Immune system of aquatic organisms can be affected by long-term ecological alterations? Focusing on Prophenoloxidase (proPO) and NLHS-induced proPO gene expression of Artemia Urmiana

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Recent ecological changes in Urmia Lake may affect immune system of local organisms, including Artemia urmiana , prompting the need to study immune regulation mechanisms in species being able to cope with stressors, survive, and reproduce under these conditions. This study evaluated effects of long-term environmental changes on the prophenoloxidase ( proPO ) expression as a key immune response and non-lethal heat shock (NLHS)-induced proPO expression in this species. qPCR assay was developed to evaluate the influence of three-decade ecological crisis on proPO and NLHS-induced proPO expression of nauplii of Artemia urmiana , based on cyst collections from 1994 (rainy period) to 2020 (drought period). To obtain partial cds of proPO , four regions of this cDNA were sequenced using Sanger method. Before expression analysis, four regions of proPO cDNA were sequenced (the accession numbers: OQ784234, OQ784235, OQ784236, OQ784237) and then assembled into a larger partial cds (the accession numbers: OQ784174). qPCR results demonstrated that ecological changes caused proPO expression shifting, which was highest in 2005 (CI 95%, p < 0.001). Notably, the nauplii exposed to longer-term changes were able to increase proPO expression more than others in response to NLHS (CI 95%, p < 0.001). Our findings highlighted effects of ecological stressors on proPO and NLHS-induced proPO expression. Notably, prior exposure to stressors may confer survival and adaptation advantages against future challenges, indicating a bright side of long-term environmental stressors.
Full text 131,888 characters · extracted from preprint-html · click to expand
Immune system of aquatic organisms can be affected by long-term ecological alterations? Focusing on Prophenoloxidase (proPO) and NLHS-induced proPO gene expression of Artemia Urmiana | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Immune system of aquatic organisms can be affected by long-term ecological alterations? Focusing on Prophenoloxidase (proPO) and NLHS-induced proPO gene expression of Artemia Urmiana Reyhaneh Ravanbakhsh, Naser Agh, Peter Bossier This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7453914/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Feb, 2026 Read the published version in Aquatic Ecology → Version 1 posted 10 You are reading this latest preprint version Abstract Recent ecological changes in Urmia Lake may affect immune system of local organisms, including Artemia urmiana , prompting the need to study immune regulation mechanisms in species being able to cope with stressors, survive, and reproduce under these conditions. This study evaluated effects of long-term environmental changes on the prophenoloxidase ( proPO ) expression as a key immune response and non-lethal heat shock (NLHS)-induced proPO expression in this species. qPCR assay was developed to evaluate the influence of three-decade ecological crisis on proPO and NLHS-induced proPO expression of nauplii of Artemia urmiana , based on cyst collections from 1994 (rainy period) to 2020 (drought period). To obtain partial cds of proPO , four regions of this cDNA were sequenced using Sanger method. Before expression analysis, four regions of proPO cDNA were sequenced (the accession numbers: OQ784234, OQ784235, OQ784236, OQ784237) and then assembled into a larger partial cds (the accession numbers: OQ784174). qPCR results demonstrated that ecological changes caused proPO expression shifting, which was highest in 2005 (CI 95%, p < 0.001). Notably, the nauplii exposed to longer-term changes were able to increase proPO expression more than others in response to NLHS (CI 95%, p < 0.001). Our findings highlighted effects of ecological stressors on proPO and NLHS-induced proPO expression. Notably, prior exposure to stressors may confer survival and adaptation advantages against future challenges, indicating a bright side of long-term environmental stressors. Artemia urmiana ecological changes environmental stresses NLHS proPO Figures Figure 1 Figure 2 Introduction Recently, one of the biggest challenges in our world is ecological changes (Dervis, K., 2016 ; Lazarus, R., 2023). As a result of these changes, mass mortalities and economic losses of animals living in those ecosystems have been recorded (Ge et al., 2020 ). Urmia Lake, second largest hypersaline lake globally (Nikraftar et al., 2021 ) located in Northwest Iran at coordinates 37◦20′ E–45◦40′N and positioned at 1278 meters above sea level, is one of the affected aquatic ecosystems (Sheibani et al., 2020 ). It has been subjected to severe ecological alterations, with more than 90 percent of the lake's surface disappearing (Rahimi and Breuste, 2021 ), and the salinity of Urmia Lake has increased from 165 ppt in 1994 to supersaturated level (~ 360 ppt) in 2020. (Sheibani et al., 2020 ). According to many literatures, these tensions can inflict a notable threat to the organisms living in it (Asem et al., 2019 ; Ravanbakhsh et al., 2023 ). In these circumstances, only organisms that can develop some degree of adaptation to fluctuating environmental stressors particularly high salinity levels and temperature increment, would survive and continue their generation (Roy et al., 2022 ; Junprung et al., 2024 ). One of these creatures is a unique brine shrimp specie named Artemia urmiana Günther ( 1899 ) (Günther R.,1899), which has been living under these stresses in Urmia Lake for decades. This valuable unique zooplankton has numerous applications, especially within the fisheries sector. This organism can be employed as a live food source in aquaculture, with a specific emphasis on larviculture (Ahmadifard et al., 2019 ), used for drug delivery (Joshua et al., 2022 ), toxicity assay (Banti and Hadjikakou, 2021 ; Rasyid et al., 2022 ) and pedagogic and research purposes as a model organism in various bioscience reseach (Piper et al., 2018; Albarano et al., 2022 ). Although these micro-crustacean species are potentially adapted to live in tough conditions (Agh et al., 2008 ), it is evident that a variety of environmental tensions, including changes in temperature, salinity, dissolved oxygen, and pH, can affect morphology (Ravanbakhsh et al., 2023 ), growth, survival, and most importantly, the immune system of Artemia (Anufriieva and Shadrin, 2023 ; Junprung et al., 2024 ; Ge et al., 2020 ). Hence, in such ecological tension, Artemia organisms that are able to survive are forced to rectify the imbalances created by the stressor (Tort, 2011 ) and apply the suitable adaptive response (Junprung et al., 2024 ). Subsequently these organisms would attempt to pass these abilities on to the next generation to impede population extinction (Demir et al., 2022 ; Junprung et al., 2024 ). One of the important systems which are influenced by long-term ecological alterations is innate immune system of Artemia. It sounds that; survivors should evoke a series of mechanisms by which they can keep their immune system in the best shape to deal with the harsh conditions and any surrounding pathogen (Tort, 2011 ). Understanding these mechanisms and how the immune system responds to long-term ecological alterations has aroused curiosity and interest of researchers and has not yet been clearly explored. Since Artemia populations belong to aquatic crustacean, a key system in innate immune of this genus is (prophenoloxidase) proPO system (Huang et al., 2020; Kulkarni et al., 2021 ; Patnaik et al., 2024 ). Prophenoloxidase, which is coded by proPO gene, is one of the vital enzymes in this system. Pivotal roles of proPO system in Artemia are pathogen recognition and defense against it (Patnaik et al., 2024 ), as well as the response to fluctuations in environmental factors (Ge et al., 2020 ; Kulkarni et al., 2021 ’ Mengal et al., 2023 ) through maintaining homeostasis (Fagutao et al., 2009 ) and catalyzing the sclerotization of their newly formed exoskeleton, which is essential to protect their soft bodies in harsh conditions (Mengal et al., 2023 ; Patnaik et al., 2024 ). In fact, prophenoloxidase can be activated by biotic or regulated by abiotic factors (Ge et al., 2020 ; Mengal et al., 2023 ; Patnaik et al., 2024 ). Microbial cell wall components of pathogen, including β-1, 3-glucan, lipopolysaccharide (LPS) and peptidoglycan are considered as biotic factors and environmental and experimental factors containing climate, salinity, pH, temperature, etc., can be fallen into abiotic factors (Kumar and Kumar, 2018; Ge et al., 2020 ). According to many studies, among abiotic factors, salinity and temperature are the most important ones, which can directly affect the survival, growth, immune system, and metabolism of a variety of aquatic organisms (Pan et al., 2010 ; Kültz, D., 2015 ; Velasco et al., 2019 ; Ge et al., 2020 ; Anufriieva and Shadrin, 2023 ; Junprung et al., 2024 ). The mechanism of the proPO system activation in crustaceans induced by biotic factors has been well documented (Kumar and Kumar, 2018; Velasco et al., 2019 ; Ge et al., 2020 ; Anufriieva and Shadrin, 2023 ); however, there is still little information on how proPO system responds to long-term ecological changes. Hence, in light of global warming and climate change and occurrence of ecological changes, especially in aquatic ecosystems, this research aimed to evaluate the response of prophenoloxidase system-related gene named proPO to three-decade ecological changes in Urmia Lake. Furthermore, this study set out to investigate the response of proPO gene in nauplii of Artemia urmiana originating from rainy to drought periods to subsequent stresses such as NLHS, in order to answer the question of whether prior experience with chronic stressors might confer an advantage to those animals when exposed to a subsequent stressful factor. Materials and Methods Sample Collection The cysts of Artemia urmiana used in this study were provided by Artemia and Aquaculture Research Institute Cyst Bank, collected over the past three decades from different geographical localities of Urmia Lake in Iran. The years chosen for this research were 1994, 2001, 2003, 2005 and 2020. Geographical location of sampling was at coordinates at 37°47´06.02˝N, 45°22´19.95˝E, which corresponds to the location beneath Shahid Kalantari Bridge. All harvested cysts had been specified to be bisexual in accordance with Agh et al. ( 2007 ). Additionally, to ensure proper storage conditions for the cysts, the hatching process was performed on all cysts harvested from 1994 to 2020. The specifications of sampling years were reported in detail in the research conducted by Ravanbakhsh and colleagues (Ravanbakhsh et al., 2023 ). The study reported an increase in temperature and salinity of Urmia Lake over the last three decades from 165 ppm to 360 and 28°C to 31.8°C, respectively. Artemia Hatching and culture procedure To investigate expression profile of Artemia urmiana nauplii, all cysts should be first decapsulated and hatched. In decapsulation process, the external shell of cysts is chemically removed and only the embryo surrounded by the inner cuticular membrane is left. Decapsulation was accomplished according to the protocol described by Rahman and Sorgeloos ( 2022 ). Briefly, before hatching, in order to get rid of any debris and salt, which might affect subsequent experiments such as RNA extraction, the cysts underwent an initial washing step by tap water. The cleaned cysts were then hydrated in a funnel-shaped tube containing fresh water for 1–2 hour with bottom diffused aeration at room temperature (20–25°C). After 1–2 h, to dissolve the chorions, the cysts in a hydrated state were transferred into a sterile container and the suspension is diluted with an equal volume of liquid bleach (NaOCl) and water, and also in order to enhance pH and get a fast oxidation reaction; a few drops of NaOH can be applied. It is worth mentioning that strong aeration is required during this process. After about 5 minutes, color of the cysts altered from dark brown to orange. Appearance of bright orange color was a sign of dissolving the chorions and completion of decapasulation. This process was also further monitored under a stereoscopic microscope to ensure that the chorions were completely disappeared. Decapsulated cysts must then be immediately filtered and thoroughly rinsed with tap water to eliminate all traces of hypochlorite, because, prolonged exposure to the bleach may harm embryos. Decapsulated cysts were maintained under isothermal conditions at 28°C for a period of 22 hours in conical containers filled with filtered Urmia Lake water, which is diluted to 33 g/l and mild aeration. The water temperature was adjusted using a thermostatic heater. After this period, the newly-hatched nauplii from each year were subjected to RNA extraction to evaluate the effect of three-decade ecological changes on proPO gene expression, and the rest were cultured at 28°C according to the procedure described by Agh et al. ( 2008 ), and kept in new containers until instar II stage for the NLHS experiment. NLHS (Non-Lethal Heat Shock) To assess whether exposure of organisms to long-term stressors can affect their tolerance to secondary stressors (herein NLHS and evaluation through induction of proPO gene expression), we designed the NLHS experiment. To conduct the NLHS experiment, Artemia urmiana nauplii at instar II stage were selected, counted volumetrically and then based on the year of harvest (1994, 2001, 2003, 2005 and 2020), they were distributed in two groups and 5 sub-groups, each with 3 replicates. Each group was kept in 50 ml sterile tubes filled with filtered 33 g/l diluted Urmia Lake water. The samples of first-group were maintained isothermally at a temperature of 28°C using a thermostatic heater with constant illumination (E27 µE/m2/s) and gentle bottom up aeration. The second group was subjected to non-lethal heat shock in a water bath where the nauplii specimens were exposed to a temperature of 37°C for 30 min, followed by a 6-h recovery time at 28°C (Ravanbakhsh et al., 2023 ). After recovery, 0.2 g of live nauplii samples from each groups were collected. Then, they were washed with sterile distilled water and immersed immediately into liquid nitrogen to be frozen and stored at -80°C for subsequent experiments. RNA extraction and cDNA (complementary DNA) synthesis Total RNA was isolated from 0.2 gr of Artemia nauplii using TRIzol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s instructions. The quality of extracted RNAs was analyzed via observing of 28S and 18S RNA bands on 1% agarose gel. For quantification, absorbance of the isolated RNA at 260 nm and 280 nm was measured by NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA). All extracted RNA was preserved at -80°C until cDNA synthesis. One the most important process prior to cDNA synthesis is to eliminate DNA contamination from extracted RNAs by DNAase1 (Fermentase, USA). Briefly, 2µg of extracted total RNA was treated using 1 µL of DNase I, 1 µL of its buffer and 0.5 µL of RNase inhibitor (Fermentase, USA). Then the reaction volume was adjusted to 10 µl using DEPC- treated water, followed by incubation at 37°C for 30 min. To inactivate DNaseI activity, 1 µL of EDTA (Fermentase, USA) was added and incubated for 10 min at 65°C. To cDNA synthesis, reverse transcription was carried out on the treated RNA from the previous step in a final volume of 20 µl using the PrimeScript RT kit (TaKaRa Bio Inc. Kusatsu, Japan) according to the manufacturer’s protocol. Then, synthesized cDNAs were stored at -20°C for later use in real-time PCR reaction. Primer design for obtaining partial sequences of proPO mRNA To evaluate expression profile of proPO gene over long-term ecological changes, sequence of this gene was needed. Due to the lack of information about Artemia urmiana proPO cDNA sequence, it was necessary to first sequence partial cds of this gene. For this purpose, the NCBI nucleotide database was first searched in order to finding sequences of this gene in other Artemia species. For this gene, two close species of Artemia named Artemia franciscana and Artemia sinica have already been sequenced. Therefore, four degenerated primers pairs (Table 1) were designed according to a complete proPO mRNA sequence from Artemia franciscana (GenBank accession no. AM850109.1) and Artemia sinica (GenBank accession no. HM138084.1), using GeneRunner software v3.05 (Hastings Software Inc. USA). PCR product sequencing To confirm the expression of proPO and also obtain the sequence of amplified RT-PCR products, Sanger sequencing was performed. Afterwards, sequencing results were interpreted by Chromas Pro 2.4.1 and aligned using BLAST. Primer design for doing Real-time PCR After obtaining partial cds of ProPO gene, so as to evaluate expression profile of this gene during three decades via real-time PCR, related primers were first designed based on its already sequenced part by GeneRunner software v3.05 (Hastings Software Inc. USA). β-actin was selected as an internal control and its expression level was applied as an endogenous normalization factor. Hence, one pair primers were also designed for this house keeping gene using its published sequence in the GeneBank nucleic acid database. Then, Primer-BLAST tools in NCBI database was used to verify the specificity of the designed primers targeting β-actin. The real-time PCR was performed with primers specific for proPO and β-actin using SYBR Green master mix (TaKaRa Bio Inc. Kusatsu, Japan) by Magnetic Induction Cycler (Mic) PCR Machine (Australia). In summary, Real-time PCR was performed in triplicate for each gene listed in Table 2 , in 10 µL of reaction volume, containing 5 µL SYBR Green master mix (TaKaRa Bio Inc. Kusatsu, Japan), 0.18 µL of each forward and reverse primer, 1 µL of the synthesized cDNA from nauplii relevant to years 1994, 2001, 2003, 2005 and 2020, and RNase free water to bring the reaction mixture up to the final volume of 10 µL. Primers sequences and real-time -PCR conditions have been mentioned in Table 2 . Table 1: Primer sequences used for amplifying about 1400 bp of proPO mRNA Primers Sequences Accession number ProPOF22 F: 5 ﹶ - GTGATGAAGATGAGGAAACCGT-3 ﹶ R: 5 ﹶ - GGTATGCAAATGGTTCGTGG-3 ﹶ OQ784235 ProPOF33 F: 5 ﹶ - GAATTTTCTGCACTGGACA-3 ﹶ R: 5 ﹶ - CTTCTACGCCCTTGGAGATC-3 ﹶ OQ784237 ProPOF12 F: 5 ﹶ - GGACATGGAAGGCTGGAGAG3 ﹶ R: 5 ﹶ - GGTATGCAAATGGTTCGTGG3 ﹶ OQ784236 ProPOF31 F: 5 ﹶ - CGTCAGCGTTAGCAATGGTA3 ﹶ R: 5 ﹶ - CAATAGGACGATCAAATGGGA3 ﹶ OQ784234 Table 2: The sequences of the primers used in this study for doing real-time PCR and its programs Primers product size (bp) Sequences qPCR cycling program* T(s) proPO 191 F: 5 ﹶ -CGTCAGCGTTAGCAATGGTA-3 ﹶ R: 5 ﹶ - CACGAAAACAGACTCTTCTTGG -3 ﹶ D: 95 ( 30) A: 59 (27) E: 72 (25) β-actin 206 F: 5 ﹶ -GACTCTGGTGATGGTGTTTCT3 ﹶ R: 5 ﹶ -TCAAGGGCGACATAGCAAAG3 ﹶ D: 95 ( 30) A: 59 (27) E: 72 (25) *qPCR was started for two primers with initial denaturation at 95 °C for 10 min; D, denaturation; A, primer annealing; E, extension; F, forward; R, Reverse Abbreviation. T: temperature ( oC ), s: time in second Statistical analysis The alteration of proPO gene expression in years 1994, 2001, 2003, 2005 and 2020 was analyzed by the 2 −ΔΔCt method. In this method, ΔΔCt = ΔCt (yearX) – ΔCt (year 1994) and ΔCt = Ct ( proPO ) – Ct (β-actin). Ct value considers as a cycle threshold. In order for statistical comparison with other years, 1994 (with favorable salinity for brine shrimp) was considered as a control. In order to accurately identify the expression levels of proPO gene, normalization using the housekeeping gene β-actin was accomplished. Student’s t-test and one-way ANOVA were employed to compare between two groups and more than two groups, respectively. P-values < 0.05 were considered statistically significant. All experiments were repeated three times, and data were displayed as mean ± standard deviation. All analyzes were performed using SPSS software v22.0 (IBM, Armonk, NY, USA) and GraphPad Prism 6.01 was applied to plot all graphs. Results RNA extraction and RT-PCR (Reverse Transcription PCR) Qualitative and quantitative tests for extracted RNAs were done by 1% agarose gel electroforesis and NanoDrop (Thermo Fisher Scientific, Wilmington, USA) respectively. The appearance of ribosomal bands 28S and 18S on the gel indicated the good quality of the extracted RNAs. Nanodrop displayed that Concentration and purity (OD: absorbance at 260 nm and 280 nm ratio) of the RNAs were 300–600 ng/ul and 1.8-2, respectively. The PCR amplicons for proPO and β-actin were specifically synthesized by their primers (Fig. 1 a). Figure 1 b is the results from real-time PCR device. This figure depicts melting curve analysis of ProPO and β-actin. A single peak in the curves confirmed amplification of single product in each micro-tube and validated that no dimers and unspecific products interfere with the reaction. Sequencing results Sequencing the target regions confirmed that RT-PCR products represented the expected candidate gene. proPO-related sequences with their relevant accession numbers (Table 2 ) were deposited to NCBI. Furthermore, a 1365-bp sequence resulted from assembling of target sequences was submitted in NCBI with accession number OQ784174. To realize identity percent of the sequenced part of Artemia urmiana with two close species ( Artemia sinica and Artemia franciscana ) multiple sequence alignment was done by Clustal 2.1 (See supplementary data I). The result showed that the sequenced region of Artemia urmiana has 93.92% and 93.63% similarity with Artemia sinica and Artemia franciscana , respectively. Furthermore, according to phylogenetic tree results, Artemia sinica and Artemia franciscana are in one group and Artemia urmiana is in separate group. Increased expression of proPO and NLHS-induced proPO over the last three-decade ecological alterations The expression profile of the proPO gene in nauplii of Artemia urmiana under salinity crisis due to three decades ecological changes is shown in Fig. 2 . Under environmental tensions especially salinity and temperature stresses, the expression of proPO gene was significantly up-regulated compared with the control group (Nauplii from harvested cyst of Artemia urmiana in year 1994 with the salinity 160 ppt and temperature 28°C). The highest expression level was observed in year 2005 with the salinity 265 ppt and temperature 29.3°C (2.68 ± 0.26, p < 0.001) (Fig. 2 ). However, as shown in Fig. 2 , a significant decrease in proPO gene expression was demonstrated in 2020 (salinity 360 ppt and temperature 31.8°C) compared to 2005 (CI 95%, p = 0.008). Furthermore, as already mentioned, to assess how the immune system of nauplii exposed to long-term ecological changes responds to subsequent stresses, we exposed each group of nauplii (from harvested cyst of Artemia urmiana in year 1994, 2001, 2003, 2005 and 2020) to NLHS and subsequently analyzed proPO gene expression. Our results showed that all groups were able to significantly induce proPO , compared to the control group (Nauplii in1994 without NLHS exposure), but nauplii from the cyst harvested in 2020 could increase the expression more than others, which was 5.97 fold (5.97 ± 0.41, p < 0.0001) higher than the control group. (Fig. 2 ). The results of multiple comparisons of expression profile of proPO and also NLHS-induced proPO over the years 1994 to 2020 were summarized in Table S1 . Discussion Understanding environmental stress responses in animals living in changing ecosystems, especially aquatic inhabitants, is of great importance. Such an understanding must necessarily include the knowledge of the mechanisms that can occur in the vital systems of these organisms and, by adopting them, they can adapt to the harsh condition, live, survive and reproduce under changing climate (Fabbri et al., 2014; Blewett et al., 2022 ; Ravanbakhsh et al.,2023). These mechanisms mainly include genetic and epigenetic alterations that affect gene expression and cellular function (Schulte et al., 2011; Murray et al., 2022 ; Ravanbakhsh et al., 2023 ; Junprung et al., 2024 ). One of the systems inside animals that ensures the survival and continuity of the generation is a responsive immune system (Lutton and Callard, 2006 ; Stope, 2023 ). Crustaceans have only an innate immune system as a defense mechanism, in which the proPO system is regarded as avital component. In this system, prophenoloxidase (proPO) is a key enzyme of it (Fan et al., 2011 ; Tran et al., 2022 ). Based on evidence, the proPO system can be activated by pathogen components including microbial cell wall Lipopolysaccharide (LPS) and peptidoglycan (Cerenius et al., 2008 ; Patnaik et al., 2024 ) and it can also be affected by environmental factors such as pH, temperature and salinity (Pan et al., 2010 , Ge et al., 2020 ; Pazir et al., 2020 ; Kulkarni et al., 2021 ; Mengal et al., 2023 ). Pan and his group (2010) showed that low salinities negatively affect PO activity in the shrimp, Litopenaeus vannamei . In contrast, Ge and his team (Ge et al., 2020 ), who worked on impact of salinity on immune system of a shrimp specie named Exopalaemon carinicauda, demonstrated that prophenoloxidase system-related genes were up-regulated in low salinities. However, Pazir and his colleagues ( 2020 ) showed the effects of sudden changes in water parameters, including temperature, salinity, and pH, on decreased immune function and increased susceptibility to some infectious diseases. (Pazir et al., 2020 ). Bailey et al. ( 2017 ) and Traylor-Knowles and Connelly ( 2017 ) showed that changes of ambient temperature affect the immune system especially in aquatic organisms, thereby can compromise the resistance of these organisms to pathogens. Although there are some evidence to support the impact of transient environmental stressors (at experimental level) on the immune system, especially the proPO system (Pan et al., 2010 ; Bailey et al., 2017 ; Ge et al., 2020 ; Pazir et al., 2020 ; Rohr and Cohen, 2020 ; Byers, 2021 ; Hutson et al., 2023 ), there are limited studies available on the impact of ecological changes and environmental stressors, particularly long-term ones, on the immune system (Roy et al., 2022 ; Junprung et al., 2024 ). Regarding the impact of ecological changes on the marine ecosystems Bijma and his colleague ( 2013 ), indicated a dramatic effect of ecological changes on the flora and fauna of the marine ecosystems with significant changes in population distribution and decline in sensitive species. Furthermore, some research (Marcogliese, 2008 ; Segner et al., 2014 ; Rohr and Cohen, 2020 ; Byers, 2021 ; Hutson et al., 2023 ) demonstrated unexpected consequences of the environmental stressors, such as the occurrence of infectious diseases in aquatic ecosystems. Although diverse mechanisms involve in the incidence of these diseases in aquatic ecosystems, one of the important reasons seems to be the effect of the stressors on immune system (Palmer, 2018 ; Roy et al., 2022 ; Junprung et al., 2024 ). Therefore, in such situations where living organisms face long-term stresses, they must adopt intelligent measures or mechanisms to survive, reproduce, and save their generation from extinction (Roy et al., 2022 ; Junprung et al., 2024 ). One of these mechanisms could be to boost immune system trough up-regulating immune-related genes to cope with infectious diseases (Tort, 2011 ; Roy et al., 2022 ). In agreement with this fact and based on the gene expression analysis in present work, our results showed that the expression of proPO gene increased gradually to the highest level during the years 1995 to 2005 and decreased thereafter when the Artemia urmiana were exposed to an extreme salinity (360 ppt) and high temperature (31.8°C) in 2020. In this year, although our results showed a significant decrease in gene expression, it was still significantly high compared to 1995. Indeed, these results suggest that long-term exposure to ecological changes, especially increased salinity (up to ~ 265 ppt) and temperature (up to ~ 29); can positively affect the immune system by overexpressing the expression level of the Artemia urmiana proPO gene, which can be in accordance with previous research (Boraschi and Italiani, 2018 ; Penkov et al., 2019 ; Roy et al., 2022 ; Zhou and Wang, 2023 ). These studies demonstrated changing aquatic ecosystems and environmental stresses such as salinity, temperature changes, and pathogens as threats to aquatic organisms, which often respond with adaptive strategies to enhance survival, including strengthening immune systems (Tort, 2011 ; Roy et al., 2022 ; Zhou and Wang, 2023 ). Given that Artemia species is an aquatic crustacean, one of the pivotal component of its innate immune system is the prophenoloxidase (proPO) system. Various studies have proven that overexpression of some immune-related genes occur due to the induction of innate immune, which is essential for adaptive immunity and resistance to disease and harsh environment. (Boraschi and Italiani, 2018 ; Penkov et al., 2019 ; Roy et al., 2022 ). In addition, to support these claims and our results, recent scientific findings of Ge et al. ( 2020 ), Kulkarni et al. ( 2021 ) and Mengal and et al. ( 2023 ) and Patnaik and colleagues ( 2024 ) demonstrated that activation of proPO in crustaceans, In addition to being able to control pathogens in the surrounding environment through its antimicrobial role, can also facilitate the catalysis of the hardening or sclerotization of the newly formed exoskeleton of aquatic animals, which may be essential for protecting their vulnerable soft bodies under adverse environmental conditions. Moreover, Fagutao and colleagues ( 2009 ) found that the lack of proPO in shrimp results in higher mortality due to its crucial role in maintaining homeostasis. In addition to survival, another fundamental goal of these organisms is to pass on these adaptive traits and capabilities to their offspring so that the subsequent generations can also respond swiftly and efficiently to their surrounding persistent environmental stressors. To achieve this objective, living organisms may apply a variety of ways. Recent findings suggest that one of the strategies is transgenerational innate immune memory (Roy et al., 2022 ) to provide an opportunity to create offspring with increased disease resistance and reduce mortality (Roy et al., 2022 ; Junprung et al., 2024 ). Junprung and his colleagues ( 2024 ) demonstrated that thermal adaptation over 12 generations of Artemia franciscana affects immune system of Artemia by modulating immune-related genes, notably upregulating peroxinectin (PX) and clip-SP, which are involved in the immune response (Sivakamavalli et al., 2016 ; Cai et al., 2020 ; Jiang et al., 2023 ). Although our study did not assess PX expression specifically, literature indicates that its expression can be directly or indirectly upregulated in response to proPO overexpression (Sivakamavalli et al., 2016 ), suggesting further investigation is warranted. Moreover, based on our results, severe ecological changes in 2020 (salinity ~ 360 ppt and temperature > 31°C) resulted in reduced proPO gene expression, which could be consistent with previous findings (Deane et al., 2002 ; Tine et al., 2010 ), suggesting a threshold for any chronic environmental stress that can affect gene expression. Additionally, under extreme conditions, organisms may shift priorities specifically towards survival by overexpressing critical genes related to metabolism or stress management, although this requires further investigation (Junprung et al., 2024 ). In addition to prolonged ecological changes on immune system, our results of NLHS-induced proPO showed remarkable increase of proPO gene expression of nuaplii of Artemia urmiana living in different years following NLHS compared to non-heating ones, which is consistent with Junprung and colleagues ( 2017 ). This study demonstrated up-regulation of some immune-related genes, including proPO in NLHS shrimp, suggesting that NLHS could induce proPO activating-system in this animal. Moreover, our results showed despite the decrease in proPO gene expression in nauplii living in 2020, a significant increase in NLHS-induced proPO gene expression was observed in 2020 more than in other years. In fact, this finding suggested that previous exposure to chronic environmental stressors may allow those organisms to better handle further stressors and maintain physiological homeostasis (Hua et al., 2014 ; Junprung et al., 2024 ) In addition to aforementioned discuss, the adaptive evolution has been also ascribed to occurrence of genetic variation (Sharopova, 2008 ; Yuan et al., 2021 ) and/or epigenetic reprogramming, which are broadly determined as sustained changes in genetic or cellular levels (Chen et al., 2015 ; Sánchez-Ramón et al., 2018 ) resulting from prolonged ecological changes. Consequently, this research defines that the enhanced expression of proPO (as an immune-related gene in Artemia urmiana ) over the past three decades of ecological changes not only may facilitate adaptation to harsh conditions, but also through passing on this adaptive ability to the next generation contributes to the generation of offspring with enhanced disease resistance and improved adaptive capacity to thrive in challenging environmental conditions. Our findings from NLHS experiment also pose an important and interesting fact that previous exposure to chronic environmental stressors may provide an advantage to those organisms when they encounter a further stressor. Furthermore, given that there are limited reports on prolonged ecological effects on the immune response, the potential mechanisms by which long-term stressors induce innate immune system remain to be elucidated and call for further research. Declarations Acknowledgments: This research was supported by Artemia and Aquaculture Research Institute, Urmia University, Urmia, Iran (Grant Number: 002/A/1400). We hereby express our gratitude to the Artemia and Aquaculture Research Institute, Urmia University, Urmia, Iran, for providing all kinds of support during the conduct of this study. CRediT authorship contribution statement: Writing original draft – review & editing, Methodology, Investigation, Formal analysis, Data curation, Conceptualization, Supervision, Project administration: [Reyhaneh Ravanbakhsh], Writing – review & editing, Investigation, Methodology, Data curation, Conceptualization: [Naser Agh],Writing – review & editing, Methodology, Conceptualization [Peter Bossier]. Data availability: Data supporting the findings of this work are available within the article and its supplementary materials. Funding: This work was supported by Artemia and Aquaculture Research Institute, Urmia University, Urmia, Iran (Grant Number: 002/A/1400). Competing Interests: There are no conflicts of interest to declare. Consent for publication: All authors have given their consent for publication. References Agh N, Abatzopoulos TJ, Kappas I, Van Stappen G, Razavi Rouhani SM, Sorgeloos P (2007) Coexistence of sexual and parthenogenetic Artemia populations in Lake Urmia and neighbouring lagoons. Int Rev Hydrobiol 92: 48-60. https://doi.org/10.1002/iroh.200610909. Agh N, Van Stappen G, Bossier P, Sepehri H, Lotfi V, Rouhani SM, Sorgeloos P (2008) Effects of salinity on survival, growth, reproductive and life span characteristics of Artemia populations from Urmia Lake and neighboring lagoons. Pak J Biol Sci 11: 164-172. https://doi.org/10.3923/pjbs.2008.164.172. Ahmadifard N, Rezaei Aminlooi V, Tukmechi A, Agh N (2019) Evaluation of the impacts of long-term enriched Artemia with Bacillus subtilis on growth performance, reproduction, intestinal microflora, and resistance to Aeromonas hydrophila of ornamental fish Poecilia latipinna. Probiotics Antimicrob Proteins 11: 957-965. https://doi.org/10.1007/s12602-018-9453-4. Albarano L, Ruocco N, Lofrano G, Guida M, Libralato G (2022) Genotoxicity in Artemia spp.: an old model with new sensitive endpoints. Aquat Toxicol 106320. https://doi.org/10.1016/j.aquatox.2022.106320. Anufriieva E V, Shadrin NV (2023) General Patterns of Salinity Influence on the Energy Balance of Aquatic Animals in Hypersaline Environment. Biol Bull Rev 13: 420-430. Asem A , Eimanifar A, Van Stappen G, Sun SC (2019) The impact of one-decade ecological disturbance on genetic changes: a study on the brine shrimp Artemia urmiana from Urmia Lake, Iran. PeerJ 7 e7190. https://doi.org/10.7717/peerj.7190. Banti C N, Hadjikakou SK (2021) Evaluation of toxicity with brine shrimp assay. Bio-protocol 11: e3895-e3895. : https://doi.org/10.21769/BioProtoc.3895. Bailey C, Segner H, Casanova-Nakayama A, Wahli T (2017) Who needs the hotspot? The effect of temperature on the fish host immune response to Tetracapsuloides bryosalmonae the causative agent of proliferative kidney disease. Fish Shellfish Immunol 63: 424-437. https://doi.org/10.1016/j.fsi.2017.02.039. Bijma J, Pörtner HO, Yesson C, Rogers AD (2013) Climate change and the oceans–What does the future hold?. Mar Pollut Bull 74: 495-505. http://dx.doi.org/10.1016/j.marpolbul.2013.07.022. Blewett T A, Binning SA, Weinrauch AM, Ivy CM, Rossi GS, Borowiec BG, Norin T (2022) Physiological and behavioural strategies of aquatic animals living in fluctuating environments. J Exp Biol 225: jeb242503. https://doi.org/10.1242/jeb.242503. Boraschi D, Italiani P (2018) Innate immune memory: time for adopting a correct terminology. Front Immunol 9: 799. https://doi.org/10.3389/fimmu.2018.00799. Byers J E (2021) Marine parasites and disease in the era of global climate change. Ann Rev Mar Sci 13: 397-420. https://doi.org/10.1146/annurev-marine-031920-100429. Cai S, Huang Y, Jian J, Yang S (2020). The functional characterization of peroxinectin in the defense of Fenneropenaeus penicillatus against pathogens. Dev Comp Immunol 104: 103538. https://doi.org/10.1016/j.dci.2019.103538. Cerenius L, Lee BL, Söderhäll K (2008) The proPO-system: pros and cons for its role in invertebrate immunity. Trends Immunol 29: 263-271. https://doi.org/10.1016/j.it.2008.02.009. Chen B, Li S, Ren Q, Tong X, Zhang X, Kang L (2015) Paternal epigenetic effects of population density on locust phase‐related characteristics associated with heat‐shock protein expression. Mol Ecol 24: 851-862. https://doi.org/10.1111/mec.13072. Deane E, Kelly ESP, Luk JC, Woo NY (2002) Chronic salinity adaptation modulates hepatic heat shock protein and insulin-like growth factor I expression in black sea bream. Mar Biotechnol 4: 193-205. https://doi.org/10.1007/PL00021690. Demir E, Ceccobelli S, Bilginer U, Pasquini M, Attard G, Karsli T (2022) Conservation and selection of genes related to environmental adaptation in native small ruminant breeds: a review. Ruminants 2: 255-270. https://doi.org/10.3390/ruminants2020017. Dervis K (2016) Reflections on Progress: Essays on the Global Political Economy. Brookings Institution Press. Fabbri E, Dinelli E (2014) Physiological responses of marine animals towards adaptation to climate changes. The Mediterranean Sea: Its history and present challenges 401-417. https://doi.org/10.1007/978-94-007-6704-1_23. Fan T, Wang L, Fan X, Xu B, Yu M, Jiang G (2011) A prophenoloxidase from Artemia sinica: cDNA cloning, expression and activity analysis during early development. Fish Shellfish Immunol 31: 1059-1064. https://doi.org/10.1016/j.fsi.2011.09.006. Ge Q, Li Z, Li J, Wang J, Li J (2020) Effects of acute salinity stress on the survival and prophenoloxidase system of Exopalaemon carinicauda. Acta Oceanol Sin 39: 57-64. https://doi.org/10.1007/s13131-020-1582-4. Günther R T (1899) Contributions to the geography of Lake Urmi and its neighbourhood. Geogr J 14: 504-523. https://doi.org/10.2307/1774539. Hua J, Jones DK, Relyea RA (2014) Induced tolerance from a sub lethal insecticide leads to cross-tolerance to other insecticides. Environ Sci Technol 48: 4078-4085. https://doi.org/10.1021/es500278f. Huang Y, Ren Q (2020) Research progress in innate immunity of freshwater crustaceans. Dev Comp Immunol 104: 103569. https://doi.org/10.1016/j.dci.2019.103569. Hutson KS, Davidson IC, Bennett J, Poulin R, Cahill PL (2023) Assigning cause for emerging diseases of aquatic organisms. Trends Microbiol 31: 681-691. https://doi.org/10.1016/j.tim.2023.01.012. Fagutao F, Koyama T, Kaizu A, Saito‐Taki T, Kondo H, Aoki T, Hirono I (2009) Increased bacterial load in shrimp hemolymph in the absence of prophenoloxidase. FEBS J 276: 5298-5306. https://doi.org/10.1111/j.1742-4658.2009.07225.x. Jacobson KC, Arkoosh MR, Kagley AN, Clemons ER, Collier TK, Casillas E (2003) Cumulative effects of natural and anthropogenic stress on immune function and disease resistance in juvenile Chinook salmon. J Aquat Anim Health 15: 1-12. https://doi.org/10.1577/1548-8667(2003)0152.0.CO;2. Jiang C, Feng M, Fan R, Wang C, Shu G, Qiu Y, Dai L (2023) Molecular cloning and functional characterization of peroxinectin from red swamp crayfish, Procambarus clarkii. Fish Shellfish Immunol 143: 109206. https://doi.org/10.1016/j.fsi.2023.109206. Joshua WJ, Kamarudin MS, Ikhsan N, Yusoff FM, Zulperi Z (2022) Development of enriched Artemia and Moina in larviculture of fish and crustaceans: a review. Lat Am J Aquat Res 50: 144-157. http://dx.doi.org/10.3856/vol50-issue2-fulltext-2840. Junprung W, Supungul P, Tassanakajon A (2017) HSP70 and HSP90 are involved in shrimp Penaeus vannamei tolerance to AHPND-causing strain of Vibrio parahaemolyticus after non-lethal heat shock. Fish Shellfish Immunol 60: 237-246. https://doi.org/10.1016/j.fsi.2016.11.049. Junprung W, Nanakorn Z, Norouzitallab P, Supungul P, Vanrompay D, Bossier P, Tassanakajon A (2024) Thermal adaptation affects expression and regulation of metabolism-, stress-, and immune-related genes in Artemia franciscana populations. Aquac Rep 39: 102511. https://doi.org/10.1016/j.aqrep.2024.102511. Kulkarni A, Krishnan S, Anand D, Kokkattunivarthil Uthaman S, Otta SK, Karunasagar I, Kooloth Valappil R (2021) Immune responses and immunoprotection in crustaceans with special reference to shrimp. Rev Aquac 13: 431-459. https://doi.org/10.1111/raq.12482. Kültz D (2015) Physiological mechanisms used by fish to cope with salinity stress. The Journal of Experimental Biology 218: 1907-1914. https://doi.org/10.1242/jeb.118695. Kumar R, Kumar V (2018) A review of phylogeography: biotic and abiotic factors. Geology, Ecology, and Landscapes 2: 268-274. https://doi.org/10.1080/24749508.2018.1452486. Lutton B, Callard I (2006) Evolution of reproductive–immune interactions. Integr Comp Biol 46: 1060-1071. https://doi.org/10.1093/icb/icl050. Lazarus RJ (2023) The making of environmental law. University of Chicago Press. Marcogliese DJ (2008) The impact of climate change on the parasites and infectious diseases of aquatic animals. Rev Sci Tech 27: 467-484. Martin LB, Hopkins WA, Mydlarz LD, Rohr JR (2010) The effects of anthropogenic global changes on immune functions and disease resistance. Ann NY Acad Sci 1195: 129-148. https://doi.org/10.1111/j.1749-6632.2010.05454.x. Mengal K, Kor G, Kozak P, Niksirat H (2023) Effects of environmental factors on the cellular and molecular parameters of the immune system in decapods. Comparative Biochemistry and Physiology Part A: Mol Integr Physiol 276, 111332. https://doi.org/10.1016/j.cbpa.2022.111332. Murray, KO, Clanton TL, Horowitz M (2022) Epigenetic responses to heat: from adaptation to maladaptation. Exp Physiol 107: 1144-1158. https://doi.org/10.1113/EP090143. Nikraftar Z, Parizi E, Hosseini SM, Ataie-Ashtiani B (2021) Lake Urmia restoration success story: A natural trend or a planned remedy?. J Great Lakes Res 47: 955-969. https://doi.org/10.1016/j.jglr.2021.03.012. Palmer CV (2018) Immunity and the coral crisis. Commun Biol 1: 91. https://doi.org/10.1038/s42003-018-0097-4. Pan L, Xie P, Hu F (2010) Responses of prophenoloxidase system and related defence parameters of Litopenaeus vannamei to low salinity. J Ocean Univ China 9: 273-278. https://doi.org/10.1007/s11802-010-1711-3. Patnaik BB, Baliarsingh S, Sarkar A, Hameed AS, Lee YS, Jo YH, Han YS, Mohanty J (2024) The role of pattern recognition receptors in crustacean innate immunity. Rev Aquac 16: 190-233. https://doi.org/10.1111/raq.12829. Penkov S, Mitroulis I, Hajishengallis G, Chavakis T (2019) Immunometabolic crosstalk: an ancestral principle of trained immunity?. Trends Immunol 40: 1-11. https://doi.org/10.1016/j.it.2018.11.002. Piper J (2018) Artemia: A Model Specimen for Educational Microscopy Projects in Biological and Ecological Fields. Microscopy Today 26: 12-19. https://doi.org/10.1017/S1551929518000652. Pazir MK, Ajdari A, Ghawampour A (2020) The effect of gradually decline of salinity on haemolymph parameters of adult shrimp Litopenaeus vannamei (Boone, 1931). Sust aquac manag J 6: 19-28. https://doi.org/10.29252/ijaah.6.1.19. Rasyid MI, Yuliani H, Triandita N, Angraeni L, Anggriawin M (2022) Toxicity Test of Laban Fruits (Vitex pinnata Linn) by Using Brine Shrimp Lethality Test (BSLT) Methode. In IOP Conference Series: Earth Environ Sci 1059: 01205. IOP Publishing. Rahimi A, Breuste J (2021) Why is Lake Urmia drying up? Prognostic modeling with land-use data and artificial neural network. Front Environ Sci 9: 603916. https://doi.org/10.3389/fenvs.2021.603916. Rahman MM, Sorgeloos P (2022) A training manual on Artemia cyst hatching and decapsulation. Ravanbakhsh R, Agh N, Nouraein M, Bossier P (2023) Prolonged ecological changes can affect morphometrics and gene expression profile? Focusing on Hsp-70 and NLHS-induced Hsp-70 of Artemia urmiana. Environmental Research 238: 117254. https://doi.org/10.1016/j.envres.2023.117254. Rohr JR, Cohen JM (2020) Understanding how temperature shifts could impact infectious disease. PLoS biol 18: e3000938. https://doi.org/10.1371/journal.pbio.3000938. Roy S, Baruah K, Bossier P, Vanrompay D, Norouzitallab P (2022) Induction of transgenerational innate immune memory against Vibrio infections in a brine shrimp (Artemia franciscana) model. Aquac 557: 738309. https://doi.org/10.1016/j.aquaculture.2022.738309. Sánchez-Ramón S, Conejero L, Netea MG, Sancho D, Palomares Ó, Subiza JL (2018) Trained immunity-based vaccines: a new paradigm for the development of broad-spectrum anti-infectious formulations. Front Immunol 9: 2936. https://doi.org/10.3389/fimmu.2018.02936. Segner H, Schmitt-Jansen M, Sabater S (2014) Assessing the impact of multiple stressors on aquatic biota: the receptor’s side matters. Environ Sci Technol 48:7690-7696. https://doi.org/10.1021/es405082t. Sharopova N (2008) Plant simple sequence repeats: distribution, variation, and effects on gene expression. Genome 51: 79-90. https://doi.org/10.1139/G07-110. Shears NT, Ross PM (2010) Toxic cascades: multiple anthropogenic stressors have complex and unanticipated interactive effects on temperate reefs. Ecol lett 13: 1149-1159. https://doi.org/10.1111/j.1461-0248.2010.01512.x. heibani S, Ataie-Ashtiani B, Safaie A, Simmons CT (2020) Influence of lakebed sediment deposit on the interaction of hypersaline lake and groundwater: A simplified case of lake Urmia, Iran. J Hydrol 588: 125110. https://doi.org/10.1016/j.jhydrol.2020.125110. SchultePM, Healy TM, Fangue NA (2011) Thermal performance curves, phenotypic plasticity, and the time scales of temperature exposure. Integr Comp Biol 51: 691-702. https://doi.org/10.1093/icb/icr097. Sivakamavalli J, Selvaraj C, Singh SK, Vaseeharan B (2016) In vitro and in silico studies on cell adhesion protein peroxinectin from Fenneropenaeus indicus and screening of heme blockers against activity. J Mol Recognit 29: 186-198. https://doi.org/10.1002/jmr.2516. Stope MB (2023) The Connection between Immunocompetence and Reproduction in Wildlife. Life 13: 785. https://doi.org/10.3390/life13030785. Tine M, Bonhomme F, McKenzie DJ, Durand JD (2010) Differential expression of the heat shock protein Hsp70 in natural populations of the tilapia, Sarotherodon melanotheron, acclimatised to a range of environmental salinities. BMC Ecol 10: 1-8. https://doi.org/10.1186/1472-6785-10-11. Tort L (2011) Stress and immune modulation in fish. Dev Comp Immunol 35: 1366-1375. https://doi.org/10.1016/j.dci.2011.07.002. Tran NT, Liang H, Zhang M, Bakky MA, Zhang Y, Li S (2022) Role of cellular receptors in the innate immune system of crustaceans in response to white spot syndrome virus. Viruses 14: 743. https://doi.org/10.3390/v14040743. Traylor-Knowles N, Connelly MT (2017) What is currently known about the effects of climate change on the coral immune response. Curr Clim Change Rep 3: 252-260. Velasco J, Gutiérrez-Cánovas C, Botella-Cruz M, Sánchez-Fernández D, Arribas P, Carbonell JA, Millán A, Pallarés S (2019) Effects of salinity changes on aquatic organisms in a multiple stressor context. Phil Trans R Soc B 374: 20180011. https://doi.org/10.1098/rstb.2018.0011. Yuan J, Zhang X, Wang M, Sun Y, Liu C, Li S, Yu Y, Gao Y, Liu F, Zhang X, Kong J (2021) Simple sequence repeats drive genome plasticity and promote adaptive evolution in penaeid shrimp. Commun Biol 4: 186. https://doi.org/10.1038/s42003-021-01716-y. Zhou L, Wang S (2023) The bright side of ecological stressors. Trends Ecol Evol 38: 568-578. https://doi.org/10.1016/j.tree.2023.01.010. Additional Declarations No competing interests reported. Supplementary Files SupplementaryDataformultiplesequencealignment.docx TableS1.docx Cite Share Download PDF Status: Published Journal Publication published 10 Feb, 2026 Read the published version in Aquatic Ecology → Version 1 posted Editorial decision: Revision requested 19 Dec, 2025 Reviews received at journal 17 Dec, 2025 Reviewers agreed at journal 01 Dec, 2025 Reviewers agreed at journal 21 Sep, 2025 Reviews received at journal 17 Sep, 2025 Reviewers agreed at journal 08 Sep, 2025 Reviewers invited by journal 02 Sep, 2025 Editor assigned by journal 28 Aug, 2025 Submission checks completed at journal 26 Aug, 2025 First submitted to journal 25 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7453914","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":510476482,"identity":"969cffa9-521a-4616-bb31-44388dd90269","order_by":0,"name":"Reyhaneh Ravanbakhsh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/ElEQVRIiWNgGAWjYBCDBAYeHgZmhgogkxkiwkOkljMka2FsI8JB5g28Dz/z1NzJ4+85e/hz4bzD+brtzA8YftQwyJg3YNcic4DdWJrn2LNiibN9adIztx223HaYzYCx5xgDj8wB7FokGNgYJGewHU5sOM9jxsy77bCB2WEGAwbeBgYeCRwOA2ph/jnj3+HE+ed5jD/zzgFpYf/A+Be/FjaJj22HEzec7TGQ5m0AaeExYMZrCzMbm8XHvsPFhmfOmAE9lQ7SUnBY5pgEbi3sbcw3Er4dzpM7k2MMDDprA7Pzxzc+fFNjY49LCyziUMEBkItHwSgYBaNgFJAPAHUqT3FoIkyEAAAAAElFTkSuQmCC","orcid":"","institution":"Urmia University","correspondingAuthor":true,"prefix":"","firstName":"Reyhaneh","middleName":"","lastName":"Ravanbakhsh","suffix":""},{"id":510476483,"identity":"1af699d5-8f02-40e8-a7dc-0b178ef46892","order_by":1,"name":"Naser Agh","email":"","orcid":"","institution":"Urmia University","correspondingAuthor":false,"prefix":"","firstName":"Naser","middleName":"","lastName":"Agh","suffix":""},{"id":510476484,"identity":"d627a0f4-8100-403e-88a9-961cbe076baa","order_by":2,"name":"Peter Bossier","email":"","orcid":"","institution":"Ghent University","correspondingAuthor":false,"prefix":"","firstName":"Peter","middleName":"","lastName":"Bossier","suffix":""}],"badges":[],"createdAt":"2025-08-25 12:53:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7453914/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7453914/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10452-026-10268-4","type":"published","date":"2026-02-10T15:58:12+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90949026,"identity":"b0cdfa66-322f-4df6-92f1-384d0099eb94","added_by":"auto","created_at":"2025-09-09 22:24:54","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":292349,"visible":true,"origin":"","legend":"\u003cp\u003eExpression \u003cem\u003eproPO\u003c/em\u003e gene in \u003cem\u003eArtemia urmiana\u003c/em\u003e nauplii. \u003cstrong\u003eA\u003c/strong\u003e Amplified \u003cem\u003eproPO\u003c/em\u003e and \u003cem\u003eβ-actin \u003c/em\u003eon %2 agarose gel. \u003cstrong\u003eB\u003c/strong\u003e Melting curves of \u003cem\u003eβ-actin \u003c/em\u003e(peaks leaning to the left)\u003cem\u003e \u003c/em\u003eand\u003cem\u003e proPO \u003c/em\u003e(peaks tending to the right)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7453914/v1/d3025c1b9b1bb29e220388b4.png"},{"id":90949159,"identity":"219fc8a6-c42f-490d-a91e-3994e009e61d","added_by":"auto","created_at":"2025-09-09 22:32:54","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":980427,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of \u003cem\u003eproPO\u003c/em\u003e over three decades from the years 1994 to 2020 in \u003cem\u003eArtemia urmiana\u003c/em\u003e nauplii. Left chart depicts original expression of \u003cem\u003eproPO\u003c/em\u003e over three decades and right one relates to NLHS-induced \u003cem\u003eproPO\u003c/em\u003e expression in those years. Fold change= 2\u003csup\u003e−ΔΔCt\u003c/sup\u003e, ΔΔCt = ΔCt (\u003cem\u003eproPO \u003c/em\u003ein Year 2001, 2003, 2005 or 2020) - ΔCt (\u003cem\u003eproPO \u003c/em\u003ein year 1994 (nauplii) as a control). * p\u0026lt;0.05, ** p\u0026lt;0.01, *** p\u0026lt;0.001. Fold changes were calculated relative to nauplii 1994.\u003c/p\u003e\n\u003cp\u003eArtemia samples were harvested fromcenter of Urmia Lake (Under Shahid Kalantari Bridge). Details of statistical analysis were mentioned in Table S1.\u003c/p\u003e\n\u003cp\u003eAbbreviation. Std: standard deviation, NLHS: non-lethal heat shock\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7453914/v1/437673c549404afac5b78e84.png"},{"id":102785447,"identity":"494e953d-da02-411e-adad-5601790c6e1c","added_by":"auto","created_at":"2026-02-16 16:06:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2413387,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7453914/v1/a1f57f8d-b7f5-48ed-b8f3-e5ddbbdbb87b.pdf"},{"id":90949024,"identity":"c7829413-d531-44c8-b4ac-9c7034435528","added_by":"auto","created_at":"2025-09-09 22:24:54","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":24876,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryDataformultiplesequencealignment.docx","url":"https://assets-eu.researchsquare.com/files/rs-7453914/v1/0ea65a312db61b1b53dd819b.docx"},{"id":90949027,"identity":"c4ddd23b-ff1e-4269-bbb3-8b34a12783c8","added_by":"auto","created_at":"2025-09-09 22:24:54","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":16417,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7453914/v1/c6809749f72b11dbfca0e830.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Immune system of aquatic organisms can be affected by long-term ecological alterations? Focusing on Prophenoloxidase (proPO) and NLHS-induced proPO gene expression of Artemia Urmiana","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRecently, one of the biggest challenges in our world is ecological changes (Dervis, K., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Lazarus, R., 2023). As a result of these changes, mass mortalities and economic losses of animals living in those ecosystems have been recorded (Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Urmia Lake, second largest hypersaline lake globally (Nikraftar et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) located in Northwest Iran at coordinates 37◦20\u0026prime; E\u0026ndash;45◦40\u0026prime;N and positioned at 1278 meters above sea level, is one of the affected aquatic ecosystems (Sheibani et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). It has been subjected to severe ecological alterations, with more than 90 percent of the lake's surface disappearing (Rahimi and Breuste, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and the salinity of Urmia Lake has increased from 165 ppt in 1994 to supersaturated level (~\u0026thinsp;360 ppt) in 2020. (Sheibani et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). According to many literatures, these tensions can inflict a notable threat to the organisms living in it (Asem et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ravanbakhsh et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In these circumstances, only organisms that can develop some degree of adaptation to fluctuating environmental stressors particularly high salinity levels and temperature increment, would survive and continue their generation (Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eOne of these creatures is a unique brine shrimp specie named \u003cem\u003eArtemia urmiana\u003c/em\u003e G\u0026uuml;nther (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e1899\u003c/span\u003e\u003cem\u003e)\u003c/em\u003e (G\u0026uuml;nther R.,1899), which has been living under these stresses in Urmia Lake for decades. This valuable unique zooplankton has numerous applications, especially within the fisheries sector. This organism can be employed as a live food source in aquaculture, with a specific emphasis on larviculture (Ahmadifard et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2019\u003c/span\u003e), used for drug delivery (Joshua et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), toxicity assay (Banti and Hadjikakou, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Rasyid et al., \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) and pedagogic and research purposes as a model organism in various bioscience reseach (Piper et al., 2018; Albarano et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Although these micro-crustacean species are potentially adapted to live in tough conditions (Agh et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), it is evident that a variety of environmental tensions, including changes in temperature, salinity, dissolved oxygen, and pH, can affect morphology (Ravanbakhsh et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), growth, survival, and most importantly, the immune system of Artemia (Anufriieva and Shadrin, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Hence, in such ecological tension, Artemia organisms that are able to survive are forced to rectify the imbalances created by the stressor (Tort, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) and apply the suitable adaptive response (Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Subsequently these organisms would attempt to pass these abilities on to the next generation to impede population extinction (Demir et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). One of the important systems which are influenced by long-term ecological alterations is innate immune system of Artemia. It sounds that; survivors should evoke a series of mechanisms by which they can keep their immune system in the best shape to deal with the harsh conditions and any surrounding pathogen (Tort, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2011\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eUnderstanding these mechanisms and how the immune system responds to long-term ecological alterations has aroused curiosity and interest of researchers and has not yet been clearly explored. Since Artemia populations belong to aquatic crustacean, a key system in innate immune of this genus is (prophenoloxidase) proPO system (Huang et al., 2020; Kulkarni et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Patnaik et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Prophenoloxidase, which is coded by \u003cem\u003eproPO\u003c/em\u003e gene, is one of the vital enzymes in this system. Pivotal roles of proPO system in Artemia are pathogen recognition and defense against it (Patnaik et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e), as well as the response to fluctuations in environmental factors (Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Kulkarni et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2021\u003c/span\u003e\u0026rsquo; Mengal et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) through maintaining homeostasis (Fagutao et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) and catalyzing the sclerotization of their newly formed exoskeleton, which is essential to protect their soft bodies in harsh conditions (Mengal et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Patnaik et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In fact, prophenoloxidase can be activated by biotic or regulated by abiotic factors (Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Mengal et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Patnaik et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Microbial cell wall components of pathogen, including β-1, 3-glucan, lipopolysaccharide (LPS) and peptidoglycan are considered as biotic factors and environmental and experimental factors containing climate, salinity, pH, temperature, etc., can be fallen into abiotic factors (Kumar and Kumar, 2018; Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). According to many studies, among abiotic factors, salinity and temperature are the most important ones, which can directly affect the survival, growth, immune system, and metabolism of a variety of aquatic organisms (Pan et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; K\u0026uuml;ltz, D., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Velasco et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Anufriieva and Shadrin, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The mechanism of the proPO system activation in crustaceans induced by biotic factors has been well documented (Kumar and Kumar, 2018; Velasco et al., \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Anufriieva and Shadrin, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e); however, there is still little information on how proPO system responds to long-term ecological changes.\u003c/p\u003e\u003cp\u003eHence, in light of global warming and climate change and occurrence of ecological changes, especially in aquatic ecosystems, this research aimed to evaluate the response of prophenoloxidase system-related gene named \u003cem\u003eproPO\u003c/em\u003e to three-decade ecological changes in Urmia Lake. Furthermore, this study set out to investigate the response of \u003cem\u003eproPO\u003c/em\u003e gene in nauplii of \u003cem\u003eArtemia urmiana\u003c/em\u003e originating from rainy to drought periods to subsequent stresses such as NLHS, in order to answer the question of whether prior experience with chronic stressors might confer an advantage to those animals when exposed to a subsequent stressful factor.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eSample Collection\u003c/h2\u003e\n \u003cp\u003eThe cysts of \u003cem\u003eArtemia urmiana\u003c/em\u003e used in this study were provided by Artemia and Aquaculture Research Institute Cyst Bank, collected over the past three decades from different geographical localities of Urmia Lake in Iran. The years chosen for this research were 1994, 2001, 2003, 2005 and 2020. Geographical location of sampling was at coordinates at 37\u0026deg;47\u0026acute;06.02˝N, 45\u0026deg;22\u0026acute;19.95˝E, which corresponds to the location beneath Shahid Kalantari Bridge. All harvested cysts had been specified to be bisexual in accordance with Agh et al. (\u003cspan class=\"CitationRef\"\u003e2007\u003c/span\u003e). Additionally, to ensure proper storage conditions for the cysts, the hatching process was performed on all cysts harvested from 1994 to 2020.\u003c/p\u003e\n \u003cp\u003eThe specifications of sampling years were reported in detail in the research conducted by Ravanbakhsh and colleagues (Ravanbakhsh et al., \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e). The study reported an increase in temperature and salinity of Urmia Lake over the last three decades from 165 ppm to 360 and 28\u0026deg;C to 31.8\u0026deg;C, respectively.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eArtemia Hatching and culture procedure\u003c/h3\u003e\n\u003cp\u003eTo investigate expression profile of \u003cem\u003eArtemia urmiana\u003c/em\u003e nauplii, all cysts should be first decapsulated and hatched. In decapsulation process, the external shell of cysts is chemically removed and only the embryo surrounded by the inner cuticular membrane is left. Decapsulation was accomplished according to the protocol described by Rahman and Sorgeloos (\u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). Briefly, before hatching, in order to get rid of any debris and salt, which might affect subsequent experiments such as RNA extraction, the cysts underwent an initial washing step by tap water. The cleaned cysts were then hydrated in a funnel-shaped tube containing fresh water for 1\u0026ndash;2 hour with bottom diffused aeration at room temperature (20\u0026ndash;25\u0026deg;C). After 1\u0026ndash;2 h, to dissolve the chorions, the cysts in a hydrated state were transferred into a sterile container and the suspension is diluted with an equal volume of liquid bleach (NaOCl) and water, and also in order to enhance pH and get a fast oxidation reaction; a few drops of NaOH can be applied. It is worth mentioning that strong aeration is required during this process. After about 5 minutes, color of the cysts altered from dark brown to orange. Appearance of bright orange color was a sign of dissolving the chorions and completion of decapasulation. This process was also further monitored under a stereoscopic microscope to ensure that the chorions were completely disappeared. Decapsulated cysts must then be immediately filtered and thoroughly rinsed with tap water to eliminate all traces of hypochlorite, because, prolonged exposure to the bleach may harm embryos. Decapsulated cysts were maintained under isothermal conditions at 28\u0026deg;C for a period of 22 hours in conical containers filled with filtered Urmia Lake water, which is diluted to 33 g/l and mild aeration. The water temperature was adjusted using a thermostatic heater. After this period, the newly-hatched nauplii from each year were subjected to RNA extraction to evaluate the effect of three-decade ecological changes on \u003cem\u003eproPO\u003c/em\u003e gene expression, and the rest were cultured at 28\u0026deg;C according to the procedure described by Agh et al. (\u003cspan class=\"CitationRef\"\u003e2008\u003c/span\u003e), and kept in new containers until instar II stage for the NLHS experiment.\u003c/p\u003e\n\u003ch3\u003eNLHS (Non-Lethal Heat Shock)\u003c/h3\u003e\n\u003cp\u003eTo assess whether exposure of organisms to long-term stressors can affect their tolerance to secondary stressors (herein NLHS and evaluation through induction of \u003cem\u003eproPO\u003c/em\u003e gene expression), we designed the NLHS experiment. To conduct the NLHS experiment, Artemia urmiana nauplii at instar II stage were selected, counted volumetrically and then based on the year of harvest (1994, 2001, 2003, 2005 and 2020), they were distributed in two groups and 5 sub-groups, each with 3 replicates.\u003c/p\u003e\n\u003cp\u003eEach group was kept in 50 ml sterile tubes filled with filtered 33 g/l diluted Urmia Lake water. The samples of first-group were maintained isothermally at a temperature of 28\u0026deg;C using a thermostatic heater with constant illumination (E27 \u0026micro;E/m2/s) and gentle bottom up aeration. The second group was subjected to non-lethal heat shock in a water bath where the nauplii specimens were exposed to a temperature of 37\u0026deg;C for 30 min, followed by a 6-h recovery time at 28\u0026deg;C (Ravanbakhsh et al., \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e). After recovery, 0.2 g of live nauplii samples from each groups were collected. Then, they were washed with sterile distilled water and immersed immediately into liquid nitrogen to be frozen and stored at -80\u0026deg;C for subsequent experiments.\u003c/p\u003e\n\u003ch3\u003eRNA extraction and cDNA (complementary DNA) synthesis\u003c/h3\u003e\n\u003cp\u003eTotal RNA was isolated from 0.2 gr of Artemia nauplii using TRIzol reagent (Invitrogen, Carlsbad, USA) according to the manufacturer\u0026rsquo;s instructions. The quality of extracted RNAs was analyzed via observing of 28S and 18S RNA bands on 1% agarose gel. For quantification, absorbance of the isolated RNA at 260 nm and 280 nm was measured by NanoDrop 2000 (Thermo Fisher Scientific, Wilmington, DE, USA). All extracted RNA was preserved at -80\u0026deg;C until cDNA synthesis.\u003c/p\u003e\n\u003cp\u003eOne the most important process prior to cDNA synthesis is to eliminate DNA contamination from extracted RNAs by DNAase1 (Fermentase, USA). Briefly, 2\u0026micro;g of extracted total RNA was treated using 1 \u0026micro;L of DNase I, 1 \u0026micro;L of its buffer and 0.5 \u0026micro;L of RNase inhibitor (Fermentase, USA). Then the reaction volume was adjusted to 10 \u0026micro;l using DEPC- treated water, followed by incubation at 37\u0026deg;C for 30 min. To inactivate DNaseI activity, 1 \u0026micro;L of EDTA (Fermentase, USA) was added and incubated for 10 min at 65\u0026deg;C.\u003c/p\u003e\n\u003cp\u003eTo cDNA synthesis, reverse transcription was carried out on the treated RNA from the previous step in a final volume of 20 \u0026micro;l using the PrimeScript RT kit (TaKaRa Bio Inc. Kusatsu, Japan) according to the manufacturer\u0026rsquo;s protocol. Then, synthesized cDNAs were stored at -20\u0026deg;C for later use in real-time PCR reaction.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePrimer design for obtaining partial sequences of\u003c/strong\u003e \u003cstrong\u003eproPO\u003c/strong\u003e \u003cstrong\u003emRNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate expression profile of \u003cem\u003eproPO\u003c/em\u003e gene over long-term ecological changes, sequence of this gene was needed. Due to the lack of information about \u003cem\u003eArtemia urmiana proPO\u003c/em\u003e cDNA sequence, it was necessary to first sequence partial cds of this gene.\u003c/p\u003e\n\u003cp\u003eFor this purpose, the NCBI nucleotide database was first searched in order to finding sequences of this gene in other Artemia species. For this gene, two close species of Artemia named \u003cem\u003eArtemia franciscana\u003c/em\u003e and \u003cem\u003eArtemia sinica\u003c/em\u003e have already been sequenced. Therefore, four degenerated primers pairs (Table\u0026nbsp;1) were designed according to a complete \u003cem\u003eproPO\u003c/em\u003e mRNA sequence from \u003cem\u003eArtemia franciscana\u003c/em\u003e (GenBank accession no. AM850109.1) and \u003cem\u003eArtemia sinica\u003c/em\u003e (GenBank accession no. HM138084.1), using GeneRunner software v3.05 (Hastings Software Inc. USA).\u003c/p\u003e\n\u003ch3\u003ePCR product sequencing\u003c/h3\u003e\n\u003cp\u003eTo confirm the expression of \u003cem\u003eproPO\u003c/em\u003e and also obtain the sequence of amplified RT-PCR products, Sanger sequencing was performed. Afterwards, sequencing results were interpreted by Chromas Pro 2.4.1 and aligned using BLAST.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003ePrimer design for doing Real-time PCR\u003c/h2\u003e\n \u003cp\u003eAfter obtaining partial cds of \u003cem\u003eProPO\u003c/em\u003e gene, so as to evaluate expression profile of this gene during three decades via real-time PCR, related primers were first designed based on its already sequenced part by GeneRunner software v3.05 (Hastings Software Inc. USA). \u0026beta;-actin was selected as an internal control and its expression level was applied as an endogenous normalization factor. Hence, one pair primers were also designed for this house keeping gene using its published sequence in the GeneBank nucleic acid database. Then, Primer-BLAST tools in NCBI database was used to verify the specificity of the designed primers targeting \u0026beta;-actin. The real-time PCR was performed with primers specific for \u003cem\u003eproPO\u003c/em\u003e and \u0026beta;-actin using SYBR Green master mix (TaKaRa Bio Inc. Kusatsu, Japan) by Magnetic Induction Cycler (Mic) PCR Machine (Australia). In summary, Real-time PCR was performed in triplicate for each gene listed in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, in 10 \u0026micro;L of reaction volume, containing 5 \u0026micro;L SYBR Green master mix (TaKaRa Bio Inc. Kusatsu, Japan), 0.18 \u0026micro;L of each forward and reverse primer, 1 \u0026micro;L of the synthesized cDNA from nauplii relevant to years 1994, 2001, 2003, 2005 and 2020, and RNase free water to bring the reaction mixture up to the final volume of 10 \u0026micro;L. Primers sequences and real-time -PCR conditions have been mentioned in Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"624\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"2\" valign=\"top\" style=\"width: 498px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 1: Primer sequences used for amplifying about 1400 bp of \u003cem\u003eproPO\u003c/em\u003e mRNA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 126px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003ePrimers\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 318px;\"\u003e\n \u003cp\u003eSequences \u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 126px;\"\u003e\n \u003cp\u003eAccession number\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003eProPOF22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 318px;\"\u003e\n \u003cp\u003eF: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e- GTGATGAAGATGAGGAAACCGT-3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eR: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e- GGTATGCAAATGGTTCGTGG-3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 126px;\"\u003e\n \u003cp\u003eOQ784235\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003eProPOF33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 318px;\"\u003e\n \u003cp\u003eF: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e- GAATTTTCTGCACTGGACA-3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eR: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e- CTTCTACGCCCTTGGAGATC-3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 126px;\"\u003e\n \u003cp\u003eOQ784237\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003eProPOF12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 318px;\"\u003e\n \u003cp\u003eF: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e-\u0026nbsp;GGACATGGAAGGCTGGAGAG3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eR: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e- GGTATGCAAATGGTTCGTGG3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 126px;\"\u003e\n \u003cp\u003eOQ784236\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003eProPOF31\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 318px;\"\u003e\n \u003cp\u003eF: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e-\u0026nbsp;CGTCAGCGTTAGCAATGGTA3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eR: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e-\u0026nbsp;CAATAGGACGATCAAATGGGA3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 126px;\"\u003e\n \u003cp\u003eOQ784234\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"614\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 614px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTable 2: The sequences of the primers used in this study for doing real-time PCR and its programs\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimers\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eproduct size \u0026nbsp; \u0026nbsp;(bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 276px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequences\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eqPCR cycling\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eprogram* \u0026nbsp;T(s)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cem\u003eproPO\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e191\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 276px;\"\u003e\n \u003cp\u003eF: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e-CGTCAGCGTTAGCAATGGTA-3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eR: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e- CACGAAAACAGACTCTTCTTGG -3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eD: 95 ( 30)\u003c/p\u003e\n \u003cp\u003eA: 59 (27)\u003c/p\u003e\n \u003cp\u003eE: 72 (25)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 85px;\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026beta;-actin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 111px;\"\u003e\n \u003cp\u003e206\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 276px;\"\u003e\n \u003cp\u003eF: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e-GACTCTGGTGATGGTGTTTCT3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003cp\u003eR: 5\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e-TCAAGGGCGACATAGCAAAG3\u003cspan dir=\"RTL\"\u003eﹶ\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eD: 95 ( 30)\u003c/p\u003e\n \u003cp\u003eA: 59 (27)\u003c/p\u003e\n \u003cp\u003eE: 72 (25)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\" valign=\"top\" style=\"width: 614px;\"\u003e\n \u003cp\u003e*qPCR was started for \u0026nbsp;two primers with initial denaturation at 95 \u0026deg;C for 10 min; D, denaturation; A, primer\u003c/p\u003e\n \u003cp\u003eannealing; E, extension; F, forward; R, Reverse\u003c/p\u003e\n \u003cp\u003eAbbreviation. T: temperature (\u003csup\u003eoC\u003c/sup\u003e), s: time in second\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eThe alteration of \u003cem\u003eproPO\u003c/em\u003e gene expression in years 1994, 2001, 2003, 2005 and 2020 was analyzed by the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method. In this method, \u0026Delta;\u0026Delta;Ct\u0026thinsp;=\u0026thinsp;\u0026Delta;Ct (yearX) \u0026ndash; \u0026Delta;Ct (year 1994) and \u0026Delta;Ct\u0026thinsp;=\u0026thinsp;Ct (\u003cem\u003eproPO\u003c/em\u003e) \u0026ndash; Ct (\u0026beta;-actin). Ct value considers as a cycle threshold.\u003c/p\u003e\n \u003cp\u003eIn order for statistical comparison with other years, 1994 (with favorable salinity for brine shrimp) was considered as a control.\u003c/p\u003e\n \u003cp\u003eIn order to accurately identify the expression levels of \u003cem\u003eproPO\u003c/em\u003e gene, normalization using the housekeeping gene \u0026beta;-actin was accomplished.\u003c/p\u003e\n \u003cp\u003eStudent\u0026rsquo;s t-test and one-way ANOVA were employed to compare between two groups and more than two groups, respectively. P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant. All experiments were repeated three times, and data were displayed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation. All analyzes were performed using SPSS software v22.0 (IBM, Armonk, NY, USA) and GraphPad Prism 6.01 was applied to plot all graphs.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eRNA extraction and RT-PCR (Reverse Transcription PCR)\u003c/h2\u003e\u003cp\u003eQualitative and quantitative tests for extracted RNAs were done by 1% agarose gel electroforesis and NanoDrop (Thermo Fisher Scientific, Wilmington, USA) respectively. The appearance of ribosomal bands 28S and 18S on the gel indicated the good quality of the extracted RNAs. Nanodrop displayed that Concentration and purity (OD: absorbance at 260 nm and 280 nm ratio) of the RNAs were 300\u0026ndash;600 ng/ul and 1.8-2, respectively. The PCR amplicons for \u003cem\u003eproPO\u003c/em\u003e and β-actin were specifically synthesized by their primers (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb is the results from real-time PCR device. This figure depicts melting curve analysis of \u003cem\u003eProPO\u003c/em\u003e and β-actin. A single peak in the curves confirmed amplification of single product in each micro-tube and validated that no dimers and unspecific products interfere with the reaction.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eSequencing results\u003c/h2\u003e\u003cp\u003eSequencing the target regions confirmed that RT-PCR products represented the expected candidate gene. \u003cem\u003eproPO-related\u003c/em\u003e sequences with their relevant accession numbers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e) were deposited to NCBI. Furthermore, a 1365-bp sequence resulted from assembling of target sequences was submitted in NCBI with accession number OQ784174.\u003c/p\u003e\u003cp\u003eTo realize identity percent of the sequenced part of \u003cem\u003eArtemia urmiana\u003c/em\u003e with two close species (\u003cem\u003eArtemia sinica\u003c/em\u003e and \u003cem\u003eArtemia franciscana\u003c/em\u003e) multiple sequence alignment was done by Clustal 2.1 (See supplementary data I). The result showed that the sequenced region of \u003cem\u003eArtemia urmiana\u003c/em\u003e has 93.92% and 93.63% similarity with \u003cem\u003eArtemia sinica\u003c/em\u003e and \u003cem\u003eArtemia franciscana\u003c/em\u003e, respectively. Furthermore, according to phylogenetic tree results, \u003cem\u003eArtemia sinica\u003c/em\u003e and \u003cem\u003eArtemia franciscana\u003c/em\u003e are in one group and \u003cem\u003eArtemia urmiana\u003c/em\u003e is in separate group.\u003c/p\u003e\u003cp\u003e\u003cb\u003eIncreased expression of\u003c/b\u003e \u003cb\u003eproPO\u003c/b\u003e \u003cb\u003eand NLHS-induced\u003c/b\u003e \u003cb\u003eproPO\u003c/b\u003e \u003cb\u003eover the last three-decade ecological alterations\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe expression profile of the \u003cem\u003eproPO\u003c/em\u003e gene in nauplii of \u003cem\u003eArtemia urmiana\u003c/em\u003e under salinity crisis due to three decades ecological changes is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. Under environmental tensions especially salinity and temperature stresses, the expression of \u003cem\u003eproPO\u003c/em\u003e gene was significantly up-regulated compared with the control group (Nauplii from harvested cyst of \u003cem\u003eArtemia urmiana\u003c/em\u003e in year 1994 with the salinity 160 ppt and temperature 28\u0026deg;C). The highest expression level was observed in year 2005 with the salinity 265 ppt and temperature 29.3\u0026deg;C (2.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). However, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, a significant decrease in \u003cem\u003eproPO\u003c/em\u003e gene expression was demonstrated in 2020 (salinity 360 ppt and temperature 31.8\u0026deg;C) compared to 2005 (CI 95%, p\u0026thinsp;=\u0026thinsp;0.008). Furthermore, as already mentioned, to assess how the immune system of nauplii exposed to long-term ecological changes responds to subsequent stresses, we exposed each group of nauplii (from harvested cyst of \u003cem\u003eArtemia urmiana\u003c/em\u003e in year 1994, 2001, 2003, 2005 and 2020) to NLHS and subsequently analyzed \u003cem\u003eproPO\u003c/em\u003e gene expression. Our results showed that all groups were able to significantly induce \u003cem\u003eproPO\u003c/em\u003e, compared to the control group (Nauplii in1994 without NLHS exposure), but nauplii from the cyst harvested in 2020 could increase the expression more than others, which was 5.97 fold (5.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.41, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) higher than the control group. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The results of multiple comparisons of expression profile of \u003cem\u003eproPO\u003c/em\u003e and also NLHS-induced \u003cem\u003eproPO\u003c/em\u003e over the years 1994 to 2020 were summarized in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eUnderstanding environmental stress responses in animals living in changing ecosystems, especially aquatic inhabitants, is of great importance. Such an understanding must necessarily include the knowledge of the mechanisms that can occur in the vital systems of these organisms and, by adopting them, they can adapt to the harsh condition, live, survive and reproduce under changing climate (Fabbri et al., 2014; Blewett et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Ravanbakhsh et al.,2023). These mechanisms mainly include genetic and epigenetic alterations that affect gene expression and cellular function (Schulte et al., 2011; Murray et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Ravanbakhsh et al., \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). One of the systems inside animals that ensures the survival and continuity of the generation is a responsive immune system (Lutton and Callard, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Stope, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Crustaceans have only an innate immune system as a defense mechanism, in which the proPO system is regarded as avital component. In this system, prophenoloxidase (proPO) is a key enzyme of it (Fan et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Tran et al., \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Based on evidence, the proPO system can be activated by pathogen components including microbial cell wall Lipopolysaccharide (LPS) and peptidoglycan (Cerenius et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Patnaik et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) and it can also be affected by environmental factors such as pH, temperature and salinity (Pan et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2010\u003c/span\u003e, Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Pazir et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Kulkarni et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Mengal et al., \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e\u003cp\u003ePan and his group (2010) showed that low salinities negatively affect PO activity in the shrimp, \u003cem\u003eLitopenaeus vannamei\u003c/em\u003e. In contrast, Ge and his team (Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), who worked on impact of salinity on immune system of a shrimp specie named Exopalaemon carinicauda, demonstrated that prophenoloxidase system-related genes were up-regulated in low salinities. However, Pazir and his colleagues (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) showed the effects of sudden changes in water parameters, including temperature, salinity, and pH, on decreased immune function and increased susceptibility to some infectious diseases. (Pazir et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Bailey et al. (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and Traylor-Knowles and Connelly (\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) showed that changes of ambient temperature affect the immune system especially in aquatic organisms, thereby can compromise the resistance of these organisms to pathogens.\u003c/p\u003e\u003cp\u003eAlthough there are some evidence to support the impact of transient environmental stressors (at experimental level) on the immune system, especially the proPO system (Pan et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Bailey et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Ge et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Pazir et al., \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Rohr and Cohen, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Byers, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Hutson et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), there are limited studies available on the impact of ecological changes and environmental stressors, particularly long-term ones, on the immune system (Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Regarding the impact of ecological changes on the marine ecosystems Bijma and his colleague (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), indicated a dramatic effect of ecological changes on the flora and fauna of the marine ecosystems with significant changes in population distribution and decline in sensitive species. Furthermore, some research (Marcogliese, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Segner et al., \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Rohr and Cohen, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Byers, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Hutson et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) demonstrated unexpected consequences of the environmental stressors, such as the occurrence of infectious diseases in aquatic ecosystems. Although diverse mechanisms involve in the incidence of these diseases in aquatic ecosystems, one of the important reasons seems to be the effect of the stressors on immune system (Palmer, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Therefore, in such situations where living organisms face long-term stresses, they must adopt intelligent measures or mechanisms to survive, reproduce, and save their generation from extinction (Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). One of these mechanisms could be to boost immune system trough up-regulating immune-related genes to cope with infectious diseases (Tort, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn agreement with this fact and based on the gene expression analysis in present work, our results showed that the expression of \u003cem\u003eproPO\u003c/em\u003e gene increased gradually to the highest level during the years 1995 to 2005 and decreased thereafter when the \u003cem\u003eArtemia urmiana\u003c/em\u003e were exposed to an extreme salinity (360 ppt) and high temperature (31.8\u0026deg;C) in 2020. In this year, although our results showed a significant decrease in gene expression, it was still significantly high compared to 1995. Indeed, these results suggest that long-term exposure to ecological changes, especially increased salinity (up to ~\u0026thinsp;265 ppt) and temperature (up to ~\u0026thinsp;29); can positively affect the immune system by overexpressing the expression level of the \u003cem\u003eArtemia urmiana proPO\u003c/em\u003e gene, which can be in accordance with previous research (Boraschi and Italiani, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Penkov et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zhou and Wang, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). These studies demonstrated changing aquatic ecosystems and environmental stresses such as salinity, temperature changes, and pathogens as threats to aquatic organisms, which often respond with adaptive strategies to enhance survival, including strengthening immune systems (Tort, \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Zhou and Wang, \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Given that Artemia species is an aquatic crustacean, one of the pivotal component of its innate immune system is the prophenoloxidase (proPO) system. Various studies have proven that overexpression of some immune-related genes occur due to the induction of innate immune, which is essential for adaptive immunity and resistance to disease and harsh environment. (Boraschi and Italiani, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Penkov et al., \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). In addition, to support these claims and our results, recent scientific findings of Ge et al. (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), Kulkarni et al. (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and Mengal and et al. (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) and Patnaik and colleagues (\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) demonstrated that activation of proPO in crustaceans, In addition to being able to control pathogens in the surrounding environment through its antimicrobial role, can also facilitate the catalysis of the hardening or sclerotization of the newly formed exoskeleton of aquatic animals, which may be essential for protecting their vulnerable soft bodies under adverse environmental conditions. Moreover, Fagutao and colleagues (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) found that the lack of proPO in shrimp results in higher mortality due to its crucial role in maintaining homeostasis.\u003c/p\u003e\u003cp\u003eIn addition to survival, another fundamental goal of these organisms is to pass on these adaptive traits and capabilities to their offspring so that the subsequent generations can also respond swiftly and efficiently to their surrounding persistent environmental stressors. To achieve this objective, living organisms may apply a variety of ways. Recent findings suggest that one of the strategies is transgenerational innate immune memory (Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) to provide an opportunity to create offspring with increased disease resistance and reduce mortality (Roy et al., \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Junprung and his colleagues (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) demonstrated that thermal adaptation over 12 generations of \u003cem\u003eArtemia franciscana\u003c/em\u003e affects immune system of Artemia by modulating immune-related genes, notably upregulating peroxinectin (PX) and clip-SP, which are involved in the immune response (Sivakamavalli et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Cai et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Jiang et al., \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Although our study did not assess PX expression specifically, literature indicates that its expression can be directly or indirectly upregulated in response to \u003cem\u003eproPO\u003c/em\u003e overexpression (Sivakamavalli et al., \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), suggesting further investigation is warranted. Moreover, based on our results, severe ecological changes in 2020 (salinity\u0026thinsp;~\u0026thinsp;360 ppt and temperature\u0026thinsp;\u0026gt;\u0026thinsp;31\u0026deg;C) resulted in reduced \u003cem\u003eproPO\u003c/em\u003e gene expression, which could be consistent with previous findings (Deane et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Tine et al., \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), suggesting a threshold for any chronic environmental stress that can affect gene expression. Additionally, under extreme conditions, organisms may shift priorities specifically towards survival by overexpressing critical genes related to metabolism or stress management, although this requires further investigation (Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn addition to prolonged ecological changes on immune system, our results of NLHS-induced \u003cem\u003eproPO\u003c/em\u003e showed remarkable increase of \u003cem\u003eproPO\u003c/em\u003e gene expression of nuaplii of \u003cem\u003eArtemia urmiana\u003c/em\u003e living in different years following NLHS compared to non-heating ones, which is consistent with Junprung and colleagues (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). This study demonstrated up-regulation of some immune-related genes, including \u003cem\u003eproPO\u003c/em\u003e in NLHS shrimp, suggesting that NLHS could induce proPO activating-system in this animal. Moreover, our results showed despite the decrease in \u003cem\u003eproPO\u003c/em\u003e gene expression in nauplii living in 2020, a significant increase in NLHS-induced \u003cem\u003eproPO\u003c/em\u003e gene expression was observed in 2020 more than in other years. In fact, this finding suggested that previous exposure to chronic environmental stressors may allow those organisms to better handle further stressors and maintain physiological homeostasis (Hua et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Junprung et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) In addition to aforementioned discuss, the adaptive evolution has been also ascribed to occurrence of genetic variation (Sharopova, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Yuan et al., \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and/or epigenetic reprogramming, which are broadly determined as sustained changes in genetic or cellular levels (Chen et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; S\u0026aacute;nchez-Ram\u0026oacute;n et al., \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) resulting from prolonged ecological changes.\u003c/p\u003e\u003cp\u003eConsequently, this research defines that the enhanced expression of \u003cem\u003eproPO\u003c/em\u003e (as an immune-related gene in \u003cem\u003eArtemia urmiana\u003c/em\u003e) over the past three decades of ecological changes not only may facilitate adaptation to harsh conditions, but also through passing on this adaptive ability to the next generation contributes to the generation of offspring with enhanced disease resistance and improved adaptive capacity to thrive in challenging environmental conditions. Our findings from NLHS experiment also pose an important and interesting fact that previous exposure to chronic environmental stressors may provide an advantage to those organisms when they encounter a further stressor. Furthermore, given that there are limited reports on prolonged ecological effects on the immune response, the potential mechanisms by which long-term stressors induce innate immune system remain to be elucidated and call for further research.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e This research was supported by Artemia and Aquaculture Research Institute, Urmia University, Urmia, Iran (Grant Number: 002/A/1400). We hereby express our gratitude to the Artemia and Aquaculture Research Institute, Urmia University, Urmia, Iran, for providing all kinds of support during the conduct of this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement:\u0026nbsp;\u003c/strong\u003eWriting original draft \u0026ndash; review \u0026amp; editing, Methodology, Investigation, Formal analysis, Data curation, Conceptualization, Supervision, Project administration: [Reyhaneh Ravanbakhsh],\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eWriting \u0026ndash; review \u0026amp; editing, Investigation, Methodology, Data curation, Conceptualization: [Naser Agh],Writing \u0026ndash; review \u0026amp; editing, Methodology, Conceptualization [Peter Bossier].\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eData availability:\u0026nbsp;\u003c/strong\u003eData supporting the findings of this work are available within the article and its supplementary materials. \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis work was supported by Artemia and Aquaculture Research Institute, Urmia University, Urmia, Iran (Grant Number: 002/A/1400).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eCompeting Interests:\u0026nbsp;\u003c/strong\u003eThere are no conflicts of interest to declare.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eConsent for publication:\u003c/strong\u003e All authors have given their consent for publication.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAgh N, Abatzopoulos TJ, Kappas I, Van Stappen G, Razavi Rouhani SM, Sorgeloos P (2007) Coexistence of sexual and parthenogenetic Artemia populations in Lake Urmia and neighbouring lagoons. Int Rev Hydrobiol 92: 48-60. https://doi.org/10.1002/iroh.200610909. \u003c/li\u003e\n\u003cli\u003eAgh N, Van Stappen G, Bossier P, Sepehri H, Lotfi V, Rouhani SM, Sorgeloos P (2008) Effects of salinity on survival, growth, reproductive and life span characteristics of Artemia populations from Urmia Lake and neighboring lagoons. Pak J Biol Sci 11: 164-172. https://doi.org/10.3923/pjbs.2008.164.172. \u003c/li\u003e\n\u003cli\u003eAhmadifard N, Rezaei Aminlooi V, Tukmechi A, Agh N (2019) Evaluation of the impacts of long-term enriched Artemia with Bacillus subtilis on growth performance, reproduction, intestinal microflora, and resistance to Aeromonas hydrophila of ornamental fish Poecilia latipinna. Probiotics Antimicrob Proteins 11: 957-965. https://doi.org/10.1007/s12602-018-9453-4. \u003c/li\u003e\n\u003cli\u003eAlbarano L, Ruocco N, Lofrano G, Guida M, Libralato G (2022) Genotoxicity in Artemia spp.: an old model with new sensitive endpoints. Aquat Toxicol 106320. https://doi.org/10.1016/j.aquatox.2022.106320. \u003c/li\u003e\n\u003cli\u003eAnufriieva E V, Shadrin NV (2023) General Patterns of Salinity Influence on the Energy Balance of Aquatic Animals in Hypersaline Environment. Biol Bull Rev 13: 420-430. \u003c/li\u003e\n\u003cli\u003eAsem A , Eimanifar A, Van Stappen G, Sun SC (2019) The impact of one-decade ecological disturbance on genetic changes: a study on the brine shrimp Artemia urmiana from Urmia Lake, Iran. PeerJ 7 e7190. https://doi.org/10.7717/peerj.7190. \u003c/li\u003e\n\u003cli\u003eBanti C N, Hadjikakou SK (2021) Evaluation of toxicity with brine shrimp assay. Bio-protocol 11: e3895-e3895. : https://doi.org/10.21769/BioProtoc.3895. \u003c/li\u003e\n\u003cli\u003eBailey C, Segner H, Casanova-Nakayama A, Wahli T (2017) Who needs the hotspot? The effect of temperature on the fish host immune response to Tetracapsuloides bryosalmonae the causative agent of proliferative kidney disease. Fish Shellfish Immunol 63: 424-437. https://doi.org/10.1016/j.fsi.2017.02.039. \u003c/li\u003e\n\u003cli\u003eBijma J, P\u0026ouml;rtner HO, Yesson C, Rogers AD (2013) Climate change and the oceans\u0026ndash;What does the future hold?. Mar Pollut Bull 74: 495-505. http://dx.doi.org/10.1016/j.marpolbul.2013.07.022. \u003c/li\u003e\n\u003cli\u003eBlewett T A, Binning SA, Weinrauch AM, Ivy CM, Rossi GS, Borowiec BG, Norin T (2022) Physiological and behavioural strategies of aquatic animals living in fluctuating environments. J Exp Biol 225: jeb242503. https://doi.org/10.1242/jeb.242503. \u003c/li\u003e\n\u003cli\u003eBoraschi D, Italiani P (2018) Innate immune memory: time for adopting a correct terminology. Front Immunol 9: 799. https://doi.org/10.3389/fimmu.2018.00799. \u003c/li\u003e\n\u003cli\u003eByers J E (2021) Marine parasites and disease in the era of global climate change. Ann Rev Mar Sci 13: 397-420. https://doi.org/10.1146/annurev-marine-031920-100429. \u003c/li\u003e\n\u003cli\u003eCai S, Huang Y, Jian J, Yang S (2020). The functional characterization of peroxinectin in the defense of Fenneropenaeus penicillatus against pathogens. Dev Comp Immunol 104: 103538. https://doi.org/10.1016/j.dci.2019.103538. \u003c/li\u003e\n\u003cli\u003eCerenius L, Lee BL, S\u0026ouml;derh\u0026auml;ll K (2008) The proPO-system: pros and cons for its role in invertebrate immunity. Trends Immunol 29: 263-271. https://doi.org/10.1016/j.it.2008.02.009. \u003c/li\u003e\n\u003cli\u003eChen B, Li S, Ren Q, Tong X, Zhang X, Kang L (2015) Paternal epigenetic effects of population density on locust phase‐related characteristics associated with heat‐shock protein expression. Mol Ecol 24: 851-862. https://doi.org/10.1111/mec.13072. \u003c/li\u003e\n\u003cli\u003eDeane E, Kelly ESP, Luk JC, Woo NY (2002) Chronic salinity adaptation modulates hepatic heat shock protein and insulin-like growth factor I expression in black sea bream. Mar Biotechnol 4: 193-205. https://doi.org/10.1007/PL00021690. \u003c/li\u003e\n\u003cli\u003eDemir E, Ceccobelli S, Bilginer U, Pasquini M, Attard G, Karsli T (2022) Conservation and selection of genes related to environmental adaptation in native small ruminant breeds: a review. Ruminants 2: 255-270. https://doi.org/10.3390/ruminants2020017. \u003c/li\u003e\n\u003cli\u003eDervis K (2016) Reflections on Progress: Essays on the Global Political Economy. Brookings Institution Press.\u003c/li\u003e\n\u003cli\u003eFabbri E, Dinelli E (2014) Physiological responses of marine animals towards adaptation to climate changes. The Mediterranean Sea: Its history and present challenges 401-417. https://doi.org/10.1007/978-94-007-6704-1_23.\u003c/li\u003e\n\u003cli\u003eFan T, Wang L, Fan X, Xu B, Yu M, Jiang G (2011) A prophenoloxidase from Artemia sinica: cDNA cloning, expression and activity analysis during early development. Fish Shellfish Immunol 31: 1059-1064. https://doi.org/10.1016/j.fsi.2011.09.006. \u003c/li\u003e\n\u003cli\u003eGe Q, Li Z, Li J, Wang J, Li J (2020) Effects of acute salinity stress on the survival and prophenoloxidase system of Exopalaemon carinicauda. Acta Oceanol Sin 39: 57-64. https://doi.org/10.1007/s13131-020-1582-4. \u003c/li\u003e\n\u003cli\u003eG\u0026uuml;nther R T (1899) Contributions to the geography of Lake Urmi and its neighbourhood. Geogr J 14: 504-523. https://doi.org/10.2307/1774539. \u003c/li\u003e\n\u003cli\u003eHua J, Jones DK, Relyea RA (2014) Induced tolerance from a sub lethal insecticide leads to cross-tolerance to other insecticides. Environ Sci Technol 48: 4078-4085. https://doi.org/10.1021/es500278f. \u003c/li\u003e\n\u003cli\u003eHuang Y, Ren Q (2020) Research progress in innate immunity of freshwater crustaceans. Dev Comp Immunol 104: 103569. https://doi.org/10.1016/j.dci.2019.103569. \u003c/li\u003e\n\u003cli\u003eHutson KS, Davidson IC, Bennett J, Poulin R, Cahill PL (2023) Assigning cause for emerging diseases of aquatic organisms. Trends Microbiol 31: 681-691. https://doi.org/10.1016/j.tim.2023.01.012. \u003c/li\u003e\n\u003cli\u003eFagutao F, Koyama T, Kaizu A, Saito‐Taki T, Kondo H, Aoki T, Hirono I (2009) Increased bacterial load in shrimp hemolymph in the absence of prophenoloxidase. FEBS J 276: 5298-5306. https://doi.org/10.1111/j.1742-4658.2009.07225.x. \u003c/li\u003e\n\u003cli\u003eJacobson KC, Arkoosh MR, Kagley AN, Clemons ER, Collier TK, Casillas E (2003) Cumulative effects of natural and anthropogenic stress on immune function and disease resistance in juvenile Chinook salmon. J Aquat Anim Health 15: 1-12. https://doi.org/10.1577/1548-8667(2003)015\u0026lt;0001:CEONAA\u0026gt;2.0.CO;2. \u003c/li\u003e\n\u003cli\u003eJiang C, Feng M, Fan R, Wang C, Shu G, Qiu Y, Dai L (2023) Molecular cloning and functional characterization of peroxinectin from red swamp crayfish, Procambarus clarkii. Fish Shellfish Immunol 143: 109206. https://doi.org/10.1016/j.fsi.2023.109206. \u003c/li\u003e\n\u003cli\u003eJoshua WJ, Kamarudin MS, Ikhsan N, Yusoff FM, Zulperi Z (2022) Development of enriched Artemia and Moina in larviculture of fish and crustaceans: a review. Lat Am J Aquat Res 50: 144-157. http://dx.doi.org/10.3856/vol50-issue2-fulltext-2840. \u003c/li\u003e\n\u003cli\u003eJunprung W, Supungul P, Tassanakajon A (2017) HSP70 and HSP90 are involved in shrimp Penaeus vannamei tolerance to AHPND-causing strain of Vibrio parahaemolyticus after non-lethal heat shock. Fish Shellfish Immunol 60: 237-246. https://doi.org/10.1016/j.fsi.2016.11.049. \u003c/li\u003e\n\u003cli\u003eJunprung W, Nanakorn Z, Norouzitallab P, Supungul P, Vanrompay D, Bossier P, Tassanakajon A (2024) Thermal adaptation affects expression and regulation of metabolism-, stress-, and immune-related genes in Artemia franciscana populations. Aquac Rep 39: 102511. https://doi.org/10.1016/j.aqrep.2024.102511. \u003c/li\u003e\n\u003cli\u003eKulkarni A, Krishnan S, Anand D, Kokkattunivarthil Uthaman S, Otta SK, Karunasagar I, Kooloth Valappil R (2021) Immune responses and immunoprotection in crustaceans with special reference to shrimp. Rev Aquac 13: 431-459. https://doi.org/10.1111/raq.12482. \u003c/li\u003e\n\u003cli\u003eK\u0026uuml;ltz D (2015) Physiological mechanisms used by fish to cope with salinity stress. The Journal of Experimental Biology 218: 1907-1914. https://doi.org/10.1242/jeb.118695. \u003c/li\u003e\n\u003cli\u003eKumar R, Kumar V (2018) A review of phylogeography: biotic and abiotic factors. Geology, Ecology, and Landscapes 2: 268-274. https://doi.org/10.1080/24749508.2018.1452486. \u003c/li\u003e\n\u003cli\u003eLutton B, Callard I (2006) Evolution of reproductive\u0026ndash;immune interactions. Integr Comp Biol 46: 1060-1071. https://doi.org/10.1093/icb/icl050. \u003c/li\u003e\n\u003cli\u003eLazarus RJ (2023) The making of environmental law. University of Chicago Press.\u003c/li\u003e\n\u003cli\u003eMarcogliese DJ (2008) The impact of climate change on the parasites and infectious diseases of aquatic animals. Rev Sci Tech 27: 467-484.\u003c/li\u003e\n\u003cli\u003eMartin LB, Hopkins WA, Mydlarz LD, Rohr JR (2010) The effects of anthropogenic global changes on immune functions and disease resistance. Ann NY Acad Sci 1195: 129-148. https://doi.org/10.1111/j.1749-6632.2010.05454.x. \u003c/li\u003e\n\u003cli\u003eMengal K, Kor G, Kozak P, Niksirat H (2023) Effects of environmental factors on the cellular and molecular parameters of the immune system in decapods. Comparative Biochemistry and Physiology Part A: Mol Integr Physiol 276, 111332. https://doi.org/10.1016/j.cbpa.2022.111332. \u003c/li\u003e\n\u003cli\u003eMurray, KO, Clanton TL, Horowitz M (2022) Epigenetic responses to heat: from adaptation to maladaptation. Exp Physiol 107: 1144-1158. https://doi.org/10.1113/EP090143. \u003c/li\u003e\n\u003cli\u003eNikraftar Z, Parizi E, Hosseini SM, Ataie-Ashtiani B (2021) Lake Urmia restoration success story: A natural trend or a planned remedy?. J Great Lakes Res 47: 955-969. https://doi.org/10.1016/j.jglr.2021.03.012. \u003c/li\u003e\n\u003cli\u003ePalmer CV (2018) Immunity and the coral crisis. Commun Biol 1: 91. https://doi.org/10.1038/s42003-018-0097-4. \u003c/li\u003e\n\u003cli\u003ePan L, Xie P, Hu F (2010) Responses of prophenoloxidase system and related defence parameters of Litopenaeus vannamei to low salinity. J Ocean Univ China 9: 273-278. https://doi.org/10.1007/s11802-010-1711-3. \u003c/li\u003e\n\u003cli\u003ePatnaik BB, Baliarsingh S, Sarkar A, Hameed AS, Lee YS, Jo YH, Han YS, Mohanty J (2024) The role of pattern recognition receptors in crustacean innate immunity. Rev Aquac 16: 190-233. https://doi.org/10.1111/raq.12829. \u003c/li\u003e\n\u003cli\u003ePenkov S, Mitroulis I, Hajishengallis G, Chavakis T (2019) Immunometabolic crosstalk: an ancestral principle of trained immunity?. Trends Immunol 40: 1-11. https://doi.org/10.1016/j.it.2018.11.002. \u003c/li\u003e\n\u003cli\u003ePiper J (2018) Artemia: A Model Specimen for Educational Microscopy Projects in Biological and Ecological Fields. Microscopy Today 26: 12-19. https://doi.org/10.1017/S1551929518000652. \u003c/li\u003e\n\u003cli\u003ePazir MK, Ajdari A, Ghawampour A (2020) The effect of gradually decline of salinity on haemolymph parameters of adult shrimp Litopenaeus vannamei (Boone, 1931). Sust aquac manag J 6: 19-28. https://doi.org/10.29252/ijaah.6.1.19. \u003c/li\u003e\n\u003cli\u003eRasyid MI, Yuliani H, Triandita N, Angraeni L, Anggriawin M (2022) Toxicity Test of Laban Fruits (Vitex pinnata Linn) by Using Brine Shrimp Lethality Test (BSLT) Methode. In IOP Conference Series: Earth Environ Sci 1059: 01205. IOP Publishing.\u003c/li\u003e\n\u003cli\u003eRahimi A, Breuste J (2021) Why is Lake Urmia drying up? Prognostic modeling with land-use data and artificial neural network. Front Environ Sci 9: 603916. https://doi.org/10.3389/fenvs.2021.603916. \u003c/li\u003e\n\u003cli\u003eRahman MM, Sorgeloos P (2022) A training manual on Artemia cyst hatching and decapsulation.\u003c/li\u003e\n\u003cli\u003eRavanbakhsh R, Agh N, Nouraein M, Bossier P (2023) Prolonged ecological changes can affect morphometrics and gene expression profile? Focusing on Hsp-70 and NLHS-induced Hsp-70 of Artemia urmiana. Environmental Research 238: 117254. https://doi.org/10.1016/j.envres.2023.117254. \u003c/li\u003e\n\u003cli\u003eRohr JR, Cohen JM (2020) Understanding how temperature shifts could impact infectious disease. PLoS biol 18: e3000938. https://doi.org/10.1371/journal.pbio.3000938. \u003c/li\u003e\n\u003cli\u003eRoy S, Baruah K, Bossier P, Vanrompay D, Norouzitallab P (2022) Induction of transgenerational innate immune memory against Vibrio infections in a brine shrimp (Artemia franciscana) model. Aquac 557: 738309. https://doi.org/10.1016/j.aquaculture.2022.738309. \u003c/li\u003e\n\u003cli\u003eS\u0026aacute;nchez-Ram\u0026oacute;n S, Conejero L, Netea MG, Sancho D, Palomares \u0026Oacute;, Subiza JL (2018) Trained immunity-based vaccines: a new paradigm for the development of broad-spectrum anti-infectious formulations. Front Immunol 9: 2936. https://doi.org/10.3389/fimmu.2018.02936. \u003c/li\u003e\n\u003cli\u003eSegner H, Schmitt-Jansen M, Sabater S (2014) Assessing the impact of multiple stressors on aquatic biota: the receptor\u0026rsquo;s side matters. Environ Sci Technol 48:7690-7696. https://doi.org/10.1021/es405082t. \u003c/li\u003e\n\u003cli\u003eSharopova N (2008) Plant simple sequence repeats: distribution, variation, and effects on gene expression. Genome 51: 79-90. https://doi.org/10.1139/G07-110. \u003c/li\u003e\n\u003cli\u003eShears NT, Ross PM (2010) Toxic cascades: multiple anthropogenic stressors have complex and unanticipated interactive effects on temperate reefs. Ecol lett 13: 1149-1159. https://doi.org/10.1111/j.1461-0248.2010.01512.x. \u003c/li\u003e\n\u003cli\u003eheibani S, Ataie-Ashtiani B, Safaie A, Simmons CT (2020) Influence of lakebed sediment deposit on the interaction of hypersaline lake and groundwater: A simplified case of lake Urmia, Iran. J Hydrol 588: 125110. https://doi.org/10.1016/j.jhydrol.2020.125110. \u003c/li\u003e\n\u003cli\u003eSchultePM, Healy TM, Fangue NA (2011) Thermal performance curves, phenotypic plasticity, and the time scales of temperature exposure. Integr Comp Biol 51: 691-702. https://doi.org/10.1093/icb/icr097. \u003c/li\u003e\n\u003cli\u003eSivakamavalli J, Selvaraj C, Singh SK, Vaseeharan B (2016) In vitro and in silico studies on cell adhesion protein peroxinectin from Fenneropenaeus indicus and screening of heme blockers against activity. J Mol Recognit 29: 186-198. https://doi.org/10.1002/jmr.2516. \u003c/li\u003e\n\u003cli\u003eStope MB (2023) The Connection between Immunocompetence and Reproduction in Wildlife. Life 13: 785. https://doi.org/10.3390/life13030785. \u003c/li\u003e\n\u003cli\u003eTine M, Bonhomme F, McKenzie DJ, Durand JD (2010) Differential expression of the heat shock protein Hsp70 in natural populations of the tilapia, Sarotherodon melanotheron, acclimatised to a range of environmental salinities. BMC Ecol 10: 1-8. https://doi.org/10.1186/1472-6785-10-11. \u003c/li\u003e\n\u003cli\u003eTort L (2011) Stress and immune modulation in fish. Dev Comp Immunol 35: 1366-1375. https://doi.org/10.1016/j.dci.2011.07.002. \u003c/li\u003e\n\u003cli\u003eTran NT, Liang H, Zhang M, Bakky MA, Zhang Y, Li S (2022) Role of cellular receptors in the innate immune system of crustaceans in response to white spot syndrome virus. Viruses 14: 743. https://doi.org/10.3390/v14040743. \u003c/li\u003e\n\u003cli\u003eTraylor-Knowles N, Connelly MT (2017) What is currently known about the effects of climate change on the coral immune response. Curr Clim Change Rep 3: 252-260.\u003c/li\u003e\n\u003cli\u003eVelasco J, Guti\u0026eacute;rrez-C\u0026aacute;novas C, Botella-Cruz M, S\u0026aacute;nchez-Fern\u0026aacute;ndez D, Arribas P, Carbonell JA, Mill\u0026aacute;n A, Pallar\u0026eacute;s S (2019) Effects of salinity changes on aquatic organisms in a multiple stressor context. Phil Trans R Soc B 374: 20180011. https://doi.org/10.1098/rstb.2018.0011. \u003c/li\u003e\n\u003cli\u003eYuan J, Zhang X, Wang M, Sun Y, Liu C, Li S, Yu Y, Gao Y, Liu F, Zhang X, Kong J (2021) Simple sequence repeats drive genome plasticity and promote adaptive evolution in penaeid shrimp. Commun Biol 4: 186. https://doi.org/10.1038/s42003-021-01716-y. \u003c/li\u003e\n\u003cli\u003eZhou L, Wang S (2023) The bright side of ecological stressors. Trends Ecol Evol 38: 568-578. https://doi.org/10.1016/j.tree.2023.01.010. \u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"aquatic-ecology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aeco","sideBox":"Learn more about [Aquatic Ecology](http://link.springer.com/journal/10452)","snPcode":"10452","submissionUrl":"https://submission.nature.com/new-submission/10452/3","title":"Aquatic Ecology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Artemia urmiana, ecological changes, environmental stresses, NLHS, proPO","lastPublishedDoi":"10.21203/rs.3.rs-7453914/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7453914/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRecent ecological changes in Urmia Lake may affect immune system of local organisms, including \u003cem\u003eArtemia urmiana\u003c/em\u003e, prompting the need to study immune regulation mechanisms in species being able to cope with stressors, survive, and reproduce under these conditions. This study evaluated effects of long-term environmental changes on the prophenoloxidase (\u003cem\u003eproPO\u003c/em\u003e) expression as a key immune response and non-lethal heat shock (NLHS)-induced \u003cem\u003eproPO\u003c/em\u003e expression in this species. qPCR assay was developed to evaluate the influence of three-decade ecological crisis on \u003cem\u003eproPO\u003c/em\u003e and NLHS-induced \u003cem\u003eproPO\u003c/em\u003e expression of nauplii of \u003cem\u003eArtemia urmiana\u003c/em\u003e, based on cyst collections from 1994 (rainy period) to 2020 (drought period). To obtain partial cds of \u003cem\u003eproPO\u003c/em\u003e, four regions of this cDNA were sequenced using Sanger method. Before expression analysis, four regions of \u003cem\u003eproPO\u003c/em\u003e cDNA were sequenced (the accession numbers: OQ784234, OQ784235, OQ784236, OQ784237) and then assembled into a larger partial cds (the accession numbers: OQ784174). qPCR results demonstrated that ecological changes caused proPO expression shifting, which was highest in 2005 (CI 95%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Notably, the nauplii exposed to longer-term changes were able to increase \u003cem\u003eproPO\u003c/em\u003e expression more than others in response to NLHS (CI 95%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Our findings highlighted effects of ecological stressors on \u003cem\u003eproPO\u003c/em\u003e and NLHS-induced \u003cem\u003eproPO\u003c/em\u003e expression. Notably, prior exposure to stressors may confer survival and adaptation advantages against future challenges, indicating a bright side of long-term environmental stressors.\u003c/p\u003e","manuscriptTitle":"Immune system of aquatic organisms can be affected by long-term ecological alterations? Focusing on Prophenoloxidase (proPO) and NLHS-induced proPO gene expression of Artemia Urmiana","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-09 22:24:50","doi":"10.21203/rs.3.rs-7453914/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-19T12:22:23+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-18T02:57:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"254567511923573695655330391551990082076","date":"2025-12-02T01:58:02+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"48249945728067333294491817999772514725","date":"2025-09-21T04:36:39+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-17T19:04:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"120770653789909683353197261105086399296","date":"2025-09-08T18:01:39+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-03T00:02:43+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-28T17:07:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-26T06:27:32+00:00","index":"","fulltext":""},{"type":"submitted","content":"Aquatic Ecology","date":"2025-08-25T12:37:59+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"aquatic-ecology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"aeco","sideBox":"Learn more about [Aquatic Ecology](http://link.springer.com/journal/10452)","snPcode":"10452","submissionUrl":"https://submission.nature.com/new-submission/10452/3","title":"Aquatic Ecology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"025443d3-be2d-4b3f-90df-6995b523ae37","owner":[],"postedDate":"September 9th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-02-16T16:03:41+00:00","versionOfRecord":{"articleIdentity":"rs-7453914","link":"https://doi.org/10.1007/s10452-026-10268-4","journal":{"identity":"aquatic-ecology","isVorOnly":false,"title":"Aquatic Ecology"},"publishedOn":"2026-02-10 15:58:12","publishedOnDateReadable":"February 10th, 2026"},"versionCreatedAt":"2025-09-09 22:24:50","video":"","vorDoi":"10.1007/s10452-026-10268-4","vorDoiUrl":"https://doi.org/10.1007/s10452-026-10268-4","workflowStages":[]},"version":"v1","identity":"rs-7453914","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7453914","identity":"rs-7453914","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00