Expression analysis of PPARα in skeletal muscle of mice at different developmental stages

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background Peroxisome proliferator-activated receptors (PPARs) belonging to the nuclear receptor family function as transcription factors. PPARα, an initial subtype of PPARs, is predominantly involved in lipid oxidation. The existing research on PPARα mostly focuses on its regulation on metabolism and inflammation in skeletal muscle. However, whether PPARα participates in skeletal muscle development remains largely unknown. Therefore, this study aims to explore the effect of PPARα on mouse skeletal muscle development by investigating the expression of PPARα in skeletal muscle of mice at different ages. Results The results of Western blot assay, quantitative real-time polymerase chain reaction (qRT-PCR), and immunofluorescence assay indicated the differences in the expression levels of PPARα in gastrocnemius muscle among different ages of mice. Specifically, young mice exhibited the highest expression of PPARα in their gastrocnemius muscle, whereas aged mice displayed its lowest expression. Furthermore, the immunofluorescence results showed that PPARα was expressed in both the nucleus and the cytoplasm. Conclusions Overall, PPARα was expressed in skeletal muscle of mice at different developmental stages, but the expression levels varied. Our findings lay a foundation for the further functional study of PPARα in skeletal muscle development.
Full text 77,244 characters · extracted from preprint-html · click to expand
Expression analysis of PPARα in skeletal muscle of mice at different developmental stages | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Expression analysis of PPARα in skeletal muscle of mice at different developmental stages Jiahui Qi, Minxing Zheng, Hao Xing, Xuanjing Wang, Haiyang Wu, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4681771/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Peroxisome proliferator-activated receptors (PPARs) belonging to the nuclear receptor family function as transcription factors. PPARα, an initial subtype of PPARs, is predominantly involved in lipid oxidation. The existing research on PPARα mostly focuses on its regulation on metabolism and inflammation in skeletal muscle. However, whether PPARα participates in skeletal muscle development remains largely unknown. Therefore, this study aims to explore the effect of PPARα on mouse skeletal muscle development by investigating the expression of PPARα in skeletal muscle of mice at different ages. Results The results of Western blot assay, quantitative real-time polymerase chain reaction (qRT-PCR), and immunofluorescence assay indicated the differences in the expression levels of PPARα in gastrocnemius muscle among different ages of mice. Specifically, young mice exhibited the highest expression of PPARα in their gastrocnemius muscle, whereas aged mice displayed its lowest expression. Furthermore, the immunofluorescence results showed that PPARα was expressed in both the nucleus and the cytoplasm. Conclusions Overall, PPARα was expressed in skeletal muscle of mice at different developmental stages, but the expression levels varied. Our findings lay a foundation for the further functional study of PPARα in skeletal muscle development. Biological sciences/Biochemistry Biological sciences/Cell biology Biological sciences/Developmental biology Biological sciences/Molecular biology Biological sciences/Physiology PPARα expression skeletal muscle development mice Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1 Introduction Skeletal muscles, as the largest muscle tissue in animals, account for about 40% of the total weight of healthy animals. In addition to support and exercise functions, they are also the main tissues that consume energy (Frontera et al. , 2015). Skeletal muscle functions are closely related to types of muscle fibers, and the growth and development of muscle fibers mainly rely on the proliferation and differentiation of muscle cells (Schiaffino et al. , 2011). Accordingly, skeletal muscle-related diseases are intimately linked to the growth and development processes of muscle cells (Lim et al. , 2023). The investigation of skeletal muscle is of great significance for elevating the economic value of animals and promoting the development of animal husbandry. PPARα, as a subtype of peroxisome proliferators activated receptors (PPAR), is mainly expressed in high-energy tissues including skeletal muscles (Yagai et al. , 2022). As a metabolic nuclear receptor, PPARα plays a crucial role in regulating systemic metabolic homeostasis (Tahri-Joutey et al., 2021 ), and its expression changes are observed in many diseases caused by lipid metabolism disorders (Wang et al., 2021 ). PPAR subtypes are important in metabolism and body energy homeostasis (Lamichane et al., 2018 ), and PPARα has been reported to be involved in regulating fatty acid intake, β oxidation, and ω oxidation (Staels et al. , 1997). PPARα is activated in a fasting state of mice, and it is involved in regulating glucose homeostasis through the AMP-activated protein kinase (AMPK) and rapamycin target protein (mTOR) signalling pathways (Grabacka et al., 2016 ). After being activated, PPARα can improve the expression of pyruvate dehydrogenase kinase 4 (PDK4), thereby regulating blood sugar content(Yamaguchi et al., 2018 ).In addition, PPARα can also regulate liver size and liver regeneration by activating the YAP-TEAD signaling pathway (Fan et al., 2022 ), and PPARα can mediate the regulation of lipid metabolism by mTORC2, thereby promoting liver regeneration (Zhang et al., 2022 ). PPARα, a key transcription factor, has been demonstrated to facilitate the healing of endothelial cell damage by enhancing the expression of CCL14 in human umbilical vein endothelial cells (Choi et al. , 2013). These above findings jointly indicate that PPARα also plays an indispensable role in tissue regeneration. Skeletal muscle-related research reveals that PPARα can prevent skeletal muscle atrophy caused by liver cancer-induced anorexic cachexia syndrome (Goncalves et al., 2018 ), suggesting that PPARα regulates skeletal muscle mass through the liver muscle axis. The effects of PPARα on skeletal muscle atrophy and inflammation have been widely reported. Previous studies have demonstrated that PPARα is key gene in skeletal muscle antioxidation and anti-inflammation pathways (Lettieri Barbato et al., 2014a ); (Lettieri Barbato et al., 2014b ), (Aquilano et al., 2016 ). Generally, the existing studies of PPARα are mostly focused on its effect on glycolipid metabolism, and the skeletal muscle-related research mainly focuses on the effect of PPARα on energy metabolism and inflammation. However, there is lack of the research on the role of PPARα in skeletal muscle development. The purpose of our study is to reveal the expression characteristics of PPARα at different development stages of skeletal muscle in vivo . The results showed pronounced differences in the expression levels of PPARα in skeletal muscle in different age groups. Specifically, juvenile mice exhibited the highest skeletal muscle content, whereas aged mice displayed the lowest. Our results demonstrated the potential important role of PPARα in skeletal muscle development. Our findings lay a foundation for the further exploration of functions and mechanisms of PPARα in skeletal muscle development. 2 Results 2.1 Morphological changes in gastrocnemius muscle of young, adult, and aged mice To investigate the morphological alterations in skeletal muscles throughout mouse various developmental stages, Hematoxylin and Eosin (HE) staining was performed to visualize the skeletal muscle morphology. The results revealed a reduction in the cross-sectional area of the gastrocnemius muscle with increasing age. The young mice displayed a dense muscle fiber arrangement (Fig. 1 (a)), adult mice exhibited a less dense arrangement (Fig. 1 (b)), whereas aged mice exhibited loose arrangement (Fig. 1 (c)). 2.2 Immunofluorescence assay of P21 and P53 in skeletal muscle and changes in their expressions in skeletal muscle at mouse different age stages Further, we performed immunofluorescence staining of cell cycle and apoptosis markers P21 and P53 from the gastrocnemius muscle of young, adult, and aged mice to investigate their expression levels. Immunofluorescence staining results showed that P21 and P53 were expressed in skeletal muscle at all age stages, and as age increased, the expression levels of P21 and P53 in skeletal muscle gradually increased. The expression levels of P21 and P53 were highest in the gastrocnemius muscle of aged mice, which was consistent with the impact of aging on them. Both P21 and P53 were expressed in the nuclei of skeletal muscle. Overall, the expression levels of these two proteins were increased in skeletal muscle with increasing age (Fig. 2 ). 2.3 Expression verification of PPARα in skeletal muscle by PCR To explore the role of PPARα in skeletal muscle development, we initially investigated the expression of PPARα in skeletal muscle tissue. PPARα has been reported to be highly expressed in the liver (Tahri-Joutey et al., 2021 ). To examine whether of PPARα was expressed in skeletal muscle, we used liver cDNA as a positive control. The electrophoresis results showed that the PPARα band corresponding to the gastrocnemius muscle was clear without tailing (Fig. 3 ), verifying the expression of PPARα in the gastrocnemius muscle of mice. 2.4 Expression of PPARα mRNA in gastrocnemius muscle of mice at different age stages Real-time quantitative PCR (qRT-PCR) results showed that the mRNA expression of PPARα in the gastrocnemius muscle of young, adult, and aged mice exhibited a gradually decreasing trend. Specifically, the young mice exhibited significantly higher mRNA expression level than aged mice (P 0.05) (Fig. 4 ). The results showed that the mRNA expression of PPARα decreased with increasing age. 2.5 Expression level of PPARα protein in gastrocnemius muscle of mice at different age stages by Western blot We detected the protein expression of PPARα in the gastrocnemius muscle of young, adult, and aged mice through Western blot. PPARα showed a higher expression level in the gastrocnemius muscle of young mice than that of adult and aged mice, with a lowest expression level in gastrocnemius muscle of aged mice, suggesting a decreasing trend with increasing age (Fig. 5 ). 2.6 Immunofluorescence assay of PPARα expression in gastrocnemius muscle of mice at different age stages Immunofluorescence assay showed that PPARα was expressed in both the cytoplasm and the nucleus of gastrocnemius tissue sections. There were more positive areas in the gastrocnemius muscle of young mice than that of adult mice, with the least positive areas in aged mice, further confirming that PPARα expression level was decreased with increasing age (Fig. 6 ). 3 Discussion Skeletal muscle is one of the large tissues in the body, accounting for about 40% of the total body weight. In addition to supporting movement, it also plays an important role in regulating energy metabolism in the body (Manickam et al., 2020 ). However, many factors including age, muscle fiber type, and exercise, and diet habits can affect the quality and function of skeletal muscles. PPARα is a transcription factor modulating the expression of genes responsible for fatty acid transport and oxidation. (Tahri-Joutey et al., 2021 ), and it is widely present in animal skeletal muscles. One previous study has indicated that PPARα expression in skeletal muscles significantly increases after aerobic exercise (Manio et al., 2017 ). PPARα has been reported to affect the expression of inflammation-related cytokines in skeletal muscle (Cabral-Santos et al., 2020 ), and the expression of PPARα in the myocardium, liver, and skeletal muscles of aged mice is much lower than that of young mice (Börsch et al., 2021 ); (Atherton et al., 2009 ). These existing research suggests that PPARα may have a certain effect on the quality of skeletal muscle. Fasting has been reported to affect the expression of PPARα in the liver and skeletal muscles (Bazhan et al., 2019 ), and its downstream FGF21 in the liver has been found to affect skeletal muscle atrophy under fasting conditions (Oost et al., 2019 ). Usually, age and diet habits have effect on skeletal muscle mass, and thus we investigated the change of PPARα expression in skeletal muscle with age. In this study, we found that the expression of PPARα in the skeletal muscle of mice was decreased with increasing age, but the expression levels of aging markers P21 and P53 were increased with increasing age. The higher expression of PPARα in the skeletal muscle of young mice than that of aged mice indicated that PPARα had an impact on skeletal muscle development. 4 Conclusion In summary, PPARα was expressed in the gastrocnemius muscle of mice at different age stages, exhibiting significant differences in expression levels among different ages of mice. Expression of PPARα was the highest in young mice and the lowest in aged mice. PPARα was expressed in both the cytoplasm and the nucleus. Our findings lay a foundation for further research on PPARα and understanding its relationship with skeletal muscle development. 5 Materials and methods 5.1 Sample collection. C57BL/6 mice including young mice (6–8 weeks), adult mice (3–4 months) and aged mice (18–20 months) were purchased from the Experimental Animal Center of Shanxi Provincial People’s Hospital (Taiyuan, Shanxi, China). They were healthy with no genetic modification or any previous procedures. All mice were given access to food and water freely under 12 h light/dark cycles. All animal care and experimental protocols were performed in accordance with the guide for the Animal Management Rule of the Ministry of Health, People’s Republic of China, and approved by the Animal Medicine Committee of Shanxi Agricultural University. Euthanasia of animals was implemented by using cervical dislocation. Gastrocnemius muscles were collected from each mouse, with left leg gastrocnemius muscle flash-frozen in liquid nitrogen and stored in a ‒80°C for RNA and protein extraction. The right leg gastrocnemius muscle with tendon was fixed in 4% paraformaldehyde solution for 24–36 h for subsequent HE staining and immunofluorescence assay. 5.2 HE staining After fixation, mouse gastrocnemius muscle samples were embedded in paraffin and sliced into 7µm by a microtome (CM1850, Leica). The HE staining was performed following the manufacturers’ instructions. The HE staining images of gastrocnemius muscle sections were captured with an ECLIPSE Ts2R (Nikon, China) microscope. 5.3 Polymerase chain reaction (PCR) Polymerase chain reaction (PCR) was performed in a 10 µL reaction system containing 1 µL cDNA template, 3.2 µL DEPC water, 5 µL Mix, 0.4 µL the upstream primer, and 0.4 µL downstream primers, with DEPC (diethyl pyrocarbonate) water as the negative control, liver tissue cDNA as the positive control, and gastrocnemius muscle tissue cDNA as detection target. The upstream primer sequence of PPARα was CCTCAGGGTACCACTACGGA, and its downstream primer sequence was TTGCAGCTCCGATCACACTT. The PCR was performed as follows: pre-denaturation at 95 ℃ for 30 s, followed by 35 cycles of denaturation at 95 ℃ for 40 s, annealing at 60 ℃ for 30 s, and extension at 72 ℃ for 40 s. PCR products were subjected to 1% agarose gel electrophoresis. Briefly, 5 µL of DL500 DNA marker, 10 µL DEPC water, 10 µL liver tissue cDNA, 10 µL of gastrocnemius muscle tissue cDNA were added to the well, and electrophoresis was performed at 220V. 5.4 RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR) RNA was extracted from mouse gastrocnemius muscle using the Trizol reagent (TaKaRa Bio, Dalian, China), and reverse transcription of RNA was performed according to the instructions of the reverse transcription kit (TOLOBIO, Shanghai, China) to synthesize cDNA. The primers of PPARα and 36B4 were synthesized by Universal Biology (Anhui, China). Real-time fluorescence quantitative PCR (was performed in 10 µL total reaction system containing 4.4 µL cDNA (diluted 20 times with DEPC water), 5 µL SYBR Premix Ex Taq (Mona, Suzhou, China), 0.3 µL the upstream primer, and 0.3 µL downstream primer. The upstream primer sequence of PPARα was CCTCAGGGTACCACTACGGA, and its downstream primer sequence was TTGCAGCTCCGATCACACTT. The upstream primer sequence of 36B4 was ACTGAGATTCGGGATATGCTGT, and its downstream primer sequence was CCCACCTTGTCTCCAGTCTTTA. There were 7 biological replicates of each gastrocnemius muscle age group. The procedures of qRT PCR were as follows: pre-denaturation at 95 ° C for 1 min, followed by 40 cycles of denaturation at 95 ° C for 10 s and annealing at 60 ° C for 30 s, ending up with extension at 95 ° C for 15 s. The relative expression of PPARα was analyzed in different developmental stages of skeletal muscle using the 2-ΔΔCt method. 5.5 Western blot The protein was extracted from muscle tissues with RIPA buffer (Beyotime Biotechnology, Shang hai, China) containing protease and phosphatase inhibitors (Servicebio, China). Total protein concentration was determined using BCA protein assay kit (Beyotime Biotechnology, Shanghai, China). The proteins were subjected to SDS-PAGE electrophoresis, and the obtained proteins were transferred onto PVDF membranes by semi-dry transfer method (Trans-blot Turbo, Bio-Rad Laboratories) at 1 amp for 10 min. Afterwards, the PVDF membranes were blocked with 5% skim milk at 37 ℃ for 1 hour, incubated with PPARα antibody (23995-1-AP, Proteintech, Wuhan, China) and GAPDH (10494-1-AP, Proteintech) at 4 ℃ overnight. After being washed five times with TBST (Tris-buffered saline with 0.1% Tween 20), the membranes were incubated with either anti-mouse or anti-rabbit IgG HRP-linked secondary antibody (1:25000 dilution, Abclonal Technology, China). The protein bands were visualized using a chemiluminescence reagent (Beyotime Biotechnology, Shanghai, China). The quantitative analysis of protein bands was performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA). 5.6 Immunofluorescence assay Paraffin-fixed muscle sections were dewaxed by xylene and gradient alcohol, immersed in 1× sodium citrate antigen retrieval solution for antigen retrieval in a microwave oven, then naturally cooled to room temperature, washed with PBS solution (3×5min), blocked with dropwise added 3% goat serum at room temperature for 30min, rewashed again with PBS solution three times for 5 min per time (3×5 min), and incubated with added dropwise PPARα,P21 or P53 antibodies (diluted at 1:200) overnight at 4°C. Subsequently, muscle sections were rewarmed at room temperature for 30 min, rinsed with PBS solution (3×5 min), added with 0.025% fluorescent secondary antibody dropwise, incubated at room temperature in the dark for 1 h, then re-rinsed with PBS solution (3×5min), finally added with DAPI agent dropwise, and incubated in incubator with coverslip. The immunofluorescence images of muscle sections were captured with an ECLIPSE Ts2R (Nikon, China) microscope. 5.7 Statistical analysis All experimental data were analyzed and processed using GraphPad Prism 5.0 software, and the statistical difference among groups were determined using T-test. P < 0.05 was considered as statistically significant. Declarations Ethics approval and consent to participate This study was approved by the Animal Experimentation Ethics Committee of Shanxi Agricultural University, Taigu, China and all procedures involving animal treatment and sample collection were performed by veterinarians following the Guiding Principles for animal use described by the Council for International Organizations of Medical Sciences (CIOMS). Competing interests The authors declare that they have no competing interests. Ethical statement All animal protocols in this study were approved by Institutional Animal Care and Use Committee of Shanxi Agricultural University. The experiments are conducted in accordance with relevant guidelines and regulations. The study complied with ARRIVE guidelines. Funding This project was supported by the National Natural Science Foundation of China (No. 32102634), the Fundamental Research Program of Shanxi Province (No. 20210302124700, 202303021211092, 202103021223166), Shanxi Province Excellent Doctoral Work Award-Scientific Research Project (No. SXBYKY2021043, SXBYKY2022013, SXBYKY2022039), Start-up Fund for doctoral research, Shanxi Agricultural University (No.2021BQ08, 2021BQ69), Shanxi Provincial Graduate Education Innovation Project (No. 2023KY345), and the Fund for Shanxi“1331 Project”(20211331-16, 20211331-12). All authors read and approved the final manuscript. Author Contribution YY and HW: Conceptualization, Funding acquisition, Project administration. Jiahui Qi: Data Curation, Methodology, Writing-Original draft preparation. MZ: Methodology, Writing-Original draft preparation. HX: Software, Validation. XW: Methodology. HW: Date Curation. JL: Formal analysis. XL: Data Curation. XY: Resources. YY: Writing Review and Editing. Data Availability The data are available from the corresponding author on reasonable request. References Aquilano K., Baldelli, S., La Barbera, L., Lettieri Barbato, D., Tatulli, G., Ciriolo, M. R. (2016). Adipose triglyceride lipase decrement affects skeletal muscle homeostasis during aging through FAs-PPARα-PGC-1α antioxidant response. Oncotarget 7: 23019–23032. https://doi.org/10.18632/oncotarget.8552 Atherton H. J., Gulston, M. K., Bailey, N. J., Cheng, K. K., Zhang, W., Clarke, K., Griffin, J. L. (2009). Metabolomics of the interaction between PPAR-α and age in the PPAR‐α‐null mouse. Molecular Systems Biology 5: 259. https://doi.org/10.1038/msb.2009.18 . Bazhan N., Jakovleva, T., Feofanova, N., Denisova, E., Dubinina, A., Sitnikova, N., Makarova, E. (2019). Sex differences in liver, adipose tissue, and muscle transcriptional response to fasting and refeeding in mice. Cells 8: 1529. https://doi.org/10.3390/cells8121529 . Börsch A., Ham, D. J., Mittal, N., Tintignac, L. A., Migliavacca, E., Feige, J. N., Rüegg, M. A., Zavolan, M. (2021). Molecular and phenotypic analysis of rodent models reveals conserved and species-specific modulators of human sarcopenia. Communications Biology 4: 194. https://doi.org/10.1038/s42003-021-01723-z . Cabral-Santos C., Silveira, L. S., Chimin, P., Rosa-Neto, J. C., Lira, F. S. (2020). Moderate aerobic exercise-induced cytokines changes are disturbed in PPARα knockout mice. Cytokine 134: 155207. https://doi.org/10.1016/j.cyto.2020.155207 . Fan S. C., Gao, Y., Qu, A. J., Jiang, Y. M., Li, H., Xie, G. M., Yao, X. P., Yang, X., Zhu, S. G., Yagai, T., Tian, J., Wang, R. M., Gonzalez, F. J., Huang, M., Bi, H. C. (2022). YAP-TEAD mediates PPAR α–induced hepatomegaly and liver regeneration in mice. Hepatology 75: 74–88. https://doi.org/10.1002/hep.32105 . Frontera W. R., Ochala, J. (2015). Skeletal muscle: a brief review of structure and function. Calcified Tissue International 96: 183–195. https://doi.org/10.1007/s00223-014-9915-y . Goncalves M. D., Hwang, S.-K., Pauli, C., Murphy, C. J., Cheng, Z., Hopkins, B. D., Wu, D., Loughran, R. M., Emerling, B. M., Zhang, G., Fearon, D. T., Cantley, L. C. (2018). Fenofibrate prevents skeletal muscle loss in mice with lung cancer. Proceedings of the National Academy of Sciences 115: E743-E752. https://doi.org/10.1073/pnas.1714703115 . Grabacka M., Pierzchalska, M., Dean, M., Reiss, K. (2016). Regulation of ketone body metabolism and the role of PPARα. International Journal of Molecular Sciences 17: 2093. https://doi.org/10.3390/ijms17122093 . Lamichane S., Dahal Lamichane, B., Kwon, S.-M. (2018). Pivotal roles of peroxisome proliferator-activated receptors (PPARs) and their signal cascade for cellular and whole-body energy homeostasis. International Journal of Molecular Sciences 19: 949. https://doi.org/10.3390/ijms19040949 . Lettieri Barbato D., Aquilano, K., Baldelli, S., Cannata, S. M., Bernardini, S., Rotilio, G., Ciriolo, M. R. (2014a). Proline oxidase–adipose triglyceride lipase pathway restrains adipose cell death and tissue inflammation. Cell Death & Differentiation 21: 113–123. https://doi.org/10.1038/cdd.2013.137 . Lettieri Barbato D., Tatulli, G., Aquilano, K., Ciriolo, M. R. (2014b). Inhibition of age-related cytokines production by ATGL: a mechanism linked to the anti-inflammatory effect of resveratrol. Mediators of Inflammation 2014: 917698. https://doi.org/10.1155/2014/917698 . Lim J.-Y., Frontera, W. R. (2023). Skeletal muscle aging and sarcopenia: Perspectives from mechanical studies of single permeabilized muscle fibers. Journal of Biomechanics 152: 111559. https://www.sciencedirect.com/science/article/pii/S0021929023001288 . Manickam R., Duszka, K., Wahli, W. (2020). PPARs and microbiota in skeletal muscle health and wasting. International Journal of Molecular Sciences 21: 8056. https://doi.org/10.3390/ijms21218056 . Manio M. C. C., Matsumura, S., Masuda, D., Inoue, K. (2017). CD36 is essential for endurance improvement, changes in whole-body metabolism, and efficient PPAR-related transcriptional responses in the muscle with exercise training. Physiological Reports 5: e13282. https://doi.org/10.14814/phy2.13282 . Oost L. J., Kustermann, M., Armani, A., Blaauw, B., Romanello, V. (2019). Fibroblast growth factor 21 controls mitophagy and muscle mass. Journal of Cachexia, Sarcopenia and Muscle 10: 630–642. https://doi.org/10.1002/jcsm.12409 . Schiaffino S., Reggiani, C. (2011). Fiber types in mammalian skeletal muscles. Physiological Reviews 91: 1447–1531. https://doi.org/10.1152/physrev.00031.2010 . Staels B., Auwerx, J. (1997). Role of PPAR in the pharmacological regulation of lipoprotein metabolism by fibrates and thiazolidinediones. Current Pharmaceutical Design 3: 1–14. http://dx.doi.org/10.2174/138161280301221005122647 . Tahri-Joutey M., Andreoletti, P., Surapureddi, S., Nasser, B., Cherkaoui-Malki, M., Latruffe, N. (2021). Mechanisms mediating the regulation of peroxisomal fatty acid beta-oxidation by PPARα. International Journal of Molecular Sciences 22: 8969. https://doi.org/10.3390/ijms22168969 . Wang L., Cai, Y., Jian, L. G., Cheung, C. W., Zhang, L. Q., Xia, Z. Y. (2021). Impact of peroxisome proliferator-activated receptor-α on diabetic cardiomyopathy. Cardiovascular Diabetology 20: 2. https://doi.org/10.1186/s12933-020-01188-0 . Yagai T., Nakamura, T. (2022). Mechanistic insights into the peroxisome proliferator-activated receptor alpha as a transcriptional suppressor. Frontiers in Medicine 9. https://doi.org/10.3389/fmed.2022.1060244 . Yamaguchi S., Moseley, A. C., Almeda-Valdes, P., Stromsdorfer, K. L., Franczyk, M. P., Okunade, A. L., Patterson, B. W., Klein, S., Yoshino, J. (2018). Diurnal Variation in PDK4 Expression Is Associated With Plasma Free Fatty Acid Availability in People. The Journal of Clinical Endocrinology & Metabolism 103: 1068–1076. https://doi.org/10.1210/jc.2017-02230 . Zhang L. L., Li, Y. Q., Wang, Y., Qiu, Y. G., Mou, H. C., Deng, Y. Y., Yao, J. Y., Xia, Z. Q., Zhang, W. Z., Zhu, D., Qiu, Z. Y., Lu, Z. J., Wang, J. R., Yang, Z. X., Mao, G. X., Chen, D., Sun, L. M., Liu, L. M., Ju, Z. Y. (2022). mTORC2 facilitates liver regeneration through sphingolipid-induced PPAR-α-fatty acid oxidation. Cellular and Molecular Gastroenterology and Hepatology 14: 1311–1331. https://doi.org/10.1016/j.jcmgh.2022.07.011 . Additional Declarations No competing interests reported. Supplementary Files SupplementaryInformation.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4681771","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":330137136,"identity":"3da11182-866a-4ba4-a9dc-f6775b349044","order_by":0,"name":"Jiahui Qi","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jiahui","middleName":"","lastName":"Qi","suffix":""},{"id":330137138,"identity":"edf0c293-061d-4d85-8f14-d904359a7060","order_by":1,"name":"Minxing Zheng","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Minxing","middleName":"","lastName":"Zheng","suffix":""},{"id":330137140,"identity":"7f217c49-ba49-4c6a-b8e7-84e87953bc4b","order_by":2,"name":"Hao Xing","email":"","orcid":"","institution":"Shanxi Jinxiu Daxiang Farming Company Limited","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Xing","suffix":""},{"id":330137142,"identity":"2eeef54b-d071-4c8c-9e89-36043c06404c","order_by":3,"name":"Xuanjing Wang","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xuanjing","middleName":"","lastName":"Wang","suffix":""},{"id":330137143,"identity":"2c7d08ce-ec78-4c4e-87d1-a696091a6e14","order_by":4,"name":"Haiyang Wu","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Haiyang","middleName":"","lastName":"Wu","suffix":""},{"id":330137145,"identity":"48201683-5bb1-4c6d-aad2-885c77dc04c7","order_by":5,"name":"Jiayin Lu","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jiayin","middleName":"","lastName":"Lu","suffix":""},{"id":330137146,"identity":"c000a965-87fd-400d-a19e-05cce4a497d4","order_by":6,"name":"Xiaomao Luo","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiaomao","middleName":"","lastName":"Luo","suffix":""},{"id":330137147,"identity":"e04707d6-031a-434c-8f60-bfcdd4dc916d","order_by":7,"name":"Xiuju Yu","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xiuju","middleName":"","lastName":"Yu","suffix":""},{"id":330137148,"identity":"4a10b795-292c-47d2-b193-f27be2c37e36","order_by":8,"name":"Haidong Wang","email":"","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Haidong","middleName":"","lastName":"Wang","suffix":""},{"id":330137149,"identity":"8681cc26-2e5b-425d-adf2-64778e8cef88","order_by":9,"name":"Yi Yan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAxklEQVRIiWNgGAWjYLCChAoog4d4LWdI1sLYRooWg+Nnj0k8nFeX2D8jgfHB2zYGeXOCWs7kpUkkbjtsLHEjgdlwbhuD4c4GQloO5JgBtRyQY7iRwCbN28aQYHCAkJbzb4Ba5tTxyN9IYP9NnJYbIFsamOUMgLYwE6VF8sYbY4uEY4eNDc88bJacc07CcAMhLXzncwxv/qipS5x3PPnghzdlNvIEbVE4wMAiAWEyNgAJCQLqgUC+gYH5A2Flo2AUjIJRMKIBANRGQMoImfhcAAAAAElFTkSuQmCC","orcid":"","institution":"Shanxi Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Yi","middleName":"","lastName":"Yan","suffix":""}],"badges":[],"createdAt":"2024-07-03 16:21:01","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4681771/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4681771/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":61581940,"identity":"d1eff1c6-dae9-4c59-9fa3-a90465cc2925","added_by":"auto","created_at":"2024-08-01 13:38:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":4433867,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological changes of mouse gastrocnemius muscle at different age stages (a) Young mouse gastrocnemius muscle. (b) Adult mouse gastrocnemius muscle. (c) Aged mouse gastrocnemius muscle. Scale bar = 250 μm.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4681771/v1/f783070cfc47a27ac74b6bd6.png"},{"id":61581303,"identity":"0b5e8594-d8e2-4ae1-85df-33ca742c2c40","added_by":"auto","created_at":"2024-08-01 13:30:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":965646,"visible":true,"origin":"","legend":"\u003cp\u003eImmunofluorescence assay of P21 and P53 in gastrocnemius muscle. (a) Immunofluorescence assay of P21 in gastrocnemius muscle at different age stages (b) Immunofluorescence assay of P53 in gastrocnemius muscle at different age stages DAPI (blue) shows nuclei. Scale bar = 200 μm\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4681771/v1/ccda8bfa0c9a73ed348455c8.png"},{"id":61581941,"identity":"244f31b5-ca0d-44c9-beb6-bbd0c71d3a07","added_by":"auto","created_at":"2024-08-01 13:38:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":221916,"visible":true,"origin":"","legend":"\u003cp\u003ePCRverification of PPARα expression in gastrocnemius muscle. \u0026nbsp;Lane M, DL500 DNA Marker; Lane 1, negative control (DEPC water); Lane 2, positive control(liver tissue cDNA); Lane 3, target band (gastrocnemius muscle cDNA).\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4681771/v1/7007b6bdf5a842f202a2fd8d.png"},{"id":61581299,"identity":"3357c5cb-22a0-4940-92d0-7813bb75d071","added_by":"auto","created_at":"2024-08-01 13:30:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":78394,"visible":true,"origin":"","legend":"\u003cp\u003eReal-time quantitative PCR of PPARα mRNA expression. (n=7; *, P\u0026lt;0.05)\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4681771/v1/cd81814efebe636a6b78b66c.png"},{"id":61581302,"identity":"4314b5d6-9f36-46b2-bdb5-3673973970f2","added_by":"auto","created_at":"2024-08-01 13:30:02","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":168958,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blot assay of expression level of PPARα protein. (a) PPARα and GADPH bands. (b) Relative expression of PPARα by Western blot (n=3; **, P\u0026lt;0.01).\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4681771/v1/faadd9ae7ed8fd9c817a9544.png"},{"id":61581309,"identity":"867a9666-019a-4c74-b3c4-b5cdec628d90","added_by":"auto","created_at":"2024-08-01 13:30:02","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3865369,"visible":true,"origin":"","legend":"\u003cp\u003eImmunofluorescence assay of PPAR α in gastrocnemius muscle of mice at different age stages. DAPI (blue) shows nuclei. Scale bar = 100 μm\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-4681771/v1/66746a9412e4f164841b7af9.png"},{"id":64916849,"identity":"7c284785-5aac-4f1f-9550-cfc1bba2c1e7","added_by":"auto","created_at":"2024-09-20 10:56:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":11086320,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4681771/v1/8970740f-e6d8-45db-9fe0-d651986ab873.pdf"},{"id":61581307,"identity":"50c2e93b-3ff6-400d-b6d6-e83823d664c2","added_by":"auto","created_at":"2024-08-01 13:30:02","extension":"pdf","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":200751,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryInformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4681771/v1/b86f5dbaaba90a5abccb218d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Expression analysis of PPARα in skeletal muscle of mice at different developmental stages","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eSkeletal muscles, as the largest muscle tissue in animals, account for about 40% of the total weight of healthy animals. In addition to support and exercise functions, they are also the main tissues that consume energy (Frontera \u003cem\u003eet al.\u003c/em\u003e, 2015). Skeletal muscle functions are closely related to types of muscle fibers, and the growth and development of muscle fibers mainly rely on the proliferation and differentiation of muscle cells (Schiaffino \u003cem\u003eet al.\u003c/em\u003e, 2011). Accordingly, skeletal muscle-related diseases are intimately linked to the growth and development processes of muscle cells (Lim \u003cem\u003eet al.\u003c/em\u003e, 2023). The investigation of skeletal muscle is of great significance for elevating the economic value of animals and promoting the development of animal husbandry.\u003c/p\u003e \u003cp\u003ePPARα, as a subtype of peroxisome proliferators activated receptors (PPAR), is mainly expressed in high-energy tissues including skeletal muscles (Yagai \u003cem\u003eet al.\u003c/em\u003e, 2022). As a metabolic nuclear receptor, PPARα plays a crucial role in regulating systemic metabolic homeostasis (Tahri-Joutey et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and its expression changes are observed in many diseases caused by lipid metabolism disorders (Wang et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePPAR subtypes are important in metabolism and body energy homeostasis (Lamichane et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), and PPARα has been reported to be involved in regulating fatty acid intake, β oxidation, and ω oxidation (Staels \u003cem\u003eet al.\u003c/em\u003e, 1997). PPARα is activated in a fasting state of mice, and it is involved in regulating glucose homeostasis through the AMP-activated protein kinase (AMPK) and rapamycin target protein (mTOR) signalling pathways (Grabacka et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). After being activated, PPARα can improve the expression of pyruvate dehydrogenase kinase 4 (PDK4), thereby regulating blood sugar content(Yamaguchi et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).In addition, PPARα can also regulate liver size and liver regeneration by activating the YAP-TEAD signaling pathway (Fan et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), and PPARα can mediate the regulation of lipid metabolism by mTORC2, thereby promoting liver regeneration (Zhang et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). PPARα, a key transcription factor, has been demonstrated to facilitate the healing of endothelial cell damage by enhancing the expression of CCL14 in human umbilical vein endothelial cells (Choi \u003cem\u003eet al.\u003c/em\u003e, 2013). These above findings jointly indicate that PPARα also plays an indispensable role in tissue regeneration.\u003c/p\u003e \u003cp\u003eSkeletal muscle-related research reveals that PPARα can prevent skeletal muscle atrophy caused by liver cancer-induced anorexic cachexia syndrome (Goncalves et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), suggesting that PPARα regulates skeletal muscle mass through the liver muscle axis. The effects of PPARα on skeletal muscle atrophy and inflammation have been widely reported. Previous studies have demonstrated that \u003cem\u003ePPARα\u003c/em\u003e is key gene in skeletal muscle antioxidation and anti-inflammation pathways (Lettieri Barbato et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014a\u003c/span\u003e); (Lettieri Barbato et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2014b\u003c/span\u003e), (Aquilano et al., \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Generally, the existing studies of PPARα are mostly focused on its effect on glycolipid metabolism, and the skeletal muscle-related research mainly focuses on the effect of PPARα on energy metabolism and inflammation. However, there is lack of the research on the role of PPARα in skeletal muscle development.\u003c/p\u003e \u003cp\u003eThe purpose of our study is to reveal the expression characteristics of PPARα at different development stages of skeletal muscle \u003cem\u003ein vivo\u003c/em\u003e. The results showed pronounced differences in the expression levels of PPARα in skeletal muscle in different age groups. Specifically, juvenile mice exhibited the highest skeletal muscle content, whereas aged mice displayed the lowest. Our results demonstrated the potential important role of PPARα in skeletal muscle development. Our findings lay a foundation for the further exploration of functions and mechanisms of PPARα in skeletal muscle development.\u003c/p\u003e"},{"header":"2 Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003e2.1 Morphological changes in gastrocnemius muscle of young, adult, and aged mice\u003c/h2\u003e\n\u003cp\u003eTo investigate the morphological alterations in skeletal muscles throughout mouse various developmental stages, Hematoxylin and Eosin (HE) staining was performed to visualize the skeletal muscle morphology. The results revealed a reduction in the cross-sectional area of the gastrocnemius muscle with increasing age. The young mice displayed a dense muscle fiber arrangement (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (a)), adult mice exhibited a less dense arrangement (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (b)), whereas aged mice exhibited loose arrangement (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (c)).\u003c/p\u003e\n\u003cp\u003e2.2\u0026nbsp;\u003cstrong\u003eImmunofluorescence assay of P21 and P53 in skeletal muscle and changes in their expressions in skeletal muscle at mouse different age stages\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFurther, we performed immunofluorescence staining of cell cycle and apoptosis markers P21 and P53 from the gastrocnemius muscle of young, adult, and aged mice to investigate their expression levels. Immunofluorescence staining results showed that P21 and P53 were expressed in skeletal muscle at all age stages, and as age increased, the expression levels of P21 and P53 in skeletal muscle gradually increased. The expression levels of P21 and P53 were highest in the gastrocnemius muscle of aged mice, which was consistent with the impact of aging on them. Both P21 and P53 were expressed in the nuclei of skeletal muscle. Overall, the expression levels of these two proteins were increased in skeletal muscle with increasing age (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n\u003ch2\u003e2.3 Expression verification of PPAR\u0026alpha; in skeletal muscle by PCR\u003c/h2\u003e\n\u003cp\u003eTo explore the role of PPAR\u0026alpha; in skeletal muscle development, we initially investigated the expression of PPAR\u0026alpha; in skeletal muscle tissue. PPAR\u0026alpha; has been reported to be highly expressed in the liver (Tahri-Joutey et al., \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). To examine whether of PPAR\u0026alpha; was expressed in skeletal muscle, we used liver cDNA as a positive control. The electrophoresis results showed that the PPAR\u0026alpha; band corresponding to the gastrocnemius muscle was clear without tailing (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e), verifying the expression of PPAR\u0026alpha; in the gastrocnemius muscle of mice.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n\u003ch2\u003e2.4 Expression of PPAR\u0026alpha; mRNA in gastrocnemius muscle of mice at different age stages\u003c/h2\u003e\n\u003cp\u003eReal-time quantitative PCR (qRT-PCR) results showed that the mRNA expression of PPAR\u0026alpha; in the gastrocnemius muscle of young, adult, and aged mice exhibited a gradually decreasing trend. Specifically, the young mice exhibited significantly higher mRNA expression level than aged mice (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, there was no significant difference in the mRNA expression between young and adult mice, between adult and aged mice (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). The results showed that the mRNA expression of PPAR\u0026alpha; decreased with increasing age.\u003c/p\u003e\n\u003cp\u003e2.5\u0026nbsp;\u003cstrong\u003eExpression level of PPAR\u0026alpha; protein in gastrocnemius muscle of mice at different age stages by Western blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe detected the protein expression of PPAR\u0026alpha; in the gastrocnemius muscle of young, adult, and aged mice through Western blot. PPAR\u0026alpha; showed a higher expression level in the gastrocnemius muscle of young mice than that of adult and aged mice, with a lowest expression level in gastrocnemius muscle of aged mice, suggesting a decreasing trend with increasing age (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n\u003ch2\u003e2.6 Immunofluorescence assay of PPAR\u0026alpha; expression in gastrocnemius muscle of mice at different age stages\u003c/h2\u003e\n\u003cp\u003eImmunofluorescence assay showed that PPAR\u0026alpha; was expressed in both the cytoplasm and the nucleus of gastrocnemius tissue sections. There were more positive areas in the gastrocnemius muscle of young mice than that of adult mice, with the least positive areas in aged mice, further confirming that PPAR\u0026alpha; expression level was decreased with increasing age (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3 Discussion","content":"\u003cp\u003eSkeletal muscle is one of the large tissues in the body, accounting for about 40% of the total body weight. In addition to supporting movement, it also plays an important role in regulating energy metabolism in the body (Manickam et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, many factors including age, muscle fiber type, and exercise, and diet habits can affect the quality and function of skeletal muscles.\u003c/p\u003e \u003cp\u003ePPARα is a transcription factor modulating the expression of genes responsible for fatty acid transport and oxidation. (Tahri-Joutey et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and it is widely present in animal skeletal muscles. One previous study has indicated that PPARα expression in skeletal muscles significantly increases after aerobic exercise (Manio et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). PPARα has been reported to affect the expression of inflammation-related cytokines in skeletal muscle (Cabral-Santos et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and the expression of PPARα in the myocardium, liver, and skeletal muscles of aged mice is much lower than that of young mice (B\u0026ouml;rsch et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2021\u003c/span\u003e); (Atherton et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). These existing research suggests that PPARα may have a certain effect on the quality of skeletal muscle.\u003c/p\u003e \u003cp\u003eFasting has been reported to affect the expression of PPARα in the liver and skeletal muscles (Bazhan et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), and its downstream FGF21 in the liver has been found to affect skeletal muscle atrophy under fasting conditions (Oost et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Usually, age and diet habits have effect on skeletal muscle mass, and thus we investigated the change of PPARα expression in skeletal muscle with age. In this study, we found that the expression of PPARα in the skeletal muscle of mice was decreased with increasing age, but the expression levels of aging markers P21 and P53 were increased with increasing age. The higher expression of PPARα in the skeletal muscle of young mice than that of aged mice indicated that PPARα had an impact on skeletal muscle development.\u003c/p\u003e"},{"header":"4 Conclusion","content":"\u003cp\u003eIn summary, PPARα was expressed in the gastrocnemius muscle of mice at different age stages, exhibiting significant differences in expression levels among different ages of mice. Expression of PPARα was the highest in young mice and the lowest in aged mice. PPARα was expressed in both the cytoplasm and the nucleus. Our findings lay a foundation for further research on PPARα and understanding its relationship with skeletal muscle development.\u003c/p\u003e"},{"header":"5 Materials and methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e5.1 Sample collection.\u003c/h2\u003e \u003cp\u003eC57BL/6 mice including young mice (6\u0026ndash;8 weeks), adult mice (3\u0026ndash;4 months) and aged mice (18\u0026ndash;20 months) were purchased from the Experimental Animal Center of Shanxi Provincial People\u0026rsquo;s Hospital (Taiyuan, Shanxi, China). They were healthy with no genetic modification or any previous procedures. All mice were given access to food and water freely under 12 h light/dark cycles. All animal care and experimental protocols were performed in accordance with the guide for the Animal Management Rule of the Ministry of Health, People\u0026rsquo;s Republic of China, and approved by the Animal Medicine Committee of Shanxi Agricultural University. Euthanasia of animals was implemented by using cervical dislocation. Gastrocnemius muscles were collected from each mouse, with left leg gastrocnemius muscle flash-frozen in liquid nitrogen and stored in a ‒80\u0026deg;C for RNA and protein extraction. The right leg gastrocnemius muscle with tendon was fixed in 4% paraformaldehyde solution for 24\u0026ndash;36 h for subsequent HE staining and immunofluorescence assay.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e5.2 HE staining\u003c/h2\u003e \u003cp\u003eAfter fixation, mouse gastrocnemius muscle samples were embedded in paraffin and sliced into 7\u0026micro;m by a microtome (CM1850, Leica). The HE staining was performed following the manufacturers\u0026rsquo; instructions. The HE staining images of gastrocnemius muscle sections were captured with an ECLIPSE Ts2R (Nikon, China) microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e5.3 Polymerase chain reaction (PCR)\u003c/h2\u003e \u003cp\u003ePolymerase chain reaction (PCR) was performed in a 10 \u0026micro;L reaction system containing 1 \u0026micro;L cDNA template, 3.2 \u0026micro;L DEPC water, 5 \u0026micro;L Mix, 0.4 \u0026micro;L the upstream primer, and 0.4 \u0026micro;L downstream primers, with DEPC (diethyl pyrocarbonate) water as the negative control, liver tissue cDNA as the positive control, and gastrocnemius muscle tissue cDNA as detection target. The upstream primer sequence of PPARα was CCTCAGGGTACCACTACGGA, and its downstream primer sequence was TTGCAGCTCCGATCACACTT. The PCR was performed as follows: pre-denaturation at 95 ℃ for 30 s, followed by 35 cycles of denaturation at 95 ℃ for 40 s, annealing at 60 ℃ for 30 s, and extension at 72 ℃ for 40 s.\u003c/p\u003e \u003cp\u003ePCR products were subjected to 1% agarose gel electrophoresis. Briefly, 5 \u0026micro;L of DL500 DNA marker, 10 \u0026micro;L DEPC water, 10 \u0026micro;L liver tissue cDNA, 10 \u0026micro;L of gastrocnemius muscle tissue cDNA were added to the well, and electrophoresis was performed at 220V.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e5.4 RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eRNA was extracted from mouse gastrocnemius muscle using the Trizol reagent (TaKaRa Bio, Dalian, China), and reverse transcription of RNA was performed according to the instructions of the reverse transcription kit (TOLOBIO, Shanghai, China) to synthesize cDNA. The primers of \u003cem\u003ePPARα\u003c/em\u003e and \u003cem\u003e36B4\u003c/em\u003e were synthesized by Universal Biology (Anhui, China).\u003c/p\u003e \u003cp\u003eReal-time fluorescence quantitative PCR (was performed in 10 \u0026micro;L total reaction system containing 4.4 \u0026micro;L cDNA (diluted 20 times with DEPC water), 5 \u0026micro;L SYBR Premix Ex Taq (Mona, Suzhou, China), 0.3 \u0026micro;L the upstream primer, and 0.3 \u0026micro;L downstream primer. The upstream primer sequence of PPARα was CCTCAGGGTACCACTACGGA, and its downstream primer sequence was TTGCAGCTCCGATCACACTT. The upstream primer sequence of 36B4 was ACTGAGATTCGGGATATGCTGT, and its downstream primer sequence was CCCACCTTGTCTCCAGTCTTTA. There were 7 biological replicates of each gastrocnemius muscle age group. The procedures of qRT PCR were as follows: pre-denaturation at 95 \u0026deg; C for 1 min, followed by 40 cycles of denaturation at 95 \u0026deg; C for 10 s and annealing at 60 \u0026deg; C for 30 s, ending up with extension at 95 \u0026deg; C for 15 s. The relative expression of PPARα was analyzed in different developmental stages of skeletal muscle using the 2-ΔΔCt method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e5.5 Western blot\u003c/h2\u003e \u003cp\u003eThe protein was extracted from muscle tissues with RIPA buffer (Beyotime Biotechnology, Shang hai, China) containing protease and phosphatase inhibitors (Servicebio, China). Total protein concentration was determined using BCA protein assay kit (Beyotime Biotechnology, Shanghai, China). The proteins were subjected to SDS-PAGE electrophoresis, and the obtained proteins were transferred onto PVDF membranes by semi-dry transfer method (Trans-blot Turbo, Bio-Rad Laboratories) at 1 amp for 10 min. Afterwards, the PVDF membranes were blocked with 5% skim milk at 37 ℃ for 1 hour, incubated with PPARα antibody (23995-1-AP, Proteintech, Wuhan, China) and GAPDH (10494-1-AP, Proteintech) at 4 ℃ overnight. After being washed five times with TBST (Tris-buffered saline with 0.1% Tween 20), the membranes were incubated with either anti-mouse or anti-rabbit IgG HRP-linked secondary antibody (1:25000 dilution, Abclonal Technology, China). The protein bands were visualized using a chemiluminescence reagent (Beyotime Biotechnology, Shanghai, China). The quantitative analysis of protein bands was performed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e5.6 Immunofluorescence assay\u003c/h2\u003e \u003cp\u003eParaffin-fixed muscle sections were dewaxed by xylene and gradient alcohol, immersed in 1\u0026times; sodium citrate antigen retrieval solution for antigen retrieval in a microwave oven, then naturally cooled to room temperature, washed with PBS solution (3\u0026times;5min), blocked with dropwise added 3% goat serum at room temperature for 30min, rewashed again with PBS solution three times for 5 min per time (3\u0026times;5 min), and incubated with added dropwise PPARα,P21 or P53 antibodies (diluted at 1:200) overnight at 4\u0026deg;C. Subsequently, muscle sections were rewarmed at room temperature for 30 min, rinsed with PBS solution (3\u0026times;5 min), added with 0.025% fluorescent secondary antibody dropwise, incubated at room temperature in the dark for 1 h, then re-rinsed with PBS solution (3\u0026times;5min), finally added with DAPI agent dropwise, and incubated in incubator with coverslip. The immunofluorescence images of muscle sections were captured with an ECLIPSE Ts2R (Nikon, China) microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e5.7 Statistical analysis\u003c/h2\u003e \u003cp\u003eAll experimental data were analyzed and processed using GraphPad Prism 5.0 software, and the statistical difference among groups were determined using T-test. P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered as statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003e This study was approved by the Animal Experimentation Ethics Committee of Shanxi Agricultural University, Taigu, China and all procedures involving animal treatment and sample collection were performed by veterinarians following the Guiding Principles for animal use described by the Council for International Organizations of Medical Sciences (CIOMS).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eCompeting interests\u003c/strong\u003e \u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eEthical statement\u003c/h2\u003e \u003cp\u003e All animal protocols in this study were approved by Institutional Animal Care and Use Committee of Shanxi Agricultural University. The experiments are conducted in accordance with relevant guidelines and regulations. The study complied with ARRIVE guidelines.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis project was supported by the National Natural Science Foundation of China (No. 32102634), the Fundamental Research Program of Shanxi Province (No. 20210302124700, 202303021211092, 202103021223166), Shanxi Province Excellent Doctoral Work Award-Scientific Research Project (No. SXBYKY2021043, SXBYKY2022013, SXBYKY2022039), Start-up Fund for doctoral research, Shanxi Agricultural University (No.2021BQ08, 2021BQ69), Shanxi Provincial Graduate Education Innovation Project (No. 2023KY345), and the Fund for Shanxi\u0026ldquo;1331 Project\u0026rdquo;(20211331-16, 20211331-12). All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eYY and HW: Conceptualization, Funding acquisition, Project administration. Jiahui Qi: Data Curation, Methodology, Writing-Original draft preparation. MZ: Methodology, Writing-Original draft preparation. HX: Software, Validation. XW: Methodology. HW: Date Curation. JL: Formal analysis. XL: Data Curation. XY: Resources. YY: Writing Review and Editing.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe data are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAquilano K., Baldelli, S., La Barbera, L., Lettieri Barbato, D., Tatulli, G., Ciriolo, M. R. (2016). Adipose triglyceride lipase decrement affects skeletal muscle homeostasis during aging through FAs-PPARα-PGC-1α antioxidant response. Oncotarget 7: 23019\u0026ndash;23032. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.18632/oncotarget.8552\u003c/span\u003e\u003cspan address=\"10.18632/oncotarget.8552\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAtherton H. J., Gulston, M. K., Bailey, N. J., Cheng, K. K., Zhang, W., Clarke, K., Griffin, J. L. (2009). Metabolomics of the interaction between PPAR-α and age in the PPAR‐α‐null mouse. Molecular Systems Biology 5: 259. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/msb.2009.18\u003c/span\u003e\u003cspan address=\"10.1038/msb.2009.18\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBazhan N., Jakovleva, T., Feofanova, N., Denisova, E., Dubinina, A., Sitnikova, N., Makarova, E. (2019). Sex differences in liver, adipose tissue, and muscle transcriptional response to fasting and refeeding in mice. Cells 8: 1529. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/cells8121529\u003c/span\u003e\u003cspan address=\"10.3390/cells8121529\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB\u0026ouml;rsch A., Ham, D. J., Mittal, N., Tintignac, L. A., Migliavacca, E., Feige, J. N., R\u0026uuml;egg, M. A., Zavolan, M. (2021). Molecular and phenotypic analysis of rodent models reveals conserved and species-specific modulators of human sarcopenia. Communications Biology 4: 194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s42003-021-01723-z\u003c/span\u003e\u003cspan address=\"10.1038/s42003-021-01723-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCabral-Santos C., Silveira, L. S., Chimin, P., Rosa-Neto, J. C., Lira, F. S. (2020). Moderate aerobic exercise-induced cytokines changes are disturbed in PPARα knockout mice. Cytokine 134: 155207. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cyto.2020.155207\u003c/span\u003e\u003cspan address=\"10.1016/j.cyto.2020.155207\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan S. C., Gao, Y., Qu, A. J., Jiang, Y. M., Li, H., Xie, G. M., Yao, X. P., Yang, X., Zhu, S. G., Yagai, T., Tian, J., Wang, R. M., Gonzalez, F. J., Huang, M., Bi, H. C. (2022). YAP-TEAD mediates PPAR α\u0026ndash;induced hepatomegaly and liver regeneration in mice. Hepatology 75: 74\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/hep.32105\u003c/span\u003e\u003cspan address=\"10.1002/hep.32105\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrontera W. R., Ochala, J. (2015). Skeletal muscle: a brief review of structure and function. Calcified Tissue International 96: 183\u0026ndash;195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00223-014-9915-y\u003c/span\u003e\u003cspan address=\"10.1007/s00223-014-9915-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoncalves M. D., Hwang, S.-K., Pauli, C., Murphy, C. J., Cheng, Z., Hopkins, B. D., Wu, D., Loughran, R. M., Emerling, B. M., Zhang, G., Fearon, D. T., Cantley, L. C. (2018). Fenofibrate prevents skeletal muscle loss in mice with lung cancer. Proceedings of the National Academy of Sciences 115: E743-E752. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1714703115\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1714703115\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrabacka M., Pierzchalska, M., Dean, M., Reiss, K. (2016). Regulation of ketone body metabolism and the role of PPARα. International Journal of Molecular Sciences 17: 2093. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms17122093\u003c/span\u003e\u003cspan address=\"10.3390/ijms17122093\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLamichane S., Dahal Lamichane, B., Kwon, S.-M. (2018). Pivotal roles of peroxisome proliferator-activated receptors (PPARs) and their signal cascade for cellular and whole-body energy homeostasis. International Journal of Molecular Sciences 19: 949. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms19040949\u003c/span\u003e\u003cspan address=\"10.3390/ijms19040949\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLettieri Barbato D., Aquilano, K., Baldelli, S., Cannata, S. M., Bernardini, S., Rotilio, G., Ciriolo, M. R. (2014a). Proline oxidase\u0026ndash;adipose triglyceride lipase pathway restrains adipose cell death and tissue inflammation. Cell Death \u0026amp; Differentiation 21: 113\u0026ndash;123. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/cdd.2013.137\u003c/span\u003e\u003cspan address=\"10.1038/cdd.2013.137\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLettieri Barbato D., Tatulli, G., Aquilano, K., Ciriolo, M. R. (2014b). Inhibition of age-related cytokines production by ATGL: a mechanism linked to the anti-inflammatory effect of resveratrol. Mediators of Inflammation 2014: 917698. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2014/917698\u003c/span\u003e\u003cspan address=\"10.1155/2014/917698\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim J.-Y., Frontera, W. R. (2023). Skeletal muscle aging and sarcopenia: Perspectives from mechanical studies of single permeabilized muscle fibers. Journal of Biomechanics 152: 111559. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.sciencedirect.com/science/article/pii/S0021929023001288\u003c/span\u003e\u003cspan address=\"https://www.sciencedirect.com/science/article/pii/S0021929023001288\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManickam R., Duszka, K., Wahli, W. (2020). PPARs and microbiota in skeletal muscle health and wasting. International Journal of Molecular Sciences 21: 8056. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms21218056\u003c/span\u003e\u003cspan address=\"10.3390/ijms21218056\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eManio M. C. C., Matsumura, S., Masuda, D., Inoue, K. (2017). CD36 is essential for endurance improvement, changes in whole-body metabolism, and efficient PPAR-related transcriptional responses in the muscle with exercise training. Physiological Reports 5: e13282. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.14814/phy2.13282\u003c/span\u003e\u003cspan address=\"10.14814/phy2.13282\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOost L. J., Kustermann, M., Armani, A., Blaauw, B., Romanello, V. (2019). Fibroblast growth factor 21 controls mitophagy and muscle mass. Journal of Cachexia, Sarcopenia and Muscle 10: 630\u0026ndash;642. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcsm.12409\u003c/span\u003e\u003cspan address=\"10.1002/jcsm.12409\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchiaffino S., Reggiani, C. (2011). Fiber types in mammalian skeletal muscles. Physiological Reviews 91: 1447\u0026ndash;1531. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/physrev.00031.2010\u003c/span\u003e\u003cspan address=\"10.1152/physrev.00031.2010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStaels B., Auwerx, J. (1997). Role of PPAR in the pharmacological regulation of lipoprotein metabolism by fibrates and thiazolidinediones. Current Pharmaceutical Design 3: 1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.2174/138161280301221005122647\u003c/span\u003e\u003cspan address=\"10.2174/138161280301221005122647\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTahri-Joutey M., Andreoletti, P., Surapureddi, S., Nasser, B., Cherkaoui-Malki, M., Latruffe, N. (2021). Mechanisms mediating the regulation of peroxisomal fatty acid beta-oxidation by PPARα. International Journal of Molecular Sciences 22: 8969. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms22168969\u003c/span\u003e\u003cspan address=\"10.3390/ijms22168969\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L., Cai, Y., Jian, L. G., Cheung, C. W., Zhang, L. Q., Xia, Z. Y. (2021). Impact of peroxisome proliferator-activated receptor-α on diabetic cardiomyopathy. Cardiovascular Diabetology 20: 2. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12933-020-01188-0\u003c/span\u003e\u003cspan address=\"10.1186/s12933-020-01188-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYagai T., Nakamura, T. (2022). Mechanistic insights into the peroxisome proliferator-activated receptor alpha as a transcriptional suppressor. Frontiers in Medicine 9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmed.2022.1060244\u003c/span\u003e\u003cspan address=\"10.3389/fmed.2022.1060244\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamaguchi S., Moseley, A. C., Almeda-Valdes, P., Stromsdorfer, K. L., Franczyk, M. P., Okunade, A. L., Patterson, B. W., Klein, S., Yoshino, J. (2018). Diurnal Variation in PDK4 Expression Is Associated With Plasma Free Fatty Acid Availability in People. The Journal of Clinical Endocrinology \u0026amp; Metabolism 103: 1068\u0026ndash;1076. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/jc.2017-02230\u003c/span\u003e\u003cspan address=\"10.1210/jc.2017-02230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang L. L., Li, Y. Q., Wang, Y., Qiu, Y. G., Mou, H. C., Deng, Y. Y., Yao, J. Y., Xia, Z. Q., Zhang, W. Z., Zhu, D., Qiu, Z. Y., Lu, Z. J., Wang, J. R., Yang, Z. X., Mao, G. X., Chen, D., Sun, L. M., Liu, L. M., Ju, Z. Y. (2022). mTORC2 facilitates liver regeneration through sphingolipid-induced PPAR-α-fatty acid oxidation. Cellular and Molecular Gastroenterology and Hepatology 14: 1311\u0026ndash;1331. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jcmgh.2022.07.011\u003c/span\u003e\u003cspan address=\"10.1016/j.jcmgh.2022.07.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"PPARα, expression, skeletal muscle, development, mice","lastPublishedDoi":"10.21203/rs.3.rs-4681771/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4681771/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003ePeroxisome proliferator-activated receptors (PPARs) belonging to the nuclear receptor family function as transcription factors. PPARα, an initial subtype of PPARs, is predominantly involved in lipid oxidation. The existing research on PPARα mostly focuses on its regulation on metabolism and inflammation in skeletal muscle. However, whether PPARα participates in skeletal muscle development remains largely unknown. Therefore, this study aims to explore the effect of PPARα on mouse skeletal muscle development by investigating the expression of PPARα in skeletal muscle of mice at different ages.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe results of Western blot assay, quantitative real-time polymerase chain reaction (qRT-PCR), and immunofluorescence assay indicated the differences in the expression levels of PPARα in gastrocnemius muscle among different ages of mice. Specifically, young mice exhibited the highest expression of PPARα in their gastrocnemius muscle, whereas aged mice displayed its lowest expression. Furthermore, the immunofluorescence results showed that PPARα was expressed in both the nucleus and the cytoplasm.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eOverall, PPARα was expressed in skeletal muscle of mice at different developmental stages, but the expression levels varied. Our findings lay a foundation for the further functional study of PPARα in skeletal muscle development.\u003c/p\u003e","manuscriptTitle":"Expression analysis of PPARα in skeletal muscle of mice at different developmental stages","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-01 13:29:56","doi":"10.21203/rs.3.rs-4681771/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"88376b1b-57e6-4032-b3c3-6606ead7f36e","owner":[],"postedDate":"August 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":34944496,"name":"Biological sciences/Biochemistry"},{"id":34944497,"name":"Biological sciences/Cell biology"},{"id":34944498,"name":"Biological sciences/Developmental biology"},{"id":34944499,"name":"Biological sciences/Molecular biology"},{"id":34944500,"name":"Biological sciences/Physiology"}],"tags":[],"updatedAt":"2024-09-20T10:47:55+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-01 13:29:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4681771","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4681771","identity":"rs-4681771","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00