E4BP4-driven circadian SLC6A1 expression governs tiagabine chronoefficacy in temporal lobe epilepsy | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article E4BP4-driven circadian SLC6A1 expression governs tiagabine chronoefficacy in temporal lobe epilepsy Yu Yang, Shuxian Gong, Xinchang Li, Lisen Sui, Jian Liu, Fangjun Yu, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6439890/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 03 Dec, 2025 Read the published version in Molecular Neurobiology → Version 1 posted 9 You are reading this latest preprint version Abstract Temporal lobe epilepsy (TLE), the most prevalent form of focal epilepsy and a leading cause of surgically managed intractable cases, is characterized by rhythmic spontaneous seizures that exhibit underutilized therapeutic potential. Here, we aim to uncover the impact of dosing time on the anticonvulsant effect of tiagabine and to elucidate the underlying mechanisms involved. Tiagabine markedly attenuated seizure severity and progression in both acute and chronic models of pilocarpine-induced TLE. Pharmacological effects of tiagabine was found to vary according to dosing time, demonstrating greater efficacy during the light phase compared to the dark phase. This variation in tiagabine efficacy was attributed to diurnal fluctuations in GABAergic neurotransmission, which depends on SLC6A1-dependent GABA reuptake rhythm. Notably, ablation of circadian transcription factor E4bp4 abolished SLC6A1 expression rhythms and abrogated the chronoefficacy of tiagabine. Our findings indicated that E4BP4-driven circadian oscillations in SLC6A1 expression regulated the efficacy of tiagabine in a circadian time-dependent manner. These results advocated for chronotherapeutic optimization of tiagabine dosing schedules to align with endogenous SLC6A1 rhythms, offering a promising avenue for precision medicine in the management of TLE. Temporal Lode Epilepsy Chronoefficacy Tiagabine Circadian Clock SLC6A1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Epilepsy is a common neurological disorder characterized by unpredictable seizures caused by abnormal discharges of brain neurons, affecting over 65 million people worldwide. As the second leading psychiatric illness globally, epilepsy poses a substantial economic burden on healthcare systems and families[ 1] . Epileptic seizures manifest as focal and generalized types, with temporal lobe epilepsy (TLE) being the most common focal form. Although oral anticonvulsant therapies are prescribed for TLE management, drug resistance remains a challenge for approximately one-third of TLE sufferers, rendering them vulnerable to recurrent seizures[ 2] . Only a minority of individuals can reduce seizures through surgery, but still need to continue taking anti-seizure medications (ASMs) after surgery. Furthermore, many ASMs possess a narrow therapeutic index, and are associated with a range of side effects, including headaches, fatigue, dizziness, blurry vision, nausea, weight gain or loss, mood disorders, and cognitive impairments[ 3 ,4] . These challenges highlight the urgent need for innovative therapeutic strategies that optimize seizure control while minimizing the adverse effects and risks inherent in current medications. In the evolving landscape of epilepsy management, recognizing the temporal patterns of seizure occurrences is crucial for diagnosis and treatment. The occurrence and severity of seizures exhibit rhythmic cycles, with circadian rhythms being the most prevalent, followed by weekly and monthly rhythms[ 5] . Different types of epilepsy show distinct seizure rhythm patterns. TLE is notably associated with a circadian rhythm, with higher seizure prevalence during the day[ 6] . This observation is further corroborated by animal studies demonstrating a circadian pattern of seizure clusters in pilocarpine- and kainic acid-induced TLE models[ 7-8 9] . Our previous studies have found that the onset and susceptibility rhythm of TLE is related to the rhythm of GABAergic activity[9]. Exploring how to utilize the rhythm of epileptic seizures and drug target sites to decrease the prevalence of drug-resistant and refractory TLE is a topic that warrants further investigation. Emerging evidence supports the potential of chronotherapy in managing epilepsy, with preliminary studies showing promising results[ 10] . For instance, adjusting ASM dosages to coincide with bedtime significantly improves seizure control in patients with persistent nocturnal or early-morning seizures, while minimizing side effects[ 11] . Further research into circadian-based dosing regimens for drugs like carbamazepine and phenytoin highlights improved seizure control and drug tolerance in tonic-clonic epileptic patients compared to conventional dosing schedule, underscoring the importance of aligning ASM administration with individual circadian rhythms[ 12] . Moreover, clinical and animal studies reveal that the pharmacokinetics and toxicity of certain ASMs, including carbamazepine, valproate and phenobarbital, show a dosing time-dependent manner, indicating that these can be exploited to improve chronotherapy[ 13,14] . These findings collectively suggest that a chronotherapeutic dosing schedule of ASMs may be effective and safe for the management of epilepsy. Tiagabine, a novel antiepileptic drug with a unique mechanism of action, emerges as a potent adjunctive therapy for refractory partial epilepsy. Preclinical trials have demonstrated that tiagabine is more potent than conventional ASMs such as phenytoin, phenobarbital, and valproic acid[ 15] . However, Mechanically, tiagabine inhibits the GABA uptake transporter SLC6A1, leading to increased synaptosomal GABA concentrations and enhanced inhibitory neurotransmission. We previously reported that SLC6A1-dependent GABA reuptake rhythm is a mechnism for triggering rhythmic seizures in TLE. Hence, we propose that the efficacy of tiagabine may be dependent on administration timing. In the present study, we uncovered that tiagabine targeted SLC6A1 to alleviate TLE in a circadian time-dependent manner. We first demonstrated that administering tiagabine at ZT6 generated stronger pharmacological effects compared to dosing at ZT18. Consistent with this time-dependent anticonvulsant effect, the enhancement of GABAergic signaling by tiagabine was also influenced by dosing time, as evidenced by more pronounced changes in mIPSC frequency and decay time at ZT6. Moreover, the temporal dependence of the regulatory effects of tiagabine on GABAergic signaling and its anticonvulsant effects depends on the rhythmic expression of SLC6A1 in the hippocampus and cortex. Additionally, the clock gene E4BP4 regulated the chronoefficacy of tiagabine by rhythmically regulating the expression of SLC6A1. Overall, our findings demonstrated that chronopharmacological targeting of SLC6A1 by tiagabine effectively alleviates TLE in mice. Materials and Methods Materials Tiagabine was purchased from Mreda Technology Inc (Dallas, TX). Pilocarpine was obtained from Aladdin (Shanghai, China). CNQX, DL-AP-5, and GABA-d6 were obtained from Sigma-Aldrich (St Louis, MO). The primers were synthesized by GUANGZHOU IGE BIOTECHNOLOGY LTD (Guangzhou, China). Anti-SLC6A1 (A15099) were purchased from Abclonal (Cambridge, MA). Anti-GAPDH antibody was purchased from Proteintech (Rockville, MD). Mice All experimental procedures were approved by the Ethics Committee of Guangzhou University of Chinese Medicine (Guangzhou, China) and conducted in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. E4bp4 −/− mice (C57BL/6 background), kindly gifted by Dr. Masato Kubo (Tokyo University of Science, Noda, Japan), were genotyped by PCR to confirm the presence of a 516 bp fragment (wild-type allele) and /or a 350 bp fragment (null allele) [ 16] . Mice were housed in specific pathogen-free cages under a 12 h:12h light-dark cycle [lights on 06:00 (ZT0), lights off 18:00 (ZT12)] with ad libitum access to food and water. Male mice aged 8-12 weeks were used for all experiments. Pilocarpine-induced acute seizure model E4bp4 −/− and wild-type mice were anesthetized with isoflurane and surgically implanted with EEG recording screws using a stereotaxic apparatus (RWD Life Science, Shenzhen, China). An EEG recording screw was implanted onto the temporal cortex (AP -2.3 mm; ML -1.0 mm), while two other screws were placed over the cerebellum to serve as the reference and background electrodes. After 7 days of recovery, mice were injected with methyllatpine (1mg/kg, s.c) to dilate their bronchus and prevent pilocarpine-induced asphyxia. Following a 30-minute interval, mice were injected with pilocarpine (300 mg/kg, i.p.) to induce acute seizure episodes. Seizure severity was scored as follows: 0 (no response), 1 (staring and diminished movement), 2 (head nodding), 3 (unilateral forelimb clonus), 4 (bilateral forelimb clonus), 5 (crazed jumping, retreating, and falling), and 6 (fully tonic-clonic seizure and death). Seizure stages 1-3 were classified as focal seizures (FS), while seizure stages 4-6 were categorized as generalized seizures (GS). EEG waveforms were captured and digitized using a PowerLab8/35 system (AD Instruments, Colorado Springs, CO) with a sampling rate of 1 k Hz, synchronized with video recording. EEG signals underwent amplification through a 0.5-100 Hz band-pass filter. Electrographic seizures were defined as spikes or sharp-wave discharges with amplitudes at least two times higher than baseline and lasting more than 5 s. For each mouse, various parameters including the latency to first EEG seizures, seizure stage, seizure duration, latency to GS and number of GS were recorded. To assess the chronoefficacy of tiagabine, E4bp4 −/− and wild-type mice were treated with tiagabine (10 mg/kg, i.p.) or vehicle at two circadian time points (ZT6 and ZT18) one hour prior to inducing the model. Pilocarpine-induced chronic seizure model Wild-type mice received pilocarpine (300 mg/kg, i.p.) 30 min after subcutaneous injection of methyllatpine (1mg /kg) to induce status epilepticus (SE). Seizures were scored using the criteria described above. SE modeling was deemed successful only when seizures reached stage 4 or higher and persisted for at least 30 min. Diazepam (10 mg/kg, i.p.) was administered 60 min after SE onset to terminate prolonged seizures. Mice that failed to meet the SE criteria were excluded from subsequent experiments. Following SE induction, continuous 24 h electroencephalogram (EEG) recordings was conducted until day 25 post-SE to monitor chronic epileptogenesis. To evaluate the circadian-dependent efficacy of tiagabine, mice received daily intraperitoneal injections of either tiagabine (10 mg/kg) or vehicle at two circadian time points (ZT6 and ZT18) for 2 weeks. During video-EEG monitoring, both the number of seizures and GS events were quantified for analysis. Pharmacokinetic studies Tiagabine (10 mg/kg) was administered via intraperitoneal injection to wild-type male mice (8-10 weeks of age) at ZT6 and ZT18. At predetermined time points (0.125, 0.25, 0.5, 0.75, 1, 2, 4, 6 and 8 h) after drug administration, three mice were subjected to retro-orbital bleeding to collect blood samples, and the samples were centrifuged at 8,000 g for 5 min and then stored at −80°C. Hippocampus, temporal lode cortex, and liver samples were collected at 0.5, 1, 2, and 4 h, immediately snap frozen in liquid nitrogen, and stored at -80°C. The samples were prepared as previously described[ 17] . The concentration of tiagabine in plasma and tissues was determined using UPLC-QTOF/MS system (Waters, Milford, MA)[ 18] . Pharmacokinetics parameters were calculated by non-compartmental analysis using PK solver 2.0. Brain slice preparation Wild-type mice were anesthetized and then decapitated. The brain was quickly transferred to ice-cold slicing solution containing (in mM) 75 sucrose, 0.5 CaCl 2 , 87 NaCl, 2.5 KCl, 4 MgCl 2 , 24 NaHCO 3 , 1.25 NaH 2 PO 4 , and 25 glucose. Cortical slices (300-μm thick) were cut using a Leica VT-1200S Vibratome (Wetzlar, Germany). Subsequently, slices were incubated in normal ACSF solution (in mM): 124 NaCl, 3 KCl, 1.25 NaH 2 PO 4 , 2 CaCl 2 , 1 MgSO 4 , 26 NaHCO 3 , 10 glucose, with an osmolarity of 310-320 mOsm/l. After recovery for 30 min at 34°C in artificial cerebrospinal fluid (aCSF), the slices were incubated at room temperature for 1 h. All solutions were bubbled continuously with 95% O 2 and 5% CO 2 . Whole-cell path-clamp recording Whole-cell patch-clamp recordings were performed using micro-manager imaging and patchmaster 9 . In brief, brain slices were transferred to a recording chamber and maintained at 36 ± 1 °C in aCSF. Data were collected with a Multiclamp HEKA EPC amplifier (Molecular Devices, DE), low-pass filtered at 3 k Hz and sampled at 10 k Hz. Whole-cell recordings were obtained with patch pipettes (6-8 MΩ) filled with different internal solutions according to experiments. Cells were recorded with a holding potential of -70 mV. To monitor spontaneous inhibitory postsynaptic currents (sIPSC) and miniature spontaneous inhibitory postsynaptic currents (mIPSC), the AMPA/kainite receptor antagonist (CNQX, 10µM) and NMDA receptor antagonist (DL-AP-5, 100 µM) were added to the perfusing aCSF. Additionally, for mIPSC recordings, 1 μM TTX was added to the bath. The internal solution contained (in mM) 126 K-gluconate, 4 KCl, 10 HEPES, 2 MgCl 2 , 0.2 EGTA, 10 HEPES, 2 Mg 2 ATP, 0.5 Na 2 GTP, and 10 phosphocreatine. For sIPSC recordings, the internal solution contained (in mM) 120 CsCl, 8 NaCl, 10 HEPES, 2 EGTA, 4 Mg 2 ATP, 0.5 Na 2 GTP, 10 QX-314 and 10 phosphocreatine. sIPSC and mIPSC data were analyzed with Prism 7 (Graphpad), Clampfit 10 (PCLAMP; Molecular Devices) and Mini analysis program (Synaptosoft). qPCR Total RNA was extracted using RNAiso Plus (Takara, Dalian, China), and reverse-transcribed to cDNA using the Takara PrimeScript ® RT reagent kit (Takara, Dalian, China) following the manufacturer’s instruction. The amount of cDNA was determined by real-time PCR using GoTaqR ® qPCR Master Mix (Vazyme, Nanjing, China). Quantitative polymerase chain reaction was performed following our published procedure[ 19] . Gene expression levels were normalized to Cyclophilin b . The primers used in this study were as follows (5′-3′): Slc6a1 -forward (F), GAAAGCTGTCTGATTCTGAGGTG; Slc6a1 -reverse (R), AGCAAACGATGATGGAGTCCC; Cyclophilin b -forward (F), TCCACACCCTTTTCCGGTCC; Cyclophilin b -reverse (R), CAAAAGGAAGACGACGGAGC. Western blotting Hippocampus samples were homogenized and extracted in RIPA lysis supplemented with 1% protease inhibitor cocktail (Thermo, Rockford, IL). Protein concentrations were determined using a BCA assay kit (Beyotime Biotechnology, Shanghai, China). The protein samples were separated by 10% SDS-PAGE and transferred to PVDF membranes. After being blocked in 5% nonfat dry milk for 1 h at room temperature, blots were probed with anti-SLC6A1 (1:1000), and anti-GAPDH (1:2000) antibodies at 4°C overnight. After probing with secondary antibody, protein bands were visualized by enhanced chemiluminescence and analyzed using the Quantity One software. Protein levels were normalized to GAPDH. Statistical analysis Data were presented as mean ± SD (standard deviation). One-way or two-way ANOVA followed by Bonferroni post hoc test was used for multiple group comparisons. Student’s t-test was used for two group comparisons. All statistical analysis were performed using Graphpad Prism software version 8.0 (GraphPad Software, Inc., California). The level of significance was set at p < 0.05. Results Tiagabine efficacy depends on dosing time in pilocarpine-induced acute temporal lobe epilepsy. To evaluate the chronoefficacy of tiagabine, we administered the drug to wild-type mice at two distinct circadian time points (ZT6 and ZT18), corresponding respectively to periods of high and low seizure severity in TLE[ 9 ]. Our results demonstrated that tiagabine administration at both ZT6 and ZT18 significantly attenuated seizure stage progression and reduced seizure severity in the pilocarpine-induced acute TLE model (Fig. 1A, B). Additionally, tiagabine delayed seizure onset and increased latency to generalized seizures (GS), suggesting its effectiveness in inhibiting neocortical seizure propagation (Fig. 1C-E). Importantly, the antiepileptic efficacy of tiagabine exhibited clear circadian dependence. Specifically, administration at ZT6 resulted in a significantly greater reduction in seizure severity and a markedly prolonged latency to onset and GS compared to administration at ZT18 (Fig. 1). To quantify this chronoefficacy, we calculated the percentage change in key pharmacological endpoints (seizure severity, seizure onset, and latency to GS). Compared with controls, seizure severity was reduced by 61% at ZT6 versus only 23% at ZT18, indicating a 2.8-fold difference in efficacy between these two time points (Fig. 1B). Similarly, latency to GS was prolonged 10-fold at ZT6 compared to a 1.7-fold increase at ZT18, representing a 5.9-fold difference in efficacy (Fig. 1D). Typical EEG and their corresponding power spectrums were shown in Fig. 1E. Collectively, these findings demonstrate that the therapeutic efficacy of tiagabine is significantly influenced by dosing time. Circadian time-dependent effects of tiagabine on chronic TLE in mice. Further, we assessed the chronoefficacy of tiagabine in a chronic TLE model by measuring electrographic seizure-like activities through in vivo EEG recording conducted 25 days post-modeling (Fig. 2A). During the 21-day monitoring period, control mice exhibited a median seizure frequency of 20.7 seizures per day, totaling 1450 seizures across all vehicle-injected animals (Fig. 2B, C). In contrast, mice treated at ZT6 demonstrated a markedly reduced median seizure frequency of 3 seizures per day, accumulating only 209 total seizures, whereas mice treated at ZT18 had a median of 7.3 seizures per day, totaling 514 seizures (Fig. 2B, C). Notably, 40% of mice receiving tiagabine at ZT6 remained free from generalized seizures (GS), accompanied by a significant reduction in overall GS count (Fig. 2C). Conversely, all mice treated at ZT18 experienced generalized seizures, although their GS frequency was reduced by 69% compared to controls (Fig. 2C). Additionally, tiagabine treatment significantly reduced total seizure duration, achieving a 78.7% reduction in the ZT6 group and a 48.8% reduction in the ZT18 group relative to controls (Fig. 2C). Further analysis of seizure frequency during daytime and nighttime revealed that ZT6 administration significantly reduced daytime seizures compared to ZT18 dosing, while nocturnal seizure frequencies were comparable between both dosing groups. These findings suggest that daytime administration of tiagabine is more effective in alleviating seizures, potentially due to the higher incidence of seizure occurrence in pilocarpine-induced chronic TLE during the light phase 20 . The effect of tiagabine on IPSC showed a dosing time-dependent manner. To assess the chronoefficacy of tiagabine at the cellular level, we performed whole-cell recordings in the dentate gyrus granule cells (DGGC) of hippocampus slices derived from wild-type mice at different circadian times. Previous studies have indicated that tiagabine primarily influences inhibitory postsynaptic currents (IPSCs), so we focused on its effects on spontaneous IPSCs (sIPSCs) and miniature IPSCs (mIPSCs). To isolate sIPSCs, which result from action potential-dependent GABA release, we added 10 μM CNQX and 100 μM APV to standard artificial cerebrospinal fluid (ACSF) to block glutamate signaling. At ZT6, sIPSCs frequency decreased by 33% in the tiagabine-treated group compared to controls, while the amplitude remained unchanged (Fig. 3A). Additionally, the decay time of sIPSCs increased by 30% in tiagabine-treated slices compared to vehicle-treated mice at ZT6, with no significant differences in sIPSCs rise time between the two groups (Fig. 3A). During night phase (ZT18), the frequency of sIPSCs decreased by 24%, and decay time increased by 20% in tiagabine treated compared to controls (Fig.3B). Moreover, the changes in the amplitude and latency of sIPSCs following drug administration at ZT6 were significantly greater than those observed at ZT18, indicating that tiagabine exerts a stronger regulatory effect on GABAergic activity when administered during the day (Fig. 3A, B). Similarly, slices treated with tiagabine at ZT6 exhibited a marked 39% reduction in mIPSCs frequency compared to controls, with no change in mIPSC amplitude (Fig. 3C). The decay time of mIPSCs following tiagabine treatment was also prolonged, increasing by 34% compared to control group, while no significant differences in mIPSC rise time were observed (Fig. 3C). During the night phase (ZT18), mIPSCs frequency decreased by 23%, and decay time increased by 12% in tiagabine-treated group compared to controls (Fig. 3D). Notably, the changes in mIPSCs frequency and decay time were more pronounced during the light period than at night (39% vs 23% decrease for frequency, 34% vs 12% increase for decay time), consistent with a stronger anticonvulsant effect of tiagabine when administered during the day (Fig. 3C,D). Together, these findings indicated that the chronoefficacy of tiagabine is linked to its temporal regulation of GABAergic function. The expression and activity of SLC6A1 exhibited a robust diurnal rhythm. Given that SLC6A1 is a target of tiagabine and plays a crucial role in regulating GABAergic signaling, we analyzed the expression of this transporter in the hippocampus and cortex of chronic TLE mice. The mRNA expression of Slc6a1 displayed significant circadian fluctuations, with higher levels during the light phase (Fig. 4A). Likewise, SLC6A1 protein levels demonstrated a diurnal rhythm, peaking around ZT6, which aligns with the enhanced GABAergic signaling and anticonvulsant effect of tiagabine at this time (Fig. 4B). Notably, the amplitude of SLC6A1 expression rhythms in the hippocampus was approximately two-fold greater than that in the cortex. In TLE, the hippocampus is a primary site of neuropathological damage, characterized by pyramidal neuron loss and synaptic reorganization, and it also shows circadian-dependent modulation of GABAergic activity[ 21] . These findings suggest that the chronoefficacy of tiagabine may primarily depend on the circadian expression of SLC6A1 in the hippocampus (Fig. 4A,B). E4BP4 deficiency abolished the chronoefficacy of tiagabine Given that E4BP4 is a circadian regulator of SLC6A1, we investigated whether the rhythmic expression of SLC6A1 contributes to the chronoefficacy of tiagabine using E4bp4 −/− mice. E4bp4 ablation significantly increased the mRNA and protein expressions of SLC6A1 in the hippocampus, and abolished its rhythmic patterns (Fig. 5A,B). Due to the aggregation of seizures and mortality observed in E4bp4 -/- mice treated with 300 mg/kg pilocarpine at both ZT6 and ZT18, we adjusted the pilocarpine dose to 270 mg/kg to better assess the impact of E4BP4 on the chronoefficacy of tiagabine. In the vehicle-treated group, no significant differences were found in seizure stage, severity, latency to GS, and GS counts between the two circadian time points, indicating that E4bp4 deletion increased seizure susceptibility and disrupted the circadian rhythm of seizure susceptibility (Fig. 5C-F). Acute treatment with tiagabine significantly reduced seizure severity in E4bp4 −/− mice (Fig. 5C,D). Moreover, tiagabine administration resulted in longer latency to GS (156.72 ± 75.74% for ZT6 dosing group; 198.27 ± 45.94% for ZT18 dosing group), and fewer GS events (98.33 ± 4.08% for ZT6 dosing group; 100% for ZT18 dosing group) compared to vehicle-treated mice (Fig. 5E,F). However, the time-dependent differences in tiagabine efficacy were abolished in E4bp4 −/− mice (Fig. 5C-F). Overall, these data indicated that the dosing time-dependent anticonvulsant effects of tiagabine were attributed to the rhythmic expression of SLC6A1. The chronoefficacy of tiagabine was not attributed to its pharmacokinetics. Increasing evidence indicates that circadian variations in pharmacokinetics can be translated to drug efficacy. We evaluated the pharmacokinetics behavior of tiagabine at the two circadian time points (ZT6 and ZT18). Unexpectedly, the pharmacokinetic behavior of tiagabine, as indicated by plasma concentration and area under the curve (AUC) values, showed no significant differences between the two dosing times (Fig. 6A,B). Additionally, pharmacokinetic parameters of tiagabine did not differ at ZT6 and ZT18 (Fig. 6C). Given that tiagabine must enter the brain to exert its effects, we examined its distribution in the hippocampus and cortex, and found no differences in concentration between the two dosing times (Fig. 6D). Therefore, the influences of pharmacokinetics on the circadian effects of tiagabine can be excluded. Collectively, the time-dependent effects of tiagabine appear to be attributed to the rhythmic expression of SLC6A1, which is regulated by clock gene E4BP4. Discussion The current study is the first to demonstrate the circadian time-dependent effects of tiagabine on TLE (Fig. 1,2). Tiagabine administered at ZT6 (light phase) was more effective against TLE than drug administered at ZT18 (dark phase) (Fig. 1,2). This difference in efficacy is linked to tiagabine's ability to antagonize SLC6A1 activity, thereby enhancing GABAergic signaling and alleviating TLE severity in mice (Fig. 3) [9]. SLC6A1, a key player in this mechanism, exhibits circadian oscillations, with a much higher expression at ZT6 (in the middle light phase) and a lower expression at ZT18 (in the dark phase) (Fig. 4) [9]. Moreover, ablation of circadian transcription factor E4bp4 abolished SLC6A1 expression rhythms and abrogated the chronoefficacy of tiagabine (Fig. 5). Importantly, the plasma concentrations of tiagabine remain consistent between ZT6 and ZT18, thereby excluding drug distribution and metabolism as potential confounding factors. Therefore, we propose that the time-varying effects of tiagabine on TLE are primarily driven by E4BP4-mediated circadian oscillations in SLC6A1 expression. Accumulating evidence reveals that circadian variations in drug pharmacodynamics and pharmacokinetics affect drug effectiveness [ 22] . Our study found that the anti-seizure effect of tiagabine varied depending on the time of administration in pilocarpine-induced acute and chronic TLE models, with a higher effect at ZT6 (Fig. 1,2). This finding aligns with similar observations in other ASMs, where dosing time impacts their anticonvulsant effects. For instance, based on a clinical trial involving 103 subjects with tonic-clonic epilepsy, Yegnanarayan et al reported that the chronotherapeutic dosing schedule, where the majority of the dose of phenytoin and carbamazepine was administered at 8 PM, led to better seizure control and reduced toxic manifestations compared to conventional dosing schedule[ 23] . Similarly, a higher-evening dose of clobazam improved seizure control in patients experiencing nocturnal and early-morning seizures, as demonstrated in a clinical trial with twenty-seven patients[ 24] . Although chronotherapy can reduce seizure frequency and the side effects of ASMs, further clinical trials with larger sample sizes are necessary to validate these findings. Additionally, both clinical and animal studies have indicated that the pharmacokinetics of ASMs, such as carbamazepine, diazepam, valproate, and phenobarbital, also exhibit circadian variations based on dosing time, suggesting that the efficacy and toxicity of these drugs are likely to display a circadian rhythm[13 ,25] . This emphasizes the importance of considering circadian rhythms in epilepsy drug treatment to optimize treatment outcomes. Although numerous clinical and animal studies have demonstrated that drug efficacy exhibits a dosing time-dependent manner, the underlying molecular mechanisms remain largely unknown [ 26] . We provided convenience evidence that the circadian expression of GABA reuptake transporters SLC6A1 contributes to the chronoefficacy of tiagabine and the rhythmicity of seizures. First, the circadian pattern of SLC6A1 expression is paralleled with the rhythmicity of tiagabine efficacy and seizure severity (Fig. 1,2,4). Second, loss of SLC6A1 rhythmicity by ablation of E4bp4 in mice blunted the chronoefficacy of tiagabine, further supporting the critical role of SLC6A1 (Fig. 5). Third, the inhibitory effect of tiagabine on the GABA signaling is time-dependent, aligning with its efficacy. Fourth, the pharmacokinetics behavior of tiagabine failed to show a dosing time-dependent difference, indicating that its chronoefficacy is not driven by pharmacokinetic factors. These findings elucidate notable observations in the literature. For instance, night shift workers exhibit an increased incidence of seizures, potentially linked to elevated SLC6A1 expression and decreased extracellular GABA levels[9 ,27] . Notably, SLC6A1 not only generates inward sodium currents and leak currents but is also associated with autism and intellectual disability, suggesting it may contribute to the rhythmicity of these functions and disorders[ 28] . Although the expression and activity of neurotransmitter receptors and ion channels display diurnal variation in the suprachiasmatic nucleus (SCN) and medial prefrontal cortex (mPFC), further research is necessary to determine their involvement in the efficacy of tiagabine [ 29,30] . In the present study, we identified E4BP4 as a critical circadian regulator of tiagabine efficacy and SLC6A1 expression. Additionally, other clock genes such as Rev-erbα , Rorγ and Bmal1 , may contribute to these effects. Previous research has shown that the core clock protein REV-ERBα regulates the circadian expression of SLC6A1 by modulating E4BP4, indicating its involvement in the rhythmicity of GABA signal and tiagabine efficacy[9] . Likewise, RORγ can induce E4bp4 reporter gene activity through RORE regulatory elements, competing with REV-ERBα for the same binding sites, suggesting that RORγ may affect tiagabine efficacy through E4BP4-SLC6A1 aix[ 31] . Furthermore, the reduced expression of astrocytic SLC6A1 in the cortex of Bmal1 cKO mice suggests impaired clearance of extracellular GABA, which affects tiagabine efficacy[ 32] . The inhibitory neurotransmitter GABA is critical for maintaining the balance between excitatory and inhibitory transmission, thereby ensuring proper neuronal network function involved in epilepsy, anxiety, depression and sleep disorders[ 33] . Our and other researchers provided compelling evidence that circadian clock plays a crucial role in GABA homeostasis. REV-ERBα can modulate extracellular GABA levels in a circadian manner through the E4BP4-SLC6A1 axis, thereby influencing neuronal excitability and seizure threshold[9]. Astrocyte deletion of Bmal1 disrupts daily locomotor activity and cognitive functions by altering extracellular GABA levels[ 34] . Conversely, GABA levels also affect circadian rhythms. Astrocytes maintain suprachiasmatic nucleus (SCN) timekeeping by controlling daily fluctuations in GABA levels, which in turn regulate the transmission of circadian output from the SCN by altering neuronal excitability[ 35,36] . Additionally, seasonal plasticity in GABAA signaling is necessary for restoring phase synchrony within the master circadian clock network through the regulation of KCC2 in the SCN [37] . One of the remarkable features of TLE is the rhythmic pattern of occurrence of spontaneous seizures, implying a dependence on the endogenous clock system for seizure threshold. mTLE patients often exhibit a 24-hour non-uniform distribution of seizures, characterized by either a unimodal peak in the afternoon or a bimodal peak in the early morning and afternoon[ 38] . Multiple studies have demonstrated that spontaneous seizures in kainic acid or pilocarpine models of mTLE occur in a daily pattern, with peak incidence during 2-4 PM[ 39- 41 ]. Although the seizure rhythm is evident in many epilepsy patients, implementing personalized chronotherapy remains challenging. Key obstacles include a lack of sufficient clinical research and scientific evidence, the diverse types and complexities of epilepsy with limited antiepileptic drug options, and issues related to patient acceptance and compliance with chronotherapy. Incorporating individual circadian rhythms into seizure prediction algorithms and developing chronotherapy strategies holds promise. However, these phenomena have not garnered sufficient scientific attention, potentially due to a lack of compelling hypotheses addressing the interaction between seizure generation and the physiological clock. Encouragingly, mechanisms underlying rhythmicity in mesial TLE are beginning to emerge. Our previous studies have indicated that the circadian expression of SLC6A1 and SLC6A11 contributes to diurnal oscillations in TLE sensitivity[ 9 ] . Additionally, the rhythmic activity of activated mTOR signaling pathways and their targets increases neuronal excitability in the epileptic brain, thereby reducing the seizure threshold and facilitating seizure onset[ 42] . Circadian pharmacokinetics is a potential factor contributing to time-varying drug effects. Therefore, we analyzed the pharmacokinetic behavior of tiagabine administered at different circadian time points (ZT6 and ZT18). Our results indicated no differences in systemic and brain exposure to tiagabine between the two dosing times (Fig. 6), suggesting that circadian pharmacokinetics does not contribute to time-dependent tiagabine effects. CYP3A4 and Ugt1a1 are known to be the primary metabolism enzymes for tiagabine[ 43] . Hepatic CYP3A4 and Ugt1a1 expression displays a diurnal rhythm in mice. However, it may be insufficient to induce diurnal variations in the pharmacokinetic behavior of tiagabine (Fig. 6). In clinical practice, tiagabine is typically administered orally, necessitating further research to ascertain whether its absorption follows a circadian rhythm. Although the expression of P-glycoprotein (P-gp) and breast cancer resistance protein (Bcrp) is rhythmic and involved in tiagabine transport in the brain, we found that the distribution of the drug in the hippocampus and cortex was not dependent on dosing time. In conclusion, the anticonvulsant effect of tiagabine in mice exhibits a circadian time-dependent manner, varying with the circadian dynamics of GABA signing and SLC6A1, both of which are regulated by the circadian clock. The discovery of tiagabine's chronotherapy potential offers a rational foundation for enhancing current medication guidelines to improve therapeutic efficacy. Declarations Funding The preparation of this article was generously supported by the following funding projects, and we hereby express our sincere gratitude: Guangdong Province Basic and Applied Basic Research Project (Project Number: 2023B1515020047 and 2025A1515012820) National Natural Science Foundation of China (Project Number:82204784) The viewpoints expressed in this article are solely the personal opinions of the authors and do not represent the positions or viewpoints of the funding organizations. Competing interest The authors have declared that no conflict of interest exists. Contributions Participated in research design: Zhang. Conducted experiments: Yang, Li, Yu, Sui, Liu and Gong. Performed data analysis: Yang, Li, and Gong. Wrote or contributed to the writing of the manuscript: Yang and Zhang. Clinical trial number Not applicable. References Kanner AM, Bicchi MM. Antiseizure Medications for Adults With Epilepsy: A Review. JAMA. 2022;327(13):1269-1281. Guo D, Feng L, Yang Z, Li R, Xiao B. Altered Temporal Variations of Functional Connectivity Associated With Surgical Outcomes in Drug-Resistant Temporal Lobe Epilepsy. Front Neurosci. 2022 Apr 19;16:840481. Nevitt SJ, Sudell M, Cividini S, Marson AG, Tudur Smith C. Antiepileptic drug monotherapy for epilepsy: a network meta-analysis of individual participant data. Cochrane Database Syst Rev. 2022;4(4):CD011412. Nevitt SJ, Marson AG, Weston J, Tudur Smith C. Sodium valproate versus phenytoin monotherapy for epilepsy: an individual participant data review. Cochrane Database Syst Rev. 2018;8(8):CD001769. Karoly PJ, Rao VR, Gregg NM, Worrell GA, Bernard C, Cook MJ, Baud MO. Cycles in epilepsy. Nat Rev Neurol. 2021;17(5):267-284. Khan S, Nobili L, Khatami R, Loddenkemper T, Cajochen C, Dijk DJ, Eriksson SH. Circadian rhythm and epilepsy. Lancet Neurol. 2018;17(12):1098-1108. Pitsch J, Becker AJ, Schoch S, Müller JA, de Curtis M, Gnatkovsky V. Circadian clustering of spontaneous epileptic seizures emerges after pilocarpine-induced status epilepticus. Epilepsia. 2017;58(7):1159-1171. Raedt R, Van Dycke A, Van Melkebeke D, De Smedt T. Seizures in the intrahippocampal kainic acid epilepsy model: characterization using long-term video-EEG monitoring in the rat. Acta Neurol Scand. 2009;119(5):293-303. Zhang T, Yu F, Xu H, Chen M, Chen X, Guo L, Zhou C, Xu Y, Wang F, Yu J, Wu B. Dysregulation of REV-ERBα impairs GABAergic function and promotes epileptic seizures in preclinical models. Nat Commun 2021;12(1):1216. Ballesta A, Innominato PF, Dallmann R, Rand DA, Lévi FA. Systems Chronotherapeutics. Pharmacol Rev. 2017;69(2):161-199. Guilhoto LM, Loddenkemper T, Vendrame M, Bergin A, Bourgeois BF, Kothare SV. Higher evening antiepileptic drug dose for nocturnal and early-morning seizures. Epilepsy Behav. 2011;20(2):334-7. Yegnanarayan R, Mahesh SD, Sangle S. Chronotherapeutic dose schedule of phenytoin and carbamazepine in epileptic patients. Chronobiol Int. 2006;23(5):1035-46. Bertilsson L, Tomson T, Tybring G. Pharmacokinetics: time-dependen changes-autoinduction of carbamazepine epoxidation. J Clin Pharmacol. 1986 ;26(6):459-62. Riva R, Albani F, Contin M, Perucca E, Ambrosetto G, Gobbi G, Santucci M, Procaccianti G, Baruzzi A. Time-dependent interaction between phenytoin and valproic acid. Neurology. 1985;35(4):510-5. Adkins JC, Noble S. Tiagabine. A review of its pharmacodynamic and pharmacokinetic properties and therapeutic potential in the management of epilepsy. Drugs. 1998;55(3):437-60. Motomura Y, Kitamura H, Hijikata A, Matsunaga Y, Matsumoto K, Inoue H, et al. The transcription factor E4BP4 regulates the production of IL-10 and IL-13 in CD4+ T cells. Nat Immunol. 2011;12(5):450-9. Zhang T, Zhao M, Lu D, Wang S, Yu F, Guo L, Wen S, Wu B. REV-ERBα Regulates CYP7A1 Through Repression of Liver Receptor Homolog-1. Drug Metab Dispos. 2018;46(3):248-258. Socała K, Wyska E, Szafarz M, Nieoczym D, Wlaź P. Acute effect of cannabidiol on the activity of various novel antiepileptic drugs in the maximal electroshock- and 6 Hz-induced seizures in mice: Pharmacodynamic and pharmacokinetic studies. Neuropharmacology. 2019;158:107733. Zhang T, Yu F, Xu H, Chen M, Chen X, Guo L, Zhou C, Xu Y, Wang F, Yu J, Wu B. Dysregulation of REV-ERBα impairs GABAergic function and promotes epileptic seizures in preclinical models. Nat Commun 2021;12(1):1216. Xu C, Yu J, Ruan Y, Wang Y, Chen Z. Decoding Circadian Rhythm and Epileptic Activities: Clues From Animal Studies. Front Neurol. 2020;11:751. Bridi MCD, Zong FJ, Min X, Luo N, Tran T, Qiu J, et al. Daily Oscillation of the Excitation-Inhibition Balance in Visual Cortical Circuits. Neuron. 2020;105(4):621-629.e4. Murakami Y, Higashi Y, Matsunaga N, Koyanagi S, Ohdo S. Circadian clock-controlled intestinal expression of the multidrug-resistance gene mdr1a in mice. Gastroenterology. 2008;135(5):1636-1644.e3. Yegnanarayan R, Mahesh SD, Sangle S. Chronotherapeutic dose schedule of phenytoin and carbamazepine in epileptic patients. Chronobiol Int. 2006;23(5):1035-46. Thome-Souza S, Klehm J, Jackson M, Kadish NE, Manganaro S, Fernández IS, Loddenkemper T. Clobazam higher-evening differential dosing as an add-on therapy in refractory epilepsy. Seizure. 2016;40:1-6. Nakano S, Watanabe H, Nagai K, Ogawa N. Circadian stage-dependent changes in diazepam kinetics. Clin Pharmacol Ther. 1984;36(2):271-7. Browne T R. Pharmacokinetics of antiepileptic drugs. Neurology, 1998,51(5 Suppl 4): S2-S7. Litinski M, Scheer FA, Shea SA. Influence of the Circadian System on Disease Severity. Sleep Med Clin. 2009;4(2):143-163. Goodspeed K, Pérez-Palma E, Iqbal S, Cooper D,. Current knowledge of SLC6A1-related neurodevelopmental disorders. Brain Commun. 2020;2(2):fcaa170. Reghunandanan V, Reghunandanan R. Neurotransmitters of the suprachiasmatic nuclei[J]. Journal of circadian rhythms, 2006, 4(1): 1-20. Harkness JH, Gonzalez AE, Bushana PN, Jorgensen ET, Diurnal changes in perineuronal nets and parvalbumin neurons in the rat medial prefrontal cortex. Brain Struct Funct. 2021;226(4):1135-1153. Takeda Y, Jothi R, Birault V, Jetten AM. RORγ directly regulates the circadian expression of clock genes and downstream targets in vivo. Nucleic Acids Res. 2012;40(17):8519-35. Barca-Mayo O, Pons-Espinal M, Follert P, Armirotti A, Berdondini L, De Pietri Tonelli D. Astrocyte deletion of Bmal1 alters daily locomotor activity and cognitive functions via GABA signalling. Nat Commun. 2017;8:14336. Farajnia S, van Westering TL, Meijer JH, Michel S. Seasonal induction of GABAergic excitation in the central mammalian clock. Proc Natl Acad Sci U S A. 2014;111(26):9627-32. Barca-Mayo O, Pons-Espinal M, Follert P, Armirotti A, Berdondini L, De Pietri Tonelli D. Astrocyte deletion of Bmal1 alters daily locomotor activity and cognitive functions via GABA signalling. Nat Commun. 2017;8:14336. Albrecht U, Ripperger JA. Circadian Clocks and Sleep: Impact of Rhythmic Metabolism and Waste Clearance on the Brain. Trends Neurosci. 2018;41(10):677-688. Liu C, Reppert SM. GABA synchronizes clock cells within the suprachiasmatic circadian clock. Neuron. 2000;25(1):123-8. Rohr KE, Pancholi H, Haider S, Karow C, Modert D, Raddatz NJ, Evans J. Seasonal plasticity in GABAA signaling is necessary for restoring phase synchrony in the master circadian clock network. Elife. 2019;8:e49578. Nzwalo H, Menezes Cordeiro I, Santos AC, Peralta R, Paiva T, Bentes C. 24-hour rhythmicity of seizures in refractory focal epilepsy. Epilepsy Behav. 2016;55:75-8. Cho CH. Molecular mechanism of circadian rhythmicity of seizures in temporal lobe epilepsy. Front Cell Neurosci. 2012;6:55. Van Nieuwenhuyse B, Raedt R, Sprengers M, Dauwe I, Gadeyne S, Carrette E, Delbeke J, Wadman WJ, Boon P, Vonck K. The systemic kainic acid rat model of temporal lobe epilepsy: Long-term EEG monitoring. Brain Res. 2015;1627:1-11. Tchekalarova J, Pechlivanova D, Itzev D, Lazarov N, Markova P, Stoynev A. Diurnal rhythms of spontaneous recurrent seizures and behavioral alterations of Wistar and spontaneously hypertensive rats in the kainate model of epilepsy. Epilepsy Behav. 2010;17(1):23-32. Cho CH. Molecular mechanism of circadian rhythmicity of seizures in temporal lobe epilepsy. Front Cell Neurosci. 2012;6:55. Perucca E. Clinically relevant drug interactions with antiepileptic drugs. Br J Clin Pharmacol. 2006;61(3):246-55. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial.pptx Tiagabinechronoefficacy9.png Cite Share Download PDF Status: Published Journal Publication published 03 Dec, 2025 Read the published version in Molecular Neurobiology → Version 1 posted Editorial decision: Revision requested 13 Jun, 2025 Reviews received at journal 13 Jun, 2025 Reviewers agreed at journal 30 May, 2025 Reviews received at journal 28 May, 2025 Reviewers agreed at journal 20 May, 2025 Reviewers invited by journal 06 May, 2025 Editor assigned by journal 27 Apr, 2025 Submission checks completed at journal 27 Apr, 2025 First submitted to journal 13 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6439890","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":454172514,"identity":"0c82c899-51bd-4201-a1a9-a8e00281c1e4","order_by":0,"name":"Yu Yang","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yu","middleName":"","lastName":"Yang","suffix":""},{"id":454172515,"identity":"1ebc582d-af57-4149-83e2-8f3d449256ee","order_by":1,"name":"Shuxian Gong","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Shuxian","middleName":"","lastName":"Gong","suffix":""},{"id":454172516,"identity":"21a916c8-e6a5-468a-bef5-802acf8b06eb","order_by":2,"name":"Xinchang Li","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xinchang","middleName":"","lastName":"Li","suffix":""},{"id":454172517,"identity":"c77e1f89-e77f-4706-bf1f-88885c0b0a69","order_by":3,"name":"Lisen Sui","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Lisen","middleName":"","lastName":"Sui","suffix":""},{"id":454172518,"identity":"017a5d19-24f6-4db5-b03c-4a9b4486527b","order_by":4,"name":"Jian Liu","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Liu","suffix":""},{"id":454172519,"identity":"290d1963-2efb-41d3-bcf9-564a9b73e07c","order_by":5,"name":"Fangjun Yu","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Fangjun","middleName":"","lastName":"Yu","suffix":""},{"id":454172522,"identity":"7b5c56a3-8d94-4e4c-b526-54f3ce30ba95","order_by":6,"name":"Tianpeng Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYDACCQglx8be2PjwA/FaEhiM+XkONxtLkKIlceaM9DYBHmJ0yM9ufvbw6487jBtuPmwD6reT020goIVxzjFzY5mEZ8wGtxPbHhQwJBubHSCghVkiwUxaIuEwG1BLu4EEw4HEbYS0sEmkfwNp4TG4ebBNgocYLTwSOWaSHxIOS0jOYCRSi4RETpk0Q9ozA36eRGAgGxDhF/kZ6dskf9jcqW9jP/7w4YcKOzmCWkCAGegeKNOACOUgwPgDrmUUjIJRMApGARYAAGaQQtc766CdAAAAAElFTkSuQmCC","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Tianpeng","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-04-13 14:53:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6439890/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6439890/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12035-025-05498-w","type":"published","date":"2025-12-03T15:58:26+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":82602884,"identity":"f3639e68-eb1b-4603-a8a4-c97ef3c3fa6f","added_by":"auto","created_at":"2025-05-13 09:52:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":296107,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTiagabine efficacy depends on dosing time in mice with pilocarpine-induced acute seizures.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Seizure stages of TLE mice treated with tiagabine (10 mg/kg) or vehicle at two circadian time points (ZT6 and ZT18). \u003cstrong\u003e(B)\u003c/strong\u003e Seizure severity of TLE mice treated with tiagabine (10 mg/kg) or vehicle at two circadian time points (ZT6 and ZT18). \u003cstrong\u003e(C)\u003c/strong\u003eThe EEG onset of TLE mice treated with tiagabine (10 mg/kg) or vehicle at two circadian time points (ZT6 and ZT18). \u003cstrong\u003e(D)\u003c/strong\u003eThe latency to GS of TLE mice treated with tiagabine (10 mg/kg) or vehicle at two circadian time points (ZT6 and ZT18). \u003cstrong\u003e(E)\u003c/strong\u003eRepresentative EEG tracings in TLE mice treated with tiagabine (10 mg/kg) at two circadian time points (ZT6 and ZT18). Data are presented as mean ± SD (\u003cem\u003en \u003c/em\u003e= 6). *\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05 at individual time points (two-way ANOVA with Bonferroni post hoc test). GS, generalized seizure.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-6439890/v1/888049be69bdd292448b248f.png"},{"id":82602894,"identity":"0c05e2ee-4094-4caf-90db-b018690f3a97","added_by":"auto","created_at":"2025-05-13 09:52:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":267871,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe anticonvulsant effects of tiagabine depends on dosing time in pilocarpine-induced chronic seizure model.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Experimental scheme for pilocarpine-induced chronic seizure model and tiagabine treatment. \u003cstrong\u003e(B) \u003c/strong\u003eRepresentative EEG tracings in pilocarpine-induced chronic seizure mice treated with tiagabine (10 mg/kg, i.p) at two circadian time points (ZT6 and ZT18) for one week.\u003cstrong\u003e (C) \u003c/strong\u003eEffects of different time tiagabine dosing on seizure parameters (numbers, GS numbers and duration) of pilocarpine-induced chronic seizure mice. \u003cstrong\u003e(D) \u003c/strong\u003eEffects of different time tiagabine dosing on\u003cstrong\u003e \u003c/strong\u003eseizure numbers of pilocarpine-induced chronic seizure mice during day and night. Data are presented as mean ± SD (\u003cem\u003en = \u003c/em\u003e5). In C, *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 (one-way ANOVA). In D, *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 (two-way ANOVA with Bonferroni post hoc test). GS, generalized seizure.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-6439890/v1/ea8259a3abd5270bdf38fdf0.png"},{"id":82607453,"identity":"42ee9ed6-d403-40fc-ab80-ab49e53112cd","added_by":"auto","created_at":"2025-05-13 10:16:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":260324,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effect of tiagabine on IPSC at different circadian time.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e sIPSCs frequency, amplitude, decay time and rise time for tiagabine treated mice (21 cells, 5 mice) and vehicle treated mice (20 cells, 5 mice). The brain slice collected at ZT6. \u003cstrong\u003e(B) \u003c/strong\u003emIPSCs frequency, amplitude, decay time and rise time for tiagabine treated mice (20 cells, 5 mice) and vehicle treated mice (20 cells, 5 mice). The brain slice collected at ZT6. \u003cstrong\u003e(C) \u003c/strong\u003esIPSCs frequency, amplitude, decay time and rise time for tiagabine treated mice (22 cells, 5 mice) and vehicle treated mice (22 cells, 5 mice). The brain slice collected at ZT18. \u003cstrong\u003e(D) \u003c/strong\u003emIPSCs frequency, amplitude, decay time and rise time for tiagabine treated mice (22 cells, 5 mice) and vehicle treated mice (22 cells, 5 mice). The brain slice collected at ZT18.\u003cstrong\u003e \u003c/strong\u003eData are mean ± SD (\u003cem\u003en\u003c/em\u003e = 5 mice for each time point), *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05 (Mann-Whitney test).\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-6439890/v1/972e44c1c2ef2480c8b27339.png"},{"id":82602882,"identity":"971bf4c9-0d48-41fd-aca8-a2fe3e54ac6e","added_by":"auto","created_at":"2025-05-13 09:52:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":134054,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of SLC6A1 exhibited a robust diurnal rhythm.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e The mRNA expressions of \u003cem\u003eSlc6a1\u003c/em\u003e in the cortex and hippocampus of wild-type mice at six circadian time points (ZT2, ZT6, ZT10, ZT14, ZT18, and ZT22). \u003cstrong\u003e(B) \u003c/strong\u003eThe protein expression of SLC6A1 in the cortex and hippocampus of chronic TLE mice at six circadian time points (ZT2, ZT6, ZT10, ZT14, ZT18, and ZT22).\u003cstrong\u003e \u003c/strong\u003eData are presented as mean ± SD (\u003cem\u003en\u003c/em\u003e = 5), *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05 (one-way ANOVA).\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-6439890/v1/eef01a880a958084812abc01.png"},{"id":82602890,"identity":"8c0b6b0e-5563-438b-ab5a-7dac99c5ff3c","added_by":"auto","created_at":"2025-05-13 09:52:17","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":236801,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eE4BP4 deficiency abolished the chronoefficacy of tiagabine via regulation of SLC6A1 expression.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) The mRNA expressions of \u003cem\u003eSlc6a1\u003c/em\u003e in the hippocampus of \u003cem\u003eE4bp4\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e and wild-type (WT) mice at two circadian time points (ZT6 and ZT18). \u003cstrong\u003e(B)\u003c/strong\u003e The protein expressions of SLC6A1 in the hippocampus of \u003cem\u003eE4bp4\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e and WT mice at two circadian time points (ZT6 and ZT18). \u003cstrong\u003e(C)\u003c/strong\u003e Effects of\u003cstrong\u003e \u003c/strong\u003etiagabine pre-treatment (10 mg/kg, i.p.) on seizure stages of \u003cem\u003eE4bp4\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e TLE mice induced by pilocarpine at ZT6 and ZT18. \u003cstrong\u003e(D) \u003c/strong\u003eEffects of\u003cstrong\u003e \u003c/strong\u003etiagabine pre-treatment (10 mg/kg, i.p.) on seizure severity of \u003cem\u003eE4bp4\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e TLE mice induced by pilocarpine at ZT6 and ZT18.\u003cstrong\u003e (E)\u003c/strong\u003e Effects of\u003cstrong\u003e \u003c/strong\u003etiagabine pre-treatment (10 mg/kg, i.p.) on GS latency of \u003cem\u003eE4bp4\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e TLE mice induced by pilocarpine at ZT6 and ZT18. \u003cstrong\u003e(F) \u003c/strong\u003eEffects of\u003cstrong\u003e \u003c/strong\u003etiagabine pre-treatment (10 mg/kg, i.p.) on GS number of \u003cem\u003eE4bp4\u003c/em\u003e\u003csup\u003e\u003cem\u003e-/-\u003c/em\u003e\u003c/sup\u003e mice induced by pilocarpine at ZT6 and ZT18. Data are presented as mean ± SD (\u003cem\u003en \u003c/em\u003e= 6). In A-B, *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 versus control (t test). In C, statistics analysis was performed with two-way ANOVA and Bonferroni post hoc test. In D-E, statistics analysis was performed with one-way ANOVA.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-6439890/v1/06324c2d028aa2ccb855b632.png"},{"id":82602895,"identity":"87e937a3-71d2-45fb-898e-ae355a83c46b","added_by":"auto","created_at":"2025-05-13 09:52:17","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":210823,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe pharmacokinetic behavior of tiagabine showed no significant dosing time-dependent changes.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003ePlasma tiagabine concentrations after drug administration (10 mg/kg, i.p) at ZT6 and ZT18 in wild-type mice. \u003cstrong\u003e(B) \u003c/strong\u003eThe AUC value of tiagabine at dosing time of ZT6 and ZT18 in wild-type mice.\u003cstrong\u003e (C) \u003c/strong\u003eThe pharmacokinetic parameters of tiagabine at dosing time of ZT6 and ZT18 in wild-type mice. \u003cstrong\u003e(D) \u003c/strong\u003eThe hippocampus, cortex and hepatic concentrations of tiagabine after administration at ZT6 and ZT18 in wild-type\u003csup\u003e \u003c/sup\u003emice. Data are presented as mean ± SD (\u003cem\u003en\u003c/em\u003e = 3 each time point). In A, statistics analysis was performed with one-way ANOVA. In B-D, statistics analysis was performed with t test.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-6439890/v1/9baacbcfe709a1c2aef565c7.png"},{"id":97724990,"identity":"19e2fab8-9b6a-4d59-b297-73e88734de60","added_by":"auto","created_at":"2025-12-08 16:14:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2418142,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6439890/v1/dbf58e1b-9444-41e7-ba0c-6e6bfb6560e7.pdf"},{"id":82602885,"identity":"60b466d1-d66c-4681-ab9a-3ab916d4b6e1","added_by":"auto","created_at":"2025-05-13 09:52:17","extension":"pptx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1007315,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial.pptx","url":"https://assets-eu.researchsquare.com/files/rs-6439890/v1/a1c2ae728177f97aae591aa4.pptx"},{"id":82602902,"identity":"7f201aa0-2887-4842-9810-777a55515a76","added_by":"auto","created_at":"2025-05-13 09:52:17","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":4019297,"visible":true,"origin":"","legend":"","description":"","filename":"Tiagabinechronoefficacy9.png","url":"https://assets-eu.researchsquare.com/files/rs-6439890/v1/7dc4f79a42d78077cb5da5b1.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"E4BP4-driven circadian SLC6A1 expression governs tiagabine chronoefficacy in temporal lobe epilepsy","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEpilepsy is a common neurological disorder characterized by unpredictable seizures caused by abnormal discharges of brain neurons, affecting over 65 million people worldwide. As the second leading psychiatric illness globally, epilepsy poses a substantial economic burden on healthcare systems and families[\u003csup\u003e1]\u003c/sup\u003e. Epileptic seizures manifest as focal and generalized types, with temporal lobe epilepsy (TLE) being the most common focal form.\u0026nbsp;Although oral anticonvulsant therapies are prescribed for TLE management, drug resistance remains a challenge for approximately one-third of TLE sufferers, rendering them vulnerable to recurrent seizures[\u003csup\u003e2]\u003c/sup\u003e. Only a minority of individuals can reduce seizures through surgery, but still need to continue taking anti-seizure medications\u0026nbsp;(ASMs)\u0026nbsp;after surgery. Furthermore, many ASMs\u0026nbsp;possess a narrow therapeutic index, and are associated with a range of side effects, including headaches, fatigue, dizziness, blurry vision, nausea, weight gain or loss, mood disorders, and cognitive impairments[\u003csup\u003e3\u003c/sup\u003e\u003csup\u003e,4]\u003c/sup\u003e.\u0026nbsp;These challenges highlight the urgent need for innovative therapeutic strategies that optimize seizure control while minimizing the adverse effects and risks inherent in current medications.\u003c/p\u003e\n\u003cp\u003eIn the evolving landscape of epilepsy management, recognizing the temporal patterns of seizure occurrences is crucial for diagnosis and treatment. The occurrence and severity of seizures exhibit rhythmic cycles, with circadian rhythms being the most prevalent, followed by weekly and monthly rhythms[\u003csup\u003e5]\u003c/sup\u003e.\u0026nbsp;Different types of epilepsy show distinct seizure rhythm patterns. TLE is notably associated with a circadian rhythm, with higher seizure prevalence during the day[\u003csup\u003e6]\u003c/sup\u003e. This observation is further corroborated by animal studies demonstrating a circadian pattern of seizure clusters in pilocarpine- and kainic acid-induced TLE models[\u003csup\u003e7-8\u003c/sup\u003e\u003csup\u003e9]\u003c/sup\u003e. Our previous studies have found that the onset and susceptibility rhythm of TLE is related to the rhythm of GABAergic activity[9]. Exploring how to utilize the rhythm of epileptic seizures and drug target sites to decrease the prevalence of drug-resistant and refractory TLE is a topic that warrants further investigation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEmerging evidence supports the potential of chronotherapy in managing epilepsy, with preliminary studies showing promising results[\u003csup\u003e10]\u003c/sup\u003e. For instance, adjusting ASM dosages to coincide with bedtime significantly improves seizure control in patients with persistent nocturnal or early-morning seizures, while minimizing side effects[\u003csup\u003e11]\u003c/sup\u003e. Further research into circadian-based dosing regimens for drugs like carbamazepine and phenytoin highlights improved seizure control and drug tolerance in tonic-clonic epileptic patients compared to conventional dosing schedule, underscoring the importance of aligning ASM administration with individual circadian rhythms[\u003csup\u003e12]\u003c/sup\u003e. Moreover, clinical and animal studies reveal that the pharmacokinetics and toxicity of certain ASMs, including carbamazepine, valproate and phenobarbital, show a dosing time-dependent manner, indicating that these can be exploited to improve chronotherapy[\u003csup\u003e13,14]\u003c/sup\u003e. These findings collectively suggest that a chronotherapeutic dosing schedule of ASMs may be effective and safe for the management of epilepsy.\u003c/p\u003e\n\u003cp\u003eTiagabine, a novel antiepileptic drug with a unique mechanism of action, emerges as a potent adjunctive therapy for refractory partial epilepsy. Preclinical trials have demonstrated that tiagabine is more potent than conventional ASMs such as phenytoin, phenobarbital, and valproic acid[\u003csup\u003e15]\u003c/sup\u003e.\u0026nbsp;However, Mechanically, tiagabine inhibits the GABA uptake transporter SLC6A1, leading to increased synaptosomal GABA concentrations and enhanced inhibitory neurotransmission.\u0026nbsp;We previously reported that SLC6A1-dependent GABA reuptake rhythm is a mechnism for triggering rhythmic seizures in TLE. Hence, we propose that the efficacy of tiagabine may be dependent on administration timing.\u003c/p\u003e\n\u003cp\u003eIn the present study, we uncovered that tiagabine targeted SLC6A1 to alleviate TLE in a circadian time-dependent manner. We first demonstrated that administering tiagabine at ZT6 generated stronger pharmacological effects compared to dosing at ZT18. Consistent with this time-dependent anticonvulsant effect, the enhancement of GABAergic signaling by tiagabine was also influenced by dosing time, as evidenced by more pronounced changes in mIPSC frequency and decay time at ZT6. Moreover, the temporal dependence of the regulatory effects of tiagabine on GABAergic signaling and its anticonvulsant effects depends on the rhythmic expression of SLC6A1 in the hippocampus and cortex. Additionally, the clock gene E4BP4 regulated the chronoefficacy of tiagabine by rhythmically regulating the expression of SLC6A1. Overall, our findings demonstrated that chronopharmacological targeting of SLC6A1 by tiagabine effectively alleviates TLE in mice.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003ch2\u003eMaterials\u003c/h2\u003e\n\u003cp\u003eTiagabine was purchased from Mreda Technology Inc (Dallas, TX). Pilocarpine was obtained from Aladdin (Shanghai, China).\u0026nbsp;CNQX, DL-AP-5, and GABA-d6 were obtained from Sigma-Aldrich (St Louis, MO). The primers were synthesized by GUANGZHOU IGE BIOTECHNOLOGY LTD (Guangzhou, China). Anti-SLC6A1 (A15099) were purchased from Abclonal (Cambridge, MA). Anti-GAPDH antibody was purchased from Proteintech (Rockville, MD).\u003c/p\u003e\n\u003ch2\u003eMice\u003c/h2\u003e\n\u003cp\u003eAll experimental procedures were approved by the Ethics Committee of Guangzhou University of Chinese Medicine (Guangzhou, China) and conducted in strict accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. \u003cem\u003eE4bp4\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mice (C57BL/6 background), kindly gifted by Dr. Masato Kubo (Tokyo University of Science, Noda, Japan), were genotyped by PCR to confirm the presence of a 516 bp fragment (wild-type allele) and /or a 350 bp fragment (null allele) [\u003csup\u003e16]\u003c/sup\u003e.\u0026nbsp;Mice were housed in specific pathogen-free cages under a 12 h:12h light-dark cycle\u0026nbsp;[lights on 06:00 (ZT0), lights off 18:00 (ZT12)]\u0026nbsp;with ad libitum access to food and water. Male mice aged 8-12 weeks were used for all experiments.\u003c/p\u003e\n\u003ch2\u003ePilocarpine-induced acute seizure model\u003c/h2\u003e\n\u003cp\u003e\u003cem\u003eE4bp4\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e and wild-type mice were anesthetized with isoflurane and surgically implanted with EEG recording screws using a stereotaxic apparatus (RWD Life Science, Shenzhen, China). An EEG recording screw was implanted onto the temporal cortex (AP -2.3\u0026thinsp;mm; ML -1.0\u0026thinsp;mm), while two other screws were placed over the cerebellum to serve as the reference and background electrodes. After 7 days of recovery, mice were injected with methyllatpine (1mg/kg, s.c) to dilate their bronchus and prevent pilocarpine-induced asphyxia. Following a 30-minute interval, mice were injected with pilocarpine (300 mg/kg, i.p.) to induce acute seizure episodes. Seizure severity was scored as follows: 0 (no response), 1 (staring and diminished movement), 2 (head nodding), 3 (unilateral forelimb clonus), 4 (bilateral forelimb clonus), 5 (crazed jumping, retreating, and falling), and 6 (fully tonic-clonic seizure and death). Seizure stages 1-3 were classified as focal seizures (FS), while seizure stages 4-6 were categorized as generalized seizures (GS). EEG waveforms were captured and digitized using a PowerLab8/35 system (AD Instruments, Colorado Springs, CO) with a sampling rate of 1 k Hz, synchronized with video recording. EEG signals underwent amplification through a 0.5-100 Hz band-pass filter. Electrographic seizures were defined as spikes or sharp-wave discharges with amplitudes at least two times higher than baseline and lasting more than 5\u0026thinsp;s. For each mouse, various parameters including the latency to first EEG seizures, seizure stage, seizure duration, latency to GS and number of GS were recorded. To assess the chronoefficacy of tiagabine, \u003cem\u003eE4bp4\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e and wild-type mice were treated with tiagabine (10 mg/kg, i.p.) or vehicle at two circadian time points (ZT6 and ZT18) one hour prior to inducing the model.\u003c/p\u003e\n\u003ch2\u003ePilocarpine-induced chronic seizure model\u003c/h2\u003e\n\u003cp\u003eWild-type mice\u0026nbsp;received pilocarpine (300 mg/kg, i.p.) 30 min after subcutaneous injection of methyllatpine (1mg /kg) to induce status epilepticus (SE). Seizures were scored using the criteria described above. SE modeling was deemed successful only when seizures reached stage 4 or higher and persisted for at least 30 min. Diazepam (10\u0026thinsp;mg/kg, i.p.) was administered 60 min after SE onset to terminate prolonged seizures. Mice that failed to meet the SE criteria were excluded from subsequent experiments. Following SE induction, continuous 24 h electroencephalogram (EEG) recordings was conducted until day 25 post-SE to monitor chronic epileptogenesis. To evaluate the circadian-dependent efficacy of tiagabine, mice received daily intraperitoneal injections of either tiagabine (10 mg/kg) or vehicle at two circadian time points (ZT6 and ZT18) for 2 weeks. During video-EEG monitoring, both the number of seizures and GS events were quantified for analysis.\u003c/p\u003e\n\u003ch2\u003ePharmacokinetic studies\u003c/h2\u003e\n\u003cp\u003eTiagabine (10 mg/kg) was administered via intraperitoneal injection to wild-type male mice (8-10 weeks of age) at ZT6 and ZT18. At predetermined time points (0.125, 0.25, 0.5, 0.75, 1, 2, 4, 6 and 8 h) after drug administration, three mice were subjected to retro-orbital bleeding to collect blood samples, and the samples were centrifuged at 8,000 g for 5 min and then stored at \u0026minus;80\u0026deg;C. Hippocampus, temporal lode cortex, and liver samples were collected at 0.5, 1, 2, and 4 h, immediately snap frozen in liquid nitrogen, and stored at -80\u0026deg;C. The samples were prepared as previously described[\u003csup\u003e17]\u003c/sup\u003e. The concentration of tiagabine in plasma and tissues was determined using UPLC-QTOF/MS system (Waters, Milford, MA)[\u003csup\u003e18]\u003c/sup\u003e. Pharmacokinetics parameters were calculated by non-compartmental analysis using PK solver 2.0.\u003c/p\u003e\n\u003ch2\u003eBrain slice preparation\u003c/h2\u003e\n\u003cp\u003eWild-type mice were anesthetized and then decapitated. The brain was quickly transferred to ice-cold slicing solution containing (in mM) 75 sucrose, 0.5 CaCl\u003csub\u003e2\u003c/sub\u003e, 87 NaCl, 2.5 KCl, 4 MgCl\u003csub\u003e2\u003c/sub\u003e, 24 NaHCO\u003csub\u003e3\u003c/sub\u003e, 1.25 NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, and 25 glucose. Cortical slices (300-\u0026mu;m thick) were cut using a Leica VT-1200S Vibratome (Wetzlar, Germany). Subsequently, slices were incubated in normal ACSF solution (in mM): 124 NaCl, 3 KCl, 1.25 NaH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e, 2 CaCl\u003csub\u003e2\u003c/sub\u003e, 1 MgSO\u003csub\u003e4\u003c/sub\u003e, 26 NaHCO\u003csub\u003e3\u003c/sub\u003e, 10 glucose, with an osmolarity of 310-320\u0026thinsp;mOsm/l. After recovery for 30 min at 34\u0026deg;C in artificial cerebrospinal fluid (aCSF), the slices were incubated at room temperature for 1 h. All solutions were bubbled continuously with 95% O\u003csub\u003e2\u003c/sub\u003e and 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\n\u003ch2\u003eWhole-cell path-clamp recording\u003c/h2\u003e\n\u003cp\u003eWhole-cell patch-clamp recordings were performed using micro-manager imaging and patchmaster\u003csup\u003e9\u003c/sup\u003e. In brief, brain slices were transferred to a recording chamber and maintained at 36\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026thinsp;\u0026deg;C in aCSF. Data were collected with a Multiclamp HEKA EPC amplifier (Molecular Devices, DE), low-pass filtered at 3 k Hz and sampled at 10\u0026thinsp;k Hz. Whole-cell recordings were obtained with patch pipettes (6-8\u0026thinsp;M\u0026Omega;) filled with different internal solutions according to experiments. Cells were recorded with a holding potential of -70\u0026thinsp;mV. To monitor spontaneous inhibitory postsynaptic currents (sIPSC) and miniature spontaneous inhibitory postsynaptic currents (mIPSC), the AMPA/kainite receptor antagonist (CNQX, 10\u0026micro;M) and NMDA receptor antagonist (DL-AP-5, 100 \u0026micro;M) were added to the perfusing aCSF. Additionally, for mIPSC recordings, 1\u0026thinsp;\u0026mu;M TTX was added to the bath. The internal solution contained (in mM) 126 K-gluconate, 4 KCl, 10 HEPES, 2 MgCl\u003csub\u003e2\u003c/sub\u003e, 0.2 EGTA, 10 HEPES, 2 Mg\u003csub\u003e2\u003c/sub\u003eATP, 0.5 Na\u003csub\u003e2\u003c/sub\u003eGTP, and 10 phosphocreatine. For sIPSC recordings, the internal solution contained (in mM) 120 CsCl, 8 NaCl, 10 HEPES, 2 EGTA, 4 Mg\u003csub\u003e2\u003c/sub\u003eATP, 0.5 Na\u003csub\u003e2\u003c/sub\u003eGTP, 10 QX-314 and 10 phosphocreatine. sIPSC and mIPSC data were analyzed with Prism 7 (Graphpad), Clampfit 10 (PCLAMP; Molecular Devices) and Mini analysis program (Synaptosoft).\u003c/p\u003e\n\u003ch2\u003eqPCR\u003c/h2\u003e\n\u003cp\u003eTotal RNA was extracted using RNAiso Plus (Takara, Dalian, China), and reverse-transcribed to cDNA using the Takara PrimeScript\u003csup\u003e\u0026reg;\u003c/sup\u003e RT reagent kit (Takara, Dalian, China)\u0026nbsp;following\u0026nbsp;the manufacturer\u0026rsquo;s instruction. The amount of cDNA was determined by real-time PCR using GoTaqR\u003csup\u003e\u0026reg;\u003c/sup\u003e qPCR Master Mix (Vazyme, Nanjing, China). Quantitative polymerase chain reaction was performed following our published procedure[\u003csup\u003e19]\u003c/sup\u003e. Gene expression levels were normalized to \u003cem\u003eCyclophilin b\u003c/em\u003e. The primers used in this study were as follows (5\u0026prime;-3\u0026prime;): \u003cem\u003eSlc6a1\u003c/em\u003e-forward (F), GAAAGCTGTCTGATTCTGAGGTG; \u003cem\u003eSlc6a1\u003c/em\u003e-reverse (R), AGCAAACGATGATGGAGTCCC; \u003cem\u003eCyclophilin b\u003c/em\u003e-forward (F), TCCACACCCTTTTCCGGTCC; \u003cem\u003eCyclophilin b\u003c/em\u003e-reverse (R), CAAAAGGAAGACGACGGAGC.\u003c/p\u003e\n\u003ch2\u003eWestern blotting\u003c/h2\u003e\n\u003cp\u003eHippocampus samples were homogenized and extracted in RIPA lysis supplemented with 1% protease inhibitor cocktail (Thermo, Rockford, IL). Protein concentrations were determined using a BCA assay kit (Beyotime Biotechnology, Shanghai, China). The protein samples were separated by 10% SDS-PAGE and transferred to PVDF membranes. After being blocked in 5% nonfat dry milk for 1 h at room temperature, blots were probed with anti-SLC6A1 (1:1000), and anti-GAPDH (1:2000) antibodies at 4\u0026deg;C\u0026nbsp;overnight.\u0026nbsp;After probing with secondary antibody, protein bands were visualized by enhanced chemiluminescence and analyzed using the Quantity One software.\u0026nbsp;Protein levels were normalized to GAPDH.\u003c/p\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eData were presented as mean \u0026plusmn; SD (standard deviation). One-way or two-way ANOVA followed by Bonferroni post hoc test was used for multiple group comparisons. Student\u0026rsquo;s t-test was used for two group comparisons. All statistical analysis were performed using Graphpad Prism software version 8.0 (GraphPad Software, Inc., California). The level of significance was set at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003ch2\u003eTiagabine efficacy depends on dosing time in pilocarpine-induced acute temporal lobe epilepsy.\u003c/h2\u003e\n\u003cp\u003eTo evaluate the chronoefficacy of tiagabine, we administered the drug to wild-type mice at two distinct circadian time points (ZT6 and ZT18), corresponding respectively to periods of high and low seizure severity in TLE[\u003csup\u003e9\u003c/sup\u003e]. Our results demonstrated that tiagabine administration at both ZT6 and ZT18 significantly attenuated seizure stage progression and reduced seizure severity in the pilocarpine-induced acute TLE model (Fig. 1A, B). Additionally, tiagabine delayed seizure onset and increased latency to generalized seizures (GS), suggesting its effectiveness in inhibiting neocortical seizure propagation (Fig. 1C-E). Importantly, the antiepileptic efficacy of tiagabine exhibited clear circadian dependence. Specifically, administration at ZT6 resulted in a significantly greater reduction in seizure severity and a markedly prolonged latency to onset and GS compared to administration at ZT18 (Fig. 1). To quantify this chronoefficacy, we calculated the percentage change in key pharmacological endpoints (seizure severity, seizure onset, and latency to GS). Compared with controls, seizure severity was reduced by 61% at ZT6 versus only 23% at ZT18, indicating a 2.8-fold difference in efficacy between these two time points (Fig. 1B). Similarly, latency to GS was prolonged 10-fold at ZT6 compared to a 1.7-fold increase at ZT18, representing a 5.9-fold difference in efficacy (Fig. 1D). Typical EEG and their corresponding power spectrums were shown in Fig. 1E. Collectively, these findings demonstrate that the therapeutic efficacy of tiagabine is significantly influenced by dosing time.\u003c/p\u003e\n\u003ch2\u003eCircadian time-dependent effects of tiagabine on chronic TLE in mice.\u003c/h2\u003e\n\u003cp\u003eFurther, we assessed the chronoefficacy of tiagabine in a chronic TLE model by measuring electrographic seizure-like activities through in vivo EEG recording conducted 25 days post-modeling (Fig. 2A). During the 21-day monitoring period, control mice exhibited a median seizure frequency of 20.7 seizures per day, totaling 1450 seizures across all vehicle-injected animals (Fig. 2B, C). In contrast, mice treated at ZT6 demonstrated a markedly reduced median seizure frequency of 3 seizures per day, accumulating only 209 total seizures, whereas mice treated at ZT18 had a median of 7.3 seizures per day, totaling 514 seizures (Fig. 2B, C). Notably, 40% of mice receiving tiagabine at ZT6 remained free from generalized seizures (GS), accompanied by a significant reduction in overall GS count (Fig. 2C). Conversely, all mice treated at ZT18 experienced generalized seizures, although their GS frequency was reduced by 69% compared to controls (Fig. 2C). Additionally, tiagabine treatment significantly reduced total seizure duration, achieving a 78.7% reduction in the ZT6 group and a 48.8% reduction in the ZT18 group relative to controls (Fig. 2C). Further analysis of seizure frequency during daytime and nighttime revealed that ZT6 administration significantly reduced daytime seizures compared to ZT18 dosing, while nocturnal seizure frequencies were comparable between both dosing groups. These findings suggest that daytime administration of tiagabine is more effective in alleviating seizures, potentially due to the higher incidence of seizure occurrence in pilocarpine-induced chronic TLE during the light phase\u003csup\u003e20\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eThe effect of tiagabine on IPSC showed a dosing time-dependent manner.\u003c/h2\u003e\n\u003cp\u003eTo assess the chronoefficacy of tiagabine at the cellular level, we performed whole-cell recordings in the dentate gyrus granule cells (DGGC) of hippocampus slices derived from wild-type mice at different circadian times. Previous studies have indicated that tiagabine primarily influences inhibitory postsynaptic currents (IPSCs), so we focused on its effects on spontaneous IPSCs (sIPSCs) and miniature IPSCs (mIPSCs). To isolate sIPSCs, which result from action potential-dependent GABA release, we added 10 \u0026mu;M CNQX and 100 \u0026mu;M APV to standard artificial cerebrospinal fluid (ACSF) to block glutamate signaling. At ZT6, sIPSCs frequency decreased by 33% in the tiagabine-treated group compared to controls, while the amplitude remained unchanged (Fig. 3A).\u0026nbsp;Additionally, the decay time of sIPSCs increased by 30% in tiagabine-treated slices compared to vehicle-treated mice at ZT6, with no significant differences in sIPSCs rise time between the two groups (Fig. 3A). During night phase (ZT18), the frequency of sIPSCs decreased by 24%, and decay time increased by 20% in tiagabine treated compared to controls (Fig.3B). Moreover, the changes in the amplitude and latency of sIPSCs following drug administration at ZT6 were significantly greater than those observed at ZT18, indicating that tiagabine exerts a stronger regulatory effect on GABAergic activity when administered during the day (Fig. 3A, B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eSimilarly, slices treated with tiagabine at ZT6 exhibited a marked 39% reduction in mIPSCs frequency compared to controls, with no change in mIPSC amplitude (Fig. 3C). The decay time of mIPSCs following tiagabine treatment was also prolonged, increasing by 34% compared to control group, while no significant differences in mIPSC rise time were observed (Fig. 3C). During the night phase (ZT18), mIPSCs frequency decreased by 23%, and decay time increased by 12% in tiagabine-treated group compared to controls (Fig. 3D). Notably, the changes in mIPSCs frequency and decay time were more pronounced during the light period than at night (39% vs 23% decrease for frequency, 34% vs 12% increase for decay time), consistent with a stronger anticonvulsant effect of tiagabine when administered during the day (Fig. 3C,D). Together, these findings indicated that the chronoefficacy of tiagabine is linked to its temporal regulation of GABAergic function.\u003c/p\u003e\n\u003ch2\u003eThe expression and activity of SLC6A1 exhibited a robust diurnal rhythm.\u003c/h2\u003e\n\u003cp\u003eGiven that SLC6A1 is a target of tiagabine and plays a crucial role in regulating GABAergic signaling, we analyzed the expression of this transporter in the hippocampus and cortex of chronic TLE mice. The mRNA expression of \u003cem\u003eSlc6a1\u003c/em\u003e displayed significant circadian fluctuations, with higher levels during the light phase (Fig. 4A). Likewise, SLC6A1 protein levels demonstrated a diurnal rhythm, peaking around ZT6, which aligns with the enhanced GABAergic signaling and anticonvulsant effect of tiagabine at this time (Fig. 4B). Notably, the amplitude of SLC6A1 expression rhythms in the hippocampus was approximately two-fold greater than that in the cortex. In TLE, the hippocampus is a primary site of neuropathological damage, characterized by pyramidal neuron loss and synaptic reorganization, and it also shows circadian-dependent modulation of GABAergic activity[\u003csup\u003e21]\u003c/sup\u003e. These findings suggest that the chronoefficacy of tiagabine may primarily depend on the circadian expression of SLC6A1 in the hippocampus\u0026nbsp;(Fig. 4A,B).\u003c/p\u003e\n\u003ch2\u003eE4BP4 deficiency abolished the chronoefficacy of tiagabine\u003c/h2\u003e\n\u003cp\u003eGiven that E4BP4 is a circadian regulator of SLC6A1, we investigated whether the rhythmic expression of SLC6A1 contributes to the chronoefficacy of tiagabine using \u003cem\u003eE4bp4\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mice. \u003cem\u003eE4bp4\u003c/em\u003e ablation significantly increased the mRNA and protein expressions of SLC6A1 in the hippocampus, and abolished its rhythmic patterns (Fig. 5A,B). Due to the aggregation of seizures and mortality observed in \u003cem\u003eE4bp4\u003csup\u003e-/-\u003c/sup\u003e\u003c/em\u003e mice treated with 300 mg/kg pilocarpine at both ZT6 and ZT18, we adjusted the pilocarpine dose to 270 mg/kg to better assess the impact of E4BP4 on the chronoefficacy of tiagabine. In the vehicle-treated group, no significant differences were found in seizure stage, severity, latency to GS, and GS counts between the two circadian time points, indicating that \u003cem\u003eE4bp4\u003c/em\u003e deletion increased seizure susceptibility and disrupted the circadian rhythm of seizure susceptibility (Fig. 5C-F). Acute treatment with tiagabine significantly reduced seizure severity in \u003cem\u003eE4bp4\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e mice (Fig. 5C,D). Moreover, tiagabine administration resulted in longer latency to GS (156.72 \u0026plusmn; 75.74% for ZT6 dosing group; 198.27 \u0026plusmn; 45.94% for ZT18 dosing group), and fewer GS events (98.33 \u0026plusmn; 4.08% for ZT6 dosing group; 100% for ZT18 dosing group) compared to vehicle-treated mice (Fig. 5E,F). However,\u0026nbsp;the time-dependent differences in tiagabine efficacy\u0026nbsp;were abolished in\u0026nbsp;\u003cem\u003eE4bp4\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e\u003c/em\u003e\u003cem\u003e\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003c/em\u003emice\u0026nbsp;(Fig. 5C-F).\u0026nbsp;Overall, these data indicated that the dosing time-dependent anticonvulsant effects of tiagabine were attributed to the rhythmic expression of SLC6A1.\u003c/p\u003e\n\u003ch2\u003eThe chronoefficacy of tiagabine was not attributed to its pharmacokinetics.\u003c/h2\u003e\n\u003cp\u003eIncreasing evidence indicates that circadian variations in pharmacokinetics can be translated to drug efficacy. We evaluated the pharmacokinetics behavior of tiagabine at the two circadian time points (ZT6 and ZT18). Unexpectedly, the pharmacokinetic behavior of tiagabine, as indicated by plasma concentration and area under the curve (AUC) values, showed no significant differences between the two dosing times (Fig. 6A,B). Additionally, pharmacokinetic parameters of tiagabine did not differ at ZT6 and ZT18 (Fig. 6C). Given that tiagabine must enter the brain to exert its effects, we examined its distribution in the hippocampus and cortex, and found no differences in concentration between the two dosing times (Fig. 6D). Therefore, the influences of pharmacokinetics on the circadian effects of tiagabine can be excluded. Collectively, the time-dependent effects of tiagabine appear to be attributed to the rhythmic expression of SLC6A1, which is regulated by clock gene E4BP4.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe current study is the first to demonstrate the circadian time-dependent effects of tiagabine on TLE (Fig. 1,2). Tiagabine administered at ZT6 (light phase) was more effective against TLE than drug administered at ZT18 (dark phase) (Fig. 1,2). This difference in efficacy is linked to tiagabine\u0026apos;s ability to antagonize SLC6A1 activity, thereby enhancing GABAergic signaling and alleviating TLE severity in mice (Fig. 3) [9]. SLC6A1, a key player in this mechanism, exhibits circadian oscillations, with a much higher expression at ZT6 (in the middle light phase) and a lower expression at ZT18 (in the dark phase) (Fig. 4) [9]. Moreover, ablation of circadian transcription factor \u003cem\u003eE4bp4\u003c/em\u003e abolished SLC6A1 expression rhythms and abrogated the chronoefficacy of tiagabine (Fig. 5). Importantly, the plasma concentrations of tiagabine remain consistent between ZT6 and ZT18, thereby excluding drug distribution and metabolism as potential confounding factors. Therefore, we propose that the time-varying effects of tiagabine on TLE are primarily driven by E4BP4-mediated circadian oscillations in SLC6A1 expression.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAccumulating evidence reveals that circadian variations in drug pharmacodynamics and pharmacokinetics affect drug effectiveness\u0026nbsp;[\u003csup\u003e22]\u003c/sup\u003e. Our study found that the anti-seizure effect of tiagabine varied depending on the time of administration in pilocarpine-induced acute and chronic TLE models, with a higher effect at ZT6 (Fig. 1,2). This finding aligns with similar observations in other ASMs, where dosing time impacts their anticonvulsant effects. For instance, based on a clinical trial involving 103 subjects with tonic-clonic epilepsy, Yegnanarayan et al reported that the chronotherapeutic dosing schedule, where the majority of the dose of phenytoin and carbamazepine was administered at 8 PM, led to better seizure control and reduced toxic manifestations compared to conventional dosing schedule[\u003csup\u003e23]\u003c/sup\u003e. Similarly, a higher-evening dose of clobazam improved seizure control in patients experiencing nocturnal and early-morning seizures, as demonstrated in a clinical trial with twenty-seven patients[\u003csup\u003e24]\u003c/sup\u003e. Although chronotherapy can reduce seizure frequency and the side effects of ASMs, further clinical trials with larger sample sizes are necessary to validate these findings. Additionally, both clinical and animal studies have indicated that the pharmacokinetics of ASMs, such as carbamazepine, diazepam, valproate, and phenobarbital, also exhibit circadian variations based on dosing time,\u0026nbsp;suggesting that the efficacy and toxicity of these drugs are likely to display a circadian rhythm[13\u003csup\u003e,25]\u003c/sup\u003e. This emphasizes the importance of considering circadian rhythms in epilepsy drug treatment to optimize treatment outcomes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAlthough numerous clinical and animal studies have demonstrated that drug efficacy exhibits a dosing time-dependent manner, the underlying molecular mechanisms remain largely unknown\u0026nbsp;[\u003csup\u003e26]\u003c/sup\u003e. We provided convenience evidence that the circadian expression of GABA reuptake transporters SLC6A1 contributes to the chronoefficacy of tiagabine and the rhythmicity of seizures. First, the circadian pattern of SLC6A1 expression is paralleled with the rhythmicity of tiagabine efficacy and seizure severity (Fig. 1,2,4). Second, loss of SLC6A1 rhythmicity by ablation of \u003cem\u003eE4bp4\u003c/em\u003e in mice blunted the chronoefficacy of tiagabine, further supporting the critical role of SLC6A1 (Fig. 5). Third, the inhibitory effect of tiagabine on the GABA signaling is time-dependent, aligning with its efficacy. Fourth, the pharmacokinetics behavior of tiagabine failed to show a dosing time-dependent difference, indicating that its chronoefficacy is not driven by pharmacokinetic factors. These findings elucidate notable observations in the literature. For instance, night shift workers exhibit an increased incidence of seizures, potentially linked to elevated SLC6A1 expression and decreased extracellular GABA levels[9\u003csup\u003e,27]\u003c/sup\u003e.\u0026nbsp;Notably, SLC6A1 not only generates inward sodium currents and leak currents but is also associated with autism and intellectual disability, suggesting it may contribute to the rhythmicity of these functions and disorders[\u003csup\u003e28]\u003c/sup\u003e. Although the expression and activity of neurotransmitter receptors and ion channels display diurnal variation in the suprachiasmatic nucleus (SCN) and medial prefrontal cortex (mPFC), further research is necessary to determine their involvement in the efficacy of tiagabine [\u003csup\u003e29,30]\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn the present study, we identified E4BP4 as a critical circadian regulator of tiagabine efficacy and SLC6A1 expression. Additionally, other clock genes such as \u003cem\u003eRev-erb\u0026alpha;\u003c/em\u003e, \u003cem\u003eRor\u0026gamma;\u003c/em\u003e and \u003cem\u003eBmal1\u003c/em\u003e, may contribute to these effects. Previous research has shown that the core clock protein REV-ERB\u0026alpha; regulates\u0026nbsp;the circadian expression of SLC6A1 by modulating\u0026nbsp;E4BP4, indicating its involvement in the rhythmicity of GABA signal and tiagabine efficacy[9]\u003cem\u003e.\u003c/em\u003e Likewise, ROR\u0026gamma; can induce \u003cem\u003eE4bp4\u003c/em\u003e reporter gene activity through RORE regulatory elements, competing with REV-ERB\u0026alpha; for the same binding sites, suggesting that ROR\u0026gamma; may affect tiagabine efficacy through E4BP4-SLC6A1 aix[\u003csup\u003e31]\u003c/sup\u003e. Furthermore, the reduced expression of astrocytic SLC6A1 in the cortex of \u003cem\u003eBmal1\u0026nbsp;\u003c/em\u003ecKO mice suggests impaired clearance of extracellular GABA, which affects tiagabine efficacy[\u003csup\u003e32]\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe inhibitory neurotransmitter GABA is critical for maintaining the balance between excitatory and inhibitory transmission, thereby ensuring proper neuronal network function involved in epilepsy, anxiety, depression and sleep disorders[\u003csup\u003e33]\u003c/sup\u003e. Our and other researchers provided compelling evidence that circadian clock plays a crucial role in GABA homeostasis. REV-ERB\u0026alpha; can modulate extracellular GABA levels in a circadian manner through the E4BP4-SLC6A1 axis, thereby influencing neuronal excitability and seizure threshold[9]. Astrocyte deletion of \u003cem\u003eBmal1\u003c/em\u003e disrupts daily locomotor activity and cognitive functions by altering extracellular GABA levels[\u003csup\u003e34]\u003c/sup\u003e. Conversely,\u0026nbsp;GABA levels also affect circadian rhythms. Astrocytes maintain suprachiasmatic nucleus (SCN) timekeeping by controlling daily fluctuations in GABA levels, which in turn regulate the transmission of circadian output from the SCN by altering neuronal excitability[\u003csup\u003e35,36]\u003c/sup\u003e. Additionally, seasonal plasticity in GABAA signaling is necessary for restoring phase synchrony within the master circadian clock network through the regulation of KCC2 in the SCN\u003csup\u003e\u0026nbsp;[37]\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOne of the remarkable features of TLE is the rhythmic pattern of occurrence of spontaneous seizures, implying a dependence on the endogenous clock system for seizure threshold.\u0026nbsp;mTLE patients often exhibit a 24-hour non-uniform distribution of seizures, characterized by either a unimodal peak in the afternoon or a bimodal peak in the early morning and afternoon[\u003csup\u003e38]\u003c/sup\u003e. Multiple studies have demonstrated that spontaneous seizures in kainic acid or pilocarpine models of mTLE occur in a daily pattern, with peak incidence during 2-4 PM[\u003csup\u003e39-\u003c/sup\u003e\u003ca href=\"#_edn1\" name=\"_ednref1\" title=\"\"\u003e\u003c/a\u003e\u003csup\u003e41\u003c/sup\u003e]. Although the seizure rhythm is evident in many epilepsy patients, implementing personalized chronotherapy remains challenging. Key obstacles include a lack of sufficient clinical research and scientific evidence, the diverse types and complexities of epilepsy with limited antiepileptic drug options, and issues related to patient acceptance and compliance with chronotherapy. Incorporating individual circadian rhythms into seizure prediction algorithms and developing chronotherapy strategies holds promise. However, these phenomena have not garnered sufficient scientific attention, potentially due to a lack of compelling hypotheses addressing the interaction between seizure generation and the physiological clock. Encouragingly, mechanisms underlying rhythmicity in mesial TLE are beginning to emerge. Our previous studies have indicated that the circadian expression of SLC6A1 and SLC6A11 contributes to diurnal oscillations in TLE sensitivity[\u003csup\u003e9\u003c/sup\u003e\u003csup\u003e]\u003c/sup\u003e. Additionally, the rhythmic activity of activated mTOR signaling pathways and their targets increases neuronal excitability in the epileptic brain, thereby reducing the seizure threshold and facilitating seizure onset[\u003csup\u003e42]\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eCircadian pharmacokinetics is a potential factor contributing to time-varying drug effects. Therefore, we analyzed the pharmacokinetic behavior of tiagabine administered at different circadian time points (ZT6 and ZT18). Our results indicated no differences in systemic and brain exposure to tiagabine between the two dosing times (Fig. 6), suggesting that circadian pharmacokinetics does not contribute to time-dependent tiagabine effects. CYP3A4 and Ugt1a1 are known to be the primary metabolism enzymes for tiagabine[\u003csup\u003e43]\u003c/sup\u003e. Hepatic CYP3A4 and Ugt1a1 expression displays a diurnal rhythm in mice. However, it may be insufficient to induce diurnal variations in the pharmacokinetic behavior of tiagabine (Fig. 6). In clinical practice, tiagabine is typically administered orally, necessitating further research to ascertain whether its absorption follows a circadian rhythm. Although the expression of P-glycoprotein (P-gp) and breast cancer resistance protein (Bcrp) is rhythmic and involved in tiagabine transport in the brain, we found that the distribution of the drug in the hippocampus and cortex was not dependent on dosing time.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn conclusion, the anticonvulsant effect of tiagabine in mice exhibits a circadian time-dependent manner, varying with the circadian dynamics of GABA signing and SLC6A1, both of which are regulated by the circadian clock. The discovery of tiagabine\u0026apos;s chronotherapy potential offers a rational foundation for enhancing current medication guidelines to improve therapeutic efficacy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThe preparation of this article was generously supported by the following funding projects, and we hereby express our sincere gratitude:\u003c/p\u003e\n\u003cul start=\"50\"\u003e\n \u003cli\u003eGuangdong Province Basic and Applied Basic Research Project (Project Number: 2023B1515020047 and 2025A1515012820)\u0026nbsp;\u003c/li\u003e\n \u003cli\u003eNational Natural Science Foundation of China (Project Number:82204784)\u003c/li\u003e\n\u003c/ul\u003e\n\u003cp\u003eThe viewpoints expressed in this article are solely the personal opinions of the authors and do not represent the positions or viewpoints of the funding organizations.\u003c/p\u003e\n\u003cp\u003eCompeting interest\u003c/p\u003e\n\u003cp\u003eThe authors have declared that no conflict of interest exists.\u003c/p\u003e\n\u003cp\u003eContributions\u003c/p\u003e\n\u003cp\u003eParticipated in research design: Zhang.\u003c/p\u003e\n\u003cp\u003eConducted experiments: Yang, Li, Yu, Sui, Liu and Gong.\u003c/p\u003e\n\u003cp\u003ePerformed data analysis: Yang, Li, and Gong.\u003c/p\u003e\n\u003cp\u003eWrote or contributed to the writing of the manuscript: Yang and Zhang.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKanner AM, Bicchi MM. Antiseizure Medications for Adults With Epilepsy: A Review. JAMA. 2022;327(13):1269-1281.\u003c/li\u003e\n\u003cli\u003eGuo D, Feng L, Yang Z, Li R, Xiao B. Altered Temporal Variations of Functional Connectivity Associated With Surgical Outcomes in Drug-Resistant Temporal Lobe Epilepsy. Front Neurosci. 2022 Apr 19;16:840481.\u003c/li\u003e\n\u003cli\u003eNevitt SJ, Sudell M, Cividini S, Marson AG, Tudur Smith C. Antiepileptic drug monotherapy for epilepsy: a network meta-analysis of individual participant data. Cochrane Database Syst Rev. 2022;4(4):CD011412.\u003c/li\u003e\n\u003cli\u003eNevitt SJ, Marson AG, Weston J, Tudur Smith C. Sodium valproate versus phenytoin monotherapy for epilepsy: an individual participant data review. Cochrane Database Syst Rev. 2018;8(8):CD001769.\u003c/li\u003e\n\u003cli\u003eKaroly PJ, Rao VR, Gregg NM, Worrell GA, Bernard C, Cook MJ, Baud MO. Cycles in epilepsy. Nat Rev Neurol. 2021;17(5):267-284.\u003c/li\u003e\n\u003cli\u003eKhan S, Nobili L, Khatami R, Loddenkemper T, Cajochen C, Dijk DJ, Eriksson SH. Circadian rhythm and epilepsy. Lancet Neurol. 2018;17(12):1098-1108.\u003c/li\u003e\n\u003cli\u003ePitsch J, Becker AJ, Schoch S, M\u0026uuml;ller JA, de Curtis M, Gnatkovsky V. Circadian clustering of spontaneous epileptic seizures emerges after pilocarpine-induced status epilepticus. Epilepsia. 2017;58(7):1159-1171.\u003c/li\u003e\n\u003cli\u003eRaedt R, Van Dycke A, Van Melkebeke D, De Smedt T. Seizures in the intrahippocampal kainic acid epilepsy model: characterization using long-term video-EEG monitoring in the rat. Acta Neurol Scand. 2009;119(5):293-303.\u003c/li\u003e\n\u003cli\u003eZhang T, Yu F, Xu H, Chen M, Chen X, Guo L, Zhou C, Xu Y, Wang F, Yu J, Wu B. Dysregulation of REV-ERB\u0026alpha; impairs GABAergic function and promotes epileptic seizures in preclinical models. Nat Commun 2021;12(1):1216.\u003c/li\u003e\n\u003cli\u003eBallesta A, Innominato PF, Dallmann R, Rand DA, L\u0026eacute;vi FA. Systems Chronotherapeutics. Pharmacol Rev. 2017;69(2):161-199.\u003c/li\u003e\n\u003cli\u003eGuilhoto LM, Loddenkemper T, Vendrame M, Bergin A, Bourgeois BF, Kothare SV. Higher evening antiepileptic drug dose for nocturnal and early-morning seizures. Epilepsy Behav. 2011;20(2):334-7.\u003c/li\u003e\n\u003cli\u003eYegnanarayan R, Mahesh SD, Sangle S. Chronotherapeutic dose schedule of phenytoin and carbamazepine in epileptic patients. Chronobiol Int. 2006;23(5):1035-46.\u003c/li\u003e\n\u003cli\u003eBertilsson L, Tomson T, Tybring G. Pharmacokinetics: time-dependen changes-autoinduction of carbamazepine epoxidation. J Clin Pharmacol. 1986 ;26(6):459-62.\u003c/li\u003e\n\u003cli\u003eRiva R, Albani F, Contin M, Perucca E, Ambrosetto G, Gobbi G, Santucci M, Procaccianti G, Baruzzi A. Time-dependent interaction between phenytoin and valproic acid. Neurology. 1985;35(4):510-5.\u003c/li\u003e\n\u003cli\u003eAdkins JC, Noble S. Tiagabine. A review of its pharmacodynamic and pharmacokinetic properties and therapeutic potential in the management of epilepsy. Drugs. 1998;55(3):437-60.\u003c/li\u003e\n\u003cli\u003eMotomura Y, Kitamura H, Hijikata A, Matsunaga Y, Matsumoto K, Inoue H, et al. The transcription factor E4BP4 regulates the production of IL-10 and IL-13 in CD4+ T cells. Nat Immunol. 2011;12(5):450-9.\u003c/li\u003e\n\u003cli\u003eZhang T, Zhao M, Lu D, Wang S, Yu F, Guo L, Wen S, Wu B. REV-ERB\u0026alpha; Regulates CYP7A1 Through Repression of Liver Receptor Homolog-1. Drug Metab Dispos. 2018;46(3):248-258.\u003c/li\u003e\n\u003cli\u003eSocała K, Wyska E, Szafarz M, Nieoczym D, Wlaź P. Acute effect of cannabidiol on the activity of various novel antiepileptic drugs in the maximal electroshock- and 6 Hz-induced seizures in mice: Pharmacodynamic and pharmacokinetic studies. Neuropharmacology. 2019;158:107733.\u003c/li\u003e\n\u003cli\u003eZhang T, Yu F, Xu H, Chen M, Chen X, Guo L, Zhou C, Xu Y, Wang F, Yu J, Wu B. Dysregulation of REV-ERB\u0026alpha; impairs GABAergic function and promotes epileptic seizures in preclinical models. Nat Commun 2021;12(1):1216.\u003c/li\u003e\n\u003cli\u003eXu C, Yu J, Ruan Y, Wang Y, Chen Z. Decoding Circadian Rhythm and Epileptic Activities: Clues From Animal Studies. Front Neurol. 2020;11:751.\u003c/li\u003e\n\u003cli\u003eBridi MCD, Zong FJ, Min X, Luo N, Tran T, Qiu J, et al. Daily Oscillation of the Excitation-Inhibition Balance in Visual Cortical Circuits. Neuron. 2020;105(4):621-629.e4.\u003c/li\u003e\n\u003cli\u003eMurakami Y, Higashi Y, Matsunaga N, Koyanagi S, Ohdo S. Circadian clock-controlled intestinal expression of the multidrug-resistance gene mdr1a in mice. Gastroenterology. 2008;135(5):1636-1644.e3.\u003c/li\u003e\n\u003cli\u003eYegnanarayan R, Mahesh SD, Sangle S. Chronotherapeutic dose schedule of phenytoin and carbamazepine in epileptic patients. Chronobiol Int. 2006;23(5):1035-46.\u003c/li\u003e\n\u003cli\u003eThome-Souza S, Klehm J, Jackson M, Kadish NE, Manganaro S, Fern\u0026aacute;ndez IS, Loddenkemper T. Clobazam higher-evening differential dosing as an add-on therapy in refractory epilepsy. Seizure. 2016;40:1-6.\u003c/li\u003e\n\u003cli\u003eNakano S, Watanabe H, Nagai K, Ogawa N. Circadian stage-dependent changes in diazepam kinetics. Clin Pharmacol Ther. 1984;36(2):271-7.\u003c/li\u003e\n\u003cli\u003eBrowne T R. Pharmacokinetics of antiepileptic drugs. Neurology, 1998,51(5 Suppl 4): S2-S7.\u003c/li\u003e\n\u003cli\u003eLitinski M, Scheer FA, Shea SA. Influence of the Circadian System on Disease Severity. Sleep Med Clin. 2009;4(2):143-163. \u003c/li\u003e\n\u003cli\u003eGoodspeed K, P\u0026eacute;rez-Palma E, Iqbal S, Cooper D,. Current knowledge of SLC6A1-related neurodevelopmental disorders. Brain Commun. 2020;2(2):fcaa170.\u003c/li\u003e\n\u003cli\u003eReghunandanan V, Reghunandanan R. Neurotransmitters of the suprachiasmatic nuclei[J]. Journal of circadian rhythms, 2006, 4(1): 1-20.\u003c/li\u003e\n\u003cli\u003eHarkness JH, Gonzalez AE, Bushana PN, Jorgensen ET, Diurnal changes in perineuronal nets and parvalbumin neurons in the rat medial prefrontal cortex. Brain Struct Funct. 2021;226(4):1135-1153.\u003c/li\u003e\n\u003cli\u003eTakeda Y, Jothi R, Birault V, Jetten AM. ROR\u0026gamma; directly regulates the circadian expression of clock genes and downstream targets in vivo. Nucleic Acids Res. 2012;40(17):8519-35.\u003c/li\u003e\n\u003cli\u003eBarca-Mayo O, Pons-Espinal M, Follert P, Armirotti A, Berdondini L, De Pietri Tonelli D. Astrocyte deletion of Bmal1 alters daily locomotor activity and cognitive functions via GABA signalling. Nat Commun. 2017;8:14336.\u003c/li\u003e\n\u003cli\u003eFarajnia S, van Westering TL, Meijer JH, Michel S. Seasonal induction of GABAergic excitation in the central mammalian clock. Proc Natl Acad Sci U S A. 2014;111(26):9627-32.\u003c/li\u003e\n\u003cli\u003eBarca-Mayo O, Pons-Espinal M, Follert P, Armirotti A, Berdondini L, De Pietri Tonelli D. Astrocyte deletion of Bmal1 alters daily locomotor activity and cognitive functions via GABA signalling. Nat Commun. 2017;8:14336.\u003c/li\u003e\n\u003cli\u003eAlbrecht U, Ripperger JA. Circadian Clocks and Sleep: Impact of Rhythmic Metabolism and Waste Clearance on the Brain. Trends Neurosci. 2018;41(10):677-688.\u003c/li\u003e\n\u003cli\u003eLiu C, Reppert SM. GABA synchronizes clock cells within the suprachiasmatic circadian clock. Neuron. 2000;25(1):123-8.\u003c/li\u003e\n\u003cli\u003eRohr KE, Pancholi H, Haider S, Karow C, Modert D, Raddatz NJ, Evans J. Seasonal plasticity in GABAA signaling is necessary for restoring phase synchrony in the master circadian clock network. Elife. 2019;8:e49578.\u003c/li\u003e\n\u003cli\u003eNzwalo H, Menezes Cordeiro I, Santos AC, Peralta R, Paiva T, Bentes C. 24-hour rhythmicity of seizures in refractory focal epilepsy. Epilepsy Behav. 2016;55:75-8.\u003c/li\u003e\n\u003cli\u003eCho CH. Molecular mechanism of circadian rhythmicity of seizures in temporal lobe epilepsy. Front Cell Neurosci. 2012;6:55.\u003c/li\u003e\n\u003cli\u003eVan Nieuwenhuyse B, Raedt R, Sprengers M, Dauwe I, Gadeyne S, Carrette E, Delbeke J, Wadman WJ, Boon P, Vonck K. The systemic kainic acid rat model of temporal lobe epilepsy: Long-term EEG monitoring. Brain Res. 2015;1627:1-11.\u003c/li\u003e\n\u003cli\u003eTchekalarova J, Pechlivanova D, Itzev D, Lazarov N, Markova P, Stoynev A. Diurnal rhythms of spontaneous recurrent seizures and behavioral alterations of Wistar and spontaneously hypertensive rats in the kainate model of epilepsy. Epilepsy Behav. 2010;17(1):23-32.\u003c/li\u003e\n\u003cli\u003eCho CH. Molecular mechanism of circadian rhythmicity of seizures in temporal lobe epilepsy. Front Cell Neurosci. 2012;6:55.\u003c/li\u003e\n\u003cli\u003ePerucca E. Clinically relevant drug interactions with antiepileptic drugs. Br J Clin Pharmacol. 2006;61(3):246-55.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"molecular-neurobiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"moln","sideBox":"Learn more about [Molecular Neurobiology](https://www.springer.com/journal/12035)","snPcode":"12035","submissionUrl":"https://submission.nature.com/new-submission/12035/3","title":"Molecular Neurobiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Temporal Lode Epilepsy, Chronoefficacy, Tiagabine, Circadian Clock, SLC6A1","lastPublishedDoi":"10.21203/rs.3.rs-6439890/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6439890/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTemporal lobe epilepsy (TLE), the most prevalent form of focal epilepsy and a leading cause of surgically managed intractable cases, is characterized by rhythmic spontaneous seizures that exhibit underutilized therapeutic potential. Here, we aim to uncover the impact of dosing time on the anticonvulsant effect of tiagabine and to elucidate the underlying mechanisms involved. Tiagabine markedly attenuated seizure severity and progression in both acute and chronic models of pilocarpine-induced TLE. Pharmacological effects of tiagabine was found to vary according to dosing time, demonstrating greater efficacy during the light phase compared to the dark phase. This variation in tiagabine efficacy was attributed to diurnal fluctuations in GABAergic neurotransmission, which depends on SLC6A1-dependent GABA reuptake rhythm. Notably, ablation of circadian transcription factor \u003cem\u003eE4bp4\u003c/em\u003e abolished SLC6A1 expression rhythms and abrogated the chronoefficacy of tiagabine. Our findings indicated that E4BP4-driven circadian oscillations in SLC6A1 expression regulated the efficacy of tiagabine in a circadian time-dependent manner. These results advocated for chronotherapeutic optimization of tiagabine dosing schedules to align with endogenous SLC6A1 rhythms, offering a promising avenue for precision medicine in the management of TLE.\u003c/p\u003e","manuscriptTitle":"E4BP4-driven circadian SLC6A1 expression governs tiagabine chronoefficacy in temporal lobe epilepsy","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-13 09:52:12","doi":"10.21203/rs.3.rs-6439890/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-06-14T02:31:14+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-13T14:52:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"320268733661175775508502669887276365436","date":"2025-05-30T18:55:02+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-28T13:36:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"93319943048623194340464608880568592797","date":"2025-05-20T09:12:22+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-07T02:52:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-28T01:20:48+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-28T01:19:56+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Neurobiology","date":"2025-04-13T14:45:46+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"molecular-neurobiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"moln","sideBox":"Learn more about [Molecular Neurobiology](https://www.springer.com/journal/12035)","snPcode":"12035","submissionUrl":"https://submission.nature.com/new-submission/12035/3","title":"Molecular Neurobiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"ff86ca43-6038-4e79-a837-3e24657dc5ba","owner":[],"postedDate":"May 13th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-12-08T16:12:22+00:00","versionOfRecord":{"articleIdentity":"rs-6439890","link":"https://doi.org/10.1007/s12035-025-05498-w","journal":{"identity":"molecular-neurobiology","isVorOnly":false,"title":"Molecular Neurobiology"},"publishedOn":"2025-12-03 15:58:26","publishedOnDateReadable":"December 3rd, 2025"},"versionCreatedAt":"2025-05-13 09:52:12","video":"","vorDoi":"10.1007/s12035-025-05498-w","vorDoiUrl":"https://doi.org/10.1007/s12035-025-05498-w","workflowStages":[]},"version":"v1","identity":"rs-6439890","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6439890","identity":"rs-6439890","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.