the development and maturation of fruiting bodies and ascospores (Bobrowicz et al. 2002 ; Lee et al. 2003 ; Kim et al. 2019a ). The genome sequencing of the mycorrhizal strains T. claveryi T7 and Tirmania nivea G3 suggested that they are heterothallic species, since, in both cases, solely the MAT1-1-1 DNA sequence was found (Marqués-Gálvez et al. 2021 ). In order to gain insight into the reproductive mode of desert truffles, the MAT locus of T. claveryi was studied. For this purpose, we (i) screened T. claveryi strains for the presence/absence of the MAT1-1-1 gene; ii) PCR amplified and sequenced the MAT1-2-1 gene from a strain lacking the opposite mating type; iii) assessed the evolutionary relationship of both MAT1-1-1 and MAT1-2-1 genes with those from other Pezizomycetes; (iv) set a reproducible PCR-based strategy to monitor the spatio-temporal distribution of strains of opposite mating type in soil and on root samples from inoculated H. almeriense plants. This work advances our understanding of the reproduction mode of desert truffle fungi and highlights its implication in ecological development of managed ecosystems from nursery to field. MATERIALS AND METHODS Experimental setup, biological material and sampling For MAT locus characterization, free living mycelium (FLM) grown in vitro on cellophane and placed over agar plates containing optimal MMN medium (Arenas et al. 2018 ) from two different T. claveryi strains (Tc1705 and TcLlano) were used. These strains belong to the Mycology-Mycorrhiza-Plant Biotechnology group collection at University of Murcia and were maintained in vitro in an incubator at 24°C in the dark. After collection of at least 100 mg of FLM from each strain, the material was placed in Eppendorf tubes, flash frozen in liquid nitrogen and stored at -80°C until DNA isolation. In addition, for DNA isolation from single spores, we also sampled an ascocarp of T. claveryi collected in 2005 in Zarzadilla de Totana (Murcia, Spain) which was stored at -20°C until use. For the assessment of the spatio-temporal distribution of MAT genes, we sampled material from H. almeriense x T. claveryi mycorrhizal plants at nursery stage (300 ml pots) and at field stage. A total of 405 H. almeriense plants were inoculated with different T. claveryi spore inocula in December 2021 according to Kagan-Zur et al. ( 2014 ). Batches of 10–15 root and rhizospheric soil samples were collected (i) in nursery at 2, 4, 6, and 9 months post inoculation (times T2-T9), and (ii) in field at 14, 18, and 27 months post inoculation (times T14-T27). Nursery plants were transplanted into an experimental plantation located in Cañada de Canara (Murcia, Spain, 38°06'47.3"N, 1°45'56.5"W). The plantation was systematically mapped by establishing ten unique plots (Supplementary Fig. 1). For each sampling event, one random sampling point per plot was selected to ensure spatial representation. In total, 71 rhizospheric soil samples and 66 root samples were collected from February 2022 to March 2024 to evaluate the spatio-temporal distribution of TcMAT1-1-1 and TcMAT1-2-1 genes. Sample collection in field was carried out using a spade at a depth of 10 cm and at 10–15 cm from the plant base, approximately. Soil and root samples were dried at room temperature and then stored at -20°C in microcentrifuge tubes until DNA isolation. DNA isolation Different approaches were followed for the isolation of genomic DNA depending on the source of the sample: soil samples, root samples, FLM from in vitro cultured strains or single spores of T. claveryi ascocarps. Three steel beads of 3 mm diameter were added to microcentrifuge tubes containing root, soil or FLM samples, which were then homogenized using the TissueLyser II (QIAGEN, Germany) as dry material (soil) or pre-immersed in liquid nitrogen to facilitate plant and fungal cell disruption (roots and FLM). DNA from soil was extracted using the NucleoSpin® Soil kit (Macherey-Nagel, Düren, Germany), following the manufacturer’s instructions with some modifications: 500 µl of the lysis buffer SL1 and 150 µl of the SX enhancer solution were used. DNA from root samples and FLM was extracted using the CTAB method (Chang et al. 1993 ). Subsequently, all samples were purified using the DNeasy® PowerClean® Pro Cleanup kit (Hilden, Germany), according to the manufacturer’s guidelines. In addition, DNA isolation of single spores belonging to the same ascus of immature T. claveryi gleba was carried out following the methodology reported by Paolocci et al. ( 2006 ) and Rubini et al. ( 2011a ). The concentration and quality of DNA samples was determined using a NanoDrop ND-2000 Spectrophotometer (Thermo Fisher Scientific,Waltham, MA, USA). These samples were stored at -20°C until further use. Primer design and PCR protocol for the identification of TcMAT genes To corroborate the identity of the T. claveryi mycelium strains, PCR methodology using primers targeting the ribosomic DNA (rDNA) region (ITS1F and ITS4) was performed (White TJ et al. 1990 ), according to Bordallo et al. ( 2013 ) (Supplementary Figs. 2–3). Primers targeting the TcMAT1-1-1 gene, which was previously identified by Marqués-Gálvez et al. ( 2021 ), were designed by using the putative sequence of MAT1-1-1 found in scaffold 39 (genomic coordinates, 66965–70230) of T. claveryi available in Mycocosm database ( https://mycocosm.jgi.doe.gov/Tercla1/Tercla1.home.html ) (Table 1 ). Using as a template the T. claveryi genome, the 453 and 455 primer pair (Table 1 ), designed on the putative regions flanking the TcMAT locus was employed to amplify the strains of the collection. This PCR was carried out in FlexCycler thermal cycler (Analytik Jena, Jena, Germany) in a final volume of 50 µl following a two-step procedure: initial denaturation at 98°C for 30 s, followed by 35 cycles of (i) denaturation at 98°C for 7 s, and (ii) annealing and extension at 72°C for 2 min, with a final extension at 72°C for 7 min. The resulting amplicons obtained from strains with (Tc1705) or without (TcLlano) the TcMAT1-1-1 gene as per PCR with TcMAT1-1-1 specific primer pair were sequenced by Plasmidsaurus ( https://plasmidsaurus.com ) using Oxford Nanopore Technology with custom analysis and annotation. The consensus sequences obtained were used to confirm the specificity of TcMAT1-1-1 primers and design TcMAT1-2-1 specific primers. All primers were designed with the help of PerlPrimer (Marshall, 2004 ) and manually fine-tuned afterwards. Table 1 List of primers employed for the optimized PCR-based characterization of T. claveryi reproductive genes. Primer ID Sequence (5’◊3’) Location Length (nt) Tm ( °C) Amplicon (pb) GC (%) ITS1F CTTGGTCATTTAGAGGAAGTAA 18S rRNA gene 22 58.0 633 36.36 ITS4 TCCTCCGCTTATTGATATGC 28S rRNA gene 20 61.0 45.00 453 GGTAATTGCGGTCGGGGATTCTGG MAT flanking locus 24 69.0 2868 ( MAT1-1-1 ) 3087 ( MAT1-2-1 ) 58.33 455 TTCCGCGCACAGTGAGTCCATCATTATT MAT flanking locus 28 70.1 46.43 MAT111BFwd TGTCTCCACTGTCTCTATCTTTGCTG MAT1-1-1 26 65.8 273 46.15 MAT111BRev AAGCGTGGTTGAAAGTCGTGTTC MAT1-1-1 23 65.7 47.83 MAT121Fwd CTCCACCTCTAAGCAACCTTCCA MAT1-2-1 23 65.7 434 52.17 MAT121Rev GTACTGAATTCCGTTCTGCTTCGAGAT MAT1-2-1 27 66.5 44.44 Tm = Melting temperature. The final optimized procedure for T. claveryi MAT gene identification consisted of a nested PCR reaction containing 0.2 mM of each dNTP, 0.2 µM of each primer, 2.5–50 ng of gDNA, 1X of Phusion™ HF Buffer and 0.02 U/µl of Phusion™ High - Fidelity DNA Polymerase (Thermo Fisher Scientific Baltics UAB, Lithuania). The first PCR employed the 453–455 primer pair and was carried out as explained above. After this reaction, PCR products were purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific Baltics UAB, Lithuania) according to the manufacturer's guidelines. The second PCR reaction was performed in a 20 µl volume using the previous purified PCR product as template with MAT111BFwd-MAT111BRev and MAT121Fwd-MAT121Rev specific primers, following a three-step program: initial denaturation at 98°C for 30 s, followed by 35 cycles of (i) denaturation at 98°C for 7 s, (ii) annealing at 68°C for 10 s, and (iii) extension at 72°C for 30 s, with a final extension at 72°C for 7 min. For the second reaction, a multiplex PCR including both MAT1-1-1 and MAT1-2-1 specific primer pairs, was applied to the analysed samples. Each nested PCR experiment included (i) two non-DNA-template negative control, one from the first PCR and another for the second PCR, and (ii) positive controls: DNA from a strain of TcMAT1-1-1 , another of TcMAT1-2-1 , and a 1:1 (v:v) mix of both. Final PCR products were loaded and separated on an agarose gel stained with SYBR™ Safe DNA Gel Stain (Thermo Fisher Scientific, Life Sciences Solutions, CA, USA) and photographed under an UV transilluminator (MultiImage™ Light Cabinet, Alpha Innotech, San Leandro, CA, USA). In addition, two putative TcMAT1-1-1 and TcMAT1-2-1 amplicons, each one obtained by conventional nested PCR from a different spore of the same ascus, were sequenced using Sanger sequencing (3500 Genetic Analyzer, Applied Biosystems, Waltham, MA, USA) at the Molecular Biology Service belonging to the “Area Científica y Técnica de Investigación” (ACTI, Universidad de Murcia) and aligned to the MAT1-1-1 and MAT1-2-1 sequences. Genomic structure prediction of T. claveryi MAT locus Using the previously sequenced MAT locus , in silico gene structure prediction of TcMAT1-1-1 and TcMAT1-2-1 was performed with FGENESH software (Solovyev et al. 2006 , http://www.softberry.com/berry.phtml ) using Neurospora crassa as a reference genome. Additionally, RNA-seq raw reads from FLM, well-watered and drought-stressed H. almeriense x T. claveryi mycorrhizal roots (Short Read Archive ID: SRP272077, Marqués-Gálvez et al. 2021 ) were used to validate the predicted gene structure at experimental level. The reads were trimmed using TRIMMOMATIC (v0.39, Bolger et al. 2014 ) and mapped against the previously sequenced TcMAT1-1-1 and TcMAT1-2-1 concatenated amplicons, using HISAT2 (v2.2.1, Kim et al. 2019b ). Mapped reads were visualized using IGV viewer (v2.11.9, Robinson et al. 2011 ). Once gene structure was defined for both TcMAT1-1-1 and TcMAT1-2-1 idiomorphs, promoter sequences were defined as the non-coding sequence upstream of the transcription starting site (TSS) of each gene. DNA-binding motifs were searched by analysing these sequences with Find Individual Motif Occurences (FIMO, v5.5.8, Grant et al. 2011 ) online tool, using the non-redundant JASPAR 2024 CORE database for fungi ( https://jaspar2024.elixir.no/ ). The presence of transposable elements in the TcMAT idiomorphs was studied using the GIRI database tool ( https://www.girinst.org ). Protein domain recognition, structural alignment and phylogenetic analysis The TcMAT1-1-1 and TcMAT1-2-1 sequences were analysed using the InterPro database and its domain prediction tools (Blum et al. 2024 ). The three-dimensional structures of α- and HMG-box domains encoded by these genes were predicted using the AlphaFold Server, which utilizes the AlphaFold 3 model (Abramson et al. 2024 ). Default parameters were applied, incorporating geometric constraints through the structure refinement. The resulting structural models were evaluated using MolProbity (Williams et al. 2018 ) to assess stereochemical quality and all-atom contacts. For each predicted protein, MolProbity scores and validation metrics, including clashscore, Ramachandran plot statistics, rotamer outliers, bond and angle geometry, and Cβ deviations, were calculated. The model displaying the most favourable validation metrics was selected for further structural analysis. Structural superposition of the secondary structures of the conserved domains was performed using UCSF Chimera v1.19 (Pettersen et al. 2004 ). Structural alignment was conducted with the Matchmaker tool, excluding long atom pairings iteratively until no aligned atom pairs exceeded a distance threshold of 2.0 Å and ensuring accurate and meaningful structural overlap. Two phylogenetic trees were constructed based on the α- and HMG-box domains encoded by orthologous MAT genes within the Pezizomycetes. Protein sequences were selected according to their phylogenetic proximity and obtained from the JGI MycoCosm database ( https://genome.jgi.doe.gov/mycocosm/home ). For the α-box domain analysis, 8 orthologous sequences were selected, whereas 11 orthologs were used for the HMG domain (Supplementary Table 1). Naumovozyma castellii and Rhizopus stolonifer were included as outgroups for the α- and HMG-box domain trees, respectively. Multiple sequence alignments were performed using MUSCLE implemented in MEGA v11 (Tamura et al. 2021 ). Model selection was carried out using 8 computational threads, while all other parameters were kept at default settings. Phylogenetic trees were inferred using the Maximum Likelihood method with 1,000 bootstrap replicates to assess branch support. The LG + I model was identified as the best-fit evolutionary model and was applied to both the α- and HMG-box domains datasets. CDS nucleotide sequences of the selected MAT1-1-1 and MAT1-2-1 genes of different Pezizomycetes fungi (Supplementary Table 1) were aligned using TranslatorX (Abascal et al. 2010 ), which performs codon alignments by translating DNA sequences into amino acids, aligning them at the protein level, and then back-translating to nucleotides. The alignment was generated using the MUSCLE algorithm for protein alignment, and poorly aligned regions were removed using Gblocks. The resulting clean nucleotide alignment was selected for further analyses, as it maintains codon alignment while excluding unreliable sites. To detect signals of selection, the Fixed Effects Likelihood (FEL) method was applied using the Datamonkey web server (Weaver et al. 2018 ), under the assumption of pervasive selection acting uniformly at each codon site across the phylogeny (Kosakovsky Pond and Frost, 2005 ). T. claveryi quantification The amount of T. claveryi DNA in soil and root samples was determined by qPCR methodology using a QuantStudio™ 5 Flex instrument (Applied Biosystems, Waltham, MA, USA). A standard curve was generated from 1:10 dilutions of purified ascocarp DNA to assess the efficiency of the primers. The total volume of each qPCR reaction was 10 µl, consisting of 1X PowerTrack™ SYBR™ Green Master Mix (Thermo Fisher Scientific Baltics UAB, Lithuania), 0.3 µM of each primer (TerclaF3 and TerclaR1, designed by Arenas et al. ( 2022a )), and 30–45 ng of gDNA. The thermal cycling conditions were: 50°C for 2 min, 95°C for 2:30 min (for enzymatic activation), followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Three technical replicates of each sample and standard were performed, and a non-DNA-template was included in each run to ensure the absence of cross-contamination. Statistical analysis Statistical analyses were conducted in R v.4.3.3 (Posit team, 2024 ). Linear models (LMs) were fitted to assess the effects of experimental factors on the abundance of T. claveryi . The response variable was transformed to the square root of ng/mg of sample to improve normality and variance homogeneity. Pairwise comparisons among factor levels (source, time, mating type and location) were performed using estimated marginal means (EMMs) computed with the emmeans package (Lenth, 2025 ). For the combination of variables source and location, pairwise comparisons were conducted applying Bonferroni correction. In all other models, Tukey’s HSD adjustment was applied for multiple comparisons. A significance threshold of p ≤ 0.05 was used throughout the analyses. Data visualization was performed using the ggplot2 package (Wickham, 2016 ). RESULTS PCR protocol optimization and determination of the sexual mating system of Terfezia claveryi To experimentally determine the mating system of T. claveryi , we first screened FLM strains by PCR using both rDNA and MAT1-1-1 primers. Samples that produced the expected amplicons were identified as TcMAT1-1-1 carrier strains. The TcLlano strain, which tested positive for ITS amplification but negative for amplification with TcMAT1-1-1 specific primer pair, was then selected as a putative strain carrying the TcMAT1-2-1 gene. Subsequently, a PCR to amplify the putative MAT idiomorphs from strains harbouring (Tc1705) or lacking (TcLlano) the TcMAT1-1-1 gene was performed by using the primers 453–455 designed on putatively conserved regions flanking the MAT locus (Marquez-Galves et al. 2021). Tc1705 and TcLlano strains showed distinct results, which suggested the presence of different idiomorphs. The obtained PCR products sized 2,925 kb for Tc1705 and 3,275 kb for TcLlano (Fig. 1 A). The sequencing of these amplicons confirmed genetic polymorphism between the strains. In fact, the sequence from Tc1705 aligned with the putative MAT1-1-1 of T. claveryi (81% of identity with scaffold 39, genomic coordinates: 66965–70230) (Supplementary Data), whereas TcLlano aligned with putative MAT1-2-1 of T. boudieri (79% of identity with scaffold 37, genomic coordinates: 129511–135835) (Supplementary Data). Using the sequences obtained from the first PCR products, a new primer pair specific to TcMAT1-1-1 (MAT111BFwd-MAT111BRev) and one to TcMAT1-2-1 (a MAT121Fwd-MAT121Rev) were designed and used to amplify the 453–455 PCR products obtained from both Tc1705 and TcLlano strains. When this second PCR was performed as a non-multiplexed PCR, Tc1705 produced a 270 bp band with MAT111BFwd-MAT111BRev primer pair, but none with MAT121Fwd-MAT121Rev primers, as expected (Fig. 1 B). The opposite result was found for TcLlano, which amplified a 430 bp band with MAT121Fwd-MAT121Rev primer pair but not with MAT111BFwd-MAT111BRev (Fig. 1 C). When this second reaction was performed as a multiplex PCR, including both primer pairs in the same reaction, again Tc1705 strain produced a single 270 bp amplicon, while TcLlano strain produced a single 430 bp amplicon. Additionally, when both templates were mixed at a 1:1 proportion, two amplicons (270 and 410 bps) were produced concomitantly. Overall, these results indicate that Tc1705 harbours the MAT1-1-1 gene, whereas TcLlano is a MAT1-2-1 strain carrier (Fig. 1 D). In order to provide another line of evidence of the heterothallic nature of T. claveryi , we isolated DNA from six spores from the same ascocarp and performed the same nested PCR protocol. In this case, the second reaction was performed as a non-mutiplex, since multiplex results were not consistent. Six spores derived from a single ascus of immature gleba exhibited a consistent pattern, in which three of them tested positive for MAT1-2-1 and the remaining three were positive for MAT1-1-1 (Fig. 1 E-F), thereby reinforcing the concept not only of heterothallism but also of the haploid nature of the T. claveryi spores. The sequencing of PCR products from two distinct spores belonging the same ascus, one positive for MAT1-1-1 and the other for MAT1-2-1 , revealed identical sequences to those obtained from amplicons of pure mycelium Tc1705 and TcLlano strains (Supplementary Data). Overall, the results from the molecular approach provided strong evidence for the occurrence of two distinct, non-concurrent idiomorphs at the MAT locus in T. claveryi , indicating its heterothallic nature. Characterization of the MAT locus of T. claveryi Both the in silico gene structure prediction based on the sequenced MAT amplicons (Supplementary Figs. 4–5). as well as RNA-seq data from H. almeriense x T. claveryi mycorrhizal roots (Supplementary Fig. 6) revealed the same gene length and genomic organization of the MAT locus, including the same intron number and positions in both TcMAT genes (Fig. 2 ). Both sequences were oriented in the antisense direction, relative to the reference genome. TcMAT1-1-1 (2,868 pb) showed a slightly smaller DNA sequence than TcMAT1-2-1 (3,087 pb). In addition, the coding region of TcMAT1-1-1 contained a single intron located within the α-box domain, whereas the coding region of TcMAT1-2-1 exhibited a more complex exon-intron structure since it contained five introns, three of which were in the HMG-box domain. Another intron was found within the CDS, while the last one was located at the 5′ UTR region in TcMAT1-2-1 . The regions flanking the idiomorphs were highly conserved, with 74.3% sequence identity in the 113 bp 5′ segment and 80.2% sequence identity in the 256 bp 3′ segment, which included the coding region of an apurinic/apyrimidinic endonuclease (APN). The CDS sequence of TcMAT1-1-1 encoded for a smaller protein (254 aa) than that encoded by TcMAT1-2-1 (446 aa). An 812 bp promotor region was identified between APN and TcMAT1-1-1 genes, whereas it was of 504 bp for TcMAT1-2-1 . We discovered several DNA-binding motifs for both promoter regions (Table 2 ), including (among others) three copies of the CHA4 motif (GGCGGAGA) and three copies of the IME1 motif (CGGCGGAG) in TcMAT1-1-1 pro , two copies of the EDS1 motif (GGAAAAA) in TcMAT1-2-1 pro and YPR196W motif ([G/A][A/T]TTC[T/A]CCG), which was found in both promoter regions. No transposable elements were found in either idiomorph. Table 2 DNA-binging motifs identified in TcMAT1-1-1 and TcMAT1-2-1 promoters. Motifs were identified by searching the 812 bp and 504 bp promoter sequences of TcMAT1-1-1 and TcMAT1-2-1 , respectively, using FIMO tool (see materials and methods). Only those hits with positive score and statistical significance (p ≤ 0.01) are shown. Promotor region TF (Motif ID) Motif sequence Position* Strand Score p-value Known biological role TcMAT1-1-1 CHA4 (MA0283.1) GGCGGAGA 413 390 344 + 14.1463 9.90e-06 Involved in aminoacidic metabolism. Responsible of the use of serine/threonine as nitrogen sources (Holmberg and Scherling, 1996) STB3 (MA 0390.2) ATTTTT TCATG 624 - 13.6557 1.22e-05 Regulator of ribosome biogenesis genes under nutrient stress. Repression of growth under quiescence (Liko et al. 2010 ) SWI4 (MA0401.1) ACGCGAAA 135 - 14.3293 1.47e-05 Involved in the regulation of transcription of cell cycle-dependent genes (Baetz and Andrews, 1999 ) IME1 (MA0320.1) CGGCGGAG 412 389 343 + 12.6571 3.25e-05 Inducer of meiosis 1 ( IME1 ) encodes a transcription factor required for sporulation and meiosis processes (Mandel et al. 1994 ; Chu and Herskowitz, 1998 ) ZMS1 (MA0441.2) CCCCGCA 389 + 12.6098 3.62e-05 Regulator of genes related to glycerol-based growth and cellular respiration (Lu et al. 2005 ) MAC1 (MA0326.1) TGTGCTCG 668 - 11.7586 5.93e-05 Copper-fist DNA binding domain. Regulation of the Cu/Fe utilization and stress resistance (Yonkovich et al. 2002 ) SUM1 (MA0398.2) TAATTTTT 626 - 10.619 6.46e-05 Related to repression of sporulation genes during vegetative growth through the recruitment of a histone deacetylase (Xie et al. 1999 ) TBF1 (MA0403.3) AACCCTGA 89 + 11.6053 7.98e-05 TBF1 encodes a protein that binds to telomeric TTAGGG repeats, regulates telomere length, and controls gene expression by acting as a chromatin insulator (Koering et al. 2000 ) NDT80 (MA0343.2) GACACAAAC 434 + 10.4404 9.09e-05 NDT80 encodes a transcription factor which is involved in the activation of genes for meiosis and spore formation, competing with the repressor SUM1 (Pierce et al. 2003 ) YPR196W (MA0437.1) GATTCTCCG 532 + 11.387 6.6e-05 C2H2 zinc finger motif. Poorly characterized. Enriched in hexose transporters in yeasts (Badis et al. 2008 ) TcMAT1-2-1 YPR196W (MA0437.1) ATTTCACCG 132 - 11.387 6.6e-05 IXR1 (MA0323.1) AAACGGTTGCGGGT 258 - 8.06579 1.11e-05 High mobility group (HMG) related to the regulation of hypoxic genes (Castro-Prego et al. 2010 ) LEU3 (MA0324.1) CCGGTTGCGG 269 - 13.3659 2.35e-05 The regulatory protein LEU3 (LEUR) controls a group of leucine-specific genes (Sze et al. 1992 ) SWI4 (MA0401.1) ACGCGAAT 319 + 12.9024 2.94e-05 The SWI4 transcription factor, together with SWI6, forms the SBF complex, responsible for activating genes in the G1/S transition of the cell cycle ( Baetz and Andrews, 1999 ) MCM1 (MA0331.1) CCTAATTGGCA 298 - 11.3878 5.65e-05 Involved in the activation of early cell cycle genes (G1/M), regulation of mating-type genes, and coordination of the arginine metabolism genes (Elble and Tye, 1991 ; Messenguy and Dubois, 1993 ) HSF1 (MA0319.2) ATGGAAC 207 + 12.1341 6.51e-05 The heat shock transcription factor (HSF1) activates heat shock proteins (HSPs) to protect cells from stress by maintaining proper protein folding and preventing damage (Wiederrecht et al. 1988 ) EDS1 (MA0294.2) GGAAAAA 161 44 + 11.878 7.93e-05 Member of C6 zinc cluster factors. Poorly characterized. ARR1 (MA0274.1) ATCTGAAT 354 + 10.9221 8.79e-05 The arsenical-resistance protein (ARR1) is involved in the cellular response to arsenic-containing substances (Menezes et al. 2004 ) ASH1 (MA0276.1) CCAAATTAGG 309 + 10.7429 9.73e-05 Involved in in chromatin organization, negative regulation of mating-type switching and promotion of pseudohyphal growth (Sil and Herskowitz, 1996 ; Pan and Heitman, 2000 ) RME1 (MA0370.1) TGTAAAGGGA 31 + 10.7237 9.85e-05 Regulator of meiosis, pseudohyphal growth and the G1/S transition. Promoter of invasive growth under glucose limitation (Toone et al. 1995 ) *Upstream TSS The aminoacidic sequences of the conserved α- and HMG-box domains are highly preserved along different Pezizomycetes fungi InterPro analysis revealed the presence of two conserved domains within the amino acid sequences of the mating type proteins: an α-box domain with 58 aas in TcMAT1-1-1 and an HMG-box domain with 78 aas in TcMAT1-2-1 (Supplementary Fig. 7). These sequences were used to investigate their evolutionary relationships among various species within the Pezizomycetes class (Fig. 3 ). The α-box domain neighbour-joining tree showed that the studied genera belonging to Pezizaceae family considered as desert truffles ( Terfezia , Tirmania , Mattirolomyces , and Kalaharituber ), formed a single clade supported by moderate to high bootstrap values (48–99). In the HMG-box domain tree, Terfezia and Kalaharituber clustered together with a bootstrap value of 77. The genus Picoa , which belongs to the Pyronemataceae family but is also regarded as a desert truffle, was positioned outside this clade. In both trees, as expected, the different Tuber species (Tuberaceae) appeared closely related, forming well-supported clusters. The conserved regions of TcMAT proteins were aligned with those from various Pezizomycetes species (Fig. 3 C-D). In total, 10 residues in α-box domain and 17 in HMG domain alignments were fully conserved across all analysed species. Additionally, a conserved intron position was observed across all species at DNA level, corresponding to a codon encoding serine or cysteine residue within the α-box domain alignment (Fig. 3 C). However, for the HMG-domain, the number and position of introns varied between species, ranging from two to four (Fig. 3 D). This variability indicates greater structural divergence according to the intron gain or loss events in the evolution of the MAT1-2-1 gene compared to MAT1-1-1 gene. The sequences of proteins encoded by TcMAT1-1-1 and TcMAT1-2-1 allowed the study of the tertiary structures of the α- and HMG-box domains, which were predicted using AlphaFold Server. For the α-box domain, the confidence score was predicted template modelling pTM = 0.72, while for the HMG-box domain, the predicted confidence was pTM = 0.78, indicating moderate to high structural reliability in both cases (Xu and Zhang, 2010 ). According to MolProbity, the best model for each domain was selected and subsequently superimposed for structural comparison (Fig. 4 ). Their three-dimensional structures exhibited remarkable similarity, as evidenced by an RMSD value of 0.78 Ångströms when aligned. This low RMSD value indicates excellent structural conservation between the α- and HMG-box domains, suggesting they adopt nearly identical protein folds despite their sequence divergence. The structural similarity observed supports both a functional relationship and a potential evolutionary connection between these mating-type domains and their potential role in transcriptional regulation within the mating system of this organism. Although amino acid conservation across the aligned sequences was variable and not uniform (Fig. 3 C-D), evolutionary analysis of mating type genes across Pezizomycetes species using the FEL method revealed a predominant pattern of purifying selection. For MAT1-1-1 , 55 out of 158 variable codons (≈ 34.8%) exhibited significant evidence of purifying selection (dN/dS < 1; p < 0.05). Similarly, for MAT1-2-1 , 46 out of 119 codons (≈ 38.7%) were under purifying selection at the same significance threshold. Importantly, no codons were identified under diversifying (positive) selection, indicating strong evolutionary constraint on both genes. Spatio-temporal evolution of TcMAT genes Over a two-year period, the dynamic of T. claveryi from nursery to the field was followed. T. claveryi was deteted and quantified by qPCR in all root and soil samples, confirming the persistence of the fungus across the complete sampling timeline (Fig. 5 A). In the nursery scenario, the abundance of T. claveryi remained relatively stable during the nine months following inoculation. This pattern was maintained to time T14, which corresponds to the first samples collected from field two weeks after transplantation. Interestingly, a marked increase in variability was observed at subsequent times T18 and T27, as evidenced by a broader distribution in fungal abundance values. Statistical analysis revealed significant differences in T. claveryi abundance between time T18 and all preceding nursery time points ( p-values : T2–T18 = 0.001, T4–T18 = 0.0055, T6–T18 = 0.0047, T9–T18 = 0.0006), and also between time T27 and all nursery time points ( p-values : T2-T27 = 0.0093, T4-T27 = 0.0411, T6-T27 = 0.026, T9-T27 = 0.0133). Additionally, T. claveryi abundance differed significantly according to the sample source (rhizospheric soil - roots; p-value = 0.0004; (Fig. 5 B). Specifically, fungal quantity was consistently lower in root than in soil samples. When the frequence of TcMAT genes was investigated differences according to the source and location variables emerged (Fig. 5 C). Whereas in root samples from nursery plants both TcMAT1-1-1 and TcMAT1-2-1 were detected, root samples from the field plants exhibited the TcMAT1-1-1 only, regardless of the collection timing. TcMAT1-1-1 , TcMAT1-2-1 and their combination ( TcMAT1-1-1 + TcMAT1-2-1 ) were detected in soil nursery samples, with TcMAT1-1-1 showing the highest frequency. In soil field samples both TcMAT1-1-1 and TcMAT1-2-1 were detected, but not their combination. In addition, the abundance of TcMAT genes in field was evaluated (Fig. 5 D). TcMAT1-1-1 was found in all the 10 plots analysed, whereas TcMAT1-2-1 was present only in the 40% of the plots. DISCUSSION By combining in silico and molecular approaches, here we not only provide compelling evidence in support of the heterothallic reproductive mode of T. claveryi , but also shed preliminary lights on the spatio- temporal distribution of T. claveryi strains of opposite mating type on both host plants and soil. This information along with the protocols herein developed are crucial to drive management practices to promote desert truffle spreading and fructification. Additionally, first hints on the evolution within Pezizomycete class of MAT genes and regulatory motifs controlling their expression have been provided. Detection of TcMAT genes requires a nested PCR approach Attempts to detect the single-copy TcMAT genes using conventional PCR proved challenging. Consequently, a nested PCR protocol was developed and optimized to enhance sensitivity and minimize the occurrence of false positives. Nested PCR, which involves two sequential rounds of amplification using two sets of primers, was found to be highly sensitive and reliable specially in soil samples. The greatest difficulties in amplifying these genes were encountered in field root samples, which is consistent with the low concentration of T. claveryi DNA found in this tissue. This likely reflects the low abundance of the fungus in the root environment despite its initial inoculation with the host plant, since it appears to be outcompeted by other fungi in the field, as previously reported by Arenas et al. ( 2021 ). Sexual reproduction in T. claveryi requires outcrossing As already suggested by Marqués-Gálvez et al. ( 2021 ), our work confirms that the MAT locus in T. claveryi is constituted by two non-concurrent idiomorphs, TcMAT1-1 and TcMAT1-2 , each one characteristic of specific strains. This research represents the first report of a desert truffle species for which the mating-type reproductive mode has been characterised. The detection and sequencing of different mating type idiomorphs in individual spores derived from the same ascus supports the haploid nature of T. claveryi ascospores. This observation indicates successful segregation of the MAT locus during meiosis, which is typical of heterothallic ascomycetes (Wilson et al. 2021 ). The confirmation of haploidy at the spore level reinforces the hypothesis that mating compatibility in T. claveryi requires the interaction of two genetically distinct strains carrying opposite mating types. This finding is consistent with previous reports in the Neurospora crassa model ascomycetes (Raju, 1992 ) as well as other mycorrhizal truffle species such as Tuber melanosporum (Rubini et al. 2011a ), Tuber indicum (Belfiori et al. 2013 ) or Tuber borchii (Belfiori et al. 2016 ). Moreover, it suggests that under natural conditions, ascospore germination and subsequent mycelial development are likely initiated from a single mating type, thus requiring the presence of a compatible strain in the surrounding environment to complete the sexual cycle. In this scenario, periodic selection and inoculation of host plants with sexually compatible strains of T. claveryi , specially in field stage, may notably increase the likelihood of mating and, therefore, fruit body development (Rubini et al. 2011a ; Rubini et al. 2014 ; Molinier et al. 2016 ; De la Varga et al. 2017 ). The genetic structure of T. claveryi MAT locus reveals lineage-specific evolution and specific regulatory mechanisms The characterisation of MAT locus through RNAseq and DNA sequencing enabled the elucidation of its genomic structure. Interestingly, TcMAT1-1 and TcMAT1-2 idiomorphs are 2,868 bp and 3,087 bp in length, respectively. This contrasts with other hypogeous symbiotic ascomycetes, such as T. melanosporum , in which both MAT1-1 and MAT1-2 idiomorphs are considerably longer, consisting of 7,430 bp and 5,550 bp, respectively (Rubini et al. 2011a ). The MAT idiomorphs lengths in other Tuber species are even greater (Belfiori et al. 2016 ). Differently from the studied Tuber species (Rubini et al. 2011a , Belfiori et al. 2016 ), in the two T. claveryi MAT idiomorphs neither transposon-like elements nor additional ORFs are present. The orientation of TcMAT genes also reveals a different structural organization when compared to other described Pezizomycetes. Both TcMAT1-1-1 and TcMAT1-2-1 are oriented in the same direction. This configuration contrasts with that of other truffles species such as T. indicum and T. melanosporum , where MAT1-1-1 shares the same orientation but MAT1-2-1 is located on the opposite strand (Rubini et al. 2011a ; Belfiori et al. 2013 ). Conversely, in T. borchii , MAT1-1-1 displays the inverted orientation relative to T. claveryi (Belfiori et al. 2016 ). The multiple sequence alignment of the conserved α- and HMG-box domains across various Pezizomycetes species revealed a high degree of conservation, with a notable number of aligned residues belonging to chemically similar amino acid groups. This outcome implies that most of the observed substitutions are conservative, preserving the structural or functional integrity of these domains and indicating potential importance across different species. Remarkably, a conserved intron at DNA level is present in the same position in all organisms within the α-box domain, although the corresponding amino acid alternates between cysteine ( T. claveryi , Tirmania nivea , Mattirolomyces terfezioides ) and serine ( Kalaharituber pfeilli , Ascobolus immersus , T. melanosporum , T. borchii , T. indicum ). These residues are structurally similar in size and polarity but differ in chemical properties, since cysteine contains a thiol group, which is highly reactive and can form disulfide bonds, whereas serine has a hydroxyl group, which is less reactive. In contrast, the HMG-box domain displays variation in both the number and location of introns among species. Altogether, the mentioned variations may reflect lineage-specific adaptations (Yampolsky et al. 2005; Huzurbazar et al. 2010 ). Such molecular phenomenon plays a role in the evolutionary dynamics of mating-type loci, possibly contributing to the suppression of recombination and the regulation of gene expression (Idnurm et al. 2008 ; De Hoff et al. 2013 ; Yamazaki et al. 2017 ). Regarding gene regulation, several DNA-binding motifs were identified in the promoter regions of both genes. Importantly, IME1, which is present in several copies, and other motifs (e.g. RME1, ASH1, MCM1, SWI4, NDT80 or SUM1) are associated with transcription factors involved in biological functions such as sexual reproduction, cell cycle progression, response to stimuli and development. This is consistent with the known function of the MAT locus in fungi, which orchestrates the regulation of reproductive processes (Fraser and Heitman, 2003 ; Debuchy et al. 2010 ). Additionally, other binding motifs related to stress response (STB3, MAC1, IXR1, HSF1, ARR1) and aminoacidic metabolism (CHA4, LEU3) were also identified. The presence of these motifs suggests that sexual reproduction in T. claveryi may be activated under stressful or changing environmental conditions, consistent with the idea that fungi tend to shift to sexual reproduction as an adaptive response to stress (Schoustra et al. 2010 ). Amino acid availability also appears to play a critical role in regulating this process in T.claceryi as much as in Aspergillus nidulans , whose sexual development is promoted when amino acids are abundant and repressed under amino acid starvation (Hoffmann et al. 2000 ). Therefore, while environmental stress may act as a signal to initiate sexual reproduction, sufficient nutrient availability, particularly of amino acids, might be required to complete the process successfully. This coordinated regulation highlights the adaptive flexibility of T. claveryi , allowing it to integrate environmental and metabolic signals to optimize sexual reproduction and fruiting body formation under arid conditions. This finding is essential for better understanding desert truffle production. Interestingly, the YPR196W motif, bound by transcription factors which may be involved in maltase and maltose permease transcription genes is present in both MAT1-1-1 and MAT1-2-1 promoters, suggesting a potentially conserved regulatory role. The presence of an intron in the 5’UTR of TcMAT1-2-1 suggests that this gene may possess specialized regulatory features (Bicknell et al. 2012 ; Hoshida et al. 2017 ). This intron can harbour transcription factor binding sites and influence gene expression at multiple levels, from transcription to translation. Evidence from Arabidopsis indicates that 5’UTR introns can enhance mRNA accumulation and modulate transcription start site selection, supporting their role as regulatory elements (Chung et al. 2006 ; Gallegos and Rose, 2017 ). In TcMAT1-2-1 , this intron may provide an additional layer of control, ensuring precise temporal and spatial expression, which could be crucial for sexual differentiation and adaptive responses to environmental cues in T. claveryi . In contrast, TcMAT1-1-1 only contains an intron, which is located in the coding region, signifying a simpler mechanism. The structural difference may reflect distinct regulatory requirements between the two mating types. Further studies should be aimed to experimentally validate the TF-DNA interactions here described in the promoter regions of TcMAT genes, which will help to better understand the regulatory mechanisms that trigger sexual reproduction in truffles. Previous comparative analyses suggest that in Pezizomycotina, the α-box domain present in MAT1-1-1 evolved from an ancestral MATA_HMG domain within the HMG-box superfamily and retained its tertiary conformation due to functional constraints (Martin et al. 2010 ). Our results in T. claveryi are in line with this report. We showed that the amino acid sequences of the α- and HMG-box domains in T. claveryi have diverged considerably (similarity = 34.1%). However, their predicted tertiary structures are highly similar, as evidenced by a low RMSD value. This finding implies that both domains share a conserved fold which is characteristic of the HMG-box superfamily, since they have similar L-shaped architecture with three α-helices. The preservation of the same scaffold in both domains suggests that they perform similar biological roles, from transcriptional regulation to mating-type determination (Ait Benkhali et al. 2013 ). Maintenance of the tertiary structure despite notable differences in primary sequence is a well-known phenomenon, particularly in DNA binding proteins and protein-protein interactions (Illergård et al. 2009 ; Thapar 2015 ). Therefore, the structural conservation despite the low sequence similarity within α- and HMG-box domains observed in TcMAT proteins suggests that selective pressure act primarily on preserving structural integrity, rather than on their exact amino acid composition. Importantly, selection analysis revealed significant finding of purifying selection, indicating that there is a strong selective pressure to eliminate non-synonymous mutations that alter the conserved domains function not only for T. claveryi , but also for the analysed Pezizomycetes. This extreme conservation is likely due to the critical role of MAT proteins as master regulators in reproductive mechanisms, where structural changes could compromise recognition specificity between strains (Fraser and Heitman, 2003 ; Debuchy et al. 2010 ; Ait Benkhali et al. 2013 ). Overall, our findings provide functional insight into the molecular mechanisms of fungal mating-type regulation and adds strong evidence related to the hypothesis of a common ancestral MATA_HMG domain as an earlier form of fungal MAT loci, which gave origin to the current α- and HMG-box domains, first postulated by Idnurm et al. ( 2008 ) and supported by Martin et al. ( 2010 ). Mating type fingerprinting of H. almeriense x T. claveryi reveals tissue-related limitations and a loss of mating diversity from nursery to field The deep characterization of both TcMAT genes allowed the design of specific primers and the optimization of a protocol to detect the sexual identity of T. claveryi in different organs. As a case scenario, we evaluated the presence of the idiomorphs in a set of mycorrhizal roots of H. almeriense and the surrounding rhizospheric soil. Regarding T. claveryi concentration, the relatively low and uniform presence of the fungus during the nursery phase suggests that the controlled conditions constrained fungal growth, maintaining a balanced symbiotic relationship (Talley et al. 2002 ; Jacquemyn et al. 2015 ). However, this pattern changed after the transplantation of plants to the field, where a marked increase in fungal DNA concentrations was observed at T18 and T27, albeit with a large variability among samples. Such phenomenon observed in field may be influenced by microenvironment heterogeneity and the adaptation of the symbiosis to the new conditions (Bang et al. 2018 ; Arenas et al. 2022b ). Altogether, these outcomes highlight how environmental factors can promote or disturb fungal colonization dynamics beyond controlled nursery settings. Determination of TcMAT genes in nursery and field root samples was limited due to the low abundance of T. claveryi DNA, as previously mentioned, likely leading to underestimation of idiomorph presence in organ. Although a mix of spores from different mating type were introduced into the substrate during inoculation, root colonization and mycorrhiza formation require time, and fungal biomass within the roots remained low during the early months, making its detection complicated. Even in the field stage, detection in roots can be constrained by climatic conditions or direct competition with other fungi, which may limit the establishment and proliferation of T. claveryi (Arenas et al. 2021 ). These factors, together with the single-copy nature of TcMAT genes, further reduced detection sensitivity. According to the mating type distribution at nursery stage, both TcMAT1-1 and TcMAT1-2 idiomorphs were found in root samples, with frequencies fluctuating over time. In contrast, the soil compartment exhibited a predominance of TcMAT1-1-1 , which was consistently detected across all sampling points, indicating its early establishment or greater sensitivity advantage. In the field stage, the pattern became even more pronounced, as most of the determined samples were dominated by TcMAT1-1-1 . The frequency of TcMAT1-2-1 was substantially reduced, and in some time points, not detected. Importantly, the use of spores as inoculum ensures that both mating types are provided to the host plants. In line with this, strains of both mating types are found under controlled conditions, as shown by root samples collected at T2-T9. In contrast, after transplantation, a specific mating type ( MAT1-1-1 ) became dominant on the roots of host plants. Interestingly, this mating type is the same that prevailed in soil nursery samples. This striking shift towards a single mating type suggests that the balance between idiomorphs depends on many, and still unknown variables governing the different steps of plant and soil colonization by T. claveryi . In turn, this observation let us to argue that strains harboring opposite MAT idiomorphs respond differently to identical environmental conditions, likely due to different regulation of MAT genes or MAT- responsive loci. Polymorphim in the promoter regions of the MAT genes and/or the presence of a 5’UTR intron in TcMAT1-2-1 may be responsible for the more restricted spatio-temporal distribution of strains carrying the MAT1-2-1 with respect to those carrying the MAT1-1-1 gene. Therefore, an intro-mediated regulation, polymorphisms within the regulatory regions of MAT genes or a combination of both factors may influence the distinct distribution patterns of strains of opposite mating types. Further studies are warranted to elucidate the relative contribution of these mechanisms. The bias distribution of T. claveryi mating types may have significant implications for the sexual reproduction potential and the maintenance of genetic diversity in T. claveryi populations under field conditions. In fact, no ascocarp production was observed during the field stage, supporting the hypothesis that biased mating type distributions limit reproductive success. Considering that desert truffle production usually begins three years after planting, this timeframe may correspond to the period required for compatible strains carrying the alternate MAT to colonize neighboring plants or soil and enable ascocarp formation. Altogether, it appears that colonization in the studied field is highly selective or that TcMAT1-1-1 is more competitive during the colonization process. This finding goes hand with hand with similar results reported in T. melanosporum open-field studies (Rubini et al. 2011b ), where a notable prevalence of a specific mating type was observed at individual sites. Thus, the dominance of one mating type over the other may depend on the competitivness of each strain. Indeed, the distribution of mating type genes is often non-random and influenced by both ecological and cultivation factors (Murat et al. 2013 ; De la Varga et al. 2017 ). Natural truffle populations, including desert truffles, tend to be spatially structured, with patches dominated by a single mating type which can limit the potential for sexual reproduction. In this context, the potential use of desert truffle nests to balance mating type distribution, as it has been already tested in black truffes (Garcia-Barreda et al. 2020 ), remains largely unexplored and could represent a promising strategy to enhance cultivation yield. These patterns presented here give insight about the distribution and persistence of mating types in ectendomycorrhizal fungi, and suggest further research is necessary to clarify the mechanisms driving idiomorph dominance and its fructification consequences. In this context, it would be interesting study more H. almeriense x T. claveryi plantations in more diverse contexts and during longer periods of time. Monitoring TcMAT genes in both roots and soil provides valuable information for optimising desert truffle cultivation. The identification of the MAT idiomorph that predominates in a plantation could allow to introduce additional inoculum containing strains of the opposite mating type in order to restore balance and increase the probability of sexual reproduction and fruiting body formation. Therefore, the methodology established in this work represents a key tool for improving the management and productivity of this type of cultivation systems. CONCLUSION The present study provides meaningful insights into the reproductive system of T. claveryi and sheds light on the phylogenetic relationships and evolution of MAT genes in symbiotic Pezizomycetes. The finding that the two master genes for sexual reproduction ( MAT1-1-1 and MAT1-2-1 ) are present in different strains provides conclusive evidence that T. claveryi is a heterothllic fungus. This observation, coupled to the uneven distribution in the field of strains carrying opposite mating types, should lead to a serious reconsideration of the process of inoculating of host plants and orchard managment practices, with the aim of promoting desert truffle fruiting. Declarations Competing interests: The authors declare no competing interests. Funding This research was funded by MCIN/AEI/10. 13039/50110 0011033, project reference PID2020-115210RB-I00. Laura Andreu-Ardil is greatiful the University of Murcia for its funding through the Predoctoral Contracts Program of the Research Promotion Plan. Author Contribution AM, FP, ANR and JEMG conceived the study; All authors performed different parts of the lab work; LAA, ALG, FA, FP, MPG and JEMG processed and analyzed data; LAA and JEMG wrote the first draft; All authors contributed critically to review and edit the drafts and gave final approval for publication; AM is the researcher responsible for funding acquisition. All authors have read and agreed to the published version of the manuscript. Acknowledgement The authors thank to desert truffle farmer Pedro Corbalán who kindly allowed the use of his plantation for the research work. Data Availability All data supporting the findings of this study are available within the paper and its Supplementary Information. References Abascal F, Zardoya R, Telford MJ (2010) TranslatorX: multiple alignment of nucleotide sequences guided by amino acid translations. Nucleic Acids Res 38(7):W7–W13. https://doi.org/10.1093/nar/gkq291 Abramson J, Adler J, Dunger J et al (2024) Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630:493–500. https://doi.org/10.1038/s41586-024-07487-w Ait Benkhali J, Coppin E, Brun S et al (2013) A network of HMG-box transcription factors regulates sexual cycle in the fungus Podospora anserina . PLoS Genet 9(7):e1003642. https://doi.org/10.1371/journal.pgen.1003642 Andrino A, Sauheitl L, Guggenberger G et al (2025) Determining the nutritional importance of common mycelial networks in a desert truffle mycorrhizal symbiosis for soil nitrogen redistribution. Rhizosphere 101055. https://doi.org/10.1016/j.rhisph.2025.101055 Arenas F, Morte A, Navarro-Ródenas A (2022a) Design and validation of qPCR-specific primers for quantification of the marketed Terfezia claveryi and Terfezia crassiverrucosa in soil. J Fungi 8(3):1095. https://doi.org/10.3390/jof8101095 Arenas F, López-García Á, Berná LM, Morte A, Navarro-Ródenas A (2022b) Desert truffle mycorrhizosphere harbors organic acid releasing plant growth-promoting rhizobacteria, essentially during the truffle fruiting season. Mycorrhiza 32:193–202. https://doi.org/10.1007/s00572-021-01067-w Arenas F, Navarro-Ródenas A, Chávez D, Guiérrez A, Pérez-Gilabert M, Morte A (2018) Mycelium of Terfezia claveryi as inoculum source to produce desert truffle mycorrhizal plants. Mycorrhiza 28:691–701. https://doi.org/10.1007/s00572-018-0867-3 Arenas F, Navarro-Ródenas A, Marqués-Gálvez JE, Ghignone S, Mello A, Morte A (2021) Different patterns in root and soil fungal diversity drive plant productivity of the desert truffle Terfezia claveryi in plantation. Environ Microbiol 23(10):5917–5933. https://doi.org/10.1111/1462-2920.15688 Badis G, Chan ET, van Bakel H et al (2008) A library of yeast transcription factor motifs reveals a widespread function for Rsc3 in targeting nucleosome exclusion at promoters. Mol Cell 32(6):878–887. https://doi.org/10.1016/j.molcel.2008.11.020 Baetz K, Andrews B (1999) Regulation of cell cycle transcription factor Swi4 through auto-inhibition of DNA binding. Mol Cell Biol 19(10):6729–6741. https://doi.org/10.1128/MCB.19.10.6729 Bang C, Dagan T, Deines P et al (2018) Metaorganisms in extreme environments: do microbes play a role in organismal adaptation? Zool. 127:1–19. https://doi.org/10.1016/j.zool.2018.02.004 Belfiori B, Riccioni C, Paolocci F, Rubini A (2013) Mating type locus of chinese black truffles reveals heterothallism and the presence of cryptic species within the T. indicum species complex. PLoS ONE 8(12):e82353. https://doi.org/10.1371/journal.pone.0082353 Belfiori B, Riccioni C, Paolocci F, Rubini A (2016) Characterization of the reproductive mode and life cycle of the whitish truffle T. borchii . Mycorrhiza 26:515–527. https://doi.org/10.1007/s00572-016-0689-0 Bennett RJ, Turgeon BG (2016) Fungal Sex: The Ascomycota. Microbiol Spectr 4(5). https://doi.org/10.1128/microbiolspec.funk-0005-2016 Berrios L, Yeam J, Holm L et al (2023) Positive interactions between mycorrhizal fungi and bacteria are widespread and benefit plant growth. Curr Biol 33(14):2878–2887. https://doi.org/10.1016/j.cub.2023.06.010 Bicknell AA, Cenik C, Chua HN, Roth FP, Moore MJ (2012) Introns in UTRs: why we should stop ignoring them. BioEssays 34:1025–1034. https://doi.org/10.1002/bies.201200073 Blum M, Andreeva A, Florentino LC et al (2024) InterPro: the protein sequence classification resource in 2025. Nucleic Acids Res 53(D1):D444–D456. https://doi.org/10.1093/nar/gkae1082 Bobrowicz P, Pawlak R, Correa, Bell-Pedersen D, Ebbole DJ (2002) The Neurospora crassa pheromone precursor genes are regulated by the mating type locus and the circadian clock. Mol Microbiol 45(3):795–804. https://doi.org/10.1046/j.1365-2958.2002.03052.x Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinform 30(15):2114–2120. https://doi.org/10.1093/bioinformatics/btu170 Bordallo JJ, Rodríguez A, Muñoz-Mohedano JM, Suz LM, Honrubia M, Morte A (2013) Five new Terfezia species from the Iberian Peninsula. Mycotaxon 124(1):189–208. https://doi.org/10.5248/124.189 Castro-Prego R, Lamas-Maceiras M, Soengas P, Carneiro I, González-Siso I, Celdrán ME (2010) Regulatory factors controlling transcription of Saccharomyces cerevisiae IXR1 by oxygen levels: a model of transcriptional adaptation from aerobiosis to hypoxia implicating ROX1 and IXR1 cross-regulation. Biochem J 425(1):235–243. https://doi.org/10.1042/BJ20091500 Chang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol Rep 11:113–116. https://doi.org/10.1007/BF02670468 Chu S, Herskowitz I (1998) Gametogenesis in yeast is regulated by a transcriptional cascade dependent on Ndt80. Mol Cell 1(5):685–696. https://doi.org/10.1016/S1097-2765(00)80068-4 Chung BY, Simons C, Firth AE, Brown CM, Hellens RP (2006) Effect of 5'UTR introns on gene expression in Arabidopsis thaliana . BMC Genom 7:120. https://doi.org/10.1186/1471-2164-7-120 De Hoff PL, Ferris P, Olson BJ et al (2013) Species and population level molecular profiling reveals cryptic recombination and emergent asymmetry in the dimorphic mating locus of C. reinhardtii . PLoS Genet 9(8):e1003724. https://doi.org/10.1371/journal.pgen.1003724 De la Varga H, Le Tacon F, Lagoguet M et al (2017) Five years investigation of female and male genotypes in périgord black truffle ( Tuber melanosporum Vittad.) revealed contrasted reproduction strategies. Environ Microbiol 19(7):2604–2615. https://doi.org/10.1111/1462-2920.13735 Debuchy R, Berteaux-Lecellier V, Silar P (2010) Mating systems and sexual morphogenesis in Ascomycetes. In: Borkovich KA, Ebbole DJ (eds) Cellular and molecular biology of filamentous fungi. ASM, Washington, DC, pp 501–535 Elble R, Tye BK (1991) Both activation and repression of a-mating-type-specific genes in yeast require transcription factor Mcm1. Proc. Natl. Acad. Sci. USA 88(23):10966–10970. https://doi.org/10.1073/pnas.88.23.10966 Fraser JA, Heitman J (2003) Fungal mating-type loci. Curr Biol 13(20):R792–R795. https://doi.org/10.1016/j.cub.2003.09.046 Fraser JA, Stajich JE, Tarcha EJ et al (2007) Evolution of the mating type locus: insights gained from the dimorphic primary fungal pathogens Histoplasma capsulatum , Coccidioides immitis , and Coccidioides posadasii . Eukaryot Cell 6(4). https://doi.org/10.1128/ec.00018-07 Gallegos JE, Rose AB (2017) Intron DNA sequences can be more important than the proximal promoter in determining the site of transcript initiation. Plant Cell 29(4):843–853. https://doi.org/10.1105/tpc.17.00020 Garcia-Barreda S, Marco P, Martín-Santafé M, Tejedor-Calvo E, Sánchez S (2020) Edaphic and temporal patterns of Tuber melanosporum fruitbody traits and effect of localised peat-based amendment. Sci Rep 10:4422. https://doi.org/10.1038/s41598-020-61274-x Grant CE, Bailey TL, Noble WS (2011) FIMO: scanning for occurrences of a given motif. Bioinform 27(7):1017–1018. https://doi.org/10.1093/bioinformatics/btr064 Guarnizo ÁL, Marqués-Gálvez JE, Arenas F, NavarroRóenas A, Morte A (2025) Morphological and molecular development of Terfezia claveryi ectendomycorrhizae exhibits three well-defined stages. Mycorrhiza 35:31. https://doi.org/10.1007/s00572-025-01205-8 Gutiérrez A, Morte A, Honrubia M (2003) Morphological characterization of the mycorrhiza formed by Helianthemum almeriense Pau with Terfezia claveryi Chatin and Picoa lefebvrei . (Pat) Maire Mycorrhiza 13:299–307. https://doi.org/10.1007/s00572-003-0236-7 Hoffmann B, Wanke C, Lapaglia SK, Braus GH (2000) c-Jun and RACK1 homologues regulate a control point for sexual development in Aspergillus nidulans . Mol Microbiol 37(1):28–41. https://doi.org/10.1046/j.1365-2958.2000.01954.x Holmberg S, Schjerling P (1996) Cha4p of Saccharomyces cerevisiae activates transcription via serine/threonine response elements. Genetics 144(2):467–478. https://doi.org/10.1093/genetics/144.2.467 Hoshida H, Kondo M, Kobayashi T, Yarimizu T, Akada R (2017) 5´-UTR introns enhance protein expression in the yeast Saccharomyces cerevisiae . Appl Microbiol Biotechnol 101:241–251. https://doi.org/10.1007/s00253-016-7891-z Huzurbazar S, Kolesov G, Massey SE, Harris KC, Churbanov A, Liberles DA (2010) Lineage-specific differences in the amino acid substitution process. J Mol Biol 396(5):1410–1421. https://doi.org/10.1016/j.jmb.2009.11.075 Idnurm A, Walton FJ, Floyd A et al (2008) Identification of the sex genes in an early diverged fungus. Nature 451:193–196. https://doi.org/10.1038/nature06453 Illergård K, Ardell DH, Elofsson A (2009) Structure is three to ten times more conserved than sequence-A study of structural response in protein cores. Proteins 77(3):499–508. https://doi.org/10.1002/prot.22458 Jacquemyn H, Waud M, Merckx VS, Lievens B, Brys R (2015) Mycorrhizal diversity, seed germination and long-term changes in population size across nine populations of the terrestrial orchid Neottia ovata . Mol Ecol 24(13):3269–3280. https://doi.org/10.1111/mec.13236 Kagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (2014) Desert truffles: phylogeny, physiologu, distribution and domestication. https://doi.org/10.1007/978-3-642-40096-4 Kim W, Cavinder B, Proctor RH, O’Donnell K, Townsend JP, Trail F (2019a) Comparative genomics and transcriptomics during sexual development gives insight into the life history of the cosmopolitan fungus Fusarium neocosmosporiellum . Front Microbiol 10:1247. https://doi.org/10.3389/fmicb.2019.01247 Kim D, Paggi JM, Park C, Bennet C, Salzberg SL (2019b) Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol 37(8):907–915. https://doi.org/10.1038/s41587-019-0201-4 Koering CE, Fourel G, Binet-Brasselet E, Laroche T, Klein F, Gilson E (2000) Identification of high affinity Tbf1p-binding sites within the budding yeast genome. Nucleic Acids Res 28(13):2519–2526. https://doi.org/10.1093/nar/28.13.2519 Kosakovsky Pond SL, Frost SD (2005) Not so different after all: a comparison of methods for detecting amino acid sites under selection. Mol Biol Evol 22:1208–1222. https://doi.org/10.1093/molbev/msi105 Le Tacon F, Zeller B, Plain C, Hossann C, Bréchet C, Robin C (2013) Carbon transfer from the host to Tuber melanosporum mycorrhizas and ascocarps followed using a 13C pulse-labeling technique. PLoS ONE 8(5):e64626. https://doi.org/10.1371/journal.pone.0064626 Lee J, Lee T, Lee YW, Yun SH, Turgeon BG (2003) Shifting fungal reproductive mode by manipulation of mating-type genes: obligatory heterothallism of Gibberella zeae . Mol Microbiol 50(1):145–152. https://doi.org/10.1046/j.1365-2958.2003.03694.x Lenth R (2025) emmeans: Estimated marginal means, aka least-squares means. R package version 1.11.0. https://CRAN.R-project.org/package=emmeans Liko D, Conway MK, Grunwald DS, Heideman W (2010) Stb3 plays a role in the glucose-induced transition from quiescence to growth in Saccharomyces cerevisiae . Genetics 185(3):797–810. https://doi.org/10.1534/genetics.110.116665 Lu L, Roberts GG, Oszust C, Hudson AP (2005) The YJR127C/ ZMS1 gene product is involved in glycerol-based respiratory growth of the yeast Saccharomyces cerevisiae . Curr Genet 48(4):235–246. https://doi.org/10.1007/s00294-005-0023-4 Mandel S, Robzyk K, Kassir Y (1994) IME1 gene encodes a transcription factor which is required to induce meiosis in Saccharomyces cerevisiae . Dev Biol 15(2):139–147. https://doi.org/10.1002/dvg.1020150204 Marqués-Gálvez JE, Miyauchi S, Paolocci F et al (2021) Desert truffle genomes reveal their reproductive modes and new insights into plant-fungal interaction and ectendomycorrhizal lifestyle. New Phytol 229(5):2917–2932. https://doi.org/10.1111/nph.17044 Marshall OJ (2004) PerlPrimer: cross-platform, graphical primer design for standard, bisulphite and real-time PCR. Bioinform 20(15):2471–2472. https://doi.org/10.1093/bioinformatics/bth254 Martin T, Lu SW, van Tilbeurgh H et al (2010) Tracing the origin of the fungal α1 domain places its ancestor in the HMG-box superfamily: implication for fungal mating-type evolution. PLoS ONE 5(12):e15199. https://doi.org/10.1371/journal.pone.0015199 Martínez-Tomé M, Maggi L, Jiménez-Monreal AM, Murcia MA, Tomás Marí JA (2014) Nutritional and antioxidant properties of Terfezia and Picoa . In: Kagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (eds) Desert Truffles. Springer, Berlin, pp 261–273 Menezes RA, Amaral C, Delaunay A, Toledano M, Rodrigues-Pousada (2004) Yap8p activation in Saccharomyces cerevisiae under arsenic conditions. FEBS Lett 566(1–3):141–146. https://doi.org/10.1016/j.febslet.2004.04.019 Messenguy F, Dubois E (1993) Genetic evidence for a role for MCM1 in the regulation of arginine metabolism in Saccharomyces cerevisiae . Mol Cell Biol 13(4):2586–2592. https://doi.org/10.1128/mcb.13.4.2586-2592.1993 Molinier V, Murat C, Baltensweiler A et al (2016) Fine-scale genetic structure of natural Tuber aestivum sites in southern Germany. Mycorrhiza 26(8):895–907. https://doi.org/10.1007/s00572-016-0719-y Morte A, Kagan-Zur V, Navarro-Ródenas A, Sitrit Y (2021) Cultivation of Desert Truffles - A Crop Suitable for Arid and Semi-Arid Zones. Agronomy 11:1462. https://doi.org/10.3390/agronomy11081462 Morte A, Lovisolo C, Schubert A (2000) Mycorrhiza Effect of drought stress on growth and water relations of the mycorrhizal association Helianthemum almeriense-Terfezia claveryi . Mycorrhiza 10:115–119. https://doi.org/10.1007/s005720000066 Morte A, Zamora M, Gutiérrez A, Honrubia M (2009) Desert truffle cultivation in semiarid Mediterranean areas. In: Azcón-Aguilar C, Barea J, Gianinazzi S, Gianinazzi-Pearson V (eds) Mycorrhizas - functional processes and ecological impact. Springer, Berlin/Heidelberg, pp 495–505 Murat C, Rubini A, Riccioni C et al (2013) Fine-scale spatial genetic structure of the black truffle ( Tuber melanosporum ) investigated with neutral microsatellites and functional mating type genes. New Phytol 199(1):176–187. https://doi.org/10.1111/nph.12264 Pan X, Heitman J (2000) Sok2 regulates yeast pseudohyphal differentiation via a transcription factor cascade that regulates cell-cell adhesion. Mol Cell Biol 20(22):8364–8372. https://doi.org/10.1128/MCB.20.22.8364-8372.2000 Paolocci F, Rubini A, Riccioni C, Arcioni S (2006) Reevaluation of the life cycle of Tuber magnatum . Appl Environ Microbiol 72(4):2390–2393. https://doi.org/10.1128/AEM.72.4.2390-2393.2006 Pettersen EF, Goddard TD, Huang CC et al (2004) UCSF Chimera-A visualization system for exploratory research and analysis. J Comput Chem 25(13):1605–1612. https://doi.org/10.1002/jcc.20084 Pierce M, Benjamin KR, Montano SP, Georgiadis MM, Winter E, Vershon AK (2003) Sum1 and Ndt80 proteins compete for binding to middle sporulation element sequences that control meiotic gene expression. Mol Cell Biol 23(14):4814–4825. https://doi.org/10.1128/MCB.23.14.4814-4825.2003 Posit team (2024) RStudio: Integrated development environment for R. Posit Software. PBC, Boston, MA. http://www.posit.co/ Raju NB (1992) Genetic control of the sexual cycle in Neurospora. Mycol. Res 96:241–262 Robinson JT, Thorvaldsdóttir H, Winckler W et al (2011) Integrative genomics viewer. Nat Biotechnol 29(1):24–26. https://doi.org/10.1038/nbt.1754 Rubini A, Belfiori B, Riccioni C et al (2011a) Isolation and characterization of MAT genes in the symbiotic ascomycete Tuber melanosporum . New Phytol 189(3):710–722. https://doi.org/10.1111/j.1469-8137.2010.03492.x Rubini A, Belfiori B, Riccioni C, Arcioni S, Martin F, Paolocci F (2011b) Tuber melanosporum : mating type distribution in a natural plantation and dynamics of strains of different mating types on the roots of nursery-inoculated host plants. New Phytol 189(3):723–735. https://doi.org/10.1111/j.1469-8137.2010.03493.x Rubini A, Riccioni C, Belfiori B, Paolocci F (2014) Impact of the competition between mating types on the cultivation of Tuber melanosporum: Romeo and Juliet and the matter of space and time. Mycorrhiza 24(1):19–27. https://doi.org/10.1007/s00572-013-0551-6 Schoustra S, Rundle HD, Dali R, Kassen R (2010) Fitness-associated sexual reproduction in a filamentous fungus. Curr Biol 20(15):1350–1355. https://doi.org/10.1016/j.cub.2010.05.060 Shavit E (2014) The history of desert truffle use. In: Kagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (eds) Desert Truffles. Springer, Berlin/Heidelberg, pp 3–19 Shavit E, Shavit E (2014) The medicinal value of desert truffles. In: Kagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (eds) Desert Truffles. Springer, Berlin/Heidelberg, pp 283–297 Sil A, Herskowitz I (1996) Identification of asymmetrically localized determinant, Ash1p, required for lineage-specific transcription of the yeast HO gene. Cell 84(5):711–722. https://doi.org/10.1016/S0092-8674(00)81049-1 Solovyev V, Kosarev P, Seledsov I, Vorobyev D (2006) Automatic annotation of eukaryotic genes, pseudogenes and promoters. Genome Biol 7(1):S10. https://doi.org/10.1186/gb-2006-7-s1-s10 Sze JY, Woontner M, Jaehning JA, Kohlhaw GB (1992) In vitro transcriptional activation by a metabolic intermediate: activation by Leu3 depends on alpha-isopropylmalate. Science 258(5085):1143–1145. https://doi.org/10.1126/science.1439822 Talley SM, Coley PD, Kursar TA (2002) The effects of weather on fungal abundance and richness among 25 communities in the Intermountain West. BMC Ecol 2:7. https://doi.org/10.1186/1472-6785-2-7 Tamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022–3027. https://doi.org/10.1093/molbev/msab120 Tejedor-Calvo E, Amara K, Reis FS et al (2021) Chemical composition and evaluation of antioxidant, antimicrobial and antiproliferative activities of Tuber and Terfezia truffles. Food Res Int 140:110071. https://doi.org/10.1016/j.foodres.2020.110071 Thapar R (2015) Structure-specific nucleic acid recognition by L-motifs and their diverse roles in expression and regulation of the genome. Biochim Biophys Acta 1849(6):677–687. https://doi.org/10.1016/j.bbagrm.2015.02.006 Toone WM, Johnson AL, Banks GR et al (1995) Rme1, a negative regulator of meiosis, is also a positive activator of G1 cyclin gene expression. EMBO J 14(23):5824–5832. https://doi.org/10.1002/j.1460-2075.1995.tb00270.x Weaver S, Shank SD, Spielman SJ et al (2018) Datamonkey 2.0: A modern web application for characterizing selective and other evolutionary processes. Mol Biol Evol 35:773–777. https://doi.org/10.1093/molbev/msx335 White TJ, Bruns TD, Lee SB, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR Protocols: A Guide to Methods and Applications. Academic, New York, pp 315–322 Wickham H (2016) Data analysis. ggplot2: elegant graphics for data analysis. Springer International Publishing, Cham, pp 189–201. https://doi.org/10.1007/978-3-319-24277-4_9 Wiederrecht G, Seto D, Parker CS (1988) Isolation of the gene encoding the S. cerevisiae heat shock transcription factor. Cell 54(6):841–853. https://doi.org/10.1016/S0092-8674(88)91197-X Williams CJ, Headd JJ, Moriarty NW et al (2018) MolProbity: More and better reference data for improved all-atom structure validation. Protein Sci 27(1):293–315. https://doi.org/10.1002/pro.3330 Wilson AM, Wilken PM, Wingfield MJ, Wingfield BD (2021) Genetic Networks That Govern Sexual Reproduction in the Pezizomycotina. Microbiol Mol Biol Rev 85(4):e00020–21. https://doi.org/10.1128/MMBR.00020-21 Xie J, Pierce M, Gailus-Durner V, Wagner M, Winter E, Vershon AK (1999) Sum1 and Hst1 repress middle sporulation-specific gene expression during mitosis in Saccharomyces cerevisiae . EMBO J 18(22):6448–6454. https://doi.org/10.1093/emboj/18.22.6448 Xu J, Zhang Y (2010) How significant is a protein structure similarity with TM-score = 0.5? Bioinform 26(7):889–895. https://doi.org/10.1093/bioinformatics/btq066 Yamazaki T, Ichihara K, Suzuki R et al (2017) Genomic structure and evolution of the mating type locus in the green seaweed Ulva partita . Sci Rep 7:11679. https://doi.org/10.1038/s41598-017-11677-0 Yampolsky LY, Stoltzfus A (2005) The exchangeability of amino acids in proteins. Genetics 170(4):1459–1472. https://doi.org/10.1534/genetics.104.039107 Yoder OC, Valent B, Chumley FG (1986) Genetic nomenclature and practice for plant pathogenic fungi. Phytopathology 76:383–385. https://doi.org/10.1094/Phyto-76-383 Yonkovich J, McKenndry R, Shi X, Zhu Z (2002) Copper ion-sensing transcription factor Mac1p post-translationally controls the degradation of its target gene product Ctr1p. J Biol Chem 277(27):23981–23984. https://doi.org/10.1074/jbc.C200203200 Zambonelli A, Donnini D, Rana GL et al (2014) Hypogeous Fungi in Mediterranean Maquis, Arid and Semi-Arid Forests. Plant Biosyst 148(2):392–401. https://doi.org/10.1080/11263504.2013.877537 Zitouni-Haouar FEH, Fortas Z, Chevalier G (2014) Morphological characterization of mycorrhizae formed between three Terfezia species (desert truffles) and several Cistaceae and Aleppo pine. Mycorrhiza 24:397–403. https://doi.org/10.1007/s00572-013-0550-7 Kagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (2014) Desert truffles: phylogeny, physiologu, distribution and domestication. https://doi.org/10.1007/978-3-642-40096-4 Additional Declarations No competing interests reported. Supplementary Files SupplementaryData.zip MSSupplementaryTable.pdf SupplementaryFigures.pdf Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 30 Jan, 2026 Reviews received at journal 30 Jan, 2026 Reviews received at journal 14 Jan, 2026 Reviewers agreed at journal 22 Dec, 2025 Reviewers agreed at journal 17 Dec, 2025 Reviewers invited by journal 17 Dec, 2025 Editor assigned by journal 17 Dec, 2025 Submission checks completed at journal 17 Dec, 2025 First submitted to journal 15 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8367999","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":561864336,"identity":"977029a8-031c-4684-92a8-41ba14cb6c8a","order_by":0,"name":"Laura Andreu-Ardil","email":"","orcid":"","institution":"University of Murcia","correspondingAuthor":false,"prefix":"","firstName":"Laura","middleName":"","lastName":"Andreu-Ardil","suffix":""},{"id":561864337,"identity":"26431e92-6af0-4166-b1e3-14e43335a555","order_by":1,"name":"Ángel Guarnizo","email":"","orcid":"","institution":"University of Murcia","correspondingAuthor":false,"prefix":"","firstName":"Ángel","middleName":"","lastName":"Guarnizo","suffix":""},{"id":561864338,"identity":"f1114ddb-27c8-447c-99a0-29f3f0a1858d","order_by":2,"name":"Alfonso Navarro-Ródenas","email":"","orcid":"","institution":"University of Murcia","correspondingAuthor":false,"prefix":"","firstName":"Alfonso","middleName":"","lastName":"Navarro-Ródenas","suffix":""},{"id":561864339,"identity":"17e6819c-0513-4fd5-9b6e-250c77fc0593","order_by":3,"name":"Francisco Arenas","email":"","orcid":"","institution":"University of Murcia","correspondingAuthor":false,"prefix":"","firstName":"Francisco","middleName":"","lastName":"Arenas","suffix":""},{"id":561864340,"identity":"3a6173d6-02ce-4e33-8fd7-fce43a54d163","order_by":4,"name":"Manuela Pérez-Gilabert","email":"","orcid":"","institution":"University of Murcia","correspondingAuthor":false,"prefix":"","firstName":"Manuela","middleName":"","lastName":"Pérez-Gilabert","suffix":""},{"id":561864341,"identity":"c4bb3f6e-b433-4602-a547-1059b8864cf8","order_by":5,"name":"José Eduardo Marqués-Gálvez","email":"","orcid":"","institution":"University of Murcia","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"Eduardo","lastName":"Marqués-Gálvez","suffix":""},{"id":561864342,"identity":"329a6d1d-933c-4fd1-98ea-e45b92ff0f32","order_by":6,"name":"Francesco Paolocci","email":"","orcid":"","institution":"National Research Council","correspondingAuthor":false,"prefix":"","firstName":"Francesco","middleName":"","lastName":"Paolocci","suffix":""},{"id":561864343,"identity":"6d2b6bbf-039a-4f47-ad5c-a13c69069ca3","order_by":7,"name":"Asunción Morte","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAkElEQVRIiWNgGAWjYPACG1I1HGBII13LYRJU8087fOzzh4rziWsbmA9/IEqLxO205BkHztxO3HaALU2COGtu5xgzHGwDaeExI06HPFjLv3NALfyfiXOYAVhLwwGQLQzEOcwQ6BeGM8eSjbcdZjMjTovc7eTDDBU1drLbjjc/Js5hCMBMovpRMApGwSgYBXgAAO2BMvDX2i9FAAAAAElFTkSuQmCC","orcid":"","institution":"University of Murcia","correspondingAuthor":true,"prefix":"","firstName":"Asunción","middleName":"","lastName":"Morte","suffix":""}],"badges":[],"createdAt":"2025-12-15 15:39:02","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8367999/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8367999/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98639990,"identity":"c864a0b7-2eca-45d4-a10e-b4ee6cfc8844","added_by":"auto","created_at":"2025-12-19 18:11:24","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2097668,"visible":true,"origin":"","legend":"","description":"","filename":"MSsubmission15.12.25.docx","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/3bbe979290b2d7788ae9b76f.docx"},{"id":98775371,"identity":"2c7251c9-04a8-4f07-a4c9-f1593b67b48e","added_by":"auto","created_at":"2025-12-22 12:19:42","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9313,"visible":true,"origin":"","legend":"","description":"","filename":"e7b70ea472a444d195b72b8efd06de1c.json","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/9ee9372c5f894f639a859a92.json"},{"id":98776025,"identity":"40d44826-cd3f-44d8-be6b-b1a4fcf922f9","added_by":"auto","created_at":"2025-12-22 12:21:47","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":187589,"visible":true,"origin":"","legend":"","description":"","filename":"MSSupplementaryTable.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/d07711f8695b3ff7e5b13621.pdf"},{"id":98775514,"identity":"c4c87e4e-af10-4d8f-aaed-303abce07aed","added_by":"auto","created_at":"2025-12-22 12:20:09","extension":"zip","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9109,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryData.zip","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/a7bad865622a1aa9f8e5920f.zip"},{"id":98774999,"identity":"fbc55f95-55cf-44f1-836a-7d26ef59bed9","added_by":"auto","created_at":"2025-12-22 12:17:50","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":510361,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/c2450864bad34598f230d7f4.pdf"},{"id":98775305,"identity":"9823c309-5d0c-46ca-9ac0-7e16c1612c66","added_by":"auto","created_at":"2025-12-22 12:19:18","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":253588,"visible":true,"origin":"","legend":"","description":"","filename":"e7b70ea472a444d195b72b8efd06de1c1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/2ccdae6a9099b1fae3f431c8.xml"},{"id":98775591,"identity":"b9e7d87a-21bc-4a8e-863e-6837731d5838","added_by":"auto","created_at":"2025-12-22 12:20:24","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":686437,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/9425a3da1a97a4fb9f4b9d13.png"},{"id":98775512,"identity":"d7ee7b29-1665-4518-ad23-4181bd495e12","added_by":"auto","created_at":"2025-12-22 12:20:09","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":108490,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/c18587d371734c6e94d9c550.png"},{"id":98774734,"identity":"5dfdabe9-71ef-4427-8256-813c45c4d01f","added_by":"auto","created_at":"2025-12-22 12:12:49","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1202569,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/0e387447e53ebcc6f4b3b97a.jpeg"},{"id":98775742,"identity":"0862e24b-9e45-412f-9dc3-83ae447de838","added_by":"auto","created_at":"2025-12-22 12:20:56","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":211201,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/c54cc9dd89a67bef65c89fb9.png"},{"id":98774839,"identity":"ef253cf7-3f92-4bc5-8640-7893ae51e16f","added_by":"auto","created_at":"2025-12-22 12:15:33","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":359558,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/82c85de2b71f98306a04ad63.jpeg"},{"id":98774735,"identity":"8754be32-382d-48a6-9301-310661cb8e4f","added_by":"auto","created_at":"2025-12-22 12:12:50","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92235,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/81e0addf129c31c09a3af890.png"},{"id":98640008,"identity":"dfa42624-30fb-476c-998d-4d1e844bc605","added_by":"auto","created_at":"2025-12-19 18:11:24","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22069,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/f483847a3182c7d5371bd639.png"},{"id":98775572,"identity":"e21f443f-30cd-4967-a2cd-81526bd08024","added_by":"auto","created_at":"2025-12-22 12:20:20","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":262890,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/ed8dc791b5f3b797a6102db6.png"},{"id":98639999,"identity":"0d33de42-dc3c-4e1d-a2d2-4fe93a39e198","added_by":"auto","created_at":"2025-12-19 18:11:24","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":35730,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/9ccec0048b4f318f93a53aba.png"},{"id":98775016,"identity":"0e6f714f-da1f-4f90-a862-139ce00320b8","added_by":"auto","created_at":"2025-12-22 12:17:56","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":38820,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/d50e51b3e589b3f925410c87.png"},{"id":98640011,"identity":"b94557b5-6592-4573-b41a-cfe5698cb746","added_by":"auto","created_at":"2025-12-19 18:11:24","extension":"xml","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":254678,"visible":true,"origin":"","legend":"","description":"","filename":"e7b70ea472a444d195b72b8efd06de1c1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/6acec6cdca5ece44a1aaff0e.xml"},{"id":98640010,"identity":"b385197a-efc3-4141-af52-35c8c97808e1","added_by":"auto","created_at":"2025-12-19 18:11:24","extension":"html","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":276165,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/f79355ff04f481e497c1bba4.html"},{"id":98775185,"identity":"77304d89-d0c2-4511-8ec5-cc5d012dded1","added_by":"auto","created_at":"2025-12-22 12:18:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":396289,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenetic evidence of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eT. claveryi\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e’s heterothallism.\u003c/strong\u003e Agarose gel electrophoresis showing PCR products obtained from: (a) a direct reaction carrying 453-455 primer pairs; a nested reaction using (b) MAT111BFwd-MAT111BRev primers and (c) MAT121Fwd-MAT121Rev primers; and (d-e) a nested multiplex PCR using MAT111BFwd-MAT111BRev and MAT121Fwd- MAT121Rev. Strain mix: Tc1705:TcLlano (1:1); S1-S6: spores isolated from the same ascus.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/5ab2ac82aa6afe3c631dd339.png"},{"id":98639986,"identity":"8517366c-9cf6-4c47-a969-2afa5cc7828a","added_by":"auto","created_at":"2025-12-19 18:11:23","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":127785,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic representation of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eT. claveryi\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e mating type \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003elocus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003eSequences\u003cem\u003e \u003c/em\u003eamplified\u003cem\u003e \u003c/em\u003eby 453 and 455 primers, showing the idiomorphic regions \u003cem\u003eTcMAT1-1\u003c/em\u003e (top) and \u003cem\u003eTcMAT1-2\u003c/em\u003e(bottom). The \u003cem\u003eMAT1-1-1\u003c/em\u003e gene is represented as a red box and contains an α-box domain, whereas the \u003cem\u003eMAT1-2-1\u003c/em\u003e gene is shown as a purple structure containing an HMG-box domain. Untranslated regions (UTRs) are represented in blue for \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and orange for \u003cem\u003eTcMAT1-2-1\u003c/em\u003e. Both idiomorphs are flanked by a conserved Apurinic/apyrimidinic endonuclease (APN) gene (green box). Two homologous regions are shared between idiomorphs, which are represented as grey boxes, with a diagonal grid pattern.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/2d11edd3ffb860cf3ac24303.png"},{"id":98639996,"identity":"d95c7e17-4fe6-4107-bcc9-80e2064f24c7","added_by":"auto","created_at":"2025-12-19 18:11:24","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3372084,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhylogenetic relationships and alignment of α-box and HMG-containing domains\u003c/strong\u003e \u003cstrong\u003ein Pezizomycetes.\u003c/strong\u003e Maximum likelihood phylogenetic trees inferred from the predicted amino acid sequences of conserved mating-type protein domains: (a) α-box domain (encoded by \u003cem\u003eMAT1-1-1\u003c/em\u003e) and (b) HMG-domain (encoded by \u003cem\u003eMAT1-2-1\u003c/em\u003e). Bootstrap support values (≥ 48%) are indicated at each node. The trees were rooted using sequences from \u003cem\u003eN. castellii\u003c/em\u003e (Saccharomycotina) and \u003cem\u003eR. stolonifer\u003c/em\u003e (Mucoromycota) as outgroups. Multiple sequence alignments performed by MUSCLE of mating-type proteins conserved regions: (c) α-domain and (d) HMG-domain. Sequences correspond to both representative taxa of truffle-forming Pezizomycetes and closely related taxa. Residues are colored by conservation score, with dark blue indicating high conservation (BLOSUM 62 matrix). Conservation scores are plotted below each alignment. Red bars mark putative intron positions, inferred from alignment gaps and domain structure annotations.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/30042dac1829c44fd656548a.png"},{"id":98639992,"identity":"a54354c0-6db2-44e8-94e0-37d837e469ed","added_by":"auto","created_at":"2025-12-19 18:11:24","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":174911,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSuperposition of the tertiary structure of the conserved α- (blue) and HMG-box (red) domains of TcMAT1-1-1 and TcMAT1-2-1 proteins.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/48e83ef71a23c6135ec2a36d.png"},{"id":98639994,"identity":"9be405de-16a4-4503-a361-a143dcf82a07","added_by":"auto","created_at":"2025-12-19 18:11:24","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1115392,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEvaluation of the distribution of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eT. claveryi\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and its mating genes.\u003c/strong\u003e (a) amount of \u003cem\u003eT. claveryi\u003c/em\u003e, expressed as the square root of ng/mg of sample, along the 7 time points of study; (b) amount detected of \u003cem\u003eT. claveryi\u003c/em\u003e, represented as the square root of ng/mg of sample, according to the source (root or soil) for all the different samples collected over the study period; (c) relative frequency of \u003cem\u003eTcMAT\u003c/em\u003e genes in root and soil samples across the time points according to their location: (i) nursery and (ii) field; (d) \u003cem\u003eTcMAT\u003c/em\u003e distribution across the different plots of the sampling plantation. T2-T9 and T14-T27 correspond to sampling times in the nursery and in the field stages, respectively.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/d04ffdff3180bbce9329fcb6.png"},{"id":98782701,"identity":"a4733dc2-7152-4731-bbf7-21c7ca34f720","added_by":"auto","created_at":"2025-12-22 12:40:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6893502,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/96b57330-4b2d-4391-a928-38904c0ca131.pdf"},{"id":98775327,"identity":"66ed92f1-eb40-4b0c-9661-0621993ee27b","added_by":"auto","created_at":"2025-12-22 12:19:23","extension":"zip","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":9109,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryData.zip","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/37f1278e9212b118178b53b8.zip"},{"id":98775152,"identity":"fd153ece-94c6-48e7-a292-1edf8db7122e","added_by":"auto","created_at":"2025-12-22 12:18:39","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":187589,"visible":true,"origin":"","legend":"","description":"","filename":"MSSupplementaryTable.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/8dd00b74aa80e80169461c4b.pdf"},{"id":98775176,"identity":"fdaa70e7-5104-4dc8-b64b-4c70d020473f","added_by":"auto","created_at":"2025-12-22 12:18:44","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":510361,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8367999/v1/53d6886b16598445d73710fe.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Terfezia claveryi MAT locus characterization uncovers evolutionary insights about sexual reproduction of Pezizomycetes and reveals mating type dynamics in mycorrhizal plants.","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003e \u003cem\u003eTerfezia claveryi\u003c/em\u003e Chatin is a filamentous fungus belonging to the Pezizaceae family of the Ascomycota phylum, which typically forms ectendomycorrhizal symbiosis with perennial and annual plants of the \u003cem\u003eCistaceae\u003c/em\u003e family (e.g. \u003cem\u003eHelianthemum\u003c/em\u003e spp.) (Guti\u0026eacute;rrez et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Zitouni-Haouar et al. \u003cspan citationid=\"CR99\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Guarnizo et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The completion of the sexual reproduction cycle of this fungus leads to the development of edible hypogeous fruit bodies, commonly referred to as \u0026lsquo;desert truffles\u0026rsquo; (Morte et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Desert truffles comprise a group of phylogenetically closely related Ascomycota genera, including the aforementioned \u003cem\u003eTerfezia\u003c/em\u003e but also \u003cem\u003eTirmania\u003c/em\u003e, \u003cem\u003eKalaharituber\u003c/em\u003e, \u003cem\u003eMattirolomyces\u003c/em\u003e and \u003cem\u003ePicoa\u003c/em\u003e. This term arises from their natural distribution in arid and semi-arid regions of the Mediterranean basin, mainly found in Spain, the Middle East, Morocco, Algeria, and Tunisia (Zambonelli et al. \u003cspan citationid=\"CR98\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). These truffles contribute to rural economic development, especially due to their highly appreciated nutritional and culinary value (Mart\u0026iacute;nez-Tom\u0026eacute; et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Shavit \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Tejedor-Calvo et al. \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), as well as their antioxidant and antimicrobial properties used in traditional medicine (Shavit and Shavit, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The \u003cem\u003eHelianthemum almeriense\u003c/em\u003e x \u003cem\u003eT. clavery\u003c/em\u003ei mutualistic symbiosis plays a crucial role in enhancing plant survival during drought stress by facilitating the exchange of water and key nutrients (N, P, and K) with the host plant (Morte et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Andrino et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). Mycorrhizal associations, such as those of \u003cem\u003eCistaceae\u003c/em\u003e plants with desert truffle species, constitute a potential ecological tool not only to prevent desertification in Mediterranean regions, but also to enrich soil fungal and bacterial communities without relying on chemicals (Morte et al. \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Berrios et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Despite its adaptations, the adverse climatic conditions caused by relentless global warming have resulted in a significant decline in truffle yields, in both natural areas and cultivated plantations (Morte et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Thus, understanding the reproductive mode and life cycle of \u003cem\u003eT. claveryi\u003c/em\u003e is relevant for enhancing desert truffle production in both wild areas and cultivated orchards. Promoting desert truffle yield may in turn facilitate fungal spread within the soil and increase plant colonization levels, thereby helping alleviating the adverse effects of climate change on the symbiotic partners. Despite the considerable ecological and economic repercussions, the life cycle and reproductive biology of the fungi responsible for producing these truffles remain largely unexplored.\u003c/p\u003e \u003cp\u003eLife cycle in Ascomycota initiates once the haploid ascospores germinate. In heterothallic (self-sterile) species, the ascogonium (female partner) and antheridium (male partner) interact in a process called plasmogamy, which leads to the formation of a fruiting body with nuclei of opposite mating types. After karyogamy and meiosis, asci containing a variable number of haploid ascospores are formed. In homothallic (self-fertile) species, the process is similar but does not require a mating partner (Bennett and Turgeon, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The regulation of sexual identity in fungal cells is governed by both mating pheromones and the mating-type (\u003cem\u003eMAT\u003c/em\u003e) locus, commonly known as \u003cem\u003eMAT1\u003c/em\u003e, since all ascomycetes possess at least one copy of this genomic region (Yoder et al. \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e1986\u003c/span\u003e). The \u003cem\u003eMAT1\u003c/em\u003e locus harbours two different idiomorphs, \u003cem\u003eMAT1-1\u003c/em\u003e and \u003cem\u003eMAT1-2\u003c/em\u003e, which primarily include the \u003cem\u003eMAT1-1-1\u003c/em\u003e and \u003cem\u003eMAT1-2-1\u003c/em\u003e genes, respectively (Yoder et al. \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e1986\u003c/span\u003e; Debuchy et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). These sequences are considered idiomorphic because they occupy the same locus although are highly divergent and non-homologous. In homothallic species, both \u003cem\u003eMAT1-1\u003c/em\u003e and \u003cem\u003eMAT1-2\u003c/em\u003e idiomorphs are present within the same haploid genome, eliminating the requirement for mating between genetically distinct types. In contrast, in heterothallic species, each haploid spore contains only one of the two idiomorphs, and sexual reproduction requires the combination of complementary idiomorphs from separate individuals (Fraser et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Specifically for mycorrhizal heterothallic species, successful reproduction occurs only when (i) strains of opposite mating types interact, allowing the fusion of compatible hyphae and subsequent development of reproductive structures and (ii) at least one of the mating partners uses mycorrhizae to obtain nutrients from the host plants to sustain the growth of developing fruit bodies (Paolocci et at. 2006; Rubini et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2011a\u003c/span\u003e; Le Tacon et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Wilson et al. \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). This system promotes genetic diversity by ensuring outcrossing between genetically distinct partners. \u003cem\u003eMAT1-1-1\u003c/em\u003e and \u003cem\u003eMAT1-2-1\u003c/em\u003e genes, which encode an α-box domain protein and HMG-box domain protein, respectively, play crucial roles in fungal reproduction, including: (i) acting as master regulators of fertilization by encoding key transcription factors that control sex-related genes, (ii) facilitating mating partner recognition by regulating the release of mating pheromones, and (iii) contributing to the development and maturation of fruiting bodies and ascospores (Bobrowicz et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Lee et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Kim et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2019a\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe genome sequencing of the mycorrhizal strains \u003cem\u003eT. claveryi\u003c/em\u003e T7 and \u003cem\u003eTirmania nivea\u003c/em\u003e G3 suggested that they are heterothallic species, since, in both cases, solely the \u003cem\u003eMAT1-1-1\u003c/em\u003e DNA sequence was found (Marqu\u0026eacute;s-G\u0026aacute;lvez et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In order to gain insight into the reproductive mode of desert truffles, the MAT \u003cem\u003elocus\u003c/em\u003e of \u003cem\u003eT. claveryi\u003c/em\u003e was studied. For this purpose, we (i) screened \u003cem\u003eT. claveryi\u003c/em\u003e strains for the presence/absence of the \u003cem\u003eMAT1-1-1\u003c/em\u003e gene; ii) PCR amplified and sequenced the \u003cem\u003eMAT1-2-1\u003c/em\u003e gene from a strain lacking the opposite mating type; iii) assessed the evolutionary relationship of both \u003cem\u003eMAT1-1-1\u003c/em\u003e and \u003cem\u003eMAT1-2-1\u003c/em\u003e genes with those from other Pezizomycetes; (iv) set a reproducible PCR-based strategy to monitor the spatio-temporal distribution of strains of opposite mating type in soil and on root samples from inoculated \u003cem\u003eH. almeriense\u003c/em\u003e plants. This work advances our understanding of the reproduction mode of desert truffle fungi and highlights its implication in ecological development of managed ecosystems from nursery to field.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental setup, biological material and sampling\u003c/h2\u003e \u003cp\u003eFor MAT \u003cem\u003elocus\u003c/em\u003e characterization, free living mycelium (FLM) grown \u003cem\u003ein vitro\u003c/em\u003e on cellophane and placed over agar plates containing optimal MMN medium (Arenas et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) from two different \u003cem\u003eT. claveryi\u003c/em\u003e strains (Tc1705 and TcLlano) were used. These strains belong to the Mycology-Mycorrhiza-Plant Biotechnology group collection at University of Murcia and were maintained \u003cem\u003ein vitro\u003c/em\u003e in an incubator at 24\u0026deg;C in the dark. After collection of at least 100 mg of FLM from each strain, the material was placed in Eppendorf tubes, flash frozen in liquid nitrogen and stored at -80\u0026deg;C until DNA isolation. In addition, for DNA isolation from single spores, we also sampled an ascocarp of \u003cem\u003eT. claveryi\u003c/em\u003e collected in 2005 in Zarzadilla de Totana (Murcia, Spain) which was stored at -20\u0026deg;C until use.\u003c/p\u003e \u003cp\u003eFor the assessment of the spatio-temporal distribution of MAT genes, we sampled material from \u003cem\u003eH. almeriense\u003c/em\u003e x \u003cem\u003eT. claveryi\u003c/em\u003e mycorrhizal plants at nursery stage (300 ml pots) and at field stage. A total of 405 \u003cem\u003eH. almeriense\u003c/em\u003e plants were inoculated with different \u003cem\u003eT. claveryi\u003c/em\u003e spore inocula in December 2021 according to Kagan-Zur et al. (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Batches of 10\u0026ndash;15 root and rhizospheric soil samples were collected (i) in nursery at 2, 4, 6, and 9 months post inoculation (times T2-T9), and (ii) in field at 14, 18, and 27 months post inoculation (times T14-T27). Nursery plants were transplanted into an experimental plantation located in Ca\u0026ntilde;ada de Canara (Murcia, Spain, 38\u0026deg;06'47.3\"N, 1\u0026deg;45'56.5\"W). The plantation was systematically mapped by establishing ten unique plots (Supplementary Fig.\u0026nbsp;1). For each sampling event, one random sampling point per plot was selected to ensure spatial representation. In total, 71 rhizospheric soil samples and 66 root samples were collected from February 2022 to March 2024 to evaluate the spatio-temporal distribution of \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e genes. Sample collection in field was carried out using a spade at a depth of 10 cm and at 10\u0026ndash;15 cm from the plant base, approximately. Soil and root samples were dried at room temperature and then stored at -20\u0026deg;C in microcentrifuge tubes until DNA isolation.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDNA isolation\u003c/h3\u003e\n\u003cp\u003eDifferent approaches were followed for the isolation of genomic DNA depending on the source of the sample: soil samples, root samples, FLM from \u003cem\u003ein vitro\u003c/em\u003e cultured strains or single spores of \u003cem\u003eT. claveryi\u003c/em\u003e ascocarps. Three steel beads of 3 mm diameter were added to microcentrifuge tubes containing root, soil or FLM samples, which were then homogenized using the TissueLyser II (QIAGEN, Germany) as dry material (soil) or pre-immersed in liquid nitrogen to facilitate plant and fungal cell disruption (roots and FLM). DNA from soil was extracted using the NucleoSpin\u0026reg; Soil kit (Macherey-Nagel, D\u0026uuml;ren, Germany), following the manufacturer\u0026rsquo;s instructions with some modifications: 500 \u0026micro;l of the lysis buffer SL1 and 150 \u0026micro;l of the SX enhancer solution were used. DNA from root samples and FLM was extracted using the CTAB method (Chang et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1993\u003c/span\u003e). Subsequently, all samples were purified using the DNeasy\u0026reg; PowerClean\u0026reg; Pro Cleanup kit (Hilden, Germany), according to the manufacturer\u0026rsquo;s guidelines. In addition, DNA isolation of single spores belonging to the same ascus of immature \u003cem\u003eT. claveryi\u003c/em\u003e gleba was carried out following the methodology reported by Paolocci et al. (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2006\u003c/span\u003e) and Rubini et al. (\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2011a\u003c/span\u003e). The concentration and quality of DNA samples was determined using a NanoDrop ND-2000 Spectrophotometer (Thermo Fisher Scientific,Waltham, MA, USA). These samples were stored at -20\u0026deg;C until further use.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePrimer design and PCR protocol for the identification of\u003c/b\u003e \u003cb\u003eTcMAT\u003c/b\u003e \u003cb\u003egenes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo corroborate the identity of the \u003cem\u003eT. claveryi\u003c/em\u003e mycelium strains, PCR methodology using primers targeting the ribosomic DNA (rDNA) region (ITS1F and ITS4) was performed (White TJ et al. \u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e1990\u003c/span\u003e), according to Bordallo et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) (Supplementary Figs.\u0026nbsp;2\u0026ndash;3). Primers targeting the \u003cem\u003eTcMAT1-1-1\u003c/em\u003e gene, which was previously identified by Marqu\u0026eacute;s-G\u0026aacute;lvez et al. (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), were designed by using the putative sequence of \u003cem\u003eMAT1-1-1\u003c/em\u003e found in scaffold 39 (genomic coordinates, 66965\u0026ndash;70230) of \u003cem\u003eT. claveryi\u003c/em\u003e available in Mycocosm database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://mycocosm.jgi.doe.gov/Tercla1/Tercla1.home.html\u003c/span\u003e\u003cspan address=\"https://mycocosm.jgi.doe.gov/Tercla1/Tercla1.home.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Using as a template the \u003cem\u003eT. claveryi\u003c/em\u003e genome, the 453 and 455 primer pair (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), designed on the putative regions flanking the \u003cem\u003eTcMAT\u003c/em\u003e locus was employed to amplify the strains of the collection. This PCR was carried out in FlexCycler thermal cycler (Analytik Jena, Jena, Germany) in a final volume of 50 \u0026micro;l following a two-step procedure: initial denaturation at 98\u0026deg;C for 30 s, followed by 35 cycles of (i) denaturation at 98\u0026deg;C for 7 s, and (ii) annealing and extension at 72\u0026deg;C for 2 min, with a final extension at 72\u0026deg;C for 7 min. The resulting amplicons obtained from strains with (Tc1705) or without (TcLlano) the \u003cem\u003eTcMAT1-1-1\u003c/em\u003e gene as per PCR with \u003cem\u003eTcMAT1-1-1\u003c/em\u003e specific primer pair were sequenced by Plasmidsaurus (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://plasmidsaurus.com\u003c/span\u003e\u003cspan address=\"https://plasmidsaurus.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) using Oxford Nanopore Technology with custom analysis and annotation. The consensus sequences obtained were used to confirm the specificity of \u003cem\u003eTcMAT1-1-1\u003c/em\u003e primers and design \u003cem\u003eTcMAT1-2-1\u003c/em\u003e specific primers. All primers were designed with the help of PerlPrimer (Marshall, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) and manually fine-tuned afterwards.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of primers employed for the optimized PCR-based characterization of \u003cem\u003eT. claveryi\u003c/em\u003e reproductive genes.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequence (5\u0026rsquo;\u0026loz;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLocation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eLength (nt)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTm (\u003c/p\u003e \u003cp\u003e\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAmplicon (pb)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGC (%)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eITS1F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTGGTCATTTAGAGGAAGTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e18S rRNA gene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e58.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e633\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e36.36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eITS4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCTCCGCTTATTGATATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28S rRNA gene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e61.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e45.00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e453\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTAATTGCGGTCGGGGATTCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMAT flanking \u003cem\u003elocus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e69.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e2868 (\u003cem\u003eMAT1-1-1\u003c/em\u003e)\u003c/p\u003e \u003cp\u003e3087 (\u003cem\u003eMAT1-2-1\u003c/em\u003e)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e58.33\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e455\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCCGCGCACAGTGAGTCCATCATTATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMAT flanking \u003cem\u003elocus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e70.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e46.43\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMAT111BFwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTCTCCACTGTCTCTATCTTTGCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eMAT1-1-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e65.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e273\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e46.15\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMAT111BRev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGCGTGGTTGAAAGTCGTGTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eMAT1-1-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e65.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e47.83\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMAT121Fwd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCACCTCTAAGCAACCTTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eMAT1-2-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e65.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e434\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e52.17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMAT121Rev\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTACTGAATTCCGTTCTGCTTCGAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cem\u003eMAT1-2-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e66.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e44.44\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eTm\u0026thinsp;=\u0026thinsp;Melting temperature.\u003c/p\u003e \u003cp\u003eThe final optimized procedure for \u003cem\u003eT. claveryi MAT\u003c/em\u003e gene identification consisted of a nested PCR reaction containing 0.2 mM of each dNTP, 0.2 \u0026micro;M of each primer, 2.5\u0026ndash;50 ng of gDNA, 1X of Phusion\u0026trade; HF Buffer and 0.02 U/\u0026micro;l of Phusion\u0026trade; High - Fidelity DNA Polymerase (Thermo Fisher Scientific Baltics UAB, Lithuania). The first PCR employed the 453\u0026ndash;455 primer pair and was carried out as explained above. After this reaction, PCR products were purified using the GeneJET PCR Purification Kit (Thermo Fisher Scientific Baltics UAB, Lithuania) according to the manufacturer's guidelines. The second PCR reaction was performed in a 20 \u0026micro;l volume using the previous purified PCR product as template with MAT111BFwd-MAT111BRev and MAT121Fwd-MAT121Rev specific primers, following a three-step program: initial denaturation at 98\u0026deg;C for 30 s, followed by 35 cycles of (i) denaturation at 98\u0026deg;C for 7 s, (ii) annealing at 68\u0026deg;C for 10 s, and (iii) extension at 72\u0026deg;C for 30 s, with a final extension at 72\u0026deg;C for 7 min. For the second reaction, a multiplex PCR including both \u003cem\u003eMAT1-1-1\u003c/em\u003e and \u003cem\u003eMAT1-2-1\u003c/em\u003e specific primer pairs, was applied to the analysed samples. Each nested PCR experiment included (i) two non-DNA-template negative control, one from the first PCR and another for the second PCR, and (ii) positive controls: DNA from a strain of \u003cem\u003eTcMAT1-1-1\u003c/em\u003e, another of \u003cem\u003eTcMAT1-2-1\u003c/em\u003e, and a 1:1 (v:v) mix of both. Final PCR products were loaded and separated on an agarose gel stained with SYBR\u0026trade; Safe DNA Gel Stain (Thermo Fisher Scientific, Life Sciences Solutions, CA, USA) and photographed under an UV transilluminator (MultiImage\u0026trade; Light Cabinet, Alpha Innotech, San Leandro, CA, USA). In addition, two putative \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e amplicons, each one obtained by conventional nested PCR from a different spore of the same ascus, were sequenced using Sanger sequencing (3500 Genetic Analyzer, Applied Biosystems, Waltham, MA, USA) at the Molecular Biology Service belonging to the \u0026ldquo;Area Cient\u0026iacute;fica y T\u0026eacute;cnica de Investigaci\u0026oacute;n\u0026rdquo; (ACTI, Universidad de Murcia) and aligned to the MAT1-1-1 and MAT1-2-1 sequences.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGenomic structure prediction of\u003c/b\u003e \u003cb\u003eT. claveryi\u003c/b\u003e \u003cb\u003eMAT\u003c/b\u003e \u003cb\u003elocus\u003c/b\u003e\u003c/p\u003e \u003cp\u003eUsing the previously sequenced MAT \u003cem\u003elocus\u003c/em\u003e, \u003cem\u003ein silico\u003c/em\u003e gene structure prediction of \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e was performed with FGENESH software (Solovyev et al. \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2006\u003c/span\u003e, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.softberry.com/berry.phtml\u003c/span\u003e\u003cspan address=\"http://www.softberry.com/berry.phtml\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) using \u003cem\u003eNeurospora crassa\u003c/em\u003e as a reference genome. Additionally, RNA-seq raw reads from FLM, well-watered and drought-stressed \u003cem\u003eH. almeriense\u003c/em\u003e x \u003cem\u003eT. claveryi\u003c/em\u003e mycorrhizal roots (Short Read Archive ID: SRP272077, Marqu\u0026eacute;s-G\u0026aacute;lvez et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) were used to validate the predicted gene structure at experimental level. The reads were trimmed using TRIMMOMATIC (v0.39, Bolger et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) and mapped against the previously sequenced \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e concatenated amplicons, using HISAT2 (v2.2.1, Kim et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019b\u003c/span\u003e). Mapped reads were visualized using IGV viewer (v2.11.9, Robinson et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Once gene structure was defined for both \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e idiomorphs, promoter sequences were defined as the non-coding sequence upstream of the transcription starting site (TSS) of each gene. DNA-binding motifs were searched by analysing these sequences with Find Individual Motif Occurences (FIMO, v5.5.8, Grant et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) online tool, using the non-redundant JASPAR 2024 CORE database for fungi (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://jaspar2024.elixir.no/\u003c/span\u003e\u003cspan address=\"https://jaspar2024.elixir.no/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The presence of transposable elements in the \u003cem\u003eTcMAT\u003c/em\u003e idiomorphs was studied using the GIRI database tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.girinst.org\u003c/span\u003e\u003cspan address=\"https://www.girinst.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eProtein domain recognition, structural alignment and phylogenetic analysis\u003c/h3\u003e\n\u003cp\u003eThe \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e sequences were analysed using the InterPro database and its domain prediction tools (Blum et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The three-dimensional structures of α- and HMG-box domains encoded by these genes were predicted using the AlphaFold Server, which utilizes the AlphaFold 3 model (Abramson et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Default parameters were applied, incorporating geometric constraints through the structure refinement. The resulting structural models were evaluated using MolProbity (Williams et al. \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) to assess stereochemical quality and all-atom contacts. For each predicted protein, MolProbity scores and validation metrics, including clashscore, Ramachandran plot statistics, rotamer outliers, bond and angle geometry, and Cβ deviations, were calculated. The model displaying the most favourable validation metrics was selected for further structural analysis. Structural superposition of the secondary structures of the conserved domains was performed using UCSF Chimera v1.19 (Pettersen et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Structural alignment was conducted with the Matchmaker tool, excluding long atom pairings iteratively until no aligned atom pairs exceeded a distance threshold of 2.0 \u0026Aring; and ensuring accurate and meaningful structural overlap.\u003c/p\u003e \u003cp\u003eTwo phylogenetic trees were constructed based on the α- and HMG-box domains encoded by orthologous MAT genes within the Pezizomycetes. Protein sequences were selected according to their phylogenetic proximity and obtained from the JGI MycoCosm database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://genome.jgi.doe.gov/mycocosm/home\u003c/span\u003e\u003cspan address=\"https://genome.jgi.doe.gov/mycocosm/home\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). For the α-box domain analysis, 8 orthologous sequences were selected, whereas 11 orthologs were used for the HMG domain (Supplementary Table\u0026nbsp;1). \u003cem\u003eNaumovozyma castellii\u003c/em\u003e and \u003cem\u003eRhizopus stolonifer\u003c/em\u003e were included as outgroups for the α- and HMG-box domain trees, respectively. Multiple sequence alignments were performed using MUSCLE implemented in MEGA v11 (Tamura et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Model selection was carried out using 8 computational threads, while all other parameters were kept at default settings. Phylogenetic trees were inferred using the Maximum Likelihood method with 1,000 bootstrap replicates to assess branch support. The LG\u0026thinsp;+\u0026thinsp;I model was identified as the best-fit evolutionary model and was applied to both the α- and HMG-box domains datasets.\u003c/p\u003e \u003cp\u003eCDS nucleotide sequences of the selected \u003cem\u003eMAT1-1-1\u003c/em\u003e and \u003cem\u003eMAT1-2-1\u003c/em\u003e genes of different Pezizomycetes fungi (Supplementary Table\u0026nbsp;1) were aligned using TranslatorX (Abascal et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), which performs codon alignments by translating DNA sequences into amino acids, aligning them at the protein level, and then back-translating to nucleotides. The alignment was generated using the MUSCLE algorithm for protein alignment, and poorly aligned regions were removed using Gblocks. The resulting clean nucleotide alignment was selected for further analyses, as it maintains codon alignment while excluding unreliable sites. To detect signals of selection, the Fixed Effects Likelihood (FEL) method was applied using the Datamonkey web server (Weaver et al. \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), under the assumption of pervasive selection acting uniformly at each codon site across the phylogeny (Kosakovsky Pond and Frost, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eT. claveryi\u003c/b\u003e \u003cb\u003equantification\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe amount of \u003cem\u003eT. claveryi\u003c/em\u003e DNA in soil and root samples was determined by qPCR methodology using a QuantStudio\u0026trade; 5 Flex instrument (Applied Biosystems, Waltham, MA, USA). A standard curve was generated from 1:10 dilutions of purified ascocarp DNA to assess the efficiency of the primers. The total volume of each qPCR reaction was 10 \u0026micro;l, consisting of 1X PowerTrack\u0026trade; SYBR\u0026trade; Green Master Mix (Thermo Fisher Scientific Baltics UAB, Lithuania), 0.3 \u0026micro;M of each primer (TerclaF3 and TerclaR1, designed by Arenas et al. (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2022a\u003c/span\u003e)), and 30\u0026ndash;45 ng of gDNA. The thermal cycling conditions were: 50\u0026deg;C for 2 min, 95\u0026deg;C for 2:30 min (for enzymatic activation), followed by 40 cycles of 95\u0026deg;C for 15 s and 60\u0026deg;C for 1 min. Three technical replicates of each sample and standard were performed, and a non-DNA-template was included in each run to ensure the absence of cross-contamination.\u003c/p\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were conducted in R v.4.3.3 (Posit team, \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Linear models (LMs) were fitted to assess the effects of experimental factors on the abundance of \u003cem\u003eT. claveryi\u003c/em\u003e. The response variable was transformed to the square root of ng/mg of sample to improve normality and variance homogeneity. Pairwise comparisons among factor levels (source, time, mating type and location) were performed using estimated marginal means (EMMs) computed with the emmeans package (Lenth, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). For the combination of variables source and location, pairwise comparisons were conducted applying Bonferroni correction. In all other models, Tukey\u0026rsquo;s HSD adjustment was applied for multiple comparisons. A significance threshold of p\u0026thinsp;\u0026le;\u0026thinsp;0.05 was used throughout the analyses. Data visualization was performed using the ggplot2 package (Wickham, \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003e \u003cb\u003ePCR protocol optimization and determination of the sexual mating system of\u003c/b\u003e \u003cb\u003eTerfezia claveryi\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo experimentally determine the mating system of \u003cem\u003eT. claveryi\u003c/em\u003e, we first screened FLM strains by PCR using both rDNA and MAT1-1-1 primers. Samples that produced the expected amplicons were identified as \u003cem\u003eTcMAT1-1-1\u003c/em\u003e carrier strains. The TcLlano strain, which tested positive for ITS amplification but negative for amplification with \u003cem\u003eTcMAT1-1-1\u003c/em\u003e specific primer pair, was then selected as a putative strain carrying the \u003cem\u003eTcMAT1-2-1\u003c/em\u003e gene. Subsequently, a PCR to amplify the putative \u003cem\u003eMAT\u003c/em\u003e idiomorphs from strains harbouring (Tc1705) or lacking (TcLlano) the \u003cem\u003eTcMAT1-1-1\u003c/em\u003e gene was performed by using the primers 453\u0026ndash;455 designed on putatively conserved regions flanking the \u003cem\u003eMAT\u003c/em\u003e locus (Marquez-Galves et al. 2021). Tc1705 and TcLlano strains showed distinct results, which suggested the presence of different idiomorphs. The obtained PCR products sized 2,925 kb for Tc1705 and 3,275 kb for TcLlano (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The sequencing of these amplicons confirmed genetic polymorphism between the strains. In fact, the sequence from Tc1705 aligned with the putative \u003cem\u003eMAT1-1-1\u003c/em\u003e of \u003cem\u003eT. claveryi\u003c/em\u003e (81% of identity with scaffold 39, genomic coordinates: 66965\u0026ndash;70230) (Supplementary Data), whereas TcLlano aligned with putative \u003cem\u003eMAT1-2-1\u003c/em\u003e of \u003cem\u003eT. boudieri\u003c/em\u003e (79% of identity with scaffold 37, genomic coordinates: 129511\u0026ndash;135835) (Supplementary Data).\u003c/p\u003e \u003cp\u003eUsing the sequences obtained from the first PCR products, a new primer pair specific to \u003cem\u003eTcMAT1-1-1\u003c/em\u003e (MAT111BFwd-MAT111BRev) and one to \u003cem\u003eTcMAT1-2-1\u003c/em\u003e (a MAT121Fwd-MAT121Rev) were designed and used to amplify the 453\u0026ndash;455 PCR products obtained from both Tc1705 and TcLlano strains. When this second PCR was performed as a non-multiplexed PCR, Tc1705 produced a 270 bp band with MAT111BFwd-MAT111BRev primer pair, but none with MAT121Fwd-MAT121Rev primers, as expected (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). The opposite result was found for TcLlano, which amplified a 430 bp band with MAT121Fwd-MAT121Rev primer pair but not with MAT111BFwd-MAT111BRev (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). When this second reaction was performed as a multiplex PCR, including both primer pairs in the same reaction, again Tc1705 strain produced a single 270 bp amplicon, while TcLlano strain produced a single 430 bp amplicon. Additionally, when both templates were mixed at a 1:1 proportion, two amplicons (270 and 410 bps) were produced concomitantly. Overall, these results indicate that Tc1705 harbours the \u003cem\u003eMAT1-1-1\u003c/em\u003e gene, whereas TcLlano is a \u003cem\u003eMAT1-2-1\u003c/em\u003e strain carrier (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eIn order to provide another line of evidence of the heterothallic nature of \u003cem\u003eT. claveryi\u003c/em\u003e, we isolated DNA from six spores from the same ascocarp and performed the same nested PCR protocol. In this case, the second reaction was performed as a non-mutiplex, since multiplex results were not consistent. Six spores derived from a single ascus of immature gleba exhibited a consistent pattern, in which three of them tested positive for \u003cem\u003eMAT1-2-1\u003c/em\u003e and the remaining three were positive for \u003cem\u003eMAT1-1-1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-F), thereby reinforcing the concept not only of heterothallism but also of the haploid nature of the \u003cem\u003eT. claveryi\u003c/em\u003e spores. The sequencing of PCR products from two distinct spores belonging the same ascus, one positive for \u003cem\u003eMAT1-1-1\u003c/em\u003e and the other for \u003cem\u003eMAT1-2-1\u003c/em\u003e, revealed identical sequences to those obtained from amplicons of pure mycelium Tc1705 and TcLlano strains (Supplementary Data). Overall, the results from the molecular approach provided strong evidence for the occurrence of two distinct, non-concurrent idiomorphs at the \u003cem\u003eMAT\u003c/em\u003e locus in \u003cem\u003eT. claveryi\u003c/em\u003e, indicating its heterothallic nature.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eCharacterization of the\u003c/b\u003e \u003cb\u003eMAT\u003c/b\u003e \u003cb\u003elocus of\u003c/b\u003e \u003cb\u003eT. claveryi\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBoth the \u003cem\u003ein silico\u003c/em\u003e gene structure prediction based on the sequenced \u003cem\u003eMAT\u003c/em\u003e amplicons (Supplementary Figs.\u0026nbsp;4\u0026ndash;5). as well as RNA-seq data from \u003cem\u003eH. almeriense x T. claveryi\u003c/em\u003e mycorrhizal roots (Supplementary Fig.\u0026nbsp;6) revealed the same gene length and genomic organization of the \u003cem\u003eMAT\u003c/em\u003e locus, including the same intron number and positions in both \u003cem\u003eTcMAT\u003c/em\u003e genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBoth sequences were oriented in the antisense direction, relative to the reference genome. \u003cem\u003eTcMAT1-1-1\u003c/em\u003e (2,868 pb) showed a slightly smaller DNA sequence than \u003cem\u003eTcMAT1-2-1\u003c/em\u003e (3,087 pb). In addition, the coding region of \u003cem\u003eTcMAT1-1-1\u003c/em\u003e contained a single intron located within the α-box domain, whereas the coding region of \u003cem\u003eTcMAT1-2-1\u003c/em\u003e exhibited a more complex exon-intron structure since it contained five introns, three of which were in the HMG-box domain. Another intron was found within the CDS, while the last one was located at the 5\u0026prime; UTR region in \u003cem\u003eTcMAT1-2-1\u003c/em\u003e. The regions flanking the idiomorphs were highly conserved, with 74.3% sequence identity in the 113 bp 5\u0026prime; segment and 80.2% sequence identity in the 256 bp 3\u0026prime; segment, which included the coding region of an apurinic/apyrimidinic endonuclease (APN). The CDS sequence of \u003cem\u003eTcMAT1-1-1\u003c/em\u003e encoded for a smaller protein (254 aa) than that encoded by \u003cem\u003eTcMAT1-2-1\u003c/em\u003e (446 aa). An 812 bp promotor region was identified between \u003cem\u003eAPN\u003c/em\u003e and \u003cem\u003eTcMAT1-1-1\u003c/em\u003e genes, whereas it was of 504 bp for \u003cem\u003eTcMAT1-2-1\u003c/em\u003e. We discovered several DNA-binding motifs for both promoter regions (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), including (among others) three copies of the CHA4 motif (GGCGGAGA) and three copies of the IME1 motif (CGGCGGAG) in \u003cem\u003eTcMAT1-1-1\u003c/em\u003e\u003csub\u003e\u003cem\u003epro\u003c/em\u003e\u003c/sub\u003e, two copies of the EDS1 motif (GGAAAAA) in \u003cem\u003eTcMAT1-2-1\u003c/em\u003e\u003csub\u003e\u003cem\u003epro\u003c/em\u003e\u003c/sub\u003e and YPR196W motif ([G/A][A/T]TTC[T/A]CCG), which was found in both promoter regions. No transposable elements were found in either idiomorph.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eDNA-binging motifs identified in\u003c/b\u003e \u003cb\u003eTcMAT1-1-1\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eTcMAT1-2-1\u003c/b\u003e \u003cb\u003epromoters.\u003c/b\u003e Motifs were identified by searching the 812 bp and 504 bp promoter sequences of \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e, respectively, using FIMO tool (see materials and methods). Only those hits with positive score and statistical significance (p\u0026thinsp;\u0026le;\u0026thinsp;0.01) are shown.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePromotor region\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTF (Motif ID)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMotif sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePosition*\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eStrand\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eScore\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eKnown biological role\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"9\" rowspan=\"10\"\u003e \u003cp\u003e\u003cem\u003eTcMAT1-1-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCHA4 (MA0283.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCGGAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e413\u003c/p\u003e \u003cp\u003e390\u003c/p\u003e \u003cp\u003e344\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e14.1463\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e9.90e-06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eInvolved in aminoacidic metabolism. Responsible of the use of serine/threonine as nitrogen sources (Holmberg and Scherling, 1996)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSTB3\u003c/p\u003e \u003cp\u003e(MA\u003c/p\u003e \u003cp\u003e0390.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTTTT\u003c/p\u003e \u003cp\u003eTCATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e624\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e13.6557\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.22e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eRegulator of ribosome biogenesis genes under nutrient stress. Repression of growth under quiescence (Liko et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2010\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSWI4\u003c/p\u003e \u003cp\u003e(MA0401.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGCGAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e135\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e14.3293\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.47e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eInvolved in the regulation of transcription of cell cycle-dependent genes (Baetz and Andrews, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1999\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIME1 (MA0320.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGGCGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e412\u003c/p\u003e \u003cp\u003e389\u003c/p\u003e \u003cp\u003e343\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e12.6571\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.25e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eInducer of meiosis 1\u003c/em\u003e (\u003cem\u003eIME1\u003c/em\u003e) encodes a transcription factor required for sporulation and meiosis processes (Mandel et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e1994\u003c/span\u003e; Chu and Herskowitz, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1998\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eZMS1\u003c/p\u003e \u003cp\u003e(MA0441.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCCGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e389\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e12.6098\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.62e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eRegulator of genes related to glycerol-based growth and cellular respiration (Lu et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2005\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMAC1\u003c/p\u003e \u003cp\u003e(MA0326.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTGCTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e668\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11.7586\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5.93e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eCopper-fist DNA binding domain. Regulation of the Cu/Fe utilization and stress resistance (Yonkovich et al. \u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e2002\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSUM1\u003c/p\u003e \u003cp\u003e(MA0398.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAATTTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e626\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10.619\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6.46e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eRelated to repression of sporulation genes during vegetative growth through the recruitment of a histone deacetylase (Xie et al. \u003cspan citationid=\"CR92\" class=\"CitationRef\"\u003e1999\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTBF1\u003c/p\u003e \u003cp\u003e(MA0403.3)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACCCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11.6053\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7.98e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eTBF1 encodes a protein that binds to telomeric TTAGGG repeats, regulates telomere length, and controls gene expression by acting as a chromatin insulator (Koering et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2000\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNDT80\u003c/p\u003e \u003cp\u003e(MA0343.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACACAAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e434\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10.4404\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e9.09e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eNDT80 encodes a transcription factor which is involved in the activation of genes for meiosis and spore formation, competing with the repressor SUM1 (Pierce et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2003\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYPR196W\u003c/p\u003e \u003cp\u003e(MA0437.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGATTCTCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e532\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11.387\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6.6e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eC2H2 zinc finger motif. Poorly characterized. Enriched in hexose transporters in yeasts (Badis et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"9\" rowspan=\"10\"\u003e \u003cp\u003e\u003cem\u003eTcMAT1-2-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eYPR196W\u003c/p\u003e \u003cp\u003e(MA0437.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTTCACCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e132\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11.387\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6.6e-05\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIXR1\u003c/p\u003e \u003cp\u003e(MA0323.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAACGGTTGCGGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e258\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e8.06579\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1.11e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eHigh mobility group (HMG) related to the regulation of hypoxic genes (Castro-Prego et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2010\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLEU3\u003c/p\u003e \u003cp\u003e(MA0324.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCGGTTGCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e269\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e13.3659\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.35e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eThe regulatory protein LEU3 (LEUR) controls a group of leucine-specific genes (Sze et al. \u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e1992\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSWI4\u003c/p\u003e \u003cp\u003e(MA0401.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGCGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e319\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e12.9024\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2.94e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eThe SWI4 transcription factor, together with SWI6, forms the SBF complex, responsible for activating genes in the G1/S transition of the cell cycle ( Baetz and Andrews, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1999\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMCM1\u003c/p\u003e \u003cp\u003e(MA0331.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTAATTGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e298\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11.3878\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e5.65e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eInvolved in the activation of early cell cycle genes (G1/M), regulation of mating-type genes, and coordination of the arginine metabolism genes (Elble and Tye, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1991\u003c/span\u003e; Messenguy and Dubois, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e1993\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHSF1\u003c/p\u003e \u003cp\u003e(MA0319.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGGAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e207\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e12.1341\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e6.51e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eThe heat shock transcription factor (HSF1) activates heat shock proteins (HSPs) to protect cells from stress by maintaining proper protein folding and preventing damage (Wiederrecht et al. \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e1988\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eEDS1\u003c/p\u003e \u003cp\u003e(MA0294.2)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAAAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e161\u003c/p\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11.878\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7.93e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eMember of C6 zinc cluster factors. Poorly characterized.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eARR1\u003c/p\u003e \u003cp\u003e(MA0274.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATCTGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e354\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10.9221\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e8.79e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eThe arsenical-resistance protein (ARR1) is involved in the cellular response to arsenic-containing substances (Menezes et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2004\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eASH1\u003c/p\u003e \u003cp\u003e(MA0276.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAAATTAGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e309\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10.7429\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e9.73e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eInvolved in in chromatin organization, negative regulation of mating-type switching and promotion of pseudohyphal growth (Sil and Herskowitz, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Pan and Heitman, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2000\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRME1\u003c/p\u003e \u003cp\u003e(MA0370.1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTAAAGGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10.7237\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e9.85e-05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eRegulator of meiosis, pseudohyphal growth and the G1/S transition. Promoter of invasive growth under glucose limitation (Toone et al. \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e1995\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e*Upstream TSS\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe aminoacidic sequences of the conserved α- and HMG-box domains are highly preserved along different Pezizomycetes fungi\u003c/b\u003e \u003c/p\u003e \u003cp\u003eInterPro analysis revealed the presence of two conserved domains within the amino acid sequences of the mating type proteins: an α-box domain with 58 aas in TcMAT1-1-1 and an HMG-box domain with 78 aas in TcMAT1-2-1 (Supplementary Fig.\u0026nbsp;7). These sequences were used to investigate their evolutionary relationships among various species within the Pezizomycetes class (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The α-box domain neighbour-joining tree showed that the studied genera belonging to Pezizaceae family considered as desert truffles (\u003cem\u003eTerfezia\u003c/em\u003e, \u003cem\u003eTirmania\u003c/em\u003e, \u003cem\u003eMattirolomyces\u003c/em\u003e, and \u003cem\u003eKalaharituber\u003c/em\u003e), formed a single clade supported by moderate to high bootstrap values (48\u0026ndash;99). In the HMG-box domain tree, \u003cem\u003eTerfezia\u003c/em\u003e and \u003cem\u003eKalaharituber\u003c/em\u003e clustered together with a bootstrap value of 77. The genus \u003cem\u003ePicoa\u003c/em\u003e, which belongs to the Pyronemataceae family but is also regarded as a desert truffle, was positioned outside this clade. In both trees, as expected, the different \u003cem\u003eTuber\u003c/em\u003e species (Tuberaceae) appeared closely related, forming well-supported clusters.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe conserved regions of TcMAT proteins were aligned with those from various Pezizomycetes species (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D). In total, 10 residues in α-box domain and 17 in HMG domain alignments were fully conserved across all analysed species. Additionally, a conserved intron position was observed across all species at DNA level, corresponding to a codon encoding serine or cysteine residue within the α-box domain alignment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). However, for the HMG-domain, the number and position of introns varied between species, ranging from two to four (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). This variability indicates greater structural divergence according to the intron gain or loss events in the evolution of the \u003cem\u003eMAT1-2-1\u003c/em\u003e gene compared to \u003cem\u003eMAT1-1-1\u003c/em\u003e gene.\u003c/p\u003e \u003cp\u003eThe sequences of proteins encoded by \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e allowed the study of the tertiary structures of the α- and HMG-box domains, which were predicted using AlphaFold Server. For the α-box domain, the confidence score was predicted template modelling pTM\u0026thinsp;=\u0026thinsp;0.72, while for the HMG-box domain, the predicted confidence was pTM\u0026thinsp;=\u0026thinsp;0.78, indicating moderate to high structural reliability in both cases (Xu and Zhang, \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). According to MolProbity, the best model for each domain was selected and subsequently superimposed for structural comparison (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Their three-dimensional structures exhibited remarkable similarity, as evidenced by an RMSD value of 0.78 \u0026Aring;ngstr\u0026ouml;ms when aligned. This low RMSD value indicates excellent structural conservation between the α- and HMG-box domains, suggesting they adopt nearly identical protein folds despite their sequence divergence. The structural similarity observed supports both a functional relationship and a potential evolutionary connection between these mating-type domains and their potential role in transcriptional regulation within the mating system of this organism.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAlthough amino acid conservation across the aligned sequences was variable and not uniform (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D), evolutionary analysis of mating type genes across Pezizomycetes species using the FEL method revealed a predominant pattern of purifying selection. For \u003cem\u003eMAT1-1-1\u003c/em\u003e, 55 out of 158 variable codons (\u0026asymp;\u0026thinsp;34.8%) exhibited significant evidence of purifying selection (dN/dS\u0026thinsp;\u0026lt;\u0026thinsp;1; p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Similarly, for \u003cem\u003eMAT1-2-1\u003c/em\u003e, 46 out of 119 codons (\u0026asymp;\u0026thinsp;38.7%) were under purifying selection at the same significance threshold. Importantly, no codons were identified under diversifying (positive) selection, indicating strong evolutionary constraint on both genes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSpatio-temporal evolution of\u003c/b\u003e \u003cb\u003eTcMAT\u003c/b\u003e \u003cb\u003egenes\u003c/b\u003e\u003c/p\u003e \u003cp\u003eOver a two-year period, the dynamic of \u003cem\u003eT. claveryi\u003c/em\u003e from nursery to the field was followed. \u003cem\u003eT. claveryi\u003c/em\u003e was deteted and quantified by qPCR in all root and soil samples, confirming the persistence of the fungus across the complete sampling timeline (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In the nursery scenario, the abundance of \u003cem\u003eT. claveryi\u003c/em\u003e remained relatively stable during the nine months following inoculation. This pattern was maintained to time T14, which corresponds to the first samples collected from field two weeks after transplantation. Interestingly, a marked increase in variability was observed at subsequent times T18 and T27, as evidenced by a broader distribution in fungal abundance values. Statistical analysis revealed significant differences in \u003cem\u003eT. claveryi\u003c/em\u003e abundance between time T18 and all preceding nursery time points (\u003cem\u003ep-values\u003c/em\u003e: T2\u0026ndash;T18\u0026thinsp;=\u0026thinsp;0.001, T4\u0026ndash;T18\u0026thinsp;=\u0026thinsp;0.0055, T6\u0026ndash;T18\u0026thinsp;=\u0026thinsp;0.0047, T9\u0026ndash;T18\u0026thinsp;=\u0026thinsp;0.0006), and also between time T27 and all nursery time points (\u003cem\u003ep-values\u003c/em\u003e: T2-T27\u0026thinsp;=\u0026thinsp;0.0093, T4-T27\u0026thinsp;=\u0026thinsp;0.0411, T6-T27\u0026thinsp;=\u0026thinsp;0.026, T9-T27\u0026thinsp;=\u0026thinsp;0.0133). Additionally, \u003cem\u003eT. claveryi\u003c/em\u003e abundance differed significantly according to the sample source (rhizospheric soil - roots; \u003cem\u003ep-value\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0004; (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Specifically, fungal quantity was consistently lower in root than in soil samples.\u003c/p\u003e \u003cp\u003eWhen the frequence of \u003cem\u003eTcMAT\u003c/em\u003e genes was investigated differences according to the source and location variables emerged (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Whereas in root samples from nursery plants both \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e were detected, root samples from the field plants exhibited the \u003cem\u003eTcMAT1-1-1\u003c/em\u003e only, regardless of the collection timing. \u003cem\u003eTcMAT1-1-1\u003c/em\u003e, \u003cem\u003eTcMAT1-2-1\u003c/em\u003e and their combination (\u003cem\u003eTcMAT1-1-1\u003c/em\u003e\u0026thinsp;+\u0026thinsp;\u003cem\u003eTcMAT1-2-1\u003c/em\u003e) were detected in soil nursery samples, with \u003cem\u003eTcMAT1-1-1\u003c/em\u003e showing the highest frequency. In soil field samples both \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e were detected, but not their combination. In addition, the abundance of \u003cem\u003eTcMAT\u003c/em\u003e genes in field was evaluated (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). \u003cem\u003eTcMAT1-1-1\u003c/em\u003e was found in all the 10 plots analysed, whereas \u003cem\u003eTcMAT1-2-1\u003c/em\u003e was present only in the 40% of the plots.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eBy combining \u003cem\u003ein silico\u003c/em\u003e and molecular approaches, here we not only provide compelling evidence in support of the heterothallic reproductive mode of \u003cem\u003eT. claveryi\u003c/em\u003e, but also shed preliminary lights on the spatio- temporal distribution of \u003cem\u003eT. claveryi\u003c/em\u003e strains of opposite mating type on both host plants and soil. This information along with the protocols herein developed are crucial to drive management practices to promote desert truffle spreading and fructification. Additionally, first hints on the evolution within Pezizomycete class of \u003cem\u003eMAT\u003c/em\u003e genes and regulatory motifs controlling their expression have been provided.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDetection of\u003c/b\u003e \u003cb\u003eTcMAT\u003c/b\u003e \u003cb\u003egenes requires a nested PCR approach\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAttempts to detect the single-copy \u003cem\u003eTcMAT\u003c/em\u003e genes using conventional PCR proved challenging. Consequently, a nested PCR protocol was developed and optimized to enhance sensitivity and minimize the occurrence of false positives. Nested PCR, which involves two sequential rounds of amplification using two sets of primers, was found to be highly sensitive and reliable specially in soil samples. The greatest difficulties in amplifying these genes were encountered in field root samples, which is consistent with the low concentration of \u003cem\u003eT. claveryi\u003c/em\u003e DNA found in this tissue. This likely reflects the low abundance of the fungus in the root environment despite its initial inoculation with the host plant, since it appears to be outcompeted by other fungi in the field, as previously reported by Arenas et al. (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eSexual reproduction in\u003c/b\u003e \u003cb\u003eT. claveryi\u003c/b\u003e \u003cb\u003erequires outcrossing\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAs already suggested by Marqu\u0026eacute;s-G\u0026aacute;lvez et al. (\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), our work confirms that the \u003cem\u003eMAT\u003c/em\u003e locus in \u003cem\u003eT. claveryi\u003c/em\u003e is constituted by two non-concurrent idiomorphs, \u003cem\u003eTcMAT1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2\u003c/em\u003e, each one characteristic of specific strains. This research represents the first report of a desert truffle species for which the mating-type reproductive mode has been characterised.\u003c/p\u003e \u003cp\u003eThe detection and sequencing of different mating type idiomorphs in individual spores derived from the same ascus supports the haploid nature of \u003cem\u003eT. claveryi\u003c/em\u003e ascospores. This observation indicates successful segregation of the MAT \u003cem\u003elocus\u003c/em\u003e during meiosis, which is typical of heterothallic ascomycetes (Wilson et al. \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The confirmation of haploidy at the spore level reinforces the hypothesis that mating compatibility in \u003cem\u003eT. claveryi\u003c/em\u003e requires the interaction of two genetically distinct strains carrying opposite mating types. This finding is consistent with previous reports in the \u003cem\u003eNeurospora crassa\u003c/em\u003e model ascomycetes (Raju, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e1992\u003c/span\u003e) as well as other mycorrhizal truffle species such as \u003cem\u003eTuber melanosporum\u003c/em\u003e (Rubini et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2011a\u003c/span\u003e), \u003cem\u003eTuber indicum\u003c/em\u003e (Belfiori et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) or \u003cem\u003eTuber borchii\u003c/em\u003e (Belfiori et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Moreover, it suggests that under natural conditions, ascospore germination and subsequent mycelial development are likely initiated from a single mating type, thus requiring the presence of a compatible strain in the surrounding environment to complete the sexual cycle. In this scenario, periodic selection and inoculation of host plants with sexually compatible strains of \u003cem\u003eT. claveryi\u003c/em\u003e, specially in field stage, may notably increase the likelihood of mating and, therefore, fruit body development (Rubini et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2011a\u003c/span\u003e; Rubini et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Molinier et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; De la Varga et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe genetic structure of\u003c/b\u003e \u003cb\u003eT. claveryi\u003c/b\u003e \u003cb\u003eMAT\u003c/b\u003e \u003cb\u003elocus\u003c/b\u003e \u003cb\u003ereveals lineage-specific evolution and specific regulatory mechanisms\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe characterisation of \u003cem\u003eMAT\u003c/em\u003e locus through RNAseq and DNA sequencing enabled the elucidation of its genomic structure. Interestingly, \u003cem\u003eTcMAT1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2\u003c/em\u003e idiomorphs are 2,868 bp and 3,087 bp in length, respectively. This contrasts with other hypogeous symbiotic ascomycetes, such as \u003cem\u003eT. melanosporum\u003c/em\u003e, in which both \u003cem\u003eMAT1-1\u003c/em\u003e and \u003cem\u003eMAT1-2\u003c/em\u003e idiomorphs are considerably longer, consisting of 7,430 bp and 5,550 bp, respectively (Rubini et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2011a\u003c/span\u003e). The MAT idiomorphs lengths in other \u003cem\u003eTuber\u003c/em\u003e species are even greater (Belfiori et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Differently from the studied \u003cem\u003eTuber\u003c/em\u003e species (Rubini et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2011a\u003c/span\u003e, Belfiori et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), in the two \u003cem\u003eT. claveryi MAT\u003c/em\u003e idiomorphs neither transposon-like elements nor additional ORFs are present. The orientation of \u003cem\u003eTcMAT\u003c/em\u003e genes also reveals a different structural organization when compared to other described Pezizomycetes. Both \u003cem\u003eTcMAT1-1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2-1\u003c/em\u003e are oriented in the same direction. This configuration contrasts with that of other truffles species such as \u003cem\u003eT. indicum\u003c/em\u003e and \u003cem\u003eT. melanosporum\u003c/em\u003e, where \u003cem\u003eMAT1-1-1\u003c/em\u003e shares the same orientation but \u003cem\u003eMAT1-2-1\u003c/em\u003e is located on the opposite strand (Rubini et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2011a\u003c/span\u003e; Belfiori et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Conversely, in \u003cem\u003eT. borchii\u003c/em\u003e, \u003cem\u003eMAT1-1-1\u003c/em\u003e displays the inverted orientation relative to \u003cem\u003eT. claveryi\u003c/em\u003e (Belfiori et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe multiple sequence alignment of the conserved α- and HMG-box domains across various Pezizomycetes species revealed a high degree of conservation, with a notable number of aligned residues belonging to chemically similar amino acid groups. This outcome implies that most of the observed substitutions are conservative, preserving the structural or functional integrity of these domains and indicating potential importance across different species. Remarkably, a conserved intron at DNA level is present in the same position in all organisms within the α-box domain, although the corresponding amino acid alternates between cysteine (\u003cem\u003eT. claveryi\u003c/em\u003e, \u003cem\u003eTirmania nivea\u003c/em\u003e, \u003cem\u003eMattirolomyces terfezioides\u003c/em\u003e) and serine (\u003cem\u003eKalaharituber pfeilli\u003c/em\u003e, \u003cem\u003eAscobolus immersus\u003c/em\u003e, \u003cem\u003eT. melanosporum\u003c/em\u003e, \u003cem\u003eT. borchii\u003c/em\u003e, \u003cem\u003eT. indicum\u003c/em\u003e). These residues are structurally similar in size and polarity but differ in chemical properties, since cysteine contains a thiol group, which is highly reactive and can form disulfide bonds, whereas serine has a hydroxyl group, which is less reactive. In contrast, the HMG-box domain displays variation in both the number and location of introns among species. Altogether, the mentioned variations may reflect lineage-specific adaptations (Yampolsky et al. 2005; Huzurbazar et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Such molecular phenomenon plays a role in the evolutionary dynamics of mating-type loci, possibly contributing to the suppression of recombination and the regulation of gene expression (Idnurm et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; De Hoff et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Yamazaki et al. \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRegarding gene regulation, several DNA-binding motifs were identified in the promoter regions of both genes. Importantly, IME1, which is present in several copies, and other motifs (e.g. RME1, ASH1, MCM1, SWI4, NDT80 or SUM1) are associated with transcription factors involved in biological functions such as sexual reproduction, cell cycle progression, response to stimuli and development. This is consistent with the known function of the \u003cem\u003eMAT\u003c/em\u003e locus in fungi, which orchestrates the regulation of reproductive processes (Fraser and Heitman, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Debuchy et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Additionally, other binding motifs related to stress response (STB3, MAC1, IXR1, HSF1, ARR1) and aminoacidic metabolism (CHA4, LEU3) were also identified. The presence of these motifs suggests that sexual reproduction in \u003cem\u003eT. claveryi\u003c/em\u003e may be activated under stressful or changing environmental conditions, consistent with the idea that fungi tend to shift to sexual reproduction as an adaptive response to stress (Schoustra et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Amino acid availability also appears to play a critical role in regulating this process in \u003cem\u003eT.claceryi\u003c/em\u003e as much as in \u003cem\u003eAspergillus nidulans\u003c/em\u003e, whose sexual development is promoted when amino acids are abundant and repressed under amino acid starvation (Hoffmann et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Therefore, while environmental stress may act as a signal to initiate sexual reproduction, sufficient nutrient availability, particularly of amino acids, might be required to complete the process successfully. This coordinated regulation highlights the adaptive flexibility of \u003cem\u003eT. claveryi\u003c/em\u003e, allowing it to integrate environmental and metabolic signals to optimize sexual reproduction and fruiting body formation under arid conditions. This finding is essential for better understanding desert truffle production. Interestingly, the YPR196W motif, bound by transcription factors which may be involved in maltase and maltose permease transcription genes is present in both \u003cem\u003eMAT1-1-1\u003c/em\u003e and \u003cem\u003eMAT1-2-1\u003c/em\u003e promoters, suggesting a potentially conserved regulatory role.\u003c/p\u003e \u003cp\u003eThe presence of an intron in the 5\u0026rsquo;UTR of \u003cem\u003eTcMAT1-2-1\u003c/em\u003e suggests that this gene may possess specialized regulatory features (Bicknell et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Hoshida et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). This intron can harbour transcription factor binding sites and influence gene expression at multiple levels, from transcription to translation. Evidence from \u003cem\u003eArabidopsis\u003c/em\u003e indicates that 5\u0026rsquo;UTR introns can enhance mRNA accumulation and modulate transcription start site selection, supporting their role as regulatory elements (Chung et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Gallegos and Rose, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In \u003cem\u003eTcMAT1-2-1\u003c/em\u003e, this intron may provide an additional layer of control, ensuring precise temporal and spatial expression, which could be crucial for sexual differentiation and adaptive responses to environmental cues in \u003cem\u003eT. claveryi\u003c/em\u003e. In contrast, \u003cem\u003eTcMAT1-1-1\u003c/em\u003e only contains an intron, which is located in the coding region, signifying a simpler mechanism. The structural difference may reflect distinct regulatory requirements between the two mating types. Further studies should be aimed to experimentally validate the TF-DNA interactions here described in the promoter regions of \u003cem\u003eTcMAT\u003c/em\u003e genes, which will help to better understand the regulatory mechanisms that trigger sexual reproduction in truffles.\u003c/p\u003e \u003cp\u003ePrevious comparative analyses suggest that in Pezizomycotina, the α-box domain present in MAT1-1-1 evolved from an ancestral MATA_HMG domain within the HMG-box superfamily and retained its tertiary conformation due to functional constraints (Martin et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Our results in \u003cem\u003eT. claveryi\u003c/em\u003e are in line with this report. We showed that the amino acid sequences of the α- and HMG-box domains in \u003cem\u003eT. claveryi\u003c/em\u003e have diverged considerably (similarity\u0026thinsp;=\u0026thinsp;34.1%). However, their predicted tertiary structures are highly similar, as evidenced by a low RMSD value. This finding implies that both domains share a conserved fold which is characteristic of the HMG-box superfamily, since they have similar L-shaped architecture with three α-helices. The preservation of the same scaffold in both domains suggests that they perform similar biological roles, from transcriptional regulation to mating-type determination (Ait Benkhali et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Maintenance of the tertiary structure despite notable differences in primary sequence is a well-known phenomenon, particularly in DNA binding proteins and protein-protein interactions (Illerg\u0026aring;rd et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Thapar \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Therefore, the structural conservation despite the low sequence similarity within α- and HMG-box domains observed in TcMAT proteins suggests that selective pressure act primarily on preserving structural integrity, rather than on their exact amino acid composition. Importantly, selection analysis revealed significant finding of purifying selection, indicating that there is a strong selective pressure to eliminate non-synonymous mutations that alter the conserved domains function not only for \u003cem\u003eT. claveryi\u003c/em\u003e, but also for the analysed Pezizomycetes. This extreme conservation is likely due to the critical role of MAT proteins as master regulators in reproductive mechanisms, where structural changes could compromise recognition specificity between strains (Fraser and Heitman, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Debuchy et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Ait Benkhali et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Overall, our findings provide functional insight into the molecular mechanisms of fungal mating-type regulation and adds strong evidence related to the hypothesis of a common ancestral MATA_HMG domain as an earlier form of fungal \u003cem\u003eMAT\u003c/em\u003e loci, which gave origin to the current α- and HMG-box domains, first postulated by Idnurm et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) and supported by Martin et al. (\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eMating type fingerprinting of\u003c/b\u003e \u003cb\u003eH. almeriense\u003c/b\u003e \u003cb\u003ex\u003c/b\u003e \u003cb\u003eT. claveryi\u003c/b\u003e \u003cb\u003ereveals tissue-related limitations and a loss of mating diversity from nursery to field\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe deep characterization of both \u003cem\u003eTcMAT\u003c/em\u003e genes allowed the design of specific primers and the optimization of a protocol to detect the sexual identity of \u003cem\u003eT. claveryi\u003c/em\u003e in different organs. As a case scenario, we evaluated the presence of the idiomorphs in a set of mycorrhizal roots of \u003cem\u003eH. almeriense\u003c/em\u003e and the surrounding rhizospheric soil.\u003c/p\u003e \u003cp\u003eRegarding \u003cem\u003eT. claveryi\u003c/em\u003e concentration, the relatively low and uniform presence of the fungus during the nursery phase suggests that the controlled conditions constrained fungal growth, maintaining a balanced symbiotic relationship (Talley et al. \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Jacquemyn et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, this pattern changed after the transplantation of plants to the field, where a marked increase in fungal DNA concentrations was observed at T18 and T27, albeit with a large variability among samples. Such phenomenon observed in field may be influenced by microenvironment heterogeneity and the adaptation of the symbiosis to the new conditions (Bang et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Arenas et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022b\u003c/span\u003e). Altogether, these outcomes highlight how environmental factors can promote or disturb fungal colonization dynamics beyond controlled nursery settings.\u003c/p\u003e \u003cp\u003eDetermination of \u003cem\u003eTcMAT\u003c/em\u003e genes in nursery and field root samples was limited due to the low abundance of \u003cem\u003eT. claveryi\u003c/em\u003e DNA, as previously mentioned, likely leading to underestimation of idiomorph presence in organ. Although a mix of spores from different mating type were introduced into the substrate during inoculation, root colonization and mycorrhiza formation require time, and fungal biomass within the roots remained low during the early months, making its detection complicated. Even in the field stage, detection in roots can be constrained by climatic conditions or direct competition with other fungi, which may limit the establishment and proliferation of \u003cem\u003eT. claveryi\u003c/em\u003e (Arenas et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). These factors, together with the single-copy nature of \u003cem\u003eTcMAT\u003c/em\u003e genes, further reduced detection sensitivity.\u003c/p\u003e \u003cp\u003eAccording to the mating type distribution at nursery stage, both \u003cem\u003eTcMAT1-1\u003c/em\u003e and \u003cem\u003eTcMAT1-2\u003c/em\u003e idiomorphs were found in root samples, with frequencies fluctuating over time. In contrast, the soil compartment exhibited a predominance of \u003cem\u003eTcMAT1-1-1\u003c/em\u003e, which was consistently detected across all sampling points, indicating its early establishment or greater sensitivity advantage. In the field stage, the pattern became even more pronounced, as most of the determined samples were dominated by \u003cem\u003eTcMAT1-1-1\u003c/em\u003e. The frequency of \u003cem\u003eTcMAT1-2-1\u003c/em\u003e was substantially reduced, and in some time points, not detected. Importantly, the use of spores as inoculum ensures that both mating types are provided to the host plants. In line with this, strains of both mating types are found under controlled conditions, as shown by root samples collected at T2-T9. In contrast, after transplantation, a specific mating type (\u003cem\u003eMAT1-1-1\u003c/em\u003e) became dominant on the roots of host plants. Interestingly, this mating type is the same that prevailed in soil nursery samples. This striking shift towards a single mating type suggests that the balance between idiomorphs depends on many, and still unknown variables governing the different steps of plant and soil colonization by \u003cem\u003eT. claveryi\u003c/em\u003e. In turn, this observation let us to argue that strains harboring opposite \u003cem\u003eMAT\u003c/em\u003e idiomorphs respond differently to identical environmental conditions, likely due to different regulation of \u003cem\u003eMAT\u003c/em\u003e genes or \u003cem\u003eMAT-\u003c/em\u003eresponsive loci. Polymorphim in the promoter regions of the \u003cem\u003eMAT\u003c/em\u003e genes and/or the presence of a 5\u0026rsquo;UTR intron in \u003cem\u003eTcMAT1-2-1\u003c/em\u003e may be responsible for the more restricted spatio-temporal distribution of strains carrying the \u003cem\u003eMAT1-2-1\u003c/em\u003e with respect to those carrying the \u003cem\u003eMAT1-1-1\u003c/em\u003e gene. Therefore, an intro-mediated regulation, polymorphisms within the regulatory regions of \u003cem\u003eMAT\u003c/em\u003e genes or a combination of both factors may influence the distinct distribution patterns of strains of opposite mating types. Further studies are warranted to elucidate the relative contribution of these mechanisms.\u003c/p\u003e \u003cp\u003eThe bias distribution of \u003cem\u003eT. claveryi\u003c/em\u003e mating types may have significant implications for the sexual reproduction potential and the maintenance of genetic diversity in \u003cem\u003eT. claveryi\u003c/em\u003e populations under field conditions. In fact, no ascocarp production was observed during the field stage, supporting the hypothesis that biased mating type distributions limit reproductive success. Considering that desert truffle production usually begins three years after planting, this timeframe may correspond to the period required for compatible strains carrying the alternate \u003cem\u003eMAT\u003c/em\u003e to colonize neighboring plants or soil and enable ascocarp formation.\u003c/p\u003e \u003cp\u003eAltogether, it appears that colonization in the studied field is highly selective or that \u003cem\u003eTcMAT1-1-1\u003c/em\u003e is more competitive during the colonization process. This finding goes hand with hand with similar results reported in \u003cem\u003eT. melanosporum\u003c/em\u003e open-field studies (Rubini et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2011b\u003c/span\u003e), where a notable prevalence of a specific mating type was observed at individual sites. Thus, the dominance of one mating type over the other may depend on the competitivness of each strain. Indeed, the distribution of mating type genes is often non-random and influenced by both ecological and cultivation factors (Murat et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; De la Varga et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eNatural truffle populations, including desert truffles, tend to be spatially structured, with patches dominated by a single mating type which can limit the potential for sexual reproduction. In this context, the potential use of desert truffle nests to balance mating type distribution, as it has been already tested in black truffes (Garcia-Barreda et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), remains largely unexplored and could represent a promising strategy to enhance cultivation yield. These patterns presented here give insight about the distribution and persistence of mating types in ectendomycorrhizal fungi, and suggest further research is necessary to clarify the mechanisms driving idiomorph dominance and its fructification consequences. In this context, it would be interesting study more \u003cem\u003eH. almeriense\u003c/em\u003e x \u003cem\u003eT. claveryi\u003c/em\u003e plantations in more diverse contexts and during longer periods of time.\u003c/p\u003e \u003cp\u003eMonitoring \u003cem\u003eTcMAT\u003c/em\u003e genes in both roots and soil provides valuable information for optimising desert truffle cultivation. The identification of the \u003cem\u003eMAT\u003c/em\u003e idiomorph that predominates in a plantation could allow to introduce additional inoculum containing strains of the opposite mating type in order to restore balance and increase the probability of sexual reproduction and fruiting body formation. Therefore, the methodology established in this work represents a key tool for improving the management and productivity of this type of cultivation systems.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eThe present study provides meaningful insights into the reproductive system of \u003cem\u003eT. claveryi\u003c/em\u003e and sheds light on the phylogenetic relationships and evolution of \u003cem\u003eMAT\u003c/em\u003e genes in symbiotic Pezizomycetes. The finding that the two master genes for sexual reproduction (\u003cem\u003eMAT1-1-1\u003c/em\u003e and \u003cem\u003eMAT1-2-1\u003c/em\u003e) are present in different strains provides conclusive evidence that \u003cem\u003eT. claveryi\u003c/em\u003e is a heterothllic fungus. This observation, coupled to the uneven distribution in the field of strains carrying opposite mating types, should lead to a serious reconsideration of the process of inoculating of host plants and orchard managment practices, with the aim of promoting desert truffle fruiting.\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eCompeting interests:\u003c/strong\u003e \u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research was funded by MCIN/AEI/10. 13039/50110 0011033, project reference PID2020-115210RB-I00. Laura Andreu-Ardil is greatiful the University of Murcia for its funding through the Predoctoral Contracts Program of the Research Promotion Plan.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAM, FP, ANR and JEMG conceived the study; All authors performed different parts of the lab work; LAA, ALG, FA, FP, MPG and JEMG processed and analyzed data; LAA and JEMG wrote the first draft; All authors contributed critically to review and edit the drafts and gave final approval for publication; AM is the researcher responsible for funding acquisition. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe authors thank to desert truffle farmer Pedro Corbal\u0026aacute;n who kindly allowed the use of his plantation for the research work.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data supporting the findings of this study are available within the paper and its Supplementary Information.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbascal F, Zardoya R, Telford MJ (2010) TranslatorX: multiple alignment of nucleotide sequences guided by amino acid translations. Nucleic Acids Res 38(7):W7\u0026ndash;W13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/gkq291\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkq291\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbramson J, Adler J, Dunger J et al (2024) Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630:493\u0026ndash;500. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41586-024-07487-w\u003c/span\u003e\u003cspan address=\"10.1038/s41586-024-07487-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAit Benkhali J, Coppin E, Brun S et al (2013) A network of HMG-box transcription factors regulates sexual cycle in the fungus \u003cem\u003ePodospora anserina\u003c/em\u003e. PLoS Genet 9(7):e1003642. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pgen.1003642\u003c/span\u003e\u003cspan address=\"10.1371/journal.pgen.1003642\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrino A, Sauheitl L, Guggenberger G et al (2025) Determining the nutritional importance of common mycelial networks in a desert truffle mycorrhizal symbiosis for soil nitrogen redistribution. Rhizosphere 101055. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.rhisph.2025.101055\u003c/span\u003e\u003cspan address=\"10.1016/j.rhisph.2025.101055\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArenas F, Morte A, Navarro-R\u0026oacute;denas A (2022a) Design and validation of qPCR-specific primers for quantification of the marketed \u003cem\u003eTerfezia claveryi\u003c/em\u003e and \u003cem\u003eTerfezia crassiverrucosa\u003c/em\u003e in soil. J Fungi 8(3):1095. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/jof8101095\u003c/span\u003e\u003cspan address=\"10.3390/jof8101095\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArenas F, L\u0026oacute;pez-Garc\u0026iacute;a \u0026Aacute;, Bern\u0026aacute; LM, Morte A, Navarro-R\u0026oacute;denas A (2022b) Desert truffle mycorrhizosphere harbors organic acid releasing plant growth-promoting rhizobacteria, essentially during the truffle fruiting season. Mycorrhiza 32:193\u0026ndash;202. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-021-01067-w\u003c/span\u003e\u003cspan address=\"10.1007/s00572-021-01067-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArenas F, Navarro-R\u0026oacute;denas A, Ch\u0026aacute;vez D, Gui\u0026eacute;rrez A, P\u0026eacute;rez-Gilabert M, Morte A (2018) Mycelium of \u003cem\u003eTerfezia claveryi\u003c/em\u003e as inoculum source to produce desert truffle mycorrhizal plants. Mycorrhiza 28:691\u0026ndash;701. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-018-0867-3\u003c/span\u003e\u003cspan address=\"10.1007/s00572-018-0867-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArenas F, Navarro-R\u0026oacute;denas A, Marqu\u0026eacute;s-G\u0026aacute;lvez JE, Ghignone S, Mello A, Morte A (2021) Different patterns in root and soil fungal diversity drive plant productivity of the desert truffle \u003cem\u003eTerfezia claveryi\u003c/em\u003e in plantation. Environ Microbiol 23(10):5917\u0026ndash;5933. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1462-2920.15688\u003c/span\u003e\u003cspan address=\"10.1111/1462-2920.15688\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBadis G, Chan ET, van Bakel H et al (2008) A library of yeast transcription factor motifs reveals a widespread function for Rsc3 in targeting nucleosome exclusion at promoters. Mol Cell 32(6):878\u0026ndash;887. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.molcel.2008.11.020\u003c/span\u003e\u003cspan address=\"10.1016/j.molcel.2008.11.020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaetz K, Andrews B (1999) Regulation of cell cycle transcription factor Swi4 through auto-inhibition of DNA binding. Mol Cell Biol 19(10):6729\u0026ndash;6741. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/MCB.19.10.6729\u003c/span\u003e\u003cspan address=\"10.1128/MCB.19.10.6729\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBang C, Dagan T, Deines P et al (2018) Metaorganisms in extreme environments: do microbes play a role in organismal adaptation? Zool. 127:1\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.zool.2018.02.004\u003c/span\u003e\u003cspan address=\"10.1016/j.zool.2018.02.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBelfiori B, Riccioni C, Paolocci F, Rubini A (2013) Mating type locus of chinese black truffles reveals heterothallism and the presence of cryptic species within the \u003cem\u003eT. indicum\u003c/em\u003e species complex. PLoS ONE 8(12):e82353. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0082353\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0082353\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBelfiori B, Riccioni C, Paolocci F, Rubini A (2016) Characterization of the reproductive mode and life cycle of the whitish truffle \u003cem\u003eT. borchii\u003c/em\u003e. Mycorrhiza 26:515\u0026ndash;527. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-016-0689-0\u003c/span\u003e\u003cspan address=\"10.1007/s00572-016-0689-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBennett RJ, Turgeon BG (2016) Fungal Sex: The Ascomycota. Microbiol Spectr 4(5). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/microbiolspec.funk-0005-2016\u003c/span\u003e\u003cspan address=\"10.1128/microbiolspec.funk-0005-2016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerrios L, Yeam J, Holm L et al (2023) Positive interactions between mycorrhizal fungi and bacteria are widespread and benefit plant growth. Curr Biol 33(14):2878\u0026ndash;2887. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2023.06.010\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2023.06.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBicknell AA, Cenik C, Chua HN, Roth FP, Moore MJ (2012) Introns in UTRs: why we should stop ignoring them. BioEssays 34:1025\u0026ndash;1034. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/bies.201200073\u003c/span\u003e\u003cspan address=\"10.1002/bies.201200073\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlum M, Andreeva A, Florentino LC et al (2024) InterPro: the protein sequence classification resource in 2025. Nucleic Acids Res 53(D1):D444\u0026ndash;D456. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/gkae1082\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkae1082\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBobrowicz P, Pawlak R, Correa, Bell-Pedersen D, Ebbole DJ (2002) The \u003cem\u003eNeurospora crassa\u003c/em\u003e pheromone precursor genes are regulated by the mating type locus and the circadian clock. Mol Microbiol 45(3):795\u0026ndash;804. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-2958.2002.03052.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-2958.2002.03052.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinform 30(15):2114\u0026ndash;2120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btu170\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btu170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBordallo JJ, Rodr\u0026iacute;guez A, Mu\u0026ntilde;oz-Mohedano JM, Suz LM, Honrubia M, Morte A (2013) Five new \u003cem\u003eTerfezia\u003c/em\u003e species from the Iberian Peninsula. Mycotaxon 124(1):189\u0026ndash;208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5248/124.189\u003c/span\u003e\u003cspan address=\"10.5248/124.189\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCastro-Prego R, Lamas-Maceiras M, Soengas P, Carneiro I, Gonz\u0026aacute;lez-Siso I, Celdr\u0026aacute;n ME (2010) Regulatory factors controlling transcription of \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e IXR1 by oxygen levels: a model of transcriptional adaptation from aerobiosis to hypoxia implicating ROX1 and IXR1 cross-regulation. Biochem J 425(1):235\u0026ndash;243. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/BJ20091500\u003c/span\u003e\u003cspan address=\"10.1042/BJ20091500\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNA from pine trees. Plant Mol. Biol Rep 11:113\u0026ndash;116. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/BF02670468\u003c/span\u003e\u003cspan address=\"10.1007/BF02670468\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu S, Herskowitz I (1998) Gametogenesis in yeast is regulated by a transcriptional cascade dependent on Ndt80. Mol Cell 1(5):685\u0026ndash;696. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S1097-2765(00)80068-4\u003c/span\u003e\u003cspan address=\"10.1016/S1097-2765(00)80068-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChung BY, Simons C, Firth AE, Brown CM, Hellens RP (2006) Effect of 5'UTR introns on gene expression in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. BMC Genom 7:120. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2164-7-120\u003c/span\u003e\u003cspan address=\"10.1186/1471-2164-7-120\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Hoff PL, Ferris P, Olson BJ et al (2013) Species and population level molecular profiling reveals cryptic recombination and emergent asymmetry in the dimorphic mating locus of \u003cem\u003eC. reinhardtii\u003c/em\u003e. PLoS Genet 9(8):e1003724. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pgen.1003724\u003c/span\u003e\u003cspan address=\"10.1371/journal.pgen.1003724\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe la Varga H, Le Tacon F, Lagoguet M et al (2017) Five years investigation of female and male genotypes in p\u0026eacute;rigord black truffle (\u003cem\u003eTuber melanosporum\u003c/em\u003e Vittad.) revealed contrasted reproduction strategies. Environ Microbiol 19(7):2604\u0026ndash;2615. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1462-2920.13735\u003c/span\u003e\u003cspan address=\"10.1111/1462-2920.13735\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDebuchy R, Berteaux-Lecellier V, Silar P (2010) Mating systems and sexual morphogenesis in Ascomycetes. In: Borkovich KA, Ebbole DJ (eds) Cellular and molecular biology of filamentous fungi. ASM, Washington, DC, pp 501\u0026ndash;535\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElble R, Tye BK (1991) Both activation and repression of a-mating-type-specific genes in yeast require transcription factor Mcm1. Proc. Natl. Acad. Sci. USA 88(23):10966\u0026ndash;10970. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.88.23.10966\u003c/span\u003e\u003cspan address=\"10.1073/pnas.88.23.10966\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFraser JA, Heitman J (2003) Fungal mating-type loci. Curr Biol 13(20):R792\u0026ndash;R795. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2003.09.046\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2003.09.046\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFraser JA, Stajich JE, Tarcha EJ et al (2007) Evolution of the mating type locus: insights gained from the dimorphic primary fungal pathogens \u003cem\u003eHistoplasma capsulatum\u003c/em\u003e, \u003cem\u003eCoccidioides immitis\u003c/em\u003e, and \u003cem\u003eCoccidioides posadasii\u003c/em\u003e. Eukaryot Cell 6(4). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/ec.00018-07\u003c/span\u003e\u003cspan address=\"10.1128/ec.00018-07\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGallegos JE, Rose AB (2017) Intron DNA sequences can be more important than the proximal promoter in determining the site of transcript initiation. Plant Cell 29(4):843\u0026ndash;853. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.17.00020\u003c/span\u003e\u003cspan address=\"10.1105/tpc.17.00020\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarcia-Barreda S, Marco P, Mart\u0026iacute;n-Santaf\u0026eacute; M, Tejedor-Calvo E, S\u0026aacute;nchez S (2020) Edaphic and temporal patterns of \u003cem\u003eTuber melanosporum\u003c/em\u003e fruitbody traits and effect of localised peat-based amendment. Sci Rep 10:4422. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-020-61274-x\u003c/span\u003e\u003cspan address=\"10.1038/s41598-020-61274-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrant CE, Bailey TL, Noble WS (2011) FIMO: scanning for occurrences of a given motif. Bioinform 27(7):1017\u0026ndash;1018. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btr064\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btr064\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuarnizo \u0026Aacute;L, Marqu\u0026eacute;s-G\u0026aacute;lvez JE, Arenas F, NavarroR\u0026oacute;enas A, Morte A (2025) Morphological and molecular development of \u003cem\u003eTerfezia claveryi\u003c/em\u003e ectendomycorrhizae exhibits three well-defined stages. Mycorrhiza 35:31. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-025-01205-8\u003c/span\u003e\u003cspan address=\"10.1007/s00572-025-01205-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuti\u0026eacute;rrez A, Morte A, Honrubia M (2003) Morphological characterization of the mycorrhiza formed by \u003cem\u003eHelianthemum almeriense\u003c/em\u003e Pau with \u003cem\u003eTerfezia claveryi\u003c/em\u003e Chatin and \u003cem\u003ePicoa lefebvrei\u003c/em\u003e. (Pat) Maire Mycorrhiza 13:299\u0026ndash;307. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-003-0236-7\u003c/span\u003e\u003cspan address=\"10.1007/s00572-003-0236-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoffmann B, Wanke C, Lapaglia SK, Braus GH (2000) c-Jun and RACK1 homologues regulate a control point for sexual development in \u003cem\u003eAspergillus nidulans\u003c/em\u003e. Mol Microbiol 37(1):28\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-2958.2000.01954.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-2958.2000.01954.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolmberg S, Schjerling P (1996) Cha4p of \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e activates transcription via serine/threonine response elements. Genetics 144(2):467\u0026ndash;478. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/genetics/144.2.467\u003c/span\u003e\u003cspan address=\"10.1093/genetics/144.2.467\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoshida H, Kondo M, Kobayashi T, Yarimizu T, Akada R (2017) 5\u0026acute;-UTR introns enhance protein expression in the yeast \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e. Appl Microbiol Biotechnol 101:241\u0026ndash;251. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00253-016-7891-z\u003c/span\u003e\u003cspan address=\"10.1007/s00253-016-7891-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuzurbazar S, Kolesov G, Massey SE, Harris KC, Churbanov A, Liberles DA (2010) Lineage-specific differences in the amino acid substitution process. J Mol Biol 396(5):1410\u0026ndash;1421. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jmb.2009.11.075\u003c/span\u003e\u003cspan address=\"10.1016/j.jmb.2009.11.075\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIdnurm A, Walton FJ, Floyd A et al (2008) Identification of the sex genes in an early diverged fungus. Nature 451:193\u0026ndash;196. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature06453\u003c/span\u003e\u003cspan address=\"10.1038/nature06453\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIllerg\u0026aring;rd K, Ardell DH, Elofsson A (2009) Structure is three to ten times more conserved than sequence-A study of structural response in protein cores. Proteins 77(3):499\u0026ndash;508. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/prot.22458\u003c/span\u003e\u003cspan address=\"10.1002/prot.22458\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJacquemyn H, Waud M, Merckx VS, Lievens B, Brys R (2015) Mycorrhizal diversity, seed germination and long-term changes in population size across nine populations of the terrestrial orchid \u003cem\u003eNeottia ovata\u003c/em\u003e. Mol Ecol 24(13):3269\u0026ndash;3280. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/mec.13236\u003c/span\u003e\u003cspan address=\"10.1111/mec.13236\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (2014) Desert truffles: phylogeny, physiologu, distribution and domestication. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-642-40096-4\u003c/span\u003e\u003cspan address=\"10.1007/978-3-642-40096-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim W, Cavinder B, Proctor RH, O\u0026rsquo;Donnell K, Townsend JP, Trail F (2019a) Comparative genomics and transcriptomics during sexual development gives insight into the life history of the cosmopolitan fungus \u003cem\u003eFusarium neocosmosporiellum\u003c/em\u003e. Front Microbiol 10:1247. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2019.01247\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2019.01247\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim D, Paggi JM, Park C, Bennet C, Salzberg SL (2019b) Graph-based genome alignment and genotyping with HISAT2 and HISAT-genotype. Nat Biotechnol 37(8):907\u0026ndash;915. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41587-019-0201-4\u003c/span\u003e\u003cspan address=\"10.1038/s41587-019-0201-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoering CE, Fourel G, Binet-Brasselet E, Laroche T, Klein F, Gilson E (2000) Identification of high affinity Tbf1p-binding sites within the budding yeast genome. Nucleic Acids Res 28(13):2519\u0026ndash;2526. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/nar/28.13.2519\u003c/span\u003e\u003cspan address=\"10.1093/nar/28.13.2519\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKosakovsky Pond SL, Frost SD (2005) Not so different after all: a comparison of methods for detecting amino acid sites under selection. Mol Biol Evol 22:1208\u0026ndash;1222. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msi105\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msi105\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLe Tacon F, Zeller B, Plain C, Hossann C, Br\u0026eacute;chet C, Robin C (2013) Carbon transfer from the host to \u003cem\u003eTuber melanosporum\u003c/em\u003e mycorrhizas and ascocarps followed using a 13C pulse-labeling technique. PLoS ONE 8(5):e64626. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0064626\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0064626\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee J, Lee T, Lee YW, Yun SH, Turgeon BG (2003) Shifting fungal reproductive mode by manipulation of mating-type genes: obligatory heterothallism of \u003cem\u003eGibberella zeae\u003c/em\u003e. Mol Microbiol 50(1):145\u0026ndash;152. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-2958.2003.03694.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-2958.2003.03694.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLenth R (2025) emmeans: Estimated marginal means, aka least-squares means. R package version 1.11.0. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://CRAN.R-project.org/package=emmeans\u003c/span\u003e\u003cspan address=\"https://CRAN.R-project.org/package=emmeans\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiko D, Conway MK, Grunwald DS, Heideman W (2010) Stb3 plays a role in the glucose-induced transition from quiescence to growth in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e. Genetics 185(3):797\u0026ndash;810. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1534/genetics.110.116665\u003c/span\u003e\u003cspan address=\"10.1534/genetics.110.116665\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu L, Roberts GG, Oszust C, Hudson AP (2005) The YJR127C/\u003cem\u003eZMS1\u003c/em\u003e gene product is involved in glycerol-based respiratory growth of the yeast \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e. Curr Genet 48(4):235\u0026ndash;246. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00294-005-0023-4\u003c/span\u003e\u003cspan address=\"10.1007/s00294-005-0023-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMandel S, Robzyk K, Kassir Y (1994) IME1 gene encodes a transcription factor which is required to induce meiosis in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e. Dev Biol 15(2):139\u0026ndash;147. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/dvg.1020150204\u003c/span\u003e\u003cspan address=\"10.1002/dvg.1020150204\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarqu\u0026eacute;s-G\u0026aacute;lvez JE, Miyauchi S, Paolocci F et al (2021) Desert truffle genomes reveal their reproductive modes and new insights into plant-fungal interaction and ectendomycorrhizal lifestyle. New Phytol 229(5):2917\u0026ndash;2932. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.17044\u003c/span\u003e\u003cspan address=\"10.1111/nph.17044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarshall OJ (2004) PerlPrimer: cross-platform, graphical primer design for standard, bisulphite and real-time PCR. Bioinform 20(15):2471\u0026ndash;2472. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/bth254\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/bth254\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin T, Lu SW, van Tilbeurgh H et al (2010) Tracing the origin of the fungal α1 domain places its ancestor in the HMG-box superfamily: implication for fungal mating-type evolution. PLoS ONE 5(12):e15199. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0015199\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0015199\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMart\u0026iacute;nez-Tom\u0026eacute; M, Maggi L, Jim\u0026eacute;nez-Monreal AM, Murcia MA, Tom\u0026aacute;s Mar\u0026iacute; JA (2014) Nutritional and antioxidant properties of \u003cem\u003eTerfezia\u003c/em\u003e and \u003cem\u003ePicoa\u003c/em\u003e. In: Kagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (eds) Desert Truffles. Springer, Berlin, pp 261\u0026ndash;273\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMenezes RA, Amaral C, Delaunay A, Toledano M, Rodrigues-Pousada (2004) Yap8p activation in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e under arsenic conditions. FEBS Lett 566(1\u0026ndash;3):141\u0026ndash;146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.febslet.2004.04.019\u003c/span\u003e\u003cspan address=\"10.1016/j.febslet.2004.04.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMessenguy F, Dubois E (1993) Genetic evidence for a role for MCM1 in the regulation of arginine metabolism in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e. Mol Cell Biol 13(4):2586\u0026ndash;2592. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/mcb.13.4.2586-2592.1993\u003c/span\u003e\u003cspan address=\"10.1128/mcb.13.4.2586-2592.1993\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolinier V, Murat C, Baltensweiler A et al (2016) Fine-scale genetic structure of natural \u003cem\u003eTuber aestivum\u003c/em\u003e sites in southern Germany. Mycorrhiza 26(8):895\u0026ndash;907. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-016-0719-y\u003c/span\u003e\u003cspan address=\"10.1007/s00572-016-0719-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorte A, Kagan-Zur V, Navarro-R\u0026oacute;denas A, Sitrit Y (2021) Cultivation of Desert Truffles - A Crop Suitable for Arid and Semi-Arid Zones. Agronomy 11:1462. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/agronomy11081462\u003c/span\u003e\u003cspan address=\"10.3390/agronomy11081462\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorte A, Lovisolo C, Schubert A (2000) Mycorrhiza Effect of drought stress on growth and water relations of the mycorrhizal association \u003cem\u003eHelianthemum almeriense-Terfezia claveryi\u003c/em\u003e. Mycorrhiza 10:115\u0026ndash;119. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s005720000066\u003c/span\u003e\u003cspan address=\"10.1007/s005720000066\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorte A, Zamora M, Guti\u0026eacute;rrez A, Honrubia M (2009) Desert truffle cultivation in semiarid Mediterranean areas. In: Azc\u0026oacute;n-Aguilar C, Barea J, Gianinazzi S, Gianinazzi-Pearson V (eds) Mycorrhizas - functional processes and ecological impact. Springer, Berlin/Heidelberg, pp 495\u0026ndash;505\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurat C, Rubini A, Riccioni C et al (2013) Fine-scale spatial genetic structure of the black truffle (\u003cem\u003eTuber melanosporum\u003c/em\u003e) investigated with neutral microsatellites and functional mating type genes. New Phytol 199(1):176\u0026ndash;187. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/nph.12264\u003c/span\u003e\u003cspan address=\"10.1111/nph.12264\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan X, Heitman J (2000) Sok2 regulates yeast pseudohyphal differentiation via a transcription factor cascade that regulates cell-cell adhesion. Mol Cell Biol 20(22):8364\u0026ndash;8372. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/MCB.20.22.8364-8372.2000\u003c/span\u003e\u003cspan address=\"10.1128/MCB.20.22.8364-8372.2000\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePaolocci F, Rubini A, Riccioni C, Arcioni S (2006) Reevaluation of the life cycle of \u003cem\u003eTuber magnatum\u003c/em\u003e. Appl Environ Microbiol 72(4):2390\u0026ndash;2393. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/AEM.72.4.2390-2393.2006\u003c/span\u003e\u003cspan address=\"10.1128/AEM.72.4.2390-2393.2006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePettersen EF, Goddard TD, Huang CC et al (2004) UCSF Chimera-A visualization system for exploratory research and analysis. J Comput Chem 25(13):1605\u0026ndash;1612. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcc.20084\u003c/span\u003e\u003cspan address=\"10.1002/jcc.20084\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePierce M, Benjamin KR, Montano SP, Georgiadis MM, Winter E, Vershon AK (2003) Sum1 and Ndt80 proteins compete for binding to middle sporulation element sequences that control meiotic gene expression. Mol Cell Biol 23(14):4814\u0026ndash;4825. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/MCB.23.14.4814-4825.2003\u003c/span\u003e\u003cspan address=\"10.1128/MCB.23.14.4814-4825.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePosit team (2024) RStudio: Integrated development environment for R. Posit Software. PBC, Boston, MA. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.posit.co/\u003c/span\u003e\u003cspan address=\"http://www.posit.co/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaju NB (1992) Genetic control of the sexual cycle in \u003cem\u003eNeurospora.\u003c/em\u003e Mycol. Res 96:241\u0026ndash;262\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobinson JT, Thorvaldsd\u0026oacute;ttir H, Winckler W et al (2011) Integrative genomics viewer. Nat Biotechnol 29(1):24\u0026ndash;26. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nbt.1754\u003c/span\u003e\u003cspan address=\"10.1038/nbt.1754\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRubini A, Belfiori B, Riccioni C et al (2011a) Isolation and characterization of MAT genes in the symbiotic ascomycete \u003cem\u003eTuber melanosporum\u003c/em\u003e. New Phytol 189(3):710\u0026ndash;722. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.2010.03492.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.2010.03492.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRubini A, Belfiori B, Riccioni C, Arcioni S, Martin F, Paolocci F (2011b) \u003cem\u003eTuber melanosporum\u003c/em\u003e: mating type distribution in a natural plantation and dynamics of strains of different mating types on the roots of nursery-inoculated host plants. New Phytol 189(3):723\u0026ndash;735. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.2010.03493.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.2010.03493.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRubini A, Riccioni C, Belfiori B, Paolocci F (2014) Impact of the competition between mating types on the cultivation of Tuber melanosporum: Romeo and Juliet and the matter of space and time. Mycorrhiza 24(1):19\u0026ndash;27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-013-0551-6\u003c/span\u003e\u003cspan address=\"10.1007/s00572-013-0551-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchoustra S, Rundle HD, Dali R, Kassen R (2010) Fitness-associated sexual reproduction in a filamentous fungus. Curr Biol 20(15):1350\u0026ndash;1355. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2010.05.060\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2010.05.060\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShavit E (2014) The history of desert truffle use. In: Kagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (eds) Desert Truffles. Springer, Berlin/Heidelberg, pp 3\u0026ndash;19\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShavit E, Shavit E (2014) The medicinal value of desert truffles. In: Kagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (eds) Desert Truffles. Springer, Berlin/Heidelberg, pp 283\u0026ndash;297\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSil A, Herskowitz I (1996) Identification of asymmetrically localized determinant, Ash1p, required for lineage-specific transcription of the yeast \u003cem\u003eHO\u003c/em\u003e gene. Cell 84(5):711\u0026ndash;722. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0092-8674(00)81049-1\u003c/span\u003e\u003cspan address=\"10.1016/S0092-8674(00)81049-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSolovyev V, Kosarev P, Seledsov I, Vorobyev D (2006) Automatic annotation of eukaryotic genes, pseudogenes and promoters. Genome Biol 7(1):S10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/gb-2006-7-s1-s10\u003c/span\u003e\u003cspan address=\"10.1186/gb-2006-7-s1-s10\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSze JY, Woontner M, Jaehning JA, Kohlhaw GB (1992) In vitro transcriptional activation by a metabolic intermediate: activation by Leu3 depends on alpha-isopropylmalate. Science 258(5085):1143\u0026ndash;1145. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1439822\u003c/span\u003e\u003cspan address=\"10.1126/science.1439822\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTalley SM, Coley PD, Kursar TA (2002) The effects of weather on fungal abundance and richness among 25 communities in the Intermountain West. BMC Ecol 2:7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1472-6785-2-7\u003c/span\u003e\u003cspan address=\"10.1186/1472-6785-2-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura K, Stecher G, Kumar S (2021) MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol Biol Evol 38:3022\u0026ndash;3027. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msab120\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msab120\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTejedor-Calvo E, Amara K, Reis FS et al (2021) Chemical composition and evaluation of antioxidant, antimicrobial and antiproliferative activities of \u003cem\u003eTuber\u003c/em\u003e and \u003cem\u003eTerfezia\u003c/em\u003e truffles. Food Res Int 140:110071. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.foodres.2020.110071\u003c/span\u003e\u003cspan address=\"10.1016/j.foodres.2020.110071\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThapar R (2015) Structure-specific nucleic acid recognition by L-motifs and their diverse roles in expression and regulation of the genome. Biochim Biophys Acta 1849(6):677\u0026ndash;687. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbagrm.2015.02.006\u003c/span\u003e\u003cspan address=\"10.1016/j.bbagrm.2015.02.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eToone WM, Johnson AL, Banks GR et al (1995) Rme1, a negative regulator of meiosis, is also a positive activator of G1 cyclin gene expression. EMBO J 14(23):5824\u0026ndash;5832. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/j.1460-2075.1995.tb00270.x\u003c/span\u003e\u003cspan address=\"10.1002/j.1460-2075.1995.tb00270.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeaver S, Shank SD, Spielman SJ et al (2018) Datamonkey 2.0: A modern web application for characterizing selective and other evolutionary processes. Mol Biol Evol 35:773\u0026ndash;777. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msx335\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msx335\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhite TJ, Bruns TD, Lee SB, Taylor JW (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR Protocols: A Guide to Methods and Applications. Academic, New York, pp 315\u0026ndash;322\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWickham H (2016) Data analysis. ggplot2: elegant graphics for data analysis. Springer International Publishing, Cham, pp 189\u0026ndash;201. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-319-24277-4_9\u003c/span\u003e\u003cspan address=\"10.1007/978-3-319-24277-4_9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWiederrecht G, Seto D, Parker CS (1988) Isolation of the gene encoding the \u003cem\u003eS. cerevisiae\u003c/em\u003e heat shock transcription factor. Cell 54(6):841\u0026ndash;853. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0092-8674(88)91197-X\u003c/span\u003e\u003cspan address=\"10.1016/S0092-8674(88)91197-X\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilliams CJ, Headd JJ, Moriarty NW et al (2018) MolProbity: More and better reference data for improved all-atom structure validation. Protein Sci 27(1):293\u0026ndash;315. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/pro.3330\u003c/span\u003e\u003cspan address=\"10.1002/pro.3330\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilson AM, Wilken PM, Wingfield MJ, Wingfield BD (2021) Genetic Networks That Govern Sexual Reproduction in the Pezizomycotina. Microbiol Mol Biol Rev 85(4):e00020\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1128/MMBR.00020-21\u003c/span\u003e\u003cspan address=\"10.1128/MMBR.00020-21\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie J, Pierce M, Gailus-Durner V, Wagner M, Winter E, Vershon AK (1999) Sum1 and Hst1 repress middle sporulation-specific gene expression during mitosis in \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e. EMBO J 18(22):6448\u0026ndash;6454. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/emboj/18.22.6448\u003c/span\u003e\u003cspan address=\"10.1093/emboj/18.22.6448\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu J, Zhang Y (2010) How significant is a protein structure similarity with TM-score\u0026thinsp;=\u0026thinsp;0.5? Bioinform 26(7):889\u0026ndash;895. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btq066\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btq066\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamazaki T, Ichihara K, Suzuki R et al (2017) Genomic structure and evolution of the mating type locus in the green seaweed \u003cem\u003eUlva partita\u003c/em\u003e. Sci Rep 7:11679. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-017-11677-0\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-11677-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYampolsky LY, Stoltzfus A (2005) The exchangeability of amino acids in proteins. Genetics 170(4):1459\u0026ndash;1472. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1534/genetics.104.039107\u003c/span\u003e\u003cspan address=\"10.1534/genetics.104.039107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoder OC, Valent B, Chumley FG (1986) Genetic nomenclature and practice for plant pathogenic fungi. Phytopathology 76:383\u0026ndash;385. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1094/Phyto-76-383\u003c/span\u003e\u003cspan address=\"10.1094/Phyto-76-383\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYonkovich J, McKenndry R, Shi X, Zhu Z (2002) Copper ion-sensing transcription factor Mac1p post-translationally controls the degradation of its target gene product Ctr1p. J Biol Chem 277(27):23981\u0026ndash;23984. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.C200203200\u003c/span\u003e\u003cspan address=\"10.1074/jbc.C200203200\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZambonelli A, Donnini D, Rana GL et al (2014) Hypogeous Fungi in Mediterranean Maquis, Arid and Semi-Arid Forests. Plant Biosyst 148(2):392\u0026ndash;401. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/11263504.2013.877537\u003c/span\u003e\u003cspan address=\"10.1080/11263504.2013.877537\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZitouni-Haouar FEH, Fortas Z, Chevalier G (2014) Morphological characterization of mycorrhizae formed between three \u003cem\u003eTerfezia\u003c/em\u003e species (desert truffles) and several \u003cem\u003eCistaceae\u003c/em\u003e and Aleppo pine. Mycorrhiza 24:397\u0026ndash;403. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00572-013-0550-7\u003c/span\u003e\u003cspan address=\"10.1007/s00572-013-0550-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKagan-Zur V, Roth-Bejerano N, Sitrit Y, Morte A (2014) Desert truffles: phylogeny, physiologu, distribution and domestication. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-642-40096-4\u003c/span\u003e\u003cspan address=\"10.1007/978-3-642-40096-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"mycorrhiza","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcor","sideBox":"Learn more about [Mycorrhiza](http://link.springer.com/journal/572)","snPcode":"572","submissionUrl":"https://submission.nature.com/new-submission/572/3","title":"Mycorrhiza","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Ascomycota, desert truffle, mycorrhiza, arid ecosystems, heterothallism, sexual reproductive system","lastPublishedDoi":"10.21203/rs.3.rs-8367999/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8367999/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eTerfezia claveryi\u003c/em\u003e is a hypogeous fungus that forms desert truffles through ectendomycorrhizal symbiosis with Cistaceae plants in arid and semiarid environments. The study presented herein elucidates the organization and structure of the the mating type (\u003cem\u003eMAT\u003c/em\u003e) locus in this species and the spatio-temporal dynamics of \u003cem\u003eT. claveryi\u003c/em\u003e strains in \u003cem\u003eH. almeriense\u003c/em\u003e mychorrizal plants and rhizospheric soil from nursery to field. \u003cem\u003eMAT\u003c/em\u003e genes are the master loci controlling sexual reproduction and development in fungi. Our findings demonstrate that \u003cem\u003eT. claveryi\u003c/em\u003e is a haploid and heterothallic species as its strains harbor and express either \u003cem\u003eTcMAT1-1-1\u003c/em\u003e or \u003cem\u003eTcMAT1-2-1\u003c/em\u003e genes as revealed by genome sequencing and RNAseq analyses. DNA-binding motifs located in their respective promoter regions appear to play a major role in the regulation of reproductive processes. The α-box and HMG-box domains are highly conserved along the Pezizomycetes and their strong structural similarity despite its poor sequence similarity supports a common evolutionary origin. Moreover, we set out a PCR-based approach to monitor the dynamics of \u003cem\u003eT. claveryi\u003c/em\u003e strains of opposite mating type on mychorrizal plants and soil. \u003cem\u003eT. claveryi\u003c/em\u003e mycorrhizal plants at the nursery stage present strains of both mating types, whereas a notable dominance of strains with the \u003cem\u003eTcMAT1-1-1\u003c/em\u003e gene was observed in field stage. Altogether, this research provides insights about genetic regulation and evolution of the \u003cem\u003eMAT\u003c/em\u003e locus within the Pezizomycetes, and the reproductive biology of this important desert truffle, along with reliable markers to track the spatio-temporal distribution of strains of opposite mating types.\u003c/p\u003e","manuscriptTitle":"Terfezia claveryi MAT locus characterization uncovers evolutionary insights about sexual reproduction of Pezizomycetes and reveals mating type dynamics in mycorrhizal plants.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-19 18:11:13","doi":"10.21203/rs.3.rs-8367999/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-01-30T11:43:53+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-30T09:40:49+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-14T12:33:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"336359139324895163508891706464630054513","date":"2025-12-22T17:23:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"106681128121128500095579316393673511206","date":"2025-12-17T14:58:22+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-17T14:50:33+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-17T14:20:54+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-17T13:09:08+00:00","index":"","fulltext":""},{"type":"submitted","content":"Mycorrhiza","date":"2025-12-15T15:16:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"mycorrhiza","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcor","sideBox":"Learn more about [Mycorrhiza](http://link.springer.com/journal/572)","snPcode":"572","submissionUrl":"https://submission.nature.com/new-submission/572/3","title":"Mycorrhiza","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e38d6b20-b32c-492b-a7d1-1868a9c22cb5","owner":[],"postedDate":"December 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-27T08:56:04+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-19 18:11:13","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8367999","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8367999","identity":"rs-8367999","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.