Neuromedin B receptor as a potential therapeutic target for corticotroph adenomas

preprint OA: closed CC-BY-4.0
📄 Open PDF Full text JSON View at publisher

Abstract

Purpose: Cushing’s disease (CD) results from autonomous adrenocorticotropic hormone (ACTH) secretion by pituitary corticotroph adenomas, leading to excessive cortisol production, ultimately affecting morbidity and mortality. Pasireotide is the only FDA approved tumor directed treatment for CD, but it is effective in only about 25% of patients, and is associated with a high rate of hyperglycemia. Neuromedin B (NMB), a member of the bombesin-like peptide family, regulates endocrine secretion and cell proliferation. Here, we assessed NMB and NMB receptor (NMBR) expression in human corticotroph adenomas and the effects of NMBR antagonist PD168368 on murine and human corticotroph tumors. Methods: To investigate NMB and NMBR expression, real-time qPCR and immunostaining on human pathological specimens of corticotroph, non-functional and somatotroph pituitary adenomas were performed. The effects of PD168368 on hormone secretion and cell proliferation were studied in vitro , in vivo and in seven patient-derived corticotroph adenoma cells. NMB and NMBR were expressed in higher extent in human corticotroph adenomas compared with non-functional or somatotroph adenomas. Results: In murine AtT-20 cells, PD168368 reduced proopiomelanocortin (Pomc) mRNA/protein expression and ACTH secretion as well as cell proliferation. In mice with tumor xenografts, tumor growth, ACTH and corticosterone were downregulated by PD168368. In patient-derived adenoma cells, PD168368 reduced POMC mRNA expression in four out of seven cases and ACTH secretion in two out of five cases. A PD168368-mediated cyclin E suppression was also identified in AtT-20 and patient-derived cells. Conclusion: NMBR antagonist represents a potential treatment for CD and its effect may be mediated by cyclin E suppression.
Full text 161,102 characters · extracted from preprint-html · click to expand
Neuromedin B receptor as a potential therapeutic target for corticotroph adenomas | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Neuromedin B receptor as a potential therapeutic target for corticotroph adenomas Tomonori Sekizaki, Hiraku Kameda, Akinobu Nakamura, Saki Kuwabara, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3122899/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 29 Aug, 2023 Read the published version in Pituitary → Version 1 posted 10 You are reading this latest preprint version Abstract Purpose Cushing’s disease (CD) results from autonomous adrenocorticotropic hormone (ACTH) secretion by pituitary corticotroph adenomas, leading to excessive cortisol production, ultimately affecting morbidity and mortality. Pasireotide is the only FDA approved tumor directed treatment for CD, but it is effective in only about 25% of patients, and is associated with a high rate of hyperglycemia. Neuromedin B (NMB), a member of the bombesin-like peptide family, regulates endocrine secretion and cell proliferation. Here, we assessed NMB and NMB receptor (NMBR) expression in human corticotroph adenomas and the effects of NMBR antagonist PD168368 on murine and human corticotroph tumors. Methods To investigate NMB and NMBR expression, real-time qPCR and immunostaining on human pathological specimens of corticotroph, non-functional and somatotroph pituitary adenomas were performed. The effects of PD168368 on hormone secretion and cell proliferation were studied in vitro , in vivo and in seven patient-derived corticotroph adenoma cells. NMB and NMBR were expressed in higher extent in human corticotroph adenomas compared with non-functional or somatotroph adenomas. Results In murine AtT-20 cells, PD168368 reduced proopiomelanocortin (Pomc) mRNA/protein expression and ACTH secretion as well as cell proliferation. In mice with tumor xenografts, tumor growth, ACTH and corticosterone were downregulated by PD168368. In patient-derived adenoma cells, PD168368 reduced POMC mRNA expression in four out of seven cases and ACTH secretion in two out of five cases. A PD168368-mediated cyclin E suppression was also identified in AtT-20 and patient-derived cells. Conclusion NMBR antagonist represents a potential treatment for CD and its effect may be mediated by cyclin E suppression. Cushing’s disease therapeutic target neuromedin B NMB ACTH Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Cushing’s disease is the result of autonomous adrenocorticotropic hormone (ACTH) secretion by pituitary corticotroph adenomas, leading to excessive cortisol production. Patients with Cushing’s disease present with clinical features of chronic hypercortisolism, including central obesity, moon face, diabetes mellitus, hypertension, hypercoagulability and an immunocompromised state [ 1 ]. Cushing’s disease is associated with greater mortality, mainly due to cardiovascular disease or infection [ 2 , 3 ]. The first-line therapy for Cushing’s disease is pituitary surgery [ 4 ]. Although the remission rate is approximately 80% in patients with microadenoma, it is approximately 60% in those with macroadenoma, and repeat pituitary surgery is associated with poorer outcomes [ 5 ]. Patients with persistent or recurrent Cushing’s disease require additional treatment including drug therapy. Among the pituitary-targeting agents, pasireotide has been demonstrated to reduce ACTH production and control tumor volume, and the response rate has been reported to be 17–82% [ 6 – 8 ]. However, pasireotide use can be associated with adverse events, including severe hyperglycemia, diarrhea and cholelithiasis [ 7 – 9 ]. The adrenal-targeting agents osilodrostat, metyrapone and ketoconazole are effective at controlling hypercortisolism but do not directly target corticotroph adenomas [ 10 , 11 ]. Therefore, there is an unmet need for effective and safe agents for the management of Cushing’s disease. In recent years, various therapeutic agents that target epidermal growth factor (EGFR) [ 12 ], cyclin-dependent kinase 2 (CDK2)/cyclin E [ 13 , 14 ], heat-shock protein Hsp90 [ 15 ], ubiquitin-specific peptidase 8 (USP8) [ 16 , 17 ], histone deacetylase (HDAC)/phosphatidylinositol-3 kinase (PI3K) [ 18 , 19 ] and achaete-scute complex homolog 1 (ASCL1) [ 20 ] have been explored. Neuromedin B (NMB), a member of the bombesin-like peptide family, is expressed in the central nervous system, pancreas, gastrointestinal tissues and some types of cancer cells. NMB affects thermoregulation [ 21 ] and smooth muscle contraction [ 22 ]. It has also been reported that NMB stimulates cell proliferation in cancer cells [ 23 ], which is an attractive target for the treatment of malignant tumors. In addition, NMB stimulates gastrin, gastric inhibitory peptide and insulin secretion in rats or dogs, indicating NMB is a regulator of endocrine secretion [ 24 – 26 ]. The expression and function of NMB in the pituitary gland have been investigated, especially in thyrotrophs. NMB is expressed in the thyrotroph [ 27 ], and NMB receptor-deficient mice show altered TSH response to TRH stimulation [ 28 ]. Regarding its relationship with corticotrophs, subcutaneous NMB administration increases the plasma ACTH and corticosterone concentrations in rats [ 29 ]. Furthermore, we have previously shown that NMB is highly expressed in the pituitary corticotrophs of melanocortin 2 receptor (MC2R)-deficient mice, a model of chronic adrenal insufficiency [ 30 ]. Thus, NMB has been a candidate of the therapeutic target of Cushing’s disease. Here, we aimed to characterize the expression of NMB and NMB receptor (NMBR) in human corticotroph adenomas and the effects of the NMBR antagonist PD168368 on murine and human corticotroph tumors. Materials and Methods Human pituitary adenoma samples Formalin-fixed, paraffin-embedded (FFPE) blocks from patients with pituitary adenoma and diagnoses of non-functional adenoma, acromegaly or Cushing’s disease who underwent transsphenoidal surgery (n = 8–10 per group) were used to evaluate NMB and NMBR expression. Surgically resected human corticotroph tumor samples from patients who were diagnosed with Cushing’s disease or subclinical Cushing’s disease and underwent transsphenoidal surgery (n = 7, other than those whose FFPE blocks were used in the previous experiment) were used to evaluate the effect of PD168368 in primary cultures of patient-derived primary cells. The procedure used for the diagnosis of Cushing’s disease and subclinical Cushing’s disease followed the published Japanese diagnostic criteria [ 31 ]. In all the patients, the presence of an ACTH-producing tumor was confirmed histologically after its resection. RNA extraction from FFPE samples RNA was extracted from FFPE samples of human pituitary adenomas using an AllPrep DNA/RNA FFPE kit (Qiagen, Hilden, Germany) and an RNeasy kit (Qiagen), according to the manufacturers’ protocols. Immunohistochemistry Immunohistochemical staining was performed to evaluate NMB, NMBR and cyclin E1 protein expression. Human corticotroph adenoma samples were embedded in paraffin and 5-µm-thick sections were prepared. After these were deparaffinized, hydrated with ethanol, and endogenous peroxidase activity was blocked, the sections were immunostained using rabbit anti-NMB (Sigma-Aldrich, St. Louis, MO catalog no. SAB1301059, RRID:AB_2619620), mouse anti-NMBR (Santa Cruz Biotechnology, Dallas, TX, catalog no. sc-374623, RRID:AB_10989220) or mouse anti-cyclin E antibodies (Santa Cruz Biotechnology, catalog no. sc-377100, RRID:AB_2923122). The sections were counterstained with hematoxylin. Images were acquired using a BZ-X710 microscope (Keyence, Osaka, Japan). For immunofluorescence, tissue sections were incubated overnight at 4°C with the appropriate primary antibodies [rabbit anti-NMB antibody, mouse anti-NMBR, mouse anti-GH antibody (Santa Cruz Biotechnology, catalog no. sc-166696, RRID:AB_2111022) or mouse anti-ACTH antibody (Santa Cruz Biotechnology, catalog no. sc-57021, RRID:AB_785253)]. After rinsing with phosphate-buffered saline, the tissues were incubated with secondary antibodies for 30 minutes [Alexa Fluor 594-conjugated anti-mouse IgG (Molecular Probes, catalog no. A21203, RRID:AB_141633) or Alexa Fluor 488-conjugated antirabbit IgG (Molecular Probes, Eugene, OR, catalog no. A11008, RRID:AB_143165)]. The nuclei were counterstained with Vectashield HardSet mounting medium containing 4,6-diamino-2-phenylindole (DAPI) (Vector Laboratories, Newark, CA). Immunofluorescence was visualized using a BZ-9000 fluorescence microscope (Keyence). Cell culture and reagents AtT-20/D16v-F2 cells (RRID:CVCL_4109) were purchased from ATCC. AtT-20/D16v-F2 cells were cultured in DMEM (Thermo Fisher Scientific, Waltham, MA) containing 10% fetal bovine serum, penicillin and streptomycin in a 5% CO 2 -containing humidified atmosphere at 37°C. PD168368 was purchased from Santa Cruz Biotechnology (catalog no. sc-204166). Animals BALB/c-nu mice were purchased from Charles River Laboratories (Wilmington, MA) and were maintained under a 12-h light/dark cycle (lights on at 06:00 and off at 18:00). Food and water was provided ad libitum . Tumor xenograft model AtT-20/D16v-F2 cells (1×10 6 cells) in 1:1 ratio with Matrigel (BD Biosciences, Franklin Lakes, NJ) were subcutaneously injected into the dorsum of BALB/c-nu mice, then the mice were allocated to two groups of eight 1 week afterwards. The first group was administered 50 µL vehicle (polyethylene glycol 400 (PEG), Sigma-Aldrich) daily by intraperitoneal injection and the second group was administered 1.2 mg/kg PD168368 in PEG daily with reference to the previous report [ 32 ]. The mice were weighed and their tumor size was measured using calipers 0, 7 and 14 days later. Their tumor volumes were calculated using the equation length × width 2 × 0.5. The mice were euthanized on day 14, between 08:30 and 12:30, by decapitation after anesthesia was induced using isoflurane. Blood samples were obtained from the left ventricle of each mouse by cardiac puncture and serum/plasma was stored at − 80°C until analyzed. Patient-derived corticotroph adenoma cells We isolated cells from corticotroph tumors of patients using Neural Tissue Dissociation Kits (Miltenyi Biotec, Bergisch Gladbach, Germany), according to the manufacturer’s protocol, then resuspended them in DMEM supplemented with 10% fetal bovine serum. After 24 h of incubation with concentrations of PD168368, we extracted RNA from the isolated cells and collected the medium. Quantitative real-time PCR RNA was isolated from AtT-20/D16v-F2 cells or patient-derived corticotroph adenoma cells using an RNeasy Mini Kit (Qiagen) and used this to prepare cDNA. Real-time PCR was performed in duplicate using a 7500 Fast Real Time PCR system and Fast SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA). RTarget mRNA expression was calculated relative to that of 18S mRNA for experiments performed in AtT-20/D16v-F2 cells, and relative to that of GAPDH for experiments performed in patient-derived corticotroph adenoma cells. The primer sequences used are listed in Table 1 . Table 1 Primers for real-time PCR Gene name Gene symbol Forward Primer Reverse Primer Human NMB NMB CAAATACTGCAGAAATGACACCAAT AGGGTCCCATTCAGCACCTT Human NMBR NMBR AAGGTGGGCTGCAAACTG CAGTGAGAGTGAACACGGAAACC Human POMC POMC CAGGACCTCACCACGGAAAG CGGGAACATGGGAGTCTCG Human cyclin E CCNE GTGTCCTGGATGTTGACTGC TGCAGTGAAGACATGTGGG Human GAPDH GAPDH GGATTTGGTCGTATTGGG GGAAGATGGTGATGGGATT Mouse Pomc Pomc TGTACCCCAACGTTGCTGAG AGGACCTGCTCCAAGCTAA Mouse cyclin E1 Ccne1 TGCACCAGTTTGCTTATGTT CCGTGTCGTTGACATAGG Mouse cyclin-dependent kinase 2 Cdk2 TTGGAGTCCCTGTCCGAACT CGGGTCACCATTTCAGCAAAG Mouse 18S ribosomal RNA 18S TGGCCAACGGTCTAGACAAC CAGTGGTCTTGGTGTGCTGA DNA microarray analysis cDNA was prepared from RNA and used in a Clariom S assay (Affymetrix, Santa Clara, CA), the results of which were analyzed according to the Affymetrix protocol. The scanned image files were visually inspected for artefacts and normalized using GeneChip Command Console Software (Affymetrix). The gene expression of vehicle and 1 µM PD168368-treated AtT-20/D16v-F2 cells was compared using Transcriptome Analysis Console software (Applied Biosystems). Western blotting After each treatment, AtT-20 cells were lysed in CelLytic M (Sigma Aldrich) supplemented with a protease and phosphatase inhibitor cocktail. Lysates containing the same amount of protein were mixed with 2× Laemmli Sample Buffer (Bio-Rad), separated on 4–20% polyacrylamide gels (Bio-Rad, Hercules, CA) and electroblotted onto polyvinylidene fluoride membranes (Millipore, Burlington, MA). The membranes were blocked in Bullet Blocking One for Western Blotting (Nacalai Tesque. Kyoto, Japan) for 30 minutes at room temperature, then incubated with the appropriate primary antibodies overnight at 4°C [mouse anti-POMC antibody (Santa Cruz Biotechnology, catalog no. sc-57021, RRID:AB_785253),, rabbit anti-cyclin E1 antibody (Cell Signaling Technology, Danvers, MA, catalog #20808, RRID:AB_2783554), rabbit anti-CDK2 antibody (Cell Signaling Technology, catalog #18048, RRID:AB_2923174) or rabbit anti-GAPDH (Cell Signaling Technology, catalog #5174, RRID:AB_10622025)]. Horseradish peroxidase-conjugated goat anti-rabbit antibody (Bio-Rad, catalog no. 170–5046, RRID:AB_11125757) and horse anti-mouse antibody (Bio-Rad, catalog no. 172–1011, RRID:AB_11125936) were used as the secondary antibodies. Signals were detected using ECL Western Blotting Detection Reagents (Cytiva, Tokyo, Japan) and an LAS-4000 imager (Fujifilm, Tokyo, Japam), and the specific band intensities were normalized to those of GAPDH. To quantify protein expression, densitometric analysis was performed using ImageJ software (NIH Image). ACTH and corticosterone assays Medium and mouse plasma ACTH concentrations were analyzed using an ELISA kit (MD Bioproducts, Zürich, Switzerland, catalog no. M046006), according to the manufacturer’s protocol. The medium ACTH concentration was normalized to water-soluble tetrazolium salt (WST)-1 (Takara Bio, Shiga, Japan) absorbance. Mouse serum corticosterone concentration was analyzed using an ELISA kit (Enzo Life Sciences, Farmingdale, NY, catalog no. ADI-900-097). Cell proliferation analysis For cell proliferation assays, 2×10 4 cells were seeded into each well of a 96-well plate, then following each treatment WST-1 reagent (Takara Bio) was added and the cells were incubated for 2 hours in the incubator. A microplate reader (SpectraMax Paradigm, Molecular Devices, San Jose, CA) was used to measure the absorbance of each well at 440 nm. All measurements were performed in duplicate or triplicate. Statistics Data are presented as mean ± SD. Comparisons between two groups were made using unpaired Student t- tests, and one-way ANOVA was used to compare values among multiple groups. If the ANOVA test showed significant differences, the Tukey-Kramer post-hoc test was used to compare two specific groups and Dunnett’s test was used to compare other groups with the control group. The results were considered to be statistically significant if the P -value was < 0.05. Statistical analyses were performed using JMP Pro software (version 16.0.0, SAS Institute Inc. Cary, NC). Study approval All the human samples were collected following the provision of written informed consent. The human sample study protocol and the consent procedure for the patients were approved by the Institutional Review Board of Hokkaido University Hospital, Sapporo, Japan (No. 018–0201). Animal experiments were approved by the Institutional Animal Care and Use Committee of the National University Corporation, Hokkaido University (No. 18–0141), and conducted according to the ethical guidelines of the National University Corporation Hokkaido University regarding animal experimentation and the safety guidelines for gene manipulation experiments. Results NMB and NMBR expression in human pituitary adenomas In quantitive real-time PCR analysis, the expression of NMB was significantly higher in corticotroph adenomas (19 times as high as those in non-functional adenomas) than in somatotroph or non-functional adenomas (Fig. 1 A, each P < 0.01). The expression of NMBR was also significantly higher in corticotroph adenomas (110 times as high as those in non-functional adenomas) than in non-functional adenomas (Fig. 1 A, P < 0.05). Immunostaining study confirmed that the protein expression of NMB and NMBR was also higher in corticotroph adenomas than in somatotroph or non-functional adenomas (Fig. 1 B). The NMBR antagonist PD168368 reduces Pomc and cyclin E expression and ACTH secretion in murine corticotroph tumor cells To evaluate the potential for the use of NMBR as a target for the treatment of Cushing’s disease, we treated murine AtT-20/D16v-F2 cells with the NMBR antagonist PD168368 (0.1nM–1µM). Tumor cell Pomc , a precursor of ACTH, mRNA expression was dose-dependently reduced by PD168368 (~ 42%; Fig. 2 A). POMC protein expression of the cells (~ 24%; Fig. 2 B) and the ACTH content of the medium (~ 20%; Fig. 2 C) were also reduced by PD168368 treatment. Next, to identify genes related to the effect of the NMBR antagonist in tumorous corticotrophs, we performed DNA microarray analysis. Two libraries derived from the vehicle group and the PD168368 treatment (1µM) group were used. The analysis revealed that 1,709 genes were differentially expressed by ≥ 1.5-fold; 894 genes were upregulated and 815 were downregulated. A hierarchical clustering analysis heat map shows the differences between the two groups (Fig. 2 D). Pomc gene expression was significantly downregulated by approximately 0.76-fold in the PD168368 group (data not shown). Pathway analysis showed significant differences in eleven pathways (Table 2 ). In particular, 16 genes involved in the cell cycle were significantly upregulated (Table 3 ) and five downregulated (Table 4 ). Importantly, Cyclin E1 ( Ccne1 ) expression was downregulated by approximately 0.55-fold in the PD168368 treatment group. Quantitative PCR analyses confirmed the suppression of Ccne1 mRNA expression in the PD168368 treatment group (Fig. 2 E). The mRNA expression of Cdk2 , which encodes a protein that forms a complex with cyclin E, was also reduced by PD168368 treatment. Western blot analysis confirmed the dose-dependent suppression of cyclin E1 and CDK2 by PD168368 treatment (Fig. 2 B). Cell proliferation was also suppressed by PD168368 treatment, as demonstrated using a WST-1 assay (by ~ 25%; Fig. 2 F). Table 2 Pathway analysis derived from the microarray data, comparing AtT-20/D16vF2 cells treated with PD168368 1 µl or vehicle Pathway Total Up Down p-value Up List Down List Adipogenesis genes 23 8 15 < 0.001 Scd1, Gadd45b, Ncoa2, Stat2, Lifr, Il6st, Ncoa1, Tle3 Id3, Lif, Nr1h3, Serpine1, Nsg1, Hmga1, Cebpd, Foxo1, Ppargc1a, Trib3, Egr2, Bscl2, Lpin2, Agt, Mef2b Cell cycle 21 16 5 < 0.001 Hdac4, Bub1b, Abl1, Bub1, Ccna2, Ccnb1, Ccnb2, Espl1, Ep300, Cdc20, Pttg1, Mad2l1, Cdc25b, Hdac6, Plk1, Cdc25c Mcm3, Ccnd3, Ccne1, Cdkn1a, Ccnb3 mRNA processing 18 11 7 < 0.001 Polr2a, Cpeb4, Rbm4, Spen, Ilf3, Elavl3, Rbmx, Eif4g3, Pspc1, Tia1, Qk Cpeb1, Wdr55, Ppargc1a, Synj2, Rbpms, Nxf7, Pcolce p53 signaling 17 7 10 < 0.001 Mdm4, Ccnb1, Ccnb2, Gadd45b, Sesn1, Sesn3, Ccng2 Cdkn1a, Ccnd3, Ccne1, Ccnb3, Bax, Shisa5, Zmat3, Serpine1, Thbs1, Ccng1 Cholesterol metabolism with Bloch and Kandutsch-Russell pathways 16 13 3 < 0.001 Hmgcr, Fasn, Sc5d, Nsdhl, Hsd17b7, Dhcr24, Acat2, Hmgcs1, Mvd, Idi1, Fdft1, Lss, Scd1 Nr1h3, Cyp27a1, Soat2 Androgen receptor signaling pathway 15 11 4 0.03 Hmgb2, Il6st, Ep300, Ncoa2, Nr2c2, Tgif1, Cdc25b, Crebbp, Ncoa1, Pxn, Pou2f1 Etv5, Rnf14, Ccne1, Pnrc1 Kit receptor signaling pathway 11 5 6 0.01 Ptpru, Abl1, Cbl, Ep300, Kit Grb7, Plce1, Sh2b2, Tec, Dok1, Tnfrsf10b SREBF and miR33 in cholesterol and lipid homeostasis 8 5 3 < 0.001 Sirt1, Hmgcr, Mtor, Hmgcs1, Ldlr Sirt6, Nr1h3, Ppargc1a Cholesterol biosynthesis 8 8 0 < 0.001 Nsdhl, Hmgcs1, Idi1, Mvd, Hmgcr, Sc5d, Fdft1, Lss Oxidative stress response 7 3 4 0.005 Cat, Mt1, Nqo1 Sod3, Gpx3, Hmox1, Txn2 Glycogen metabolism 7 5 2 0.01 Phkg2, Ppp2r5e, Ppp2r5d, Ppp2r2b, Phka2 Pygm, Gys1 Table 3 Cell cycle-related genes that were upregulated on microarray analysis Gene Symbol Gene Description Accession Number PD168368 group (Raw) Vehicle group (Raw) p-value Absolute Fold Change Cdc20 cell division cycle 20 NM_023223 8876.788 1702.1023 0.03 5.2151905 Cdc25c cell division cycle 25C NM_009860 1820.9082 528.8153 0.05 3.4433728 Ccnb2 cyclin B2 NM_007630 15639.253 6408.7167 0.03 2.4403096 Espl1 extra spindle pole bodies 1 NM_001014976 1123.0106 490.4575 0.07 2.2897204 Bub1b budding uninhibited by benzimidazoles 1 homolog, beta NM_009773 9124.7573 4010.025 0.05 2.2754864 Bub1 budding uninhibited by benzimidazoles 1 homolog NM_001113179 17309.93 8009.819 0.04 2.1610888 Plk1 polo-like kinase 1 NM_011121 38080.697 18379.557 0.06 2.0719051 Pttg1 pituitary tumor-transforming gene 1 NM_001131054 14562.601 7669.4723 0.07 1.8987748 Ccna2 cyclin A2 NM_009828 40199.11 22595.897 0.02 1.7790447 Hdac4 histone deacetylase 4 NM_207225 302.57627 170.14993 < 0.01 1.7782920 Mad2l1 MAD2 mitotic arrest deficient-like 1 NM_019499 21404.107 12150.647 0.05 1.7615611 Ep300 E1A binding protein p300 NM_177821 551.88443 315.0866 0.02 1.7515325 Abl1 c-abl oncogene 1, non-receptor tyrosine kinase NM_001112703 117.82293 72.93047 0.01 1.6155515 Cdc25b cell division cycle 25B NM_009860 1704.1283 1065.8890 0.01 1.5987859 Ccnb1 cyclin B1 NM_172301 19795.067 12410.597 0.16 1.5950133 Hdac6 histone deacetylase 6 NM_001130416 1021.3623 667.02993 0.03 1.5312091 Table 4 Cell cycle-related genes that were downregulated on microarray analysis Gene Symbol Gene Description Accession Number PD168368 group (Raw) Vehicle group (Raw) p-value Absolute Fold Change Cdkn1a cyclin-dependent kinase inhibitor 1A (P21) NM_001111099 62591.303 133932.367 < 0.01 0.46733516 Ccnd3 cyclin D3 NM_001081635 3299.6733 6154.6873 0.01 0.53612363 Ccne1 cyclin E1 NM_007633 6303.089 11543.773 0.02 0.54601638 Mcm3 minichromosome maintenance deficient 3 NM_008563 9948.2567 14297.78 0.05 0.69579030 Ccnb3 cyclin B3 NM_183015 12.253957 17.483783 0.03 0.70087557 In vivo effects of PD168368 in a tumor xenograft model To evaluate the in vivo effects of PD168368, we used a tumor xenograft model, BALB/c-nu mice subcutaneously inoculated with AtT-20/D16v-F2 cells. PD168368 treatment significantly reduced tumor volume (control 260 ± 102 mm 3 vs . PD168368 122 ± 95 mm 3 , P < 0.05; Fig. 3 A) and growth rate (control 161%±54% vs . PD168368 70%±56%, P < 0.01; Fig. 3 B). The plasma ACTH (control 180 ± 45 pg/ml vs . PD168368 97 ± 21 pg/ml, P < 0.05; Fig. 3 C) and serum corticosterone (control 1,045 ± 237 ng/ml vs . PD168368 813 ± 135 ng/ml, P < 0.05; Fig. 3 D) concentrations were significantly reduced by PD168368 treatment. PD168368 reduces POMC expression and ACTH secretion in patient-derived corticotroph adenoma cells To confirm the effects of PD168368 that were observed in in vitro and in vivo experiments, we treated primary cell cultures derived from surgically resected human corticotroph tumors with PD168368. PD168368 treatment significantly reduced POMC mRNA expression (by 12–31%) in four (Patient 1 by ~ 12%, P < 0.05, Patient 2 by ~ 26%, P < 0.05, Patient 3 by ~ 31%, P < 0.01, Patient 4 by ~ 18%, not significant; Fig. 4 A) out of seven patient-derived corticotroph adenoma cell cultures. Cyclin E ( CCNE ) mRNA expression was also reduced in three out of the four patient cells in which POMC mRNA expression was reduced (Fig. 4 B). The ACTH content of the medium, reflecting cell secretion, was also reduced (by 23–53%) in two (Patient 4 by ~ 53%, P < 0.01, Patient 6 by ~ 23%, P < 0.01, Fig. 4 C) out of the five cases that could be evaluated (ACTH content of the medium could not be evaluated in Patient 1 and 2 due to lack of data obtained by WST-1 measurement.). Thus, five out of seven tumor cell cultures were affected by PD168368 treatment. However, the clinical features of the patients (Table 5 ) and the protein expression of NMB, NMBR and cyclin E in corticotroph tumors, determined using immunohistochemistry (Fig. 5 ), did not correlate with the effect of PD168368 in tumor cell cultures. Table 5 Clinical features of patients with human pituitary corticotroph tumors that were treated with PD168368 in primary cell culture Patient Number Age and sex Diagnosis Tumor diameter, mm ACTH, pg/ml Cortisol, µg/dl Urinary free cortisol, µg/day 1 53, F CD 4 34.1 16.4 207.3 2 48, F SCD 30 23 15.9 120.7 3 63, F CD 5 192 44 2780 4 51, F SCD 26 62.2 7.5 85.8 5 53, F CD 14 32.3 19.7 49.7 6 28, F CD 14 80.7 14.8 187.2 7 46, F CD 13 25.3 13.2 1000 Discussion In the present study, we showed that NMB and NMBR were expressed in human corticotroph adenomas. The NMBR antagonist PD168368 suppressed ACTH secretion and tumor growth in preclinical in vitro and in vivo models of Cushing’s disease as well as patient-derived corticotroph adenoma cells. NMB, a member of the bombesin-like peptide family, was first isolated from porcine spinal cord [ 33 ], and NMB and NMBR are expressed in the central nervous system, gastrointestinal tissues, pancreas and some types of cancer cells [ 23 ]. NMB affects thermoregulation [ 21 ], smooth muscle contraction [ 22 ] and endocrine secretion [ 24 – 26 , 28 ]. NMB and NMBR are co-expressed in some cancer cell lines and human cancer tissues, and stimulates cell proliferation in an autocrine and paracrine fashion [ 34 – 36 ]. Regarding its relationship with corticotrophs, subcutaneous NMB administration increases the plasma ACTH and corticosterone concentrations in rats [ 29 ]. Furthermore, we have previously shown that NMB is highly expressed in the pituitary corticotrophs of melanocortin 2 receptor (MC2R)-deficient mice, a model of chronic adrenal insufficiency [ 30 ]. Thus, NMB expression is associated with the HPA axis and cell proliferation, but there remains a lack of direct evidence for a role of NMB in the pathogenesis of Cushing’s disease. First, we showed that NMB and NMBR were expressed in human corticotroph adenomas. Considering the associations among NMB, the HPA axis and cell proliferation, we speculate that NMB may stimulate ACTH secretion and proliferation in an autocrine or paracrine manner in corticotroph adenoma cells. Second, the NMB receptor antagonist PD168368 suppressed ACTH secretion and tumor growth in preclinical in vitro and in vivo models of Cushing’s disease and some of patient-derived corticotroph adenoma cells. PD168368 is a highly selective antagonist of the NMB receptor, and shows similar pharmacology across animal species [ 37 ]. Anti-proliferative effects of PD168368 have previously been shown in in vitro models of several cancers [ 38 , 39 ] and in an in vivo model of breast cancer [ 32 ]. However, the present study is the first to evaluate the effect of PD168368 on Cushing’s disease, to the best of our knowledge. Interestingly, significant differences in cell cycle pathways were identified in pathway analyses of DNA microarray data derived from an in vitro study. In addition, PD168368 treatment reduced cyclin E expression in AtT-20/D16v-F2 cells and patient-derived corticotroph tumor cells. Cyclin E is upregulated in human corticotroph adenomas [ 40 , 41 ] and promotes POMC expression via the activation of E2F transcription factor 1 (E2F1) [ 14 , 42 ], suggesting that cyclin E upregulation induces corticotroph cell tumorigenesis. Roscovitine, a pan-CDK inhibitor, has been shown to be a possible target for the treatment of corticotroph tumors in zebrafish, murine allografts and primary cultures of human corticotroph tumors [ 13 , 14 ]. In phase Ⅱ clinical trials for treatment of patients with de novo, recurrent or persistent Cushing’s disease, three of nine patients achieved ≥ 50% 24-hour urinary free cortisol reduction by seliciclib (R-roscovitine) treatment [ 43 ]. However, roscovitine use is associated with some side effects including diarrhea, myelosuppression, anemia, hepatic dysfunction and nausea, because of its low selectivity [ 44 ]. The results of the present study suggested that PD168368 might suppress ACTH secretion and cell proliferation via a reduction in cyclin E in corticotroph adenomas (Fig. 6 ). Increased NMB expression was observed only in the pituitary gland of MC2R-deficient mice, in which corticotroph cells were hyperplastic mimicking Cushing’s disease [ 28 ], therefore a NMBR antagonist is expected to have more specific effects on corticotroph adenomas. Indeed, in the in vivo experiment, no serious toxicity of PD168368 were identified. The present study had several limitations. First, we could not detect the reduction of POMC expression or ACTH secretion by PD168368 treatment in part of patient-derived adenoma cells. The reasons given for this include that the 24 h incubation time might not be appropriate in evaluating the suppressive effect of PD168368 on POMC expression and ACTH secretion. Therefore, studies with different incubation times should be performed. Second, there were wide variation in NMB and NMBR mRNA expression of FFPE samples of human corticotroph adenomas. Also, we could not identify clinical or pathological findings associated with the therapeutic response of PD168368 in patient-derived adenoma cells. To overcome these limitations, further investigations with the larger sample size are needed. Recently, mutations in the ubiquitin-specific-protease 8 ( USP8 ) gene have been found in 20–60% of patients with ACTHomas [ 45 , 46 ]. USP8 mutations result in greater deubiquitination of EGFR and a consequent imbalance in EGFR signaling, with high ACTH synthesis and secretion secondary to E2F1-mediated transcriptional activity. These effects are attenuated by the tyrosine kinase inhibitor gefitinib [ 12 , 47 , 48 ]. NMB causes the phosphorylation of EGFR in human non-small lung cancer cells [ 49 ], suggesting that an NMBR antagonist might affect EGFR signaling. However, we could not elucidate the effect of PD168368 on EGFR or the relationship with mutations in USP8 in the present study. More comprehensive studies that investigate the relationship of NMBR antagonist and EGFR signaling/USP8 mutation are necessary. In summary, we presented evidence that NMBR may represent a molecular target for the treatment of patients with Cushing’s disease and that the effects may be mediated through the suppression of cyclin E expression. Declarations The authors have nothing to disclose. Acknowledgements This work was supported by JSPS KAKENHI Grant Numbers 18H06229, 19K21329 and 20K17481, and the Akiyama Life Science Foundation. We thank Department of Surgical Pathology, Hokkaido University Hospital for cooperation in the preparation of archival pathological specimens. We thank Mark Cleasby, PhD from Edanz (https://jp.edanz.com/ac) for editing a draft of this manuscript. Email addresses of all non-corresponding authors: Tomonori Sekizaki [email protected] Akinobu Nakamura [email protected] Saki Kuwabara [email protected] Hiroshi Nomoto [email protected] Kyu Yong Cho [email protected] Yukitomo Ishi [email protected] Hiroaki Motegi [email protected] Hideaki Miyoshi [email protected] Tatsuya Atsumi [email protected] Author Contributions Tomonori Sekizaki and Hiraku Kameda designed the study, performed experiments and acquired the data. Tomonori Sekizaki and Hiroaki Motegi obtained clinical samples. Tomonori Sekizaki and Hiraku Kameda drafted the manuscript, and all other authors reviewed and revised the manuscript. Ethical approval: The study was approved by the Institutional Review Board (No. 018-0201). All patients agreed to participate in the study and pro­vided written informed consent. Competing interests: The authors declare no potential conflicts of interest. Data Availability Some or all datasets generated during and/or analyzed during the current study are not publicly available but are available from the corresponding author on reasonable request. References Newell-Price J, Bertagna X, Grossman AB, Nieman LK. Cushing's syndrome. Lancet. (2006) 367(9522):1605-17. https://doi.org/10.1016/S0140-6736(06)68699-6 Dekkers OM, Horváth-Puhó E, Jørgensen JO, Cannegieter SC, Ehrenstein V, Vandenbroucke JP, et al. Multisystem morbidity and mortality in Cushing's syndrome: a cohort study. J Clin Endocrinol Metab. (2013) 98(6):2277-84. https://doi.org/10.1210/jc.2012-3582 Valassi E, Tabarin A, Brue T, Feelders RA, Reincke M, Netea-Maier R, et al. High mortality within 90 days of diagnosis in patients with Cushing's syndrome: results from the ERCUSYN registry. Eur J Endocrinol. (2019) 181(5):461-472. https://doi.org/10.1530/EJE-19-0464 Fleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR, et al. Consensus on diagnosis and management of Cushing's disease: a guideline update. Lancet Diabetes Endocrinol. (2021) 9(12):847-875. https://doi.org/10.1016/S2213-8587(21)00235-7 Pivonello R, De Leo M, Cozzolino A, Colao A. The treatment of Cushing's disease. Endocr Rev. (2015) 36(4):385-486. https://doi.org/10.1210/er.2013-1048 Boscaro M, Ludlam WH, Atkinson B, Glusman JE, Petersenn S, Reincke M, et al. Treatment of pituitary-dependent Cushing's disease with the multireceptor ligand somatostatin analog pasireotide (SOM230): a multicenter, phase II trial. J Clin Endocrinol Metab. (2009) 94(1):115-122. https://doi.org/10.1210/jc.2008-1008 Colao A, Petersenn S, Newell-Price J, Findling JW, Gu F, Maldonado M, et al. A 12-month phase 3 study of pasireotide in Cushing's disease. N Engl J Med. (2012) 366(10):914-924. https://doi.org/10.1056/NEJMoa1105743 Lacroix A, Gu F, Gallardo W, Pivonello R, Yu Y, Witek P, et al. Efficacy and safety of once-monthly pasireotide in Cushing's disease: a 12 month clinical trial. Lancet Diabetes Endocrinol. (2018) 6(1):17-26. https://doi.org/10.1016/S2213-8587(17)30326-1 Manetti L, Deutschbein T, Schopohl J, Yuen KCJ, Roughton M, Kriemler-Krahn U, et al. Long-term safety and efficacy of subcutaneous pasireotide in patients with Cushing's disease: interim results from a long-term real-world evidence study. Pituitary. (2019) 22(5):542-551. https://doi.org/10.1007/s11102-019-00984-6 Pivonello R, De Leo M, Cozzolino A, Colao A. Medical treatment of Cushing's disease: An overview of the current and recent clinical trials. Front Endocrinol (Lausanne). (2020) 11:648. https://doi.org/10.3389/fendo.2020.00648 Castinetti F, Nieman LK, Reincke M, Newell-Price J. Approach to the patient treated with steroidogenesis inhibitors. J Clin Endocrinol Metab. (2021) 106(7):2114-2123. https://doi.org/10.1210/clinem/dgab122 Fukuoka H, Cooper O, Ben-Shlomo A, Mamelak A, Ren SG, Bruyette D, et al. EGFR as a therapeutic target for human, canine, and mouse ACTH-secreting pituitary adenomas. J Clin Invest. (2011) 121(12):4712-4721. https://doi.org/10.1172/JCI60417 Liu NA, Jiang H, Ben-Shlomo A, Wawrowsky K, Fan XM, Lin S, et al. Targeting zebrafish and murine pituitary corticotroph tumors with a cyclin-dependent kinase (CDK) inhibitor. Proc Natl Acad Sci U S A. (2011) 108(20):8414-9. https://doi.org/ 10.1073/pnas.1018091108 Liu NA, Araki T, Cuevas-Ramos D, Hong J, Ben-Shlomo A, Tone Y, et al. Cyclin E-mediated human proopiomelanocortin regulation as a therapeutic target for Cushing disease. J Clin Endocrinol Metab. (2015) 100(7):2557-64. https://doi.org/10.1210/jc.2015-1606 Shen Y, Ji C, Jian X, Zhou J, Zhang Q, Qiao N, et al. Regulation of the EGFR Pathway by HSP90 Is Involved in the Pathogenesis of Cushing's Disease. Front Endocrinol (Lausanne). (2021) 11:601984. https://doi.org/10.3389/fendo.2020.601984 Kageyama K, Asari Y, Sugimoto Y, Niioka K, Daimon M. Ubiquitin-specific protease 8 inhibitor suppresses adrenocorticotropic hormone production and corticotroph tumor cell proliferation. Endocr J. (2020) 67(2):177-184. https://doi.org/10.1507/endocrj.EJ19-0239 Treppiedi D, Di Muro G, Marra G, Barbieri AM, Mangili F, Catalano R, et al. USP8 inhibitor RA-9 reduces ACTH release and cell growth in tumor corticotrophs. Endocr Relat Cancer. (2021) 28(8):573-582. https://doi.org/10.1530/ERC-21-0093 Lu J, Chatain GP, Bugarini A, Wang X, Maric D, Walbridge S, et al. Histone deacetylase inhibitor SAHA is a promising treatment of Cushing disease. J Clin Endocrinol Metab. (2017) 102(8):2825-2835. https://doi.org/10.1210/jc.2017-00464 Zhang D, Damoiseaux R, Babayan L, Rivera-Meza EK, Yang Y, Bergsneider M, et al. Targeting corticotroph HDAC and PI3-Kinase in Cushing disease. J Clin Endocrinol Metab. (2021) 106(1):e232-e246. https://doi.org/10.1210/clinem/dgaa699 Chen Z, Jia Q, Zhao Z, Zhang Q, Chen Y, Qiao N, et al. Transcription factor ASCL1 acts as a novel potential therapeutic target for the treatment of the Cushing's disease. J Clin Endocrinol Metab. (2021) 106(1):e232-e246. https://doi.org/10.1210/clinem/dgaa699 Itoh S, Takashima A, Itoh T, Morimoto T. Effects of neuromedins and related peptides on the body temperature of rats. Jpn J Physiol. (1995) 45(1):37-45. https://doi.org/10.2170/jjphysiol.45.37 Minamino N, Kangawa K, Matsuo H. Neuromedin C: a bombesin-like peptide identified in porcine spinal cord. Biochem Biophys Res Commun. (1984) 119(1):14-20. https://doi.org/10.1016/0006-291x(84)91611-5 Ohki-Hamazaki H. Neuromedin B. Prog Neurobiol. (2000) 62(3):297-312. https://doi.org/10.1016/s0301-0082(00)00004-6 Greeley GH Jr, Spannagel A, Hill FL, Thompson JC. Comparison of the actions of bombesin, gastrin-releasing peptide-27, neuromedin B, and gastrin-releasing peptide-10 in causing release of gastrin and gastric inhibitory peptide in rats. Proc Soc Exp Biol Med. (1986) 183(1):136-139. https://doi.org/10.3181/00379727-183-42398 Namba M, Ghatei MA, Ghiglione M, Bloom SR. Effects of decapeptide of mammalian bombesin and neuromedin B on pancreatic exocrine secretion in the rat. Digestion. (1986) 34(2):105-114. https://doi.org/0.1159/000199318 Otsuki M, Fujii M, Nakamura T, Tani S, Oka T, Yajima H, et al. Effects of neuromedin B and neuromedin C on exocrine and endocrine rat pancreas. Am J Physiol. (1987) 252(4 Pt 1):G491-498. https://doi.org/10.1152/ajpgi.1987.252.4.G491 Namba M, Ghatei MA, Bishop AE, Gibson SJ, Mann DJ, Polak JM, et al. Presence of neuromedin B-like immunoreactivity in the brain and gut of rat and guinea-pig. Peptides (1985) 6 Suppl 3:257-263. https://doi.org/10.1016/0196-9781(85)90383-3 Oliveira KJ, Ortiga-Carvalho TM, Cabanelas A, Veiga MA, Aoki K, Ohki-Hamazaki H, et al. Disruption of neuromedin B receptor gene results in dysregulation of the pituitary-thyroid axis. J Mol Endocrinol. (2006) 36(1):73-80. https://doi.org/10.1677/jme.1.01892 Malendowicz LK, Nussdorfer GG. Investigations on the acute effects of neuropeptides on the pituitary-adrenocortical function in normal and cold-stressed rats. I. Bombesin and neuromedin B. Exp Toxicol Pathol. (1995) 47(1):31-34. https://doi.org/10.1016/S0940-2993(11)80279-4 Kameda H, Miyoshi H, Shimizu C, Nagai S, Nakamura A, Kondo T, et al. Expression and regulation of neuromedin B in pituitary corticotrophs of male melanocortin 2 receptor-deficient mice. Endocrinology. (2014) 155(7):2492-2499. https://doi.org/10.1210/en.2013-2077 Kageyama K, Oki Y, Sakihara S, Nigawara T, Terui K, Suda T. Evaluation of the diagnostic criteria for Cushing's disease in Japan. Endocr J. (2013) 60(2):127-135. https://doi.org/10.1507/endocrj.ej12-0299 Park HJ, Kim SR, Kim MK, Choi KS, Jang HO, Yun I, et al. Neuromedin B receptor antagonist suppresses tumor angiogenesis and tumor growth in vitro and in vivo. Cancer Lett. (2011) 312(1):117-127. https://doi.org/10.1016/j.canlet.2011.08.014 Minamino N, Kangawa K, Matsuo H. Neuromedin B: a novel bombesin-like peptide identified in porcine spinal cord. Biochem Biophys Res Commun. (1983) 114(2):541-548. https://doi.org/10.1016/0006-291x(83)90814-8 Siegfried JM, Krishnamachary N, Gaither Davis A, Gubish C, Hunt JD, Shriver SP. Evidence for autocrine actions of neuromedin B and gastrin-releasing peptide in non-small cell lung cancer. Pulm Pharmacol Ther. (1999) 12(5):291-302. https://doi.org/10.1006/pupt.1999.0210 Sun B, Halmos G, Schally AV, Wang X, Martinez M. Presence of receptors for bombesin/gastrin-releasing peptide and mRNA for three receptor subtypes in human prostate cancers. Prostate. (2000) 42(4):295-303. https://doi.org/10.1002/(sici)1097-0045(20000301)42:43.0.co;2-b Matusiak D, Glover S, Nathaniel R, Matkowskyj K, Yang J, Benya RV. Neuromedin B and its receptor are mitogens in both normal and malignant epithelial cells lining the colon. Am J Physiol Gastrointest Liver Physiol. (2005) 288(4):G718-728. https://doi.org/10.1152/ajpgi.00156.2004 Ryan RR, Katsuno T, Mantey SA, Pradhan TK, Weber HC, Coy DH, et al. Comparative pharmacology of the nonpeptide neuromedin B receptor antagonist PD168368. J Pharmacol Exp Ther. (1999) 290(3):1202-1211. Moody TW, Jensen RT, Garcia L, Leyton J. Nonpeptide neuromedin B receptor antagonists inhibit the proliferation of C6 cells. Eur J Pharmacol. (2000) 409(2):133-42. https://doi.org/10.1016/s0014-2999(00)00828-1 Moody TW, Leyton J, Garcia-Marin L, Jensen RT. Nonpeptide gastrin releasing peptide receptor antagonists inhibit the proliferation of lung cancer cells. Eur J Pharmacol. (2003) 474(1):21-29. https://doi.org/10.1016/s0014-2999(03)01996-4 Jordan S, Lidhar K, Korbonits M, Lowe DG, Grossman AB. Cyclin D and cyclin E expression in normal and adenomatous pituitary. Eur J Endocrinol. (2000) 143(1):R1-6. https://doi.org/10.1530/eje.0.143r001 Roussel-Gervais A, Bilodeau S, Vallette S, Berthelet F, Lacroix A, Figarella-Branger D, et al. Cooperation between cyclin E and p27(Kip1) in pituitary tumorigenesis. Mol Endocrinol. (2010) 24(9):1835-1845. https://doi.org/10.1210/me.2010-0091 Araki T, Liu NA. Cell Cycle Regulators and Lineage-Specific Therapeutic Targets for Cushing Disease. Front Endocrinol (Lausanne). (2018) 9:444. https://doi.org/ 10.3389/fendo.2018.00444 Liu NA, Ben-Shlomo A, Carmichael JD, Wang C, Swerdloff RS, Heaney AP, et al. Treatment of Cushing's Disease with Pituitary-Targeting Seliciclib. J Clin Endocrinol Metab. (2022): dgac588. https://doi.org/10.1210/clinem/dgac588 Le Tourneau C, Faivre S, Laurence V, Delbaldo C, Vera K, Girre V, et al. Phase I evaluation of seliciclib (R-roscovitine), a novel oral cyclin-dependent kinase inhibitor, in patients with advanced malignancies. Eur J Cancer. (2010) 46(18):3243-3250. https://doi.org/10.1016/j.ejca.2010.08.001 Theodoropoulou M, Arzberger T, Gruebler Y, Jaffrain-Rea ML, Schlegel J, Schaaf L, et al. Expression of epidermal growth factor receptor in neoplastic pituitary cells: evidence for a role in corticotropinoma cells. J Endocrinol. (2004) 183(2):385-394. https://doi.org/10.1677/joe.1.05616 Reincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F, et al. Mutations in the deubiquitinase gene USP8 cause Cushing's disease. Nat Genet. (2015) 47(1):31-38. https://doi.org/10.1038/ng.3166 Araki T, Liu X, Kameda H, Tone Y, Fukuoka H, Tone M, et al. EGFR Induces E2F1-Mediated Corticotroph Tumorigenesis. J Endocr Soc. (2017) 1(2):127-143. https://doi.org/10.1210/js.2016-1053 Fukuoka H, Shichi H, Yamamoto M, Takahashi Y. The Mechanisms Underlying Autonomous Adrenocorticotropic Hormone Secretion in Cushing's Disease. Int J Mol Sci. (2020) 21(23):9132. https://doi.org/10.3390/ijms21239132 Moody TW, Berna MJ, Mantey S, Sancho V, Ridnour L, Wink DA, et al. Neuromedin B receptors regulate EGF receptor tyrosine phosphorylation in lung cancer cells. Eur J Pharmacol. (2010) 637(1-3):38-45. https://doi.org/10.1016/j.ejphar.2010.03.057 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 29 Aug, 2023 Read the published version in Pituitary → Version 1 posted Editorial decision: Major revision 02 Aug, 2023 Reviews received at journal 15 Jul, 2023 Reviews received at journal 06 Jul, 2023 Reviewers agreed at journal 05 Jul, 2023 Reviewers agreed at journal 05 Jul, 2023 Reviewers agreed at journal 05 Jul, 2023 Reviewers invited by journal 04 Jul, 2023 Editor assigned by journal 29 Jun, 2023 Submission checks completed at journal 29 Jun, 2023 First submitted to journal 29 Jun, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3122899","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":214234674,"identity":"e548248f-7ac6-4e97-8f45-70570e93c54e","order_by":0,"name":"Tomonori Sekizaki","email":"","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tomonori","middleName":"","lastName":"Sekizaki","suffix":""},{"id":214234677,"identity":"c4817cfc-0eda-4e75-b87e-9e040b69cace","order_by":1,"name":"Hiraku Kameda","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABFElEQVRIiWNgGAWjYBACAx4QycYgZ8AAZDE2MBgwMCQwHAAJAjl4tRiTriVxA7IWvMCc5/DTDR/K7NK3S+Qee8C4w8bY4HjywwMMNXYMzLOxW2PZ22Z2c8a55NydM/LSDRjPpJkZnHlmcIDhWDID45wD2B12nsHsNm8bc+6GGzlmEoxth20MbiQAtbAdYGCcgd2FBufZv93+21afboDQkv7hAMM/PFrO9pjdBqpMgGkxAzIMDjC24dFy5kzZzZ5zxw03nHljbpDYlmYseeZNwYHEvmQenH45k77txo+yanmD4zlmDz622Rj2HU/f/OHDNzs5QxwhhgzYEDECZPAYziCoA6gFBchLENYyCkbBKBgFIwIAAAceapaIBsJaAAAAAElFTkSuQmCC","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Hiraku","middleName":"","lastName":"Kameda","suffix":""},{"id":214234678,"identity":"b9d6b611-ef58-43bc-92cb-a58d4f598f9d","order_by":2,"name":"Akinobu Nakamura","email":"","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Akinobu","middleName":"","lastName":"Nakamura","suffix":""},{"id":214234682,"identity":"4ea00038-8324-44a2-a98b-d2877a0c9116","order_by":3,"name":"Saki Kuwabara","email":"","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Saki","middleName":"","lastName":"Kuwabara","suffix":""},{"id":214234684,"identity":"05563c97-32d1-408a-aa2a-6d33811ec047","order_by":4,"name":"Hiroshi Nomoto","email":"","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hiroshi","middleName":"","lastName":"Nomoto","suffix":""},{"id":214234686,"identity":"4b2ab22e-1fd3-43a1-8588-c67bb0c27cc4","order_by":5,"name":"Kyu Yong Cho","email":"","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kyu","middleName":"Yong","lastName":"Cho","suffix":""},{"id":214234687,"identity":"1a69da46-bba6-4b92-812f-2dce02a62bfb","order_by":6,"name":"Yukitomo Ishi","email":"","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yukitomo","middleName":"","lastName":"Ishi","suffix":""},{"id":214234689,"identity":"47e01a15-768a-4841-99d1-88085317c54a","order_by":7,"name":"Hiroaki Motegi","email":"","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hiroaki","middleName":"","lastName":"Motegi","suffix":""},{"id":214234691,"identity":"210c9f4f-9f05-44c6-a99a-6f1903e86b39","order_by":8,"name":"Hideaki Miyoshi","email":"","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Hideaki","middleName":"","lastName":"Miyoshi","suffix":""},{"id":214234692,"identity":"d27d9cbc-b649-4314-9750-e15f873f01c3","order_by":9,"name":"Tatsuya Atsumi","email":"","orcid":"","institution":"Hokkaido University Graduate School of Medicine","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tatsuya","middleName":"","lastName":"Atsumi","suffix":""}],"badges":[],"createdAt":"2023-06-29 05:14:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3122899/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3122899/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11102-023-01350-3","type":"published","date":"2023-08-29T15:10:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":39466490,"identity":"03e78f26-6f3d-4ddb-a2d8-7e538f376a5b","added_by":"auto","created_at":"2023-07-03 14:09:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":671379,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNMB and NMBR expression in human non-functional pituitary adenomas (NFAs), somatotroph adenomas (GHomas), and corticotroph adenomas (ACTHomas). \u003c/strong\u003e(A) \u003cem\u003eNMB\u003c/em\u003e and \u003cem\u003eNMBR\u003c/em\u003e mRNA expression (n=8–10 per group, normalized to the expression of \u003cem\u003eGAPDH\u003c/em\u003e). (B) Immunohistochemistry for NMB and NMBR. Immunostaining was performed using an antibody specific for NMB (green). Antibodies specific for GH or ACTH (red) were used for GHomas and ACTHomas, respectively. Nuclei were stained using DAPI (blue). Original magnification 20×. Values are mean ± SD. One-way ANOVA was used to compare multiple groups, followed by the Tukey-Kramer \u003cem\u003epost-hoc\u003c/em\u003e test, as appropriate. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"OnlineFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-3122899/v1/5086dc927f4778fec645907d.png"},{"id":39466488,"identity":"f17d5ad1-e814-4063-8d62-c3151e58b48f","added_by":"auto","created_at":"2023-07-03 14:09:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":256423,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of the NMBR antagonist PD168368 effects on murine AtT-20/D16v-F2 cells. \u003c/strong\u003e(A) Pomc mRNA expression in AtT-20/D16v-F2 cells after 24 h of treatment with PD168368 (0.1 nM, 1 nM, 10 nM, 100 nM or1 µM) (normalized to the expression of \u003cem\u003e18S\u003c/em\u003e). (B) Western blots of AtT-20/D16v-F2 cells after 24 h of treatment with PD168368 (0.1, 1, 10 or 100 nM) (normalized to the expression of \u003cem\u003eGAPDH\u003c/em\u003e). (C) ACTH concentration of the culture medium of AtT-20/D16v-F2 cells after 6 h of treatment with PD168368 (0.1, 1 or 10 nM). The medium ACTH concentration was normalized to WST-1 absorbance. (D) Differentially expressed genes using hierarchical clustering in AtT-20/D16v-F2 cells treated with 1 µM PD168368 or vehicle (n=3 per group). (E) mRNA expression in AtT-20/D16v-F2 cells after 24 h of treatment with vehicle or PD168368 (1 µM), normalized to the expression of \u003cem\u003e18S\u003c/em\u003e. (F) Proliferation of AtT-20cells treated with PD168368 (1 nM, 10 nM, 100 nM, or 1 µM) for 24 h, measured using an WST-1 assay. Values are mean ± SD. Comparisons between two groups were made using unpaired Student \u003cem\u003et\u003c/em\u003e-tests. One-way ANOVA was used to compare multiple groups, followed by Dunnett’s test, if appropriate, to compare other groups with the control group. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 \u003cem\u003evs\u003c/em\u003e. control (vehicle group). Representative results of at least three independent experiments are shown.\u003c/p\u003e","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-3122899/v1/d0bbe4a8e0d40499f67a5a47.png"},{"id":39468971,"identity":"44a095a2-2d39-4c25-9fea-273868b80c19","added_by":"auto","created_at":"2023-07-03 14:17:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":120095,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePD168368 inhibits corticotroph tumor growth \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e and reduces plasma ACTH and serum corticosterone concentrations.\u003c/strong\u003e (A, B) Vehicle or PD168368 (1.2 mg/kg dissolved in PEG) was administered daily by peritoneal injection to mice with xenografted corticotroph tumors (n=8 per group). At the end of the experiment, tumor size was measured and the tumor volume (A) and growth rate (B) were calculated. (C, D) Blood samples were collected by cardiac puncture and the plasma ACTH (C) and serum corticosterone (D) concentrations of the vehicle and PD168368-treated mice were compared. Values are mean ± SD. Comparisons between two groups were made using unpaired Student’s \u003cem\u003et\u003c/em\u003e-tests. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 \u003cem\u003evs\u003c/em\u003e. control (vehicle group).\u003c/p\u003e","description":"","filename":"OnlineFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-3122899/v1/c2d9f09e116626a2684089f1.png"},{"id":39466487,"identity":"5aa3f10d-734f-494b-bf31-eac733a41bea","added_by":"auto","created_at":"2023-07-03 14:09:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":123582,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of PD168368 on patient-derived corticotroph adenoma cell cultures.\u003c/strong\u003e (A) After the surgical resection of corticotroph adenomas, tumor cells were isolated, cultured, and treated with PD168368 (0.1, 1, or 10 nM) for 24 h, then human \u003cem\u003ePOMC\u003c/em\u003e expression was measured by real-time PCR and normalized to the expression of \u003cem\u003eGAPDH\u003c/em\u003e. (B) Human \u003cem\u003eCCNE\u003c/em\u003e expression, measured by real-time PCR and normalized to the expression of \u003cem\u003eGAPDH\u003c/em\u003e. (C) ACTH concentration of the culture medium, measured using ELISA. The medium ACTH concentration was normalized to WST-1 absorbance. Values are mean ± SD. One-way ANOVA was used to compare multiple groups, followed by Dunnett’s test, if appropriate, to compare other groups with the control group. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 \u003cem\u003evs\u003c/em\u003e. control (vehicle group).\u003c/p\u003e","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-3122899/v1/e326f1a17aa5df3c75f4af33.png"},{"id":39466491,"identity":"0dc12699-2fd4-4e84-9808-0c00311c3b00","added_by":"auto","created_at":"2023-07-03 14:09:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3603969,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImmunohistochemistry for NMB (A), NMBR (B), and Cyclin E (C) in human corticotroph adenomas. \u003c/strong\u003e#1 patient 1; #2 patient 2; #3 patient 3; #4 patient 4; #5 patient 5; #6 patient 6; #7 patient 7. Original magnification 40×.\u003c/p\u003e","description":"","filename":"OnlineFig5.png","url":"https://assets-eu.researchsquare.com/files/rs-3122899/v1/09c0220997e647eca0c64c24.png"},{"id":39468969,"identity":"ff7cc878-da98-4cc7-a226-001da8a715b0","added_by":"auto","created_at":"2023-07-03 14:17:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":133788,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic overview of hypothesis of NMBR antagonist effects on corticotroph adenomas.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"OnlineFig6.png","url":"https://assets-eu.researchsquare.com/files/rs-3122899/v1/199f4820adf5a60765779c5d.png"},{"id":42782025,"identity":"f3ff8754-fa67-4673-b3f3-ecda48eca3af","added_by":"auto","created_at":"2023-09-07 15:15:34","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3471334,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3122899/v1/cae46db1-734e-45b8-b111-e190a2530000.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Neuromedin B receptor as a potential therapeutic target for corticotroph adenomas","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCushing\u0026rsquo;s disease is the result of autonomous adrenocorticotropic hormone (ACTH) secretion by pituitary corticotroph adenomas, leading to excessive cortisol production. Patients with Cushing\u0026rsquo;s disease present with clinical features of chronic hypercortisolism, including central obesity, moon face, diabetes mellitus, hypertension, hypercoagulability and an immunocompromised state [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Cushing\u0026rsquo;s disease is associated with greater mortality, mainly due to cardiovascular disease or infection [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The first-line therapy for Cushing\u0026rsquo;s disease is pituitary surgery [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Although the remission rate is approximately 80% in patients with microadenoma, it is approximately 60% in those with macroadenoma, and repeat pituitary surgery is associated with poorer outcomes [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Patients with persistent or recurrent Cushing\u0026rsquo;s disease require additional treatment including drug therapy. Among the pituitary-targeting agents, pasireotide has been demonstrated to reduce ACTH production and control tumor volume, and the response rate has been reported to be 17\u0026ndash;82% [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, pasireotide use can be associated with adverse events, including severe hyperglycemia, diarrhea and cholelithiasis [\u003cspan additionalcitationids=\"CR8\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The adrenal-targeting agents osilodrostat, metyrapone and ketoconazole are effective at controlling hypercortisolism but do not directly target corticotroph adenomas [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Therefore, there is an unmet need for effective and safe agents for the management of Cushing\u0026rsquo;s disease. In recent years, various therapeutic agents that target epidermal growth factor (EGFR) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], cyclin-dependent kinase 2 (CDK2)/cyclin E [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], heat-shock protein Hsp90 [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], ubiquitin-specific peptidase 8 (USP8) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], histone deacetylase (HDAC)/phosphatidylinositol-3 kinase (PI3K) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] and achaete-scute complex homolog 1 (ASCL1) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] have been explored.\u003c/p\u003e \u003cp\u003eNeuromedin B (NMB), a member of the bombesin-like peptide family, is expressed in the central nervous system, pancreas, gastrointestinal tissues and some types of cancer cells. NMB affects thermoregulation [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e] and smooth muscle contraction [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. It has also been reported that NMB stimulates cell proliferation in cancer cells [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], which is an attractive target for the treatment of malignant tumors. In addition, NMB stimulates gastrin, gastric inhibitory peptide and insulin secretion in rats or dogs, indicating NMB is a regulator of endocrine secretion [\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The expression and function of NMB in the pituitary gland have been investigated, especially in thyrotrophs. NMB is expressed in the thyrotroph [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], and NMB receptor-deficient mice show altered TSH response to TRH stimulation [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Regarding its relationship with corticotrophs, subcutaneous NMB administration increases the plasma ACTH and corticosterone concentrations in rats [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Furthermore, we have previously shown that NMB is highly expressed in the pituitary corticotrophs of melanocortin 2 receptor (MC2R)-deficient mice, a model of chronic adrenal insufficiency [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Thus, NMB has been a candidate of the therapeutic target of Cushing\u0026rsquo;s disease. Here, we aimed to characterize the expression of NMB and NMB receptor (NMBR) in human corticotroph adenomas and the effects of the NMBR antagonist PD168368 on murine and human corticotroph tumors.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eHuman pituitary adenoma samples\u003c/h2\u003e \u003cp\u003eFormalin-fixed, paraffin-embedded (FFPE) blocks from patients with pituitary adenoma and diagnoses of non-functional adenoma, acromegaly or Cushing\u0026rsquo;s disease who underwent transsphenoidal surgery (n\u0026thinsp;=\u0026thinsp;8\u0026ndash;10 per group) were used to evaluate NMB and NMBR expression.\u003c/p\u003e \u003cp\u003eSurgically resected human corticotroph tumor samples from patients who were diagnosed with Cushing\u0026rsquo;s disease or subclinical Cushing\u0026rsquo;s disease and underwent transsphenoidal surgery (n\u0026thinsp;=\u0026thinsp;7, other than those whose FFPE blocks were used in the previous experiment) were used to evaluate the effect of PD168368 in primary cultures of patient-derived primary cells.\u003c/p\u003e \u003cp\u003eThe procedure used for the diagnosis of Cushing\u0026rsquo;s disease and subclinical Cushing\u0026rsquo;s disease followed the published Japanese diagnostic criteria [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In all the patients, the presence of an ACTH-producing tumor was confirmed histologically after its resection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction from FFPE samples\u003c/h2\u003e \u003cp\u003eRNA was extracted from FFPE samples of human pituitary adenomas using an AllPrep DNA/RNA FFPE kit (Qiagen, Hilden, Germany) and an RNeasy kit (Qiagen), according to the manufacturers\u0026rsquo; protocols.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e \u003cp\u003eImmunohistochemical staining was performed to evaluate NMB, NMBR and cyclin E1 protein expression. Human corticotroph adenoma samples were embedded in paraffin and 5-\u0026micro;m-thick sections were prepared. After these were deparaffinized, hydrated with ethanol, and endogenous peroxidase activity was blocked, the sections were immunostained using rabbit anti-NMB (Sigma-Aldrich, St. Louis, MO catalog no. SAB1301059, RRID:AB_2619620), mouse anti-NMBR (Santa Cruz Biotechnology, Dallas, TX, catalog no. sc-374623, RRID:AB_10989220) or mouse anti-cyclin E antibodies (Santa Cruz Biotechnology, catalog no. sc-377100, RRID:AB_2923122). The sections were counterstained with hematoxylin. Images were acquired using a BZ-X710 microscope (Keyence, Osaka, Japan).\u003c/p\u003e \u003cp\u003eFor immunofluorescence, tissue sections were incubated overnight at 4\u0026deg;C with the appropriate primary antibodies [rabbit anti-NMB antibody, mouse anti-NMBR, mouse anti-GH antibody (Santa Cruz Biotechnology, catalog no. sc-166696, RRID:AB_2111022) or mouse anti-ACTH antibody (Santa Cruz Biotechnology, catalog no. sc-57021, RRID:AB_785253)]. After rinsing with phosphate-buffered saline, the tissues were incubated with secondary antibodies for 30 minutes [Alexa Fluor 594-conjugated anti-mouse IgG (Molecular Probes, catalog no. A21203, RRID:AB_141633) or Alexa Fluor 488-conjugated antirabbit IgG (Molecular Probes, Eugene, OR, catalog no. A11008, RRID:AB_143165)]. The nuclei were counterstained with Vectashield HardSet mounting medium containing 4,6-diamino-2-phenylindole (DAPI) (Vector Laboratories, Newark, CA). Immunofluorescence was visualized using a BZ-9000 fluorescence microscope (Keyence).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and reagents\u003c/h2\u003e \u003cp\u003eAtT-20/D16v-F2 cells (RRID:CVCL_4109) were purchased from ATCC. AtT-20/D16v-F2 cells were cultured in DMEM (Thermo Fisher Scientific, Waltham, MA) containing 10% fetal bovine serum, penicillin and streptomycin in a 5% CO\u003csub\u003e2\u003c/sub\u003e-containing humidified atmosphere at 37\u0026deg;C. PD168368 was purchased from Santa Cruz Biotechnology (catalog no. sc-204166).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eBALB/c-nu mice were purchased from Charles River Laboratories (Wilmington, MA) and were maintained under a 12-h light/dark cycle (lights on at 06:00 and off at 18:00). Food and water was provided \u003cem\u003ead libitum\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eTumor xenograft model\u003c/h2\u003e \u003cp\u003eAtT-20/D16v-F2 cells (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells) in 1:1 ratio with Matrigel (BD Biosciences, Franklin Lakes, NJ) were subcutaneously injected into the dorsum of BALB/c-nu mice, then the mice were allocated to two groups of eight 1 week afterwards. The first group was administered 50 \u0026micro;L vehicle (polyethylene glycol 400 (PEG), Sigma-Aldrich) daily by intraperitoneal injection and the second group was administered 1.2 mg/kg PD168368 in PEG daily with reference to the previous report [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The mice were weighed and their tumor size was measured using calipers 0, 7 and 14 days later. Their tumor volumes were calculated using the equation length \u0026times; width\u003csup\u003e2\u003c/sup\u003e \u0026times; 0.5. The mice were euthanized on day 14, between 08:30 and 12:30, by decapitation after anesthesia was induced using isoflurane. Blood samples were obtained from the left ventricle of each mouse by cardiac puncture and serum/plasma was stored at \u0026minus;\u0026thinsp;80\u0026deg;C until analyzed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ePatient-derived corticotroph adenoma cells\u003c/h2\u003e \u003cp\u003eWe isolated cells from corticotroph tumors of patients using Neural Tissue Dissociation Kits (Miltenyi Biotec, Bergisch Gladbach, Germany), according to the manufacturer\u0026rsquo;s protocol, then resuspended them in DMEM supplemented with 10% fetal bovine serum. After 24 h of incubation with concentrations of PD168368, we extracted RNA from the isolated cells and collected the medium.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR\u003c/h2\u003e \u003cp\u003eRNA was isolated from AtT-20/D16v-F2 cells or patient-derived corticotroph adenoma cells using an RNeasy Mini Kit (Qiagen) and used this to prepare cDNA. Real-time PCR was performed in duplicate using a 7500 Fast Real Time PCR system and Fast SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA). RTarget mRNA expression was calculated relative to that of \u003cem\u003e18S\u003c/em\u003e mRNA for experiments performed in AtT-20/D16v-F2 cells, and relative to that of \u003cem\u003eGAPDH\u003c/em\u003e for experiments performed in patient-derived corticotroph adenoma cells. The primer sequences used are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene symbol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eForward Primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse Primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHuman NMB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNMB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAATACTGCAGAAATGACACCAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGGGTCCCATTCAGCACCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHuman NMBR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNMBR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGGTGGGCTGCAAACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAGTGAGAGTGAACACGGAAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHuman POMC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePOMC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAGGACCTCACCACGGAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGGGAACATGGGAGTCTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHuman cyclin E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCNE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGTCCTGGATGTTGACTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGCAGTGAAGACATGTGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHuman GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGATTTGGTCGTATTGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGAAGATGGTGATGGGATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse Pomc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePomc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTACCCCAACGTTGCTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGGACCTGCTCCAAGCTAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse cyclin E1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCcne1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCACCAGTTTGCTTATGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCGTGTCGTTGACATAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse cyclin-dependent kinase 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCdk2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGGAGTCCCTGTCCGAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGGGTCACCATTTCAGCAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMouse 18S ribosomal RNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18S\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGCCAACGGTCTAGACAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAGTGGTCTTGGTGTGCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eDNA microarray analysis\u003c/h2\u003e \u003cp\u003ecDNA was prepared from RNA and used in a Clariom S assay (Affymetrix, Santa Clara, CA), the results of which were analyzed according to the Affymetrix protocol. The scanned image files were visually inspected for artefacts and normalized using GeneChip Command Console Software (Affymetrix). The gene expression of vehicle and 1 \u0026micro;M PD168368-treated AtT-20/D16v-F2 cells was compared using Transcriptome Analysis Console software (Applied Biosystems).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eAfter each treatment, AtT-20 cells were lysed in CelLytic M (Sigma Aldrich) supplemented with a protease and phosphatase inhibitor cocktail. Lysates containing the same amount of protein were mixed with 2\u0026times; Laemmli Sample Buffer (Bio-Rad), separated on 4\u0026ndash;20% polyacrylamide gels (Bio-Rad, Hercules, CA) and electroblotted onto polyvinylidene fluoride membranes (Millipore, Burlington, MA). The membranes were blocked in Bullet Blocking One for Western Blotting (Nacalai Tesque. Kyoto, Japan) for 30 minutes at room temperature, then incubated with the appropriate primary antibodies overnight at 4\u0026deg;C [mouse anti-POMC antibody (Santa Cruz Biotechnology, catalog no. sc-57021, RRID:AB_785253),, rabbit anti-cyclin E1 antibody (Cell Signaling Technology, Danvers, MA, catalog #20808, RRID:AB_2783554), rabbit anti-CDK2 antibody (Cell Signaling Technology, catalog #18048, RRID:AB_2923174) or rabbit anti-GAPDH (Cell Signaling Technology, catalog #5174, RRID:AB_10622025)]. Horseradish peroxidase-conjugated goat anti-rabbit antibody (Bio-Rad, catalog no. 170\u0026ndash;5046, RRID:AB_11125757) and horse anti-mouse antibody (Bio-Rad, catalog no. 172\u0026ndash;1011, RRID:AB_11125936) were used as the secondary antibodies. Signals were detected using ECL Western Blotting Detection Reagents (Cytiva, Tokyo, Japan) and an LAS-4000 imager (Fujifilm, Tokyo, Japam), and the specific band intensities were normalized to those of GAPDH. To quantify protein expression, densitometric analysis was performed using ImageJ software (NIH Image).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eACTH and corticosterone assays\u003c/h2\u003e \u003cp\u003eMedium and mouse plasma ACTH concentrations were analyzed using an ELISA kit (MD Bioproducts, Z\u0026uuml;rich, Switzerland, catalog no. M046006), according to the manufacturer\u0026rsquo;s protocol. The medium ACTH concentration was normalized to water-soluble tetrazolium salt (WST)-1 (Takara Bio, Shiga, Japan) absorbance. Mouse serum corticosterone concentration was analyzed using an ELISA kit (Enzo Life Sciences, Farmingdale, NY, catalog no. ADI-900-097).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCell proliferation analysis\u003c/h2\u003e \u003cp\u003eFor cell proliferation assays, 2\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells were seeded into each well of a 96-well plate, then following each treatment WST-1 reagent (Takara Bio) was added and the cells were incubated for 2 hours in the incubator. A microplate reader (SpectraMax Paradigm, Molecular Devices, San Jose, CA) was used to measure the absorbance of each well at 440 nm. All measurements were performed in duplicate or triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistics\u003c/h2\u003e \u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Comparisons between two groups were made using unpaired Student \u003cem\u003et-\u003c/em\u003etests, and one-way ANOVA was used to compare values among multiple groups. If the ANOVA test showed significant differences, the Tukey-Kramer \u003cem\u003epost-hoc\u003c/em\u003e test was used to compare two specific groups and Dunnett\u0026rsquo;s test was used to compare other groups with the control group. The results were considered to be statistically significant if the \u003cem\u003eP\u003c/em\u003e-value was \u0026lt;\u0026thinsp;0.05. Statistical analyses were performed using JMP Pro software (version 16.0.0, SAS Institute Inc. Cary, NC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStudy approval\u003c/h2\u003e \u003cp\u003eAll the human samples were collected following the provision of written informed consent. The human sample study protocol and the consent procedure for the patients were approved by the Institutional Review Board of Hokkaido University Hospital, Sapporo, Japan (No. 018\u0026ndash;0201). Animal experiments were approved by the Institutional Animal Care and Use Committee of the National University Corporation, Hokkaido University (No. 18\u0026ndash;0141), and conducted according to the ethical guidelines of the National University Corporation Hokkaido University regarding animal experimentation and the safety guidelines for gene manipulation experiments.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eNMB and NMBR expression in human pituitary adenomas\u003c/h2\u003e \u003cp\u003eIn quantitive real-time PCR analysis, the expression of \u003cem\u003eNMB\u003c/em\u003e was significantly higher in corticotroph adenomas (19 times as high as those in non-functional adenomas) than in somatotroph or non-functional adenomas (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, each P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). The expression of \u003cem\u003eNMBR\u003c/em\u003e was also significantly higher in corticotroph adenomas (110 times as high as those in non-functional adenomas) than in non-functional adenomas (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Immunostaining study confirmed that the protein expression of NMB and NMBR was also higher in corticotroph adenomas than in somatotroph or non-functional adenomas (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eThe NMBR antagonist PD168368 reduces Pomc and cyclin E expression and ACTH secretion in murine corticotroph tumor cells\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the potential for the use of NMBR as a target for the treatment of Cushing\u0026rsquo;s disease, we treated murine AtT-20/D16v-F2 cells with the NMBR antagonist PD168368 (0.1nM\u0026ndash;1\u0026micro;M). Tumor cell \u003cem\u003ePomc\u003c/em\u003e, a precursor of ACTH, mRNA expression was dose-dependently reduced by PD168368 (~\u0026thinsp;42%; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). POMC protein expression of the cells (~\u0026thinsp;24%; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB) and the ACTH content of the medium (~\u0026thinsp;20%; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) were also reduced by PD168368 treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, to identify genes related to the effect of the NMBR antagonist in tumorous corticotrophs, we performed DNA microarray analysis. Two libraries derived from the vehicle group and the PD168368 treatment (1\u0026micro;M) group were used. The analysis revealed that 1,709 genes were differentially expressed by \u0026ge;\u0026thinsp;1.5-fold; 894 genes were upregulated and 815 were downregulated. A hierarchical clustering analysis heat map shows the differences between the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). \u003cem\u003ePomc\u003c/em\u003e gene expression was significantly downregulated by approximately 0.76-fold in the PD168368 group (data not shown). Pathway analysis showed significant differences in eleven pathways (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). In particular, 16 genes involved in the cell cycle were significantly upregulated (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) and five downregulated (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Importantly, Cyclin E1 (\u003cem\u003eCcne1\u003c/em\u003e) expression was downregulated by approximately 0.55-fold in the PD168368 treatment group. Quantitative PCR analyses confirmed the suppression of \u003cem\u003eCcne1\u003c/em\u003e mRNA expression in the PD168368 treatment group (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). The mRNA expression of \u003cem\u003eCdk2\u003c/em\u003e, which encodes a protein that forms a complex with cyclin E, was also reduced by PD168368 treatment. Western blot analysis confirmed the dose-dependent suppression of cyclin E1 and CDK2 by PD168368 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Cell proliferation was also suppressed by PD168368 treatment, as demonstrated using a WST-1 assay (by ~\u0026thinsp;25%; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePathway analysis derived from the microarray data, comparing AtT-20/D16vF2 cells treated with PD168368 1 \u0026micro;l or vehicle\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePathway\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUp\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDown\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eUp List\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eDown List\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAdipogenesis genes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eScd1, Gadd45b, Ncoa2, Stat2,\u003c/p\u003e \u003cp\u003eLifr, Il6st, Ncoa1, Tle3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eId3, Lif, Nr1h3, Serpine1, Nsg1, Hmga1, Cebpd, Foxo1, Ppargc1a, Trib3, Egr2, Bscl2, Lpin2, Agt, Mef2b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCell cycle\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHdac4, Bub1b, Abl1, Bub1, Ccna2,\u003c/p\u003e \u003cp\u003eCcnb1, Ccnb2, Espl1, Ep300, Cdc20,\u003c/p\u003e \u003cp\u003ePttg1, Mad2l1, Cdc25b, Hdac6, Plk1,\u003c/p\u003e \u003cp\u003eCdc25c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMcm3, Ccnd3, Ccne1, Cdkn1a, Ccnb3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emRNA processing\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePolr2a, Cpeb4, Rbm4, Spen, Ilf3, Elavl3, Rbmx, Eif4g3, Pspc1, Tia1, Qk\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCpeb1, Wdr55, Ppargc1a, Synj2, Rbpms, Nxf7, Pcolce\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep53 signaling\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMdm4, Ccnb1, Ccnb2, Gadd45b, Sesn1, Sesn3, Ccng2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eCdkn1a, Ccnd3, Ccne1, Ccnb3, Bax,\u003c/p\u003e \u003cp\u003eShisa5, Zmat3, Serpine1, Thbs1, Ccng1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCholesterol metabolism with Bloch and Kandutsch-Russell pathways\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHmgcr, Fasn, Sc5d, Nsdhl, Hsd17b7,\u003c/p\u003e \u003cp\u003eDhcr24, Acat2, Hmgcs1, Mvd, Idi1, Fdft1, Lss, Scd1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eNr1h3, Cyp27a1, Soat2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAndrogen receptor signaling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eHmgb2, Il6st, Ep300, Ncoa2, Nr2c2, Tgif1, Cdc25b, Crebbp, Ncoa1, Pxn, Pou2f1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eEtv5, Rnf14, Ccne1, Pnrc1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eKit receptor signaling pathway\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePtpru, Abl1, Cbl, Ep300, Kit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eGrb7, Plce1, Sh2b2, Tec, Dok1, Tnfrsf10b\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSREBF and miR33 in cholesterol and lipid homeostasis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eSirt1, Hmgcr, Mtor, Hmgcs1, Ldlr\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSirt6, Nr1h3, Ppargc1a\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCholesterol biosynthesis\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.001\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eNsdhl, Hmgcs1, Idi1, Mvd, Hmgcr, Sc5d, Fdft1, Lss\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"1\" nameend=\"c7\" namest=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOxidative stress response\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.005\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCat, Mt1, Nqo1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSod3, Gpx3, Hmox1, Txn2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGlycogen metabolism\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePhkg2, Ppp2r5e, Ppp2r5d, Ppp2r2b, Phka2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003ePygm, Gys1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCell cycle-related genes that were upregulated on microarray analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene Symbol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene Description\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePD168368 group (Raw)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eVehicle\u003c/p\u003e \u003cp\u003egroup (Raw)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAbsolute Fold\u003c/p\u003e \u003cp\u003eChange\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCdc20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecell division cycle 20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_023223\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e8876.788\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1702.1023\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e5.2151905\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCdc25c\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecell division cycle 25C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_009860\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1820.9082\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e528.8153\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e3.4433728\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCcnb2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecyclin B2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_007630\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e15639.253\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e6408.7167\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.4403096\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEspl1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eextra spindle pole bodies 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001014976\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1123.0106\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e490.4575\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.2897204\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBub1b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ebudding uninhibited by benzimidazoles 1 homolog, beta\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_009773\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9124.7573\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4010.025\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.2754864\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBub1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ebudding uninhibited by benzimidazoles 1 homolog\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001113179\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e17309.93\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e8009.819\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.1610888\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlk1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epolo-like kinase 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_011121\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e38080.697\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e18379.557\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.06\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e2.0719051\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePttg1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epituitary tumor-transforming gene 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001131054\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14562.601\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e7669.4723\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.07\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.8987748\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCcna2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecyclin A2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_009828\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e40199.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e22595.897\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.7790447\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHdac4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehistone deacetylase 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_207225\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e302.57627\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e170.14993\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.7782920\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMad2l1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMAD2 mitotic arrest deficient-like 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_019499\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e21404.107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12150.647\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.7615611\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEp300\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eE1A binding protein p300\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_177821\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e551.88443\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e315.0866\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.7515325\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAbl1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ec-abl oncogene 1, non-receptor tyrosine kinase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001112703\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e117.82293\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e72.93047\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.6155515\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCdc25b\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecell division cycle 25B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_009860\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1704.1283\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e1065.8890\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.5987859\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCcnb1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecyclin B1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_172301\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e19795.067\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12410.597\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.5950133\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHdac6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehistone deacetylase 6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001130416\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1021.3623\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e667.02993\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e1.5312091\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eCell cycle-related genes that were downregulated on microarray analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene Symbol\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene Description\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePD168368 group (Raw)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eVehicle\u003c/p\u003e \u003cp\u003egroup (Raw)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eAbsolute Fold\u003c/p\u003e \u003cp\u003eChange\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCdkn1a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecyclin-dependent kinase inhibitor 1A (P21)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001111099\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e62591.303\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e133932.367\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.46733516\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCcnd3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecyclin D3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_001081635\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3299.6733\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e6154.6873\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.53612363\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCcne1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecyclin E1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_007633\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e6303.089\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e11543.773\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.02\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.54601638\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMcm3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eminichromosome maintenance deficient 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_008563\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e9948.2567\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e14297.78\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.05\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.69579030\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCcnb3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecyclin B3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNM_183015\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12.253957\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e17.483783\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e0.70087557\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vivo\u003c/b\u003e \u003cb\u003eeffects of PD168368 in a tumor xenograft model\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo evaluate the \u003cem\u003ein vivo\u003c/em\u003e effects of PD168368, we used a tumor xenograft model, BALB/c-nu mice subcutaneously inoculated with AtT-20/D16v-F2 cells. PD168368 treatment significantly reduced tumor volume (control 260\u0026thinsp;\u0026plusmn;\u0026thinsp;102 mm\u003csup\u003e3\u003c/sup\u003e \u003cem\u003evs\u003c/em\u003e. PD168368 122\u0026thinsp;\u0026plusmn;\u0026thinsp;95 mm\u003csup\u003e3\u003c/sup\u003e, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA) and growth rate (control 161%\u0026plusmn;54% \u003cem\u003evs\u003c/em\u003e. PD168368 70%\u0026plusmn;56%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The plasma ACTH (control 180\u0026thinsp;\u0026plusmn;\u0026thinsp;45 pg/ml \u003cem\u003evs\u003c/em\u003e. PD168368 97\u0026thinsp;\u0026plusmn;\u0026thinsp;21 pg/ml, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC) and serum corticosterone (control 1,045\u0026thinsp;\u0026plusmn;\u0026thinsp;237 ng/ml \u003cem\u003evs\u003c/em\u003e. PD168368 813\u0026thinsp;\u0026plusmn;\u0026thinsp;135 ng/ml, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) concentrations were significantly reduced by PD168368 treatment.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003ePD168368 reduces POMC expression and ACTH secretion in patient-derived corticotroph adenoma cells\u003c/h2\u003e \u003cp\u003eTo confirm the effects of PD168368 that were observed in \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e experiments, we treated primary cell cultures derived from surgically resected human corticotroph tumors with PD168368. PD168368 treatment significantly reduced \u003cem\u003ePOMC\u003c/em\u003e mRNA expression (by 12\u0026ndash;31%) in four (Patient 1 by ~\u0026thinsp;12%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Patient 2 by ~\u0026thinsp;26%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, Patient 3 by ~\u0026thinsp;31%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Patient 4 by ~\u0026thinsp;18%, not significant; Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA) out of seven patient-derived corticotroph adenoma cell cultures. Cyclin E (\u003cem\u003eCCNE\u003c/em\u003e) mRNA expression was also reduced in three out of the four patient cells in which \u003cem\u003ePOMC\u003c/em\u003e mRNA expression was reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The ACTH content of the medium, reflecting cell secretion, was also reduced (by 23\u0026ndash;53%) in two (Patient 4 by ~\u0026thinsp;53%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Patient 6 by ~\u0026thinsp;23%, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC) out of the five cases that could be evaluated (ACTH content of the medium could not be evaluated in Patient 1 and 2 due to lack of data obtained by WST-1 measurement.). Thus, five out of seven tumor cell cultures were affected by PD168368 treatment. However, the clinical features of the patients (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) and the protein expression of NMB, NMBR and cyclin E in corticotroph tumors, determined using immunohistochemistry (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), did not correlate with the effect of PD168368 in tumor cell cultures.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eClinical features of patients with human pituitary corticotroph tumors that were treated with PD168368 in primary cell culture\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePatient Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAge\u003c/p\u003e \u003cp\u003eand sex\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDiagnosis\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTumor diameter, mm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eACTH, pg/ml\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eCortisol, \u0026micro;g/dl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eUrinary\u003c/p\u003e \u003cp\u003efree cortisol, \u0026micro;g/day\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e53, F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e34.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e16.4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e207.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e48, F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e15.9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e120.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e63, F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e192\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e2780\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e51, F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e62.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e85.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e53, F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e32.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e19.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e49.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e28, F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e80.7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14.8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e187.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e46, F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e25.3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e13.2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e1000\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, we showed that NMB and NMBR were expressed in human corticotroph adenomas. The NMBR antagonist PD168368 suppressed ACTH secretion and tumor growth in preclinical \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e models of Cushing\u0026rsquo;s disease as well as patient-derived corticotroph adenoma cells.\u003c/p\u003e \u003cp\u003eNMB, a member of the bombesin-like peptide family, was first isolated from porcine spinal cord [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], and NMB and NMBR are expressed in the central nervous system, gastrointestinal tissues, pancreas and some types of cancer cells [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. NMB affects thermoregulation [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], smooth muscle contraction [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and endocrine secretion [\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. NMB and NMBR are co-expressed in some cancer cell lines and human cancer tissues, and stimulates cell proliferation in an autocrine and paracrine fashion [\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Regarding its relationship with corticotrophs, subcutaneous NMB administration increases the plasma ACTH and corticosterone concentrations in rats [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Furthermore, we have previously shown that NMB is highly expressed in the pituitary corticotrophs of melanocortin 2 receptor (MC2R)-deficient mice, a model of chronic adrenal insufficiency [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Thus, NMB expression is associated with the HPA axis and cell proliferation, but there remains a lack of direct evidence for a role of NMB in the pathogenesis of Cushing\u0026rsquo;s disease.\u003c/p\u003e \u003cp\u003eFirst, we showed that NMB and NMBR were expressed in human corticotroph adenomas. Considering the associations among NMB, the HPA axis and cell proliferation, we speculate that NMB may stimulate ACTH secretion and proliferation in an autocrine or paracrine manner in corticotroph adenoma cells.\u003c/p\u003e \u003cp\u003eSecond, the NMB receptor antagonist PD168368 suppressed ACTH secretion and tumor growth in preclinical \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e models of Cushing\u0026rsquo;s disease and some of patient-derived corticotroph adenoma cells. PD168368 is a highly selective antagonist of the NMB receptor, and shows similar pharmacology across animal species [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Anti-proliferative effects of PD168368 have previously been shown in \u003cem\u003ein vitro\u003c/em\u003e models of several cancers [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] and in an \u003cem\u003ein vivo\u003c/em\u003e model of breast cancer [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. However, the present study is the first to evaluate the effect of PD168368 on Cushing\u0026rsquo;s disease, to the best of our knowledge.\u003c/p\u003e \u003cp\u003eInterestingly, significant differences in cell cycle pathways were identified in pathway analyses of DNA microarray data derived from an \u003cem\u003ein vitro\u003c/em\u003e study. In addition, PD168368 treatment reduced cyclin E expression in AtT-20/D16v-F2 cells and patient-derived corticotroph tumor cells. Cyclin E is upregulated in human corticotroph adenomas [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] and promotes \u003cem\u003ePOMC\u003c/em\u003e expression \u003cem\u003evia\u003c/em\u003e the activation of E2F transcription factor 1 (E2F1) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], suggesting that cyclin E upregulation induces corticotroph cell tumorigenesis. Roscovitine, a pan-CDK inhibitor, has been shown to be a possible target for the treatment of corticotroph tumors in zebrafish, murine allografts and primary cultures of human corticotroph tumors [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In phase Ⅱ clinical trials for treatment of patients with de novo, recurrent or persistent Cushing\u0026rsquo;s disease, three of nine patients achieved\u0026thinsp;\u0026ge;\u0026thinsp;50% 24-hour urinary free cortisol reduction by seliciclib (R-roscovitine) treatment [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. However, roscovitine use is associated with some side effects including diarrhea, myelosuppression, anemia, hepatic dysfunction and nausea, because of its low selectivity [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The results of the present study suggested that PD168368 might suppress ACTH secretion and cell proliferation \u003cem\u003evia\u003c/em\u003e a reduction in cyclin E in corticotroph adenomas (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Increased NMB expression was observed only in the pituitary gland of MC2R-deficient mice, in which corticotroph cells were hyperplastic mimicking Cushing\u0026rsquo;s disease [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], therefore a NMBR antagonist is expected to have more specific effects on corticotroph adenomas. Indeed, in the \u003cem\u003ein vivo\u003c/em\u003e experiment, no serious toxicity of PD168368 were identified.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe present study had several limitations. First, we could not detect the reduction of \u003cem\u003ePOMC\u003c/em\u003e expression or ACTH secretion by PD168368 treatment in part of patient-derived adenoma cells. The reasons given for this include that the 24 h incubation time might not be appropriate in evaluating the suppressive effect of PD168368 on \u003cem\u003ePOMC\u003c/em\u003e expression and ACTH secretion. Therefore, studies with different incubation times should be performed. Second, there were wide variation in NMB and NMBR mRNA expression of FFPE samples of human corticotroph adenomas. Also, we could not identify clinical or pathological findings associated with the therapeutic response of PD168368 in patient-derived adenoma cells. To overcome these limitations, further investigations with the larger sample size are needed.\u003c/p\u003e \u003cp\u003eRecently, mutations in the ubiquitin-specific-protease 8 (\u003cem\u003eUSP8\u003c/em\u003e) gene have been found in 20\u0026ndash;60% of patients with ACTHomas [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. \u003cem\u003eUSP8\u003c/em\u003e mutations result in greater deubiquitination of EGFR and a consequent imbalance in EGFR signaling, with high ACTH synthesis and secretion secondary to E2F1-mediated transcriptional activity. These effects are attenuated by the tyrosine kinase inhibitor gefitinib [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. NMB causes the phosphorylation of EGFR in human non-small lung cancer cells [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], suggesting that an NMBR antagonist might affect EGFR signaling. However, we could not elucidate the effect of PD168368 on EGFR or the relationship with mutations in USP8 in the present study. More comprehensive studies that investigate the relationship of NMBR antagonist and EGFR signaling/USP8 mutation are necessary.\u003c/p\u003e \u003cp\u003eIn summary, we presented evidence that NMBR may represent a molecular target for the treatment of patients with Cushing\u0026rsquo;s disease and that the effects may be mediated through the suppression of cyclin E expression.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eThe authors have nothing to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by JSPS KAKENHI Grant Numbers 18H06229, 19K21329 and 20K17481, and the Akiyama Life Science Foundation. We thank Department of Surgical Pathology, Hokkaido University Hospital for cooperation in the preparation of archival pathological specimens. We thank Mark Cleasby, PhD from Edanz (https://jp.edanz.com/ac) for editing a draft of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEmail addresses of all non-corresponding authors:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTomonori Sekizaki\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u0026nbsp; \u0026nbsp;[email protected]\u003c/p\u003e\n\u003cp\u003eAkinobu Nakamura \u0026nbsp; \u0026nbsp;[email protected]\u003c/p\u003e\n\u003cp\u003eSaki Kuwabara \u0026nbsp; \u0026nbsp;[email protected]\u003c/p\u003e\n\u003cp\u003eHiroshi Nomoto \u0026nbsp; \u0026nbsp;[email protected]\u003c/p\u003e\n\u003cp\u003eKyu Yong Cho \u0026nbsp; \u0026nbsp;[email protected]\u003c/p\u003e\n\u003cp\u003eYukitomo Ishi \u0026nbsp; \u0026nbsp;[email protected]\u003c/p\u003e\n\u003cp\u003eHiroaki Motegi \u0026nbsp; \u0026nbsp;[email protected]\u003c/p\u003e\n\u003cp\u003eHideaki Miyoshi \u0026nbsp; \u0026nbsp;[email protected]\u003c/p\u003e\n\u003cp\u003eTatsuya Atsumi \u0026nbsp; \u0026nbsp;[email protected]\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTomonori Sekizaki and Hiraku Kameda designed the study, performed experiments and acquired the data. Tomonori Sekizaki and Hiroaki Motegi obtained clinical samples. Tomonori Sekizaki and Hiraku Kameda drafted the manuscript, and all other authors reviewed and revised the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval:\u0026nbsp;\u003c/strong\u003eThe study was approved by the Institutional Review Board (No. 018-0201). All patients agreed to participate in the study and pro\u0026shy;vided written informed consent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u0026nbsp;\u003c/strong\u003eThe authors declare no potential conflicts of interest.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSome or all datasets generated during and/or analyzed during the current study are not publicly available but are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eNewell-Price J, Bertagna X, Grossman AB, Nieman LK. Cushing\u0026apos;s syndrome. Lancet. (2006) 367(9522):1605-17. https://doi.org/10.1016/S0140-6736(06)68699-6\u003c/li\u003e\n\u003cli\u003eDekkers OM, Horv\u0026aacute;th-Puh\u0026oacute; E, J\u0026oslash;rgensen JO, Cannegieter SC, Ehrenstein V, Vandenbroucke JP, et al. Multisystem morbidity and mortality in Cushing\u0026apos;s syndrome: a cohort study. J Clin Endocrinol Metab. (2013) 98(6):2277-84. https://doi.org/10.1210/jc.2012-3582\u003c/li\u003e\n\u003cli\u003eValassi E, Tabarin A, Brue T, Feelders RA, Reincke M, Netea-Maier R, et al. High mortality within 90 days of diagnosis in patients with Cushing\u0026apos;s syndrome: results from the ERCUSYN registry. Eur J Endocrinol. (2019) 181(5):461-472. https://doi.org/10.1530/EJE-19-0464\u003c/li\u003e\n\u003cli\u003eFleseriu M, Auchus R, Bancos I, Ben-Shlomo A, Bertherat J, Biermasz NR, et al. Consensus on diagnosis and management of Cushing\u0026apos;s disease: a guideline update. Lancet Diabetes Endocrinol. (2021) 9(12):847-875. https://doi.org/10.1016/S2213-8587(21)00235-7\u003c/li\u003e\n\u003cli\u003ePivonello R, De Leo M, Cozzolino A, Colao A. The treatment of Cushing\u0026apos;s disease. Endocr Rev. (2015) 36(4):385-486. https://doi.org/10.1210/er.2013-1048 \u003c/li\u003e\n\u003cli\u003eBoscaro M, Ludlam WH, Atkinson B, Glusman JE, Petersenn S, Reincke M, et al. Treatment of pituitary-dependent Cushing\u0026apos;s disease with the multireceptor ligand somatostatin analog pasireotide (SOM230): a multicenter, phase II trial. J Clin Endocrinol Metab. (2009) 94(1):115-122. https://doi.org/10.1210/jc.2008-1008\u003c/li\u003e\n\u003cli\u003eColao A, Petersenn S, Newell-Price J, Findling JW, Gu F, Maldonado M, et al. A 12-month phase 3 study of pasireotide in Cushing\u0026apos;s disease. N Engl J Med. (2012) 366(10):914-924. https://doi.org/10.1056/NEJMoa1105743\u003c/li\u003e\n\u003cli\u003eLacroix A, Gu F, Gallardo W, Pivonello R, Yu Y, Witek P, et al. Efficacy and safety of once-monthly pasireotide in Cushing\u0026apos;s disease: a 12 month clinical trial. Lancet Diabetes Endocrinol. (2018) 6(1):17-26. https://doi.org/10.1016/S2213-8587(17)30326-1\u003c/li\u003e\n\u003cli\u003eManetti L, Deutschbein T, Schopohl J, Yuen KCJ, Roughton M, Kriemler-Krahn U, et al. Long-term safety and efficacy of subcutaneous pasireotide in patients with Cushing\u0026apos;s disease: interim results from a long-term real-world evidence study. Pituitary. (2019) 22(5):542-551. https://doi.org/10.1007/s11102-019-00984-6\u003c/li\u003e\n\u003cli\u003ePivonello R, De Leo M, Cozzolino A, Colao A. Medical treatment of Cushing\u0026apos;s disease: An overview of the current and recent clinical trials. Front Endocrinol (Lausanne). (2020) 11:648. https://doi.org/10.3389/fendo.2020.00648\u003c/li\u003e\n\u003cli\u003eCastinetti F, Nieman LK, Reincke M, Newell-Price J. Approach to the patient treated with steroidogenesis inhibitors. J Clin Endocrinol Metab. (2021) 106(7):2114-2123. https://doi.org/10.1210/clinem/dgab122\u003c/li\u003e\n\u003cli\u003eFukuoka H, Cooper O, Ben-Shlomo A, Mamelak A, Ren SG, Bruyette D, et al. EGFR as a therapeutic target for human, canine, and mouse ACTH-secreting pituitary adenomas. J Clin Invest. (2011) 121(12):4712-4721. https://doi.org/10.1172/JCI60417\u003c/li\u003e\n\u003cli\u003eLiu NA, Jiang H, Ben-Shlomo A, Wawrowsky K, Fan XM, Lin S, et al. Targeting zebrafish and murine pituitary corticotroph tumors with a cyclin-dependent kinase (CDK) inhibitor. Proc Natl Acad Sci U S A. (2011) 108(20):8414-9. https://doi.org/ 10.1073/pnas.1018091108\u003c/li\u003e\n\u003cli\u003eLiu NA, Araki T, Cuevas-Ramos D, Hong J, Ben-Shlomo A, Tone Y, et al. Cyclin E-mediated human proopiomelanocortin regulation as a therapeutic target for Cushing disease. J Clin Endocrinol Metab. (2015) 100(7):2557-64. https://doi.org/10.1210/jc.2015-1606\u003c/li\u003e\n\u003cli\u003eShen Y, Ji C, Jian X, Zhou J, Zhang Q, Qiao N, et al. Regulation of the EGFR Pathway by HSP90 Is Involved in the Pathogenesis of Cushing\u0026apos;s Disease. Front Endocrinol (Lausanne). (2021) 11:601984. https://doi.org/10.3389/fendo.2020.601984\u003c/li\u003e\n\u003cli\u003eKageyama K, Asari Y, Sugimoto Y, Niioka K, Daimon M. Ubiquitin-specific protease 8 inhibitor suppresses adrenocorticotropic hormone production and corticotroph tumor cell proliferation. Endocr J. (2020) 67(2):177-184. https://doi.org/10.1507/endocrj.EJ19-0239 \u003c/li\u003e\n\u003cli\u003eTreppiedi D, Di Muro G, Marra G, Barbieri AM, Mangili F, Catalano R, et al. USP8 inhibitor RA-9 reduces ACTH release and cell growth in tumor corticotrophs. Endocr Relat Cancer. (2021) 28(8):573-582. https://doi.org/10.1530/ERC-21-0093\u003c/li\u003e\n\u003cli\u003eLu J, Chatain GP, Bugarini A, Wang X, Maric D, Walbridge S, et al. Histone deacetylase inhibitor SAHA is a promising treatment of Cushing disease. J Clin Endocrinol Metab. (2017) 102(8):2825-2835. https://doi.org/10.1210/jc.2017-00464\u003c/li\u003e\n\u003cli\u003eZhang D, Damoiseaux R, Babayan L, Rivera-Meza EK, Yang Y, Bergsneider M, et al. Targeting corticotroph HDAC and PI3-Kinase in Cushing disease. J Clin Endocrinol Metab. (2021) 106(1):e232-e246. https://doi.org/10.1210/clinem/dgaa699\u003c/li\u003e\n\u003cli\u003eChen Z, Jia Q, Zhao Z, Zhang Q, Chen Y, Qiao N, et al. Transcription factor ASCL1 acts as a novel potential therapeutic target for the treatment of the Cushing\u0026apos;s disease. J Clin Endocrinol Metab. (2021) 106(1):e232-e246. https://doi.org/10.1210/clinem/dgaa699\u003c/li\u003e\n\u003cli\u003eItoh S, Takashima A, Itoh T, Morimoto T. Effects of neuromedins and related peptides on the body temperature of rats. Jpn J Physiol. (1995) 45(1):37-45. https://doi.org/10.2170/jjphysiol.45.37\u003c/li\u003e\n\u003cli\u003eMinamino N, Kangawa K, Matsuo H. Neuromedin C: a bombesin-like peptide identified in porcine spinal cord. Biochem Biophys Res Commun. (1984) 119(1):14-20. https://doi.org/10.1016/0006-291x(84)91611-5\u003c/li\u003e\n\u003cli\u003eOhki-Hamazaki H. Neuromedin B. Prog Neurobiol. (2000) 62(3):297-312. https://doi.org/10.1016/s0301-0082(00)00004-6\u003c/li\u003e\n\u003cli\u003eGreeley GH Jr, Spannagel A, Hill FL, Thompson JC. Comparison of the actions of bombesin, gastrin-releasing peptide-27, neuromedin B, and gastrin-releasing peptide-10 in causing release of gastrin and gastric inhibitory peptide in rats. Proc Soc Exp Biol Med. (1986) 183(1):136-139. https://doi.org/10.3181/00379727-183-42398\u003c/li\u003e\n\u003cli\u003eNamba M, Ghatei MA, Ghiglione M, Bloom SR. Effects of decapeptide of mammalian bombesin and neuromedin B on pancreatic exocrine secretion in the rat. Digestion. (1986) 34(2):105-114. https://doi.org/0.1159/000199318\u003c/li\u003e\n\u003cli\u003eOtsuki M, Fujii M, Nakamura T, Tani S, Oka T, Yajima H, et al. Effects of neuromedin B and neuromedin C on exocrine and endocrine rat pancreas. Am J Physiol. (1987) 252(4 Pt 1):G491-498. https://doi.org/10.1152/ajpgi.1987.252.4.G491\u003c/li\u003e\n\u003cli\u003eNamba M, Ghatei MA, Bishop AE, Gibson SJ, Mann DJ, Polak JM, et al. Presence of neuromedin B-like immunoreactivity in the brain and gut of rat and guinea-pig. Peptides (1985) 6 Suppl 3:257-263. https://doi.org/10.1016/0196-9781(85)90383-3\u003c/li\u003e\n\u003cli\u003eOliveira KJ, Ortiga-Carvalho TM, Cabanelas A, Veiga MA, Aoki K, Ohki-Hamazaki H, et al. Disruption of neuromedin B receptor gene results in dysregulation of the pituitary-thyroid axis. J Mol Endocrinol. (2006) 36(1):73-80. https://doi.org/10.1677/jme.1.01892\u003c/li\u003e\n\u003cli\u003eMalendowicz LK, Nussdorfer GG. Investigations on the acute effects of neuropeptides on the pituitary-adrenocortical function in normal and cold-stressed rats. I. Bombesin and neuromedin B. Exp Toxicol Pathol. (1995) 47(1):31-34. https://doi.org/10.1016/S0940-2993(11)80279-4\u003c/li\u003e\n\u003cli\u003eKameda H, Miyoshi H, Shimizu C, Nagai S, Nakamura A, Kondo T, et al. Expression and regulation of neuromedin B in pituitary corticotrophs of male melanocortin 2 receptor-deficient mice. Endocrinology. (2014) 155(7):2492-2499. https://doi.org/10.1210/en.2013-2077\u003c/li\u003e\n\u003cli\u003eKageyama K, Oki Y, Sakihara S, Nigawara T, Terui K, Suda T. Evaluation of the diagnostic criteria for Cushing\u0026apos;s disease in Japan. Endocr J. (2013) 60(2):127-135. https://doi.org/10.1507/endocrj.ej12-0299\u003c/li\u003e\n\u003cli\u003ePark HJ, Kim SR, Kim MK, Choi KS, Jang HO, Yun I, et al. Neuromedin B receptor antagonist suppresses tumor angiogenesis and tumor growth in vitro and in vivo. Cancer Lett. (2011) 312(1):117-127. https://doi.org/10.1016/j.canlet.2011.08.014\u003c/li\u003e\n\u003cli\u003eMinamino N, Kangawa K, Matsuo H. Neuromedin B: a novel bombesin-like peptide identified in porcine spinal cord. Biochem Biophys Res Commun. (1983) 114(2):541-548. https://doi.org/10.1016/0006-291x(83)90814-8\u003c/li\u003e\n\u003cli\u003eSiegfried JM, Krishnamachary N, Gaither Davis A, Gubish C, Hunt JD, Shriver SP. Evidence for autocrine actions of neuromedin B and gastrin-releasing peptide in non-small cell lung cancer. Pulm Pharmacol Ther. (1999) 12(5):291-302. https://doi.org/10.1006/pupt.1999.0210\u003c/li\u003e\n\u003cli\u003eSun B, Halmos G, Schally AV, Wang X, Martinez M. Presence of receptors for bombesin/gastrin-releasing peptide and mRNA for three receptor subtypes in human prostate cancers. Prostate. (2000) 42(4):295-303. https://doi.org/10.1002/(sici)1097-0045(20000301)42:4\u0026lt;295::aid-pros7\u0026gt;3.0.co;2-b\u003c/li\u003e\n\u003cli\u003eMatusiak D, Glover S, Nathaniel R, Matkowskyj K, Yang J, Benya RV. Neuromedin B and its receptor are mitogens in both normal and malignant epithelial cells lining the colon. Am J Physiol Gastrointest Liver Physiol. (2005) 288(4):G718-728. https://doi.org/10.1152/ajpgi.00156.2004\u003c/li\u003e\n\u003cli\u003eRyan RR, Katsuno T, Mantey SA, Pradhan TK, Weber HC, Coy DH, et al. Comparative pharmacology of the nonpeptide neuromedin B receptor antagonist PD168368. J Pharmacol Exp Ther. (1999) 290(3):1202-1211.\u003c/li\u003e\n\u003cli\u003eMoody TW, Jensen RT, Garcia L, Leyton J. Nonpeptide neuromedin B receptor antagonists inhibit the proliferation of C6 cells. Eur J Pharmacol. (2000) 409(2):133-42. https://doi.org/10.1016/s0014-2999(00)00828-1\u003c/li\u003e\n\u003cli\u003eMoody TW, Leyton J, Garcia-Marin L, Jensen RT. Nonpeptide gastrin releasing peptide receptor antagonists inhibit the proliferation of lung cancer cells. Eur J Pharmacol. (2003) 474(1):21-29. https://doi.org/10.1016/s0014-2999(03)01996-4\u003c/li\u003e\n\u003cli\u003eJordan S, Lidhar K, Korbonits M, Lowe DG, Grossman AB. Cyclin D and cyclin E expression in normal and adenomatous pituitary. Eur J Endocrinol. (2000) 143(1):R1-6. https://doi.org/10.1530/eje.0.143r001\u003c/li\u003e\n\u003cli\u003eRoussel-Gervais A, Bilodeau S, Vallette S, Berthelet F, Lacroix A, Figarella-Branger D, et al. Cooperation between cyclin E and p27(Kip1) in pituitary tumorigenesis. Mol Endocrinol. (2010) 24(9):1835-1845. https://doi.org/10.1210/me.2010-0091\u003c/li\u003e\n\u003cli\u003eAraki T, Liu NA. Cell Cycle Regulators and Lineage-Specific Therapeutic Targets for Cushing Disease. Front Endocrinol (Lausanne). (2018) 9:444. https://doi.org/ 10.3389/fendo.2018.00444\u003c/li\u003e\n\u003cli\u003eLiu NA, Ben-Shlomo A, Carmichael JD, Wang C, Swerdloff RS, Heaney AP, et al. Treatment of Cushing\u0026apos;s Disease with Pituitary-Targeting Seliciclib. J Clin Endocrinol Metab. (2022): dgac588. https://doi.org/10.1210/clinem/dgac588\u003c/li\u003e\n\u003cli\u003eLe Tourneau C, Faivre S, Laurence V, Delbaldo C, Vera K, Girre V, et al. Phase I evaluation of seliciclib (R-roscovitine), a novel oral cyclin-dependent kinase inhibitor, in patients with advanced malignancies. Eur J Cancer. (2010) 46(18):3243-3250. https://doi.org/10.1016/j.ejca.2010.08.001\u003c/li\u003e\n\u003cli\u003eTheodoropoulou M, Arzberger T, Gruebler Y, Jaffrain-Rea ML, Schlegel J, Schaaf L, et al. Expression of epidermal growth factor receptor in neoplastic pituitary cells: evidence for a role in corticotropinoma cells. J Endocrinol. (2004) 183(2):385-394. https://doi.org/10.1677/joe.1.05616\u003c/li\u003e\n\u003cli\u003eReincke M, Sbiera S, Hayakawa A, Theodoropoulou M, Osswald A, Beuschlein F, et al. Mutations in the deubiquitinase gene USP8 cause Cushing\u0026apos;s disease. Nat Genet. (2015) 47(1):31-38. https://doi.org/10.1038/ng.3166\u003c/li\u003e\n\u003cli\u003eAraki T, Liu X, Kameda H, Tone Y, Fukuoka H, Tone M, et al. EGFR Induces E2F1-Mediated Corticotroph Tumorigenesis. J Endocr Soc. (2017) 1(2):127-143. https://doi.org/10.1210/js.2016-1053\u003c/li\u003e\n\u003cli\u003eFukuoka H, Shichi H, Yamamoto M, Takahashi Y. The Mechanisms Underlying Autonomous Adrenocorticotropic Hormone Secretion in Cushing\u0026apos;s Disease. Int J Mol Sci. (2020) 21(23):9132. https://doi.org/10.3390/ijms21239132\u003c/li\u003e\n\u003cli\u003eMoody TW, Berna MJ, Mantey S, Sancho V, Ridnour L, Wink DA, et al. Neuromedin B receptors regulate EGF receptor tyrosine phosphorylation in lung cancer cells. Eur J Pharmacol. (2010) 637(1-3):38-45. https://doi.org/10.1016/j.ejphar.2010.03.057\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"pituitary","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pitu","sideBox":"Learn more about [Pituitary]()","snPcode":"11102","submissionUrl":"https://submission.nature.com/new-submission/11102/3","title":"Pituitary","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Cushing’s disease therapeutic target, neuromedin B, NMB, ACTH","lastPublishedDoi":"10.21203/rs.3.rs-3122899/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3122899/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cb\u003ePurpose\u003c/b\u003e\u003c/p\u003e \u003cp\u003eCushing\u0026rsquo;s disease (CD) results from autonomous adrenocorticotropic hormone (ACTH) secretion by pituitary corticotroph adenomas, leading to excessive cortisol production, ultimately affecting morbidity and mortality. Pasireotide is the only FDA approved tumor directed treatment for CD, but it is effective in only about 25% of patients, and is associated with a high rate of hyperglycemia. Neuromedin B (NMB), a member of the bombesin-like peptide family, regulates endocrine secretion and cell proliferation. Here, we assessed NMB and NMB receptor (NMBR) expression in human corticotroph adenomas and the effects of NMBR antagonist PD168368 on murine and human corticotroph tumors.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMethods\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo investigate NMB and NMBR expression, real-time qPCR and immunostaining on human pathological specimens of corticotroph, non-functional and somatotroph pituitary adenomas were performed. The effects of PD168368 on hormone secretion and cell proliferation were studied \u003cem\u003ein vitro\u003c/em\u003e, \u003cem\u003ein vivo\u003c/em\u003e and in seven patient-derived corticotroph adenoma cells. NMB and NMBR were expressed in higher extent in human corticotroph adenomas compared with non-functional or somatotroph adenomas.\u003c/p\u003e\u003cp\u003e\u003cb\u003eResults\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn murine AtT-20 cells, PD168368 reduced proopiomelanocortin (Pomc) mRNA/protein expression and ACTH secretion as well as cell proliferation. In mice with tumor xenografts, tumor growth, ACTH and corticosterone were downregulated by PD168368. In patient-derived adenoma cells, PD168368 reduced \u003cem\u003ePOMC\u003c/em\u003e mRNA expression in four out of seven cases and ACTH secretion in two out of five cases. A PD168368-mediated cyclin E suppression was also identified in AtT-20 and patient-derived cells.\u003c/p\u003e\u003cp\u003e\u003cb\u003eConclusion\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNMBR antagonist represents a potential treatment for CD and its effect may be mediated by cyclin E suppression.\u003c/p\u003e","manuscriptTitle":"Neuromedin B receptor as a potential therapeutic target for corticotroph adenomas","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-07-03 14:09:31","doi":"10.21203/rs.3.rs-3122899/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2023-08-02T11:24:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2023-07-15T18:38:50+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2023-07-06T14:23:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"e857c763-5a2e-48a4-afb5-b31e7d1541f4","date":"2023-07-05T10:38:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"c6cc4022-7c11-4773-a29b-66ca6f49f6a1","date":"2023-07-05T08:46:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"104de162-8832-4715-9d53-876c1cc6dd49","date":"2023-07-05T07:05:42+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2023-07-04T22:58:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2023-06-29T07:41:32+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2023-06-29T07:41:32+00:00","index":"","fulltext":""},{"type":"submitted","content":"Pituitary","date":"2023-06-29T05:10:30+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"pituitary","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pitu","sideBox":"Learn more about [Pituitary]()","snPcode":"11102","submissionUrl":"https://submission.nature.com/new-submission/11102/3","title":"Pituitary","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"019ec1ee-330c-4688-93c1-494b90a6c4ae","owner":[],"postedDate":"July 3rd, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-09-07T15:13:11+00:00","versionOfRecord":{"articleIdentity":"rs-3122899","link":"https://doi.org/10.1007/s11102-023-01350-3","journal":{"identity":"pituitary","isVorOnly":false,"title":"Pituitary"},"publishedOn":"2023-08-29 15:10:20","publishedOnDateReadable":"August 29th, 2023"},"versionCreatedAt":"2023-07-03 14:09:31","video":"","vorDoi":"10.1007/s11102-023-01350-3","vorDoiUrl":"https://doi.org/10.1007/s11102-023-01350-3","workflowStages":[]},"version":"v1","identity":"rs-3122899","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3122899","identity":"rs-3122899","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. The paper's references may be in our DB but unresolved to ``paper_id`` (resolution happens at ingest when the cited DOI matches a row we already have). Run the cross-source citation reconcile pass to retry.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00
unpaywall
last seen: 2026-05-20T11:00:21.680559+00:00
License: CC-BY-4.0