Saffold Virus Exploits Integrin αVβ8 and Sulfated Glycosaminoglycans as Two Parallel Receptors for Infection

Saffold Virus Exploits Integrin αVβ8 and Sulfated Glycosaminoglycans as Two Parallel Receptors for Infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Saffold Virus Exploits Integrin αVβ8 and Sulfated Glycosaminoglycans as Two Parallel Receptors for Infection Toshiki HIMEDA, Takako Okuwa, Kyousuke Kobayashi, Namiko Nomura, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5450276/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Dec, 2025 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Abstract Saffold virus (SAFV), a member of the species Cardiovirus saffoldi within the Picornaviridae family, causes acute respiratory and gastrointestinal illnesses, as well as hand, foot, and mouth diseases. It is also suspected to be associated with neuronal disorders such as encephalitis and meningitis in severe cases. Despite its clinical significance, the virus-host interactions underlying SAFV pathogenicity remain largely unknown. Using a genome-wide CRISPR-Cas9 knockout screen, we identified receptors for SAFV infection: sulfated glycosaminoglycans (GAGs) and integrin aVb8. Single knockouts of SLC35B2 , an essential gene for sulfated GAG synthesis, or the integrin genes, ITGAV or ITGB8 partially reduced SAFV-3 susceptibility in HeLa cells, and double knockout conferred complete resistance. Furthermore, we demonstrated that SAFV-3 virions bind directly to sulfated GAGs and integrin aVb8. Based on these findings, we propose a model of SAFV infection, in which sulfated GAGs and integrin aVb8 function in parallel pathways during viral entry. Biological sciences/Microbiology/Virology/Virus–host interactions Biological sciences/Microbiology/Virology/Viral pathogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Saffold virus (SAFV) belongs to the species Cardiovirus saffoldi (formerly Cardiovirus D) within the genus Cardiovirus of the family Picornaviridae . It is closely related to Theiler’s murine encephalomyelitis virus (TMEV), which is classified under the species Cardiovirus theileri (formerly Cardiovirus B) [1–3]. In 2007, SAFV was first isolated from a stool sample of an eight-month-old infant with a fever of unknown origin in the United States [4]. To date, 11 different SAFV genotypes have been identified, with SAFV-2 and SAFV-3 being highly prevalent in humans [5]. SAFV is primarily detected in pediatric patients with acute respiratory illness and gastroenteritis, but it has also been found in specimens from severe cases, including acute flaccid paralysis, aseptic meningitis, myocarditis, acute pancreatitis, and cerebellitis [5–10]. In addition, SAFV infection has been associated with hand, foot, and mouth disease (HFMD), where an increased frequency of severe nervous system manifestations has been reported [11]. SAFV co-infection exacerbates the severity of HFMD caused by enterovirus 71 infection [11]. However, the pathogenicity of SAFV, which causes a range of mild to severe symptoms, remains poorly understood. The capsid of SAFV is composed of 60 capsomers, each containing four subunits: VP1, VP2, VP3, and VP4. The fourth capsid protein, VP4, is located inside the capsid [12]. Surface-exposed capsid proteins bind to receptors on target cells, thereby initiating the first step of infection. This virus-receptor interaction is followed by viral entry, uncoating, replication, assembly, and ultimately the release of progeny viruses from infected cells. Thus, the receptors and their distribution are the most important factors in defining the host range and tissue tropism, playing a crucial role in viral pathogenicity. However, the SAFV receptor has not been identified. To identify SAFV receptors, we employed genome-wide CRISPR-Cas9 knockout (KO) screens, a widely used method of identifying critical host factors for viral infection, including receptors [13–18], using HeLa-N cells, which are a HeLa-subline highly susceptible to SAFV-3 infection [19]. We herein report the identification of sulfated glycosaminoglycans (GAGs) and integrin aVb8 as SAFV receptors, and further demonstrate that these two pathways function in parallel during SAFV infection. Results Identification of genes involved in sulfated GAG synthesis as host factors for efficient SAFV-3 infection To identify the host factors required for SAFV infection, we used the human CRISPR KO pooled library (GeCKO v2) [20] and HeLa-N cells, which are highly susceptible to SAFV infection [19], along with the JPN08-404 strain of SAFV-3. To strengthen the reliability of the screening, we conducted two independent screens using separately established HeLa-N KO cell libraries. We isolated six candidate genes that are essential host factors for SAFV infection. However, it is important to note that the number of surviving cells following SAFV infection was very low in both screens, suggesting the possibility of multiple pathways being involved in infection. Notably, three of these genes are involved in the synthesis of sulfated GAGs, including the genes required for the synthesis of heparan sulfate (HS) substrates (uridine diphosphate glucose dehydrogenase, UGDH ), elongation of the HS chain (exostosin-2, EXT-2 ), and transport of the sulfate donor 3′-phosphoadenosine-5′-phosphosulfate (solute carrier family 35 member B2, SLC35B2 ), which was isolated on both screens (Fig. 1 a). To determine whether or not sulfated GAGs are critical for SAFV infection, we established SLC35B2 KO and EXT1 KO HeLa-N cell lines (HeLaN-∆SLC and HeLaN-∆EXT1, respectively) and confirmed that HS was absent on the surface of these cells and that frameshift mutations were introduced in the target region (Fig. 1 b and Extended Data Fig. 1 ). We examined the susceptibility of these cells to SAFV-3 infection by inoculating them with serially diluted viruses. The susceptibility of HeLaN-∆SLC cells to SAFV-3 was reduced by 3-log compared to that of wild-type (WT) cells, yet HeLaN-∆SLC cells were still eradicated by high-titer viral inoculation (Fig. 1 c, upper panel). A similar reduction in SAFV-3 susceptibility in HeLaN-∆SLC cells was observed when they were infected with SAF/UnaG virus, a recombinant virus expressing the green fluorescent protein UnaG in infected cells [21] (Extended Data Fig. 3 ). In addition, the susceptibility of HeLaN-∆EXT1 cells to SAFV-3 was reduced by two logs compared to WT cells (Fig. 1 c, lower panel), suggesting that the decreased susceptibility caused by SLC35B2 KO was largely due to the deletion of sulfated GAGs, particularly HS proteoglycans. Next, we assessed the growth kinetics of SAFV-3 in HeLaN-∆SLC and WT HeLa-N cells. Consistent with the reduced susceptibility of HeLaN-∆SLC cells, they also supported SAFV-3 infection and replication, albeit with approximately 2-log lower efficiency than that of WT cells (Fig. 1 d). These findings indicate that sulfated GAGs are required for efficient SAFV-3 infection, but strongly suggest the further presence of another major receptor that functions in cooperation with sulfated GAGs or independently of them. Identification of integrin a V and integrin b 8 as critical factors for SAFV-3 infection To identify the major receptors for SAFV-3 infection other than sulfated GAGs, we conducted a second genome-wide CRISPR screening using HeLaN-∆SLC cells with two SAFV-3 strains (JPN08-404 and JPN08-356). The top two most enriched candidate genes identified in both screens were ITGAV and ITGB8 genes, which encode the integrin subunits aV and b8, respectively (Fig. 2 a), and their products form integrin aVb8 heterodimer. These two genes were significantly enriched, prompting us to focus on ITGAV and ITGB8 in further studies. To verify the role of integrin aVb8 in SAFV infection, we knocked out ITGAV or ITGB8 in WT and HeLaN-∆SLC cells (resulting in HeLaN-∆AV, HeLaN-∆B8, HeLaN-∆SLC∆AV, and HeLaN-∆SLC∆B8 cells) and established KO clones, in which the loss of target gene expression on the cell surface was validated, and frameshift mutations were confirmed (Fig. 2 b and Extended Data Figs. 1 and 2 ). First, we examined their susceptibility to SAFV-3 by inoculating cells with serially diluted viruses (Fig. 2 c). Although HeLaN-∆AV and HeLaN-∆B8 cells were eradicated by high-titer viral inoculation, their susceptibility to SAFV-3 was 3-log lower than that of WT. In contrast, HeLaN-∆SLC∆AV and HeLaN-∆SLC∆B8 cells were completely resistant to SAFV-3 even at the highest viral multiplicity of infection (MOI). Two additional clones from each KO cell line showed similar susceptibility to SAFV-3 (Extended Data Fig. 2 b). When infected with the SAF/UnaG virus, UnaG-positive cells were detected in HeLaN-∆AV and HeLaN-∆B8 cells, albeit at a lower frequency than in WT, whereas no UnaG-positive cells were observed in HeLaN-∆SLC∆AV and HeLaN-∆SLC∆B8 double KO cells (Extended Data Fig. 3 ). Next, we assessed the growth kinetics of SAFV-3 in HeLaN-∆B8 single-KO and HeLaN-∆SLC∆B8 double-KO cells. As shown in Fig. 2 d, viral growth in HeLaN-∆B8 cells was considerably reduced, exhibiting delayed replication and decreased titers; viral growth still occurred, similar to that was observed in HeLaN-∆SLC cells. In contrast, no viral growth was detected in the HeLaN-∆SLC∆B8 cells (Fig. 2 d). These results indicated that in HeLa-N cells, knocking out either SLC35B2 or integrin alone retained some susceptibility to SAFV-3. However, knocking out ITGAV or ITGB8 in addition to SLC35B2 resulted in a complete loss of susceptibility to SAFV-3. This suggests that the sulfated GAG-dependent and integrin aVb8-dependent pathways function in parallel for SAFV-3 infection. In our previous study, we reported that HeLa cells obtained from RIKEN BRC (RCB0007, referred to as HeLa-R) showed low susceptibility to SAFV-3 infection [19]. When we assessed the expression of HS and integrin aVb8 on the surface of HeLa-R cells, we found that the amount of HS was extremely low compared to that in HeLa-N cells, whereas integrin aVb8 expression was comparable (Extended Data Fig. 4 ). This result suggests that the low susceptibility of HeLa-R cells to SAFV-3 is due to the low expression of HS on the cell surface and that efficient SAFV-3 infection requires sufficient expression of both HS and integrin aVb8. Expression of integrin a V b 8 confers susceptibility to SAFV-3 in BHK-21 cells BHK-21 cells are resistant to SAFV-3 infection, even at a high MOI, but can produce progeny viruses when transfected with infectious SAFV-3 RNA [21]. This suggests that BHK-21 cells lack the key host factors involved in the attachment, internalization, or uncoating of SAFV-3. We hypothesized that if integrin aVb8 is a missing factor, expressing it would confer SAFV-3 susceptibility to BHK-21 cells. First, we analyzed the expression of integrins aV and b8 in BHK-21 cells. As antibodies to hamster integrins aV and b8 for flow cytometry were not available, we employed Western blotting using anti-human integrin aV and anti-mouse integrin b8 antibodies, which are cross-reactive to hamster integrins (Fig. 3 a). We detected endogenous hamster integrin aV, as well as exogenously expressed human integrin aV, but could not detect endogenously expressed hamster integrin b8, demonstrating that BHK-21 cells express integrin aV but not b8 at detectable levels. Flow cytometry showed that HS was abundantly present on the cell surface of BHK-21 cells (Fig. 3 b), indicating that sulfated GAGs alone were insufficient for SAFV-3 infection in these cells. Next, we exogenously expressed human integrin aV and/or b8 in WT BHK-21 cells via lentiviral transduction (Fig. 3 b) and assessed SAFV-3 susceptibility using the SAF/UnaG virus (Fig. 3 c). The expression of integrin b8 alone (BHK + human B8) conferred susceptibility to SAFV-3 in BHK-21 cells, whereas the expression of integrin aV alone (BHK + human AV) did not. The co-expression of integrin aV and b8 (BHK + human AVB8) further increased SAFV-3 susceptibility in BHK-21 cells. Finally, we examined the growth kinetics of SAFV-3 in integrin-expressing BHK-21 and control cells. No viral growth was observed in control or BHK + human AV cells. However, drastic viral growth was observed in BHK + human B8 and BHK + human AVB8 cells (Fig. 3 d). These results confirmed that integrin aVb8 is a critical factor in SAFV-3 infection. Interestingly, integrin aVb8-expressing ∆SLC35B2 BHK-21 (BHK + human AVB8-∆SLC) cells exhibited lower susceptibility to SAFV-3 compared to BHK + human AVB8 cells. This decreased susceptibility to SAFV-3 was rescued by complementing SLC35B2 (Extended Data Fig. 5 ), suggesting that sulfated GAGs enhance integrin-mediated SAFV-3 infection in BHK-21 cells. SAFV-3 specifically utilizes integrin a V b 8 among the integrin a V subfamily for infection Integrin aV forms heterodimers with not only integrin b8 but also b1, b3, b5, and b6, constituting the integrin aV subfamily. Since some picornaviruses, such as foot-and-mouth disease virus (FMDV), utilize multiple members of the integrin aV subfamily as receptors, we investigated whether or not SAFV-3 can utilize other integrin b subunits besides b8 for infection. We generated BHK-21 cells co-expressing integrin aV with each b subunit (b1, b3, b5, or b6) by lentiviral transduction (Fig. 4 a) and assessed their susceptibility to SAFV-3 using the SAF/UnaG virus. No obvious increase in the number of UnaG-positive cells was observed in cells expressing b subunits other than b8 (Fig. 4 b). These results indicate that SAFV-3 specifically utilizes integrin aVb8 among the aV subfamily members for infection. Next, we explored whether the b subunit determines the species specificity of SAFV-3 infection by assessing SAFV-3 susceptibility of BHK-21 cells expressing hamster or mouse integrin b8 (Fig. 4 c), using SAF/UnaG virus (Fig. 4 d). We observed a remarkable increase in the number of UnaG-positive cells in both hamster and mouse integrin b8-expressing cells, comparable to those expressing human integrin b8. These data suggest that differences in integrin aVb8 among species do not determine the species specificity of SAFV-3 infection. HS, as the representative sulfated GAG, and integrin a V b 8 interact directly with SAFV-3 To determine whether SAFV-3 binds to sulfated GAGs and integrin aVb8 on the cell surface, we conducted a virus attachment assay using HeLaN-∆SLC, HeLaN-∆B8, HeLaN-∆SLC∆B8, integrin aVb8-overexpressing HeLaN-∆SLC (HeLaN-∆SLC + human AVB8), and WT HeLa-N cells. Flow cytometry confirmed the overexpression of integrin aVb8 in HeLaN-∆SLC + human AVB8 cells generated by lentiviral transduction (Extended Data Fig. 6 ). These cells were incubated with SAFV-3 at 4°C, and the viruses attached to the cells were quantified using quantitative reverse transcription polymerase chain reaction (RT-qPCR) (Fig. 5 a). The amount of virus attached to the cells was significantly reduced in HeLaN-∆SLC and HeLaN-∆SLC∆B8 cells but not in HeLaN-∆B8 cells, suggesting that sulfated GAGs play a major role in the attachment of SAFV-3 in HeLa-N cells, whereas integrin b8 plays a minor role. However, a significant increase in viral attachment was observed in HeLaN-∆SLC + human AVB8 cells, indicating that integrin aVb8 does indeed have the potential to bind to SAFV-3 on the cell surface. To confirm that sulfated GAGs and integrin aVb8 directly bind to SAFV-3, we first examined the effect of pretreating the viruses with soluble heparin, a structural analog of HS, on SAFV binding (Fig. 5 b). Pretreatment with soluble heparin strongly inhibited the binding of SAFV-3 to WT HeLa-N cells. Next, we assessed the effect of pretreatment with soluble integrin aVb8 on SAFV binding in HeLaN-∆SLC + human AVB8 cells (Fig. 5 c). Pretreatment with soluble integrin aVb8, but not soluble integrin aVb3, inhibited virus binding in a dose-dependent manner. These results indicate that both sulfated GAGs and integrin aVb8 mediate SAFV-3 attachment to the cell surface. To further clarify these interactions, we examined the direct binding of SAFV-3 to heparin and integrin aVb8 using a pull-down assay with biotinylated heparin and Fc-tagged soluble integrin aVb8, respectively. Western blotting detected SAFV-3 antigen in the sample pulled down by heparin beads (Fig. 5 d, left panel). Furthermore, the SAFV-3 antigen was detected in a Ca2+/Mg2+-dependent manner in the sample pulled down by the integrin aVb8 beads but not by the integrin aVb3 beads (Fig. 5 d, right panel). These data clearly demonstrate that SAFV-3 can directly bind to sulfated GAGs and integrin aVb8 at the cell surface. SAFV-3 binds to the RGD binding site of integrin a V b 8 Several picornaviruses use an RGD sequence in their capsid to bind to integrins during infection. Although SAFV-3 lacks an RGD sequence, it carries an RAD sequence in the puff A region of VP2, whereas SAFV-2 has an RLD sequence in the CD loop I of VP1 (Extended Data Fig. 7). These regions, referred to as loops and puffs, protrude from the surface of the virion. However, RAD is generally thought to reduce the integrin-binding affinity [22]. Since it is possible that the RAD sequence might still facilitate SAFV-3 binding to integrin aVb8, we first examined whether the RGD peptide, which masks the RGD-binding site on integrin aVb8, could block SAFV-3 infection using the SAF/UnaG virus. Pretreatment of HeLaN-ΔSLC with the RGD peptide clearly reduced the number of UnaG-positive cells in a dose-dependent manner (Fig. 5 e), suggesting that SAFV-3 interacts with integrin aVb8 through the RGD-binding site. To further verify this, we generated BHK-21 cells transiently expressing integrin b8 mutants (∆SDL, Y172N, and I208R), which are known to lose their ability to bind latent-TGF-β [23], and inoculated them with SAFV-3. No viral propagation was observed in BHK-21 cells expressing the b8 mutants, whereas robust viral propagation was detected in WT integrin b8-expressing cells (Fig. 5 f). These findings suggest that the SAFV-3-binding region of integrin aVb8 is indeed an RGD-binding site. Other clinical isolates and genotypes also utilize both sulfated GAGs and integrin a V b 8 To determine whether or not the parallel infection pathway mediated by sulfated GAGs and integrin aVb8 is commonly used for SAFV infection, we analyzed the infectivity of two additional clinical isolates of genotype 3 (JPN08-356 and 987/Niigata/2007) and one clinical isolate of genotype 2 (1801-Yamagata-2009) (Fig. 6 ). The infectivity of the JPN08-356 strain was reduced by two logs in HeLaN-∆SLC cells and by two logs in HeLaN-∆B8 cells compared to control (WT) cells. For the 987/Niigata/2007 strain, infectivity was 1 log lower in HeLaN-∆SLC cells and 3 logs lower in HeLaN-∆B8 cells than in WT cells. Similarly, the infectivity of SAFV-2 strain 1801-Yamagata-2009 was reduced by 3 logs in HeLaN-∆SLC cells and by 2 logs in HeLaN-∆B8 cells compared to WT cells. Notably, none of the strains were able to infect the HeLaN-∆SLC∆B8 cells. These results indicate that the infections of all strains examined in this study are mediated by both sulfated GAGs and integrin pathways, at least in genotypes 2 and 3. Discussion Virus-host interactions critical for SAFV pathogenicity remain largely unknown. In this study, our data showed that double KO of ITGAV or ITGB8 together with SLC35B2 led to a complete loss of susceptibility to SAFV-3. In contrast, KO of either SLC35B2 or integrin alone reduced susceptibility but did not result in complete resistance. Based on these findings, we proposed a model for SAFV infection mediated by two receptors functioning in parallel (Extended Data Fig. 8). Integrins function as heterodimers formed by combinations of a and b chains, with 18 known types of a chains, 8 types of b chains, and 24 confirmed ab heterodimers on cell membranes [24]. Integrin aV is the most versatile subunit among a chains, forming heterodimers with five types of b subunits (b1, b3, b5, b6 or b8). Our study demonstrated that SAFV specifically utilizes integrin aVb8 for infection, distinguishing it from many other viruses that can interact with multiple b subunits. For example, parechovirus A1 (PeV-A1) uses aVb1, aVb3, and aVb6 [25–27], coxsackievirus A9 (CVA9) uses aVb3 and aVb6 [28, 29]; and FMDV uses aVb1, aVb3, aVb6, aVb8, and a5b1 as receptors [30, 31]. In addition, our results showed that both mouse and hamster integrin b8 functions as receptors for SAFV infection, similar to human integrin b8 (Fig. 4 b), suggesting that the differences in integrin β8 are not a determinant of species specificity. Other unknown factors may also determine the species specificity of SAFV infections. Integrin heterodimers containing the aV subunit (aVb1, aVb3, aVb5, aVb6, aVb8) are known as ‘RGD receptors’ due to their ability to bind to proteins with an RGD motif, such as vitronectin and fibronectin [32, 33]. Recently, sialylated integrins (aXb2 and aMb2) have been identified as receptors for TMEV-DA strain infection [34]. FMDV utilizes the five types of integrin heterodimers described above, and for both TMEV-DA and FMDV, the RGD motif on the protruding loop of the capsid protein plays a key role in integrin binding [30, 34]. Similar RGD motif-dependent interactions between virions and integrins have also been observed in PeVA1 and CVA9 [25–29]. However, the capsid protein of SAFV-3 lacks an RGD motif. Our data from the RGD peptide-blocking assay and integrin b8 mutant analysis clearly demonstrated that the virus-binding region of integrin aVb8 is the RGD-binding site (Fig. 5 e, f). RGD-like sequences (e.g. RAD, RLD, or an alternative sequence) in the capsid protein of SAFV may be responsible for generating an integrin aVb8-specific interaction. Further studies using mutant viruses are required to resolve this issue. Cell surface sulfated GAGs, including HS, are ubiquitous negatively charged molecules that are commonly used by many viruses as attachment and entry receptors [35–37]. In HeLa-N cells, KO of SLC35B2 resulted in reduced susceptibility to SAFV infection (Fig. 1 c, d). BHK-21 cells, which express HS on their surface, were not susceptible to SAFV (Fig. 3 c, d), indicating that binding to HS alone is insufficient for SAFV infection. Given that SAFV-3 infection still occurred through sulfated GAGs even in integrin-deficient HeLa-N cells (Fig. 2 c, d), this suggests the presence of additional factor X involved in the post-adsorption process in the sulfated GAGs-mediated pathway of SAFV infection in HeLa-N cells, but not in BHK-21 cells. Identifying this factor, which operates downstream of the interaction between SAFV and sulfated GAGs but is independent of integrin aVb8, remains an important future research focus (Extended Data Fig. 8). In summary, this study identified two key receptors for SAFV infection: integrin aVb8 and sulfated GAGs and demonstrated that they function in parallel. Our findings suggest that sulfated GAGs primarily serve as attachment receptors, whereas other factors, including integrin aVb8, play a role in the subsequent process. Although integrin aVb8 is clearly involved in attachment, its role in the later stages of infection, such as entry and uncoating, remains unclear. Further elucidation of these mechanisms is essential for a deeper understanding of SAFV pathogenesis. Declarations Acknowledgements This work was supported by JSPS KAKENHI (Grant Number 21K07045) from the Japan Society for the Promotion of Science, Grant for Promoted Research from Kanazawa Medical University (S2023-4), Grant for Assistance KAKEN from Kanazawa Medical University (K2024-3), and a grant from Yakult Honsha Co., Ltd. We thank Dr. Hiroyuki Shimizu from the National Institute of Infectious Diseases, Dr. Katsumi Mizuta from Yamagata Prefectural Institute of Public Health, and Dr. Chika Hirokawa from the Niigata Prefectural Institute of Public Health and Environmental Sciences for kindly providing the clinical isolate of SAFV. We thank Ms. Sumie Saito for technical assistance. We extend special thanks to Dr. Yoshiro Ohara for his support as an observer. Author’s contributions TO established the cell lines and performed the virological experiments. TH made a proposal for this study, performed virological experiments, and wrote the manuscript. KK and NN performed genome-wide gene-KO screening. KU supported the various experiments. SK supervised the design of this study and performed virological experiments. AN supported the analysis of viral binding to integrins through computer simulations. MH established the cell lines, was responsible for budget execution, and edited the final version of the manuscript. All authors have read and approved the final manuscript. Competing interests The authors declare that they have no competing interests. Methods Cells HeLa-N is a HeLa subline that is highly susceptible to SAFV-3, whereas HeLa-R is a less susceptible subline obtained from RIKEN BRC (RCB0007) [19]. HeLa-N and 293T [38] cells were maintained in Dulbecco's modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 10% fetal calf serum (FCS) containing 100 U/ml penicillin and 100 mg/ml streptomycin. HeLa-R cells were maintained in Eagle’s minimum essential medium (MEM, Nissui) supplemented with 10% calf serum (CS) and 0.03% l-glutamine. BHK-21 (C-13) was obtained from JCRB Cell Bank (JCRB9020). BHK-21[39] and BHK-21 (C-13) cells were maintained in MEM supplemented with 5% CS and 0.03% l-glutamine. Caco-2 cells [40] were maintained in MEM with 20% FCS, 0.03% l-glutamine, and 0.1 mM non-essential amino acids (Gibco). RD-18S-Niigata (RD-18S-N) [41] cells were maintained in MEM with 8% FCS, 0.03% l-glutamine, and 0.5% Fangizon. All cell lines were incubated at 37 °C in a 5% CO 2 atmosphere. Viruses SAFV genotype 3 (SAFV-3) was prepared from the infectious cDNA clone pSAF404 derived from the JPN08-404 strain [7]. The virus was propagated in HeLa-N cells, and the sequence of the viral RNA was confirmed to be identical to that of the pSAF404 cDNA clone. The other SAFV-3 strains used in this study were as follows: JPN08-356, isolated from pharyngeal swabs and kindly provided by Dr. Hiroyuki Shimizu at the National Institute of Infectious Diseases; and 987/Niigata/2007 [6], isolated from cerebrospinal fluid and kindly provided by Dr. Chika Hirokawa at the Niigata Prefectural Institute of Public Health and Environmental Sciences. These viruses were also propagated in HeLa-N cells. The SAFV-2 isolate (1801-Yamagata-2009), isolated from pharyngeal swabs, was kindly provided by Dr. Katsumi Mizuta at the Yamagata Prefectural Institute of Public Health and propagated in RD-18S-N cells [41, 42]. Viral titers were determined using a standard plaque assay in HeLa-N cells. Genome-wide CRISPR-Cas9 knockout screen We screened the genes required for SAFV-3 infection using a previously described method, with some modifications [20]. In brief, for genome-wide CRISPR-Cas9 knockout (KO) screening, we used the GeCKO v2.0 two-vector system (Addgene #1000000049). HeLa-N and HeLaN-∆SLC cells were stably transduced with lentiCas9-Blast (Addgene #52962) and subsequently selected in a medium containing 4 mg/ml Blasticidin S for 7 days. Next, 210 million HeLa-N and HeLaN-∆SLC cells constitutively expressing Cas9 were transduced with lentiGuide-Puro from the human CRISPR KO pooled lentiviral library at a multiplicity of infection (MOI) of 0.3 in the presence of 8 mg/ml polybrene. The cells were then selected with 1 mg/ml puromycin for 7 days. For CRISPR screening, 30 million cells were infected with SAFV-3 (JPN08-404 strain and JPN08-356 strain) at a high MOI, causing 95% CPE in untransduced HeLa-N cells within 24 hours and in untransduced HeLaN-∆SLC cells within 48 hours. Surviving cells were subjected to a second infection at high MOI. Genomic DNA was extracted from the pooled surviving cells using the Blood & Cell Culture DNA Maxi Kit (13362, Qiagen). The sgRNA sequences were amplified from the genomic DNA using NEBNext High-Fidelity 2× PCR Master Mix (M0541S, NEB) with 10 NGS-Lib-Fwd primers and 1 barcoded NGS-Lib-KO-Rev primer [20]. The PCR product was concentrated by isopropanol precipitation and electrophoresed on a 3% agarose gel. DNA between 200 and 300 base pairs was extracted using a QIAquick Gel Extraction Kit (28704, Qiagen) and further purified with AMPure XP (A63880, Beckman Coulter). Sequencing of the PCR products was performed using next-generation sequencing (NGS; Illumina MiSeq instrument; Illumina). Acquired fastq files were cleaned by trimming and removing low-quality reads using the Prinseq software program, version 0.20.4 (http://prinseq.sourceforge.net/index.html). Count data for sgRNA were extracted from fastq files using count_spacers.py [20]. Because six sgRNAs were designed for each gene in the GeCKO library, we searched for genes for which the number of remaining sgRNAs were significantly different between uninfected samples and those infected with SAFV-3. To achieve this, the edgeR included in the TCC R package was used [43]. Lentiviral transduction For lentivirus production, 293T cells were transfected with the lentiviral plasmid and packaging plasmids (pCAG-HIVgp and pCMV-VSV-G-RSV-Rev from RIKEN BRC) using PEI max transfection reagent (24765, Polysciences), and cultured for 72 hours. The resulting lentivirus-containing culture supernatant was added to the target cells with 8 mg/ml polybrene. The cells were then cultured in selection medium supplemented with the appropriate antibiotics: 1 mg/ml puromycin (ant-pr-1, Invivogen), 1 mg/ml G418 (074-05963, Fujifilm Wako Pure Chemical), and 10 mg/ml Blasticidin S (ant-bl-1, Invivogen) for HeLa-N, and 20 mg/ml Blasticidin S, 800 mg/ml G418, and 400 mg/ml Zeocin (R25001, Thermo Fisher Scientific) for BHK-21 cells. Establishment of KO cell lines To establish the SLC35B2 KO cell lines (HeLaN-∆SLC and BHK-∆SLC), the pGuide-it-ZsGreen1 plasmid (632601, Takara Bio) containing human (5′- AGAGTGATGACCCGCAGCTA -3′) or hamster (5′- GCTCGCCGCGCTCCCGTCTT -3′) SLC35B2 sgRNA sequences was transfected into HeLa-N and BHK-21 cells, respectively, using Lipofectamine 2000 transfection reagent (11668019, Thermo Fisher Scientific). For the EXT1 KO HeLa cell line (HeLaN-∆EXT1), the pGuide-it-ZsGreen1 plasmid containing the EXT1 sgRNA sequence (5’- CGCAGAGCGTCCGGGAAGCG -3’) was used. Forty-eight hours after transfection, ZsGreen-positive cells were sorted using an SH800 cell sorter (SONY) and cloned using limiting dilution. ∆SLC and ∆EXT1 clonal cells were assessed for HS expression on the cell surface by flow cytometry (see below). The genomic DNA surrounding the target sequence was PCR-amplified and sequenced using Sanger sequencing. Chromatograms were analyzed using DECODR v3.0 [44] (https://decodr.org/) and TIDE [45] (https://tide.nki.nl/). To establish ITGAV and ITGB8 KO cell lines (HeLaN-∆AV, HeLaN-∆B8, HeLaN-∆SLC∆AV, and HeLaN-∆SLC∆B8), sgRNA sequences ( ITGAV : 5′- AAATTCCAATGGATCATCCT -3′, ITGB8 : 5′- CAAATGCAGCATCCTGTGCC -3′) were cloned into lentiGuide-Puro (Addgene #52963). The lentivirus was added to Cas9-expressing HeLa-N and HeLaN-∆SLC cells, which were cultured in a selection medium containing 1 mg/ml puromycin for 7 days and then cloned by limiting dilution. To confirm the depletion of integrins, cell surface expression was examined by flow cytometry (see below). Genomic DNA surrounding the target sequence was PCR-amplified and analyzed as described above. Flow cytometry Cells were detached using Accutase (12679-54, Nacalai Tesque) and incubated with primary antibodies for 30 minutes on ice, followed by incubation with secondary antibodies for an additional 30 minutes on ice, if required. The cells were analyzed using FACS Canto II (BD Biosciences) and the WinMDI software program. To detect HS, cells were stained with biotinylated mouse anti-heparan sulfate antibody (10E4 epitope) (370255-B, amsbio) or biotinylated mouse IgMk Isotype control (401621, BioLegend), followed by PE-streptavidin (405203, BioLegend) staining. For the detection of integrin aV, b1, b3, b5, and b6, cells were stained with PE-conjugated antibodies against CD51 (integrin aV) (327910, BioLegend), CD29 (integrin b1) (303003, BioLegend), CD61 (integrin b3) (336405, BioLegend), and integrin b5 (345203, BioLegend), as well as an APC-conjugated antibody against integrin b6 (FAB4155A, R&D Systems). PE-conjugated mouse IgG1k (981804, BioLegend) and IgG2ak (400213, BioLegend) isotype-matched antibodies were used as the controls. For integrin b8 detection, cells were stained with anti-integrin aVb8 (clone EM13309) (ZRB1192, Sigma Aldrich), followed by PE-conjugated donkey anti-rabbit IgG secondary antibody (406421, BioLegend). A Rabbit Polyclonal Isotype antibody (910801, BioLegend) was used as the control. Cloning Total RNA was extracted from HeLa-N, Caco-2, and BHK-21 (C-13) cells using an RNeasy Mini Kit (74104, Qiagen) following the manufacturer's instructions. cDNAs for human ITGAV and ITGB8 from HeLa-N, human ITGB1 and ITGB5 from Caco-2, and hamster Itgb8 from BHK-21 (C-13) cells were synthesized and amplified using the PrimeScript II High Fidelity One Step RT-PCR Kit (R026A, Takara Bio). cDNAs for human ITGB3 and ITGB6 and mouse Itgb8 were PCR-amplified from plasmids MHS6278-211691048, MHS6278-211690966, and MMM1013-211691535, respectively (Horizon). The cDNAs were subsequently cloned into the pENTR-2B or pENTR/D-TOPO vector (K240020SP, Thermo Fisher Scientific) and transferred to the lentiviral expression vectors CSII-EF-IN-RfA [18] or CSII-EF-IB-RfA [38] using LR Clonase (11791020, Thermo Fisher Scientific). SLC35B2 cDNA was amplified from Caco-2 RNA and ligated into CSII-PGK-IZ, in which the human PGK promoter and IRES-Zeocin resistance gene cassette were assembled into the backbone of the lentiviral vector plasmid CS-CDF-CG-PRE (RIKEN BRC). Fc-tagged integrins, consisting of the extracellular domains of integrin aV, b8, or b3 fused to the mouse IgG2a Fc tag from pFUSEss-CHIg-mG2a_M18 (105930, Addgene), were cloned into the pENTR-2B vector and subsequently transferred to the expression vector pEFneo-RfA [46] using LR Clonase, resulting in pEFneo-ITGaV-Fc, pEFneo-ITGb8-Fc, and pEFneo-ITGb3-Fc. pEFneo-ss-Fc containing only the signal sequence (ss) of integrin αV was constructed in the same manner. Full-length cDNA of human ITGB8 and ITGB3 with a FLAG tag at the 3’ end was cloned into Eco RI site of pCAGGS-PUR (pCAG-hITGb8-F and pCAG-hITGb3-F) [47]. Mutations that disrupt the RGD binding site (DSDL, Y172N and I208R) are described in ref. 23. The same mutations were introduced in pCAG-hITGb8-F. Viral susceptibility analysis To examine the susceptibility of KO cell lines to SAFV-3 (cDNA-derived JPN08-404) and SAFV clinical isolates, 50 ml of 10-fold serial dilutions of viruses and 100 ml of 5 × 10 3 cells were added to each well of uncoated or collagen-coated 96-well plates and incubated at 37 °C with 5% CO 2 for 6 days. The cells were subsequently fixed with 10% neutral-buffered formalin and stained with 1% crystal violet/20% methanol solution. To assess susceptibility to SAFV, 4 × 10 5 cells were seeded in collagen-coated 6-well plates and incubated at 37 °C for at least 24 hours. The cells were then washed with phosphate-buffered saline (PBS) (-) and inoculated with 200 ml of SAF/UnaG (8 × 10 6 PFU/well) for 1 hour at 37 °C with 5% CO 2 . After inoculation, the cells were washed with serum-free DMEM and incubated at 37 °C in 1 mL 1% FCS DMEM. At 16 hours post-infection, the expression of UnaG in the infected cells was captured by fluorescence microscopy, with nuclear staining using Hoechst 33342. For BHK-21 and its derivatives, 50 ml of SAF/UnaG virus (2 × 10 5 PFU/well diluted in 5% CS MEM) and 100 ml of 2 × 10 4 cells were added to each well of 96-well plates and incubated at 37 °C. After 16 hours of incubation, UnaG expression in the infected cells was captured by fluorescence microscopy, with nuclear staining using Hoechst 33342 when necessary. The number of UnaG-positive cells was quantified using the ImageJ software program. The PFU values of viral titers shown in the experiments using BHK-21 cells were determined in HeLa-N cells. Viral growth kinetics To measure SAFV-3 growth in HeLa-N and its derivatives, cells were seeded at a density of 1 × 10 5 cells/well in 24-well plates and cultured for 1 day. Cells were then inoculated with SAFV-3 at 1 × 10 4 PFU/well and incubated at 37 °C with 5% CO 2 for 0, 1, 2, 3, 4, or 5 days before collection. Samples were prepared by subjecting the cells to three freeze-thaw cycles to release virions, followed by centrifugation to remove cell debris. Viral titers were determined in HeLa-N cells by the 50% tissue culture infectious dose (TCID 50 ) assay using the Kärber method [48]. For BHK-21 and its derivatives, cells were seeded at a density of 4 × 10 5 cells/well in 6-well plates and cultured for 1 day. After washing the cells with PBS (-), they were inoculated with 200 ml of SAFV-3 (8 × 10 6 PFU/well) and incubated for 1 hour at 37 °C with 5% CO 2 . After inoculation, the cells were washed twice with PBS (-) and incubated at 37 °C in 1 mL of 1% CS MEM. The cells and supernatants were collected at 0, 3, 6, 12, and 24 hours post-infection. Samples were prepared by three freeze-thaw cycles and centrifuged to remove cell debris. Viral titers were determined using a standard plaque assay with HeLa-N cells. The PFU values were used in the experiment using BHK-21 cells, as described above. Western blotting Cells were lysed using 1× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample loading buffer (786-701, G-Biosciences), supplemented with 2-mercaptoethanol and complete mini protease inhibitor cocktail tablets (11836153001, Roche) and boiled for 5 minutes. Samples were separated by SDS-PAGE using 10%–20% Extra PAGE One precast gels (13068-24, Nacalai Tesque) and transferred onto a polyvinylidene difluoride (PVDF) membrane (Trans-Blot Turbo Mimi PVDF Transfer Packs; 1704156, Bio-Rad Laboratories) using the Trans-Blot Turbo Transfer System (1704150, Bio-Rad Laboratories). The membrane was blocked with 5% skim milk in TBS-T (T9142, Takara Bio) and incubated with primary and secondary antibodies. The antibodies used were rabbit anti-integrin aV polyclonal antibody (27096-1-AP, Proteintech), rabbit anti-integrin b8 (D1V7M) monoclonal antibody (88300, Cell Signaling Technology), rabbit-anti-integrin aVb8 monoclonal antibody (clone EM13309), rabbit-anti-integrin aVb3 monoclonal antibody (clone EM22703) (ZRB1190, Sigma-Aldrich), mouse anti-actin (AC-40) monoclonal antibody (A3853, Sigma Aldrich), rabbit anti-SAFV-3 antiserum [19], and horseradish peroxidase-conjugated anti-mouse or rabbit IgG (170-6516 and 170-6515, respectively, Bio-Rad Laboratories). Signals were detected using the ECL prime Western blotting detection reagent (RPN2236, Cytiva). Viral attachment and inhibition assay Cells were seeded at 5 × 10 4 cells/well in 24-well plates and cultured for 2 days. The cells were then incubated with SAFV-3 (2 × 10 6 PFU/well) at 4 °C for 2 hours to allow viral attachment. Following adsorption, the cells were washed three times with cold DMEM containing 10% FCS to remove unbound viruses. Total RNA was extracted using the RNeasy Mini Kit and bound viral RNA was quantified by RT-qPCR. For the viral binding inhibition assay, SAFV-3 (1 × 10 6 PFU/well) was pretreated with either 1 mg or 10 mg of heparin sodium salt (17513-96, Nacalai Tesque), or recombinant human integrin aVb8 (4135-AV, R&D Systems). Recombinant human integrin aVb3 (3050-AV, R&D Systems) was used as a negative control. The mixtures were incubated at 4 °C for 2 hours and then inoculated into cells that had been pre-seeded in 24-well plates. After adsorption at 4 °C for 2 hours, the cells were washed three times with cold DMEM containing 10% FCS. Total RNA was extracted, and bound viral RNA was quantified by RT-qPCR. cDNA was synthesized using PrimeScript RT Master Mix (RR036A, Takara Bio), and quantification was performed using THUNDERBIRD SYBR qPCR Mix (QPS-201, Toyobo). The following primers were used: SAFV forward primer, 5′-TGTAGCGACCTCACAGTAGCAG-3′, and SAFV reverse primer, 5′-AGGACATTCTTGGCTTCTCTACCG-3′. For the blocking assay using RGD peptide, cells were seeded at 1.5 × 10 4 cells/well in 48-well plates and cultured for 2 days. The cells were pre-incubated with the GRGDS synthetic peptide (4189, Peptide institute) at 4 °C for 30 minutes and then 50 ml of SAF/UnaG (5,000 UnaG-positive units in HeLaN-∆SLC+human AVB8 cells) was added and incubated at 37 °C for 1 hour (total volume of 300 ml). The cells were subsequently washed three times with DMEM containing 10% FCS and incubated in growth medium at 37 °C for 10 hours. UnaG expression in infected cells was captured by fluorescence microscopy with nuclear staining using Hoechst 33342. The number of UnaG-positive cells was quantified using the ImageJ software program. Integrin b 8 mutant analysis BHK-21 cells (1 × 10 5 cells/well) were seeded in 24-well plates. The next day, the plasmids expressing WT human integrin b8, pCAG-hITGb8-F, and its mutants, pCAG-hITGb8-DSDL, pCAG-hITGb8-Y172N, pCAG-hITGb8-I208R, and pCAG-hITGb3-F as a negative control (0.5mg/well) were transfected in triplicate using FuGENE HD (E2311, Promega). One day after transfection, SAFV (1 × 10 4 PFU/well) was inoculated for 2 hours, and washed once, and then fresh medium was added and incubated at 37 °C. The cells and supernatants were frozen two days later, and viral titers were determined. Pull-down assay To prepare heparin-biotin-streptavidin (SA)-magnetic bead complexes, 50 ml of SA-magnetic beads (S1420, NEB) were incubated with 400 mg (25 ml) of biotinylated heparin (B9806, Sigma Aldrich) at 4 °C for 1 hour with rotation. For the pull-down of SAFV-3 by heparin, SAFV-3 (1 × 10 6 PFU) was mixed with 50 ml of heparin-biotin-SA-beads or biotin-SA-beads without heparin (negative control). The mixture was incubated at 4 °C for 1 hour with rotation. After incubation, the beads were washed three times with 0.1% BSA-PBS (-). The precipitates were boiled in 2× SDS-PAGE sample loading buffer and subjected to a Western blot analysis using an anti-SAFV-3 antiserum. To prepareFc-tagged integrin beads, 293T cells were transfected with pEFneo-ss-Fc, pEFneo-ITGaV-Fc, pEFneo-ITGb8-Fc, or pEFneo-ITGb3-Fc in the selected combinations using PEI max. After 4 hours of incubation, the medium was replaced with 2 ml of 1% FCS-DMEM per well. Seventy-two hours after transfection, the culture supernatants containing soluble Fc-tagged integrins were harvested. A total of 200 ml of the supernatant was incubated with 20 ml of protein A magnetic Dynabeads (10002D, Thermo Fisher Scientific) at 4 °C for 2 hours with rotation. The integrin-Fc-bead complexes were washed three times with 0.5% BSA-PBS (-). The binding of Fc-tagged integrin aVb8 or aVb3 to the beads was confirmed by Western blotting using a horseradish peroxidase-conjugated anti-mouse IgG antibody under both reducing and non-reducing conditions. For the pull-down of SAFV-3 by integrins aVb8 and aVb3, half of the prepared integrin-Fc-bead complexes were suspended in 1 ml of 0.5% BSA-PBS, with or without 1.5 mM CaCl 2 and 1 mM MgCl 2 (PBS(-) or (+)), and mixed with SAFV-3 (1 × 10 6 PFU). The mixture was incubated at 4 °C for 2 hours with rotation. After incubation, the beads were washed three times with 0.5% BSA-PBS (-) or 0.5% BSA-PBS (+) and once with PBS (-) or PBS (+), respectively. The precipitates were boiled in 2× SDS-PAGE sample loading buffer and subjected to a Western blot analysis using an anti-SAFV-3 antiserum. The ss-Fc beads were used as negative controls. Statistical analysis Data were analyzed for statistical significance using one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test and two-sided Welch’s t-test. A P-value of < 0.05 or < 0.01 was considered statistically significant or highly significant. The GraphPad Prism software program, version 7 (GraphPad Software) was used for all statistical analyses. References Zoll J et al (2009) Saffold virus, a human Theiler's-like cardiovirus, is ubiquitous and causes infection early in life. PLoS Pathog 5:e1000416 Liang Z, Kumar AS, Jones MS, Knowles NJ (2008) Lipton H. L. Phylogenetic analysis of the species Theilovirus: emerging murine and human pathogens. J Virol 82:11545–11554 International Committee on Taxonomy of Viruses (ICTV) (2024) https://ictv.global/taxonomy (accessed on 3 Jones MS, Lukashov VV, Ganac RD, Schnurr DP (2007) Discovery of a novel human picornavirus in a stool sample from a pediatric patient presenting with fever of unknown origin. J Clin Microbiol 45:2144–2150 Naeem A et al (2014) Genetic diversity of circulating Saffold Viruses in Pakistan and Afghanistan. J Gen Virol 95:1945–1957 Ugai S et al (2019) Clinical characteristics of Saffold virus infection in children. Pediatr Infect Dis J 38:781–785 Himeda T et al (2011) The preparation of an infectious full-length cDNA clone of Saffold virus. Virol J 8:110 Nielsen TS et al (2016) Saffold virus infection associated with human myocarditis. J Clin Virol 74:78–81 Ito H et al (2017) Saffold cardiovirus infection in a 2-year-old boy with acute pancreatitis. Jpn J Infect Dis 70:105–107 Nielsen ACY et al (2012) Serious invasive Saffold virus infections in children, 2009. Emerg Infect Dis 18:7–12 Zhang XA et al (2015) Prevalence and genetic characteristics of Saffold cardiovirus in China from 2009 to 2012. Sci Rep 5:7704 Mullapudi E et al (2016) Structure and genome release mechanism of the human cardiovirus Saffold virus 3. J Virol 90:7628–7639 Dudek AM et al (2020) GPR108 is a highly conserved AAV entry factor. Mol Ther 28:367–381 Karakus U et al (2019) MHC class II proteins mediate cross-species entry of bat influenza viruses. Nature 567:109–112 Zhang R et al (2018) Mxra8 is a receptor for multiple arthritogenic alphaviruses. Nature 557:570–574 Park RJ et al (2017) A genome-wide CRISPR screen identifies a restricted set of HIV host dependency factors. Nat Genet 49:193–203 Haga K et al (2016) Functional receptor molecules CD300lf and CD300ld within the CD300 family enable murine noroviruses to infect cells. Proc . Natl . Acad . Sci . U . S . A . 113, E6248–E6255 Watanabe K et al (2023) Myeloid-associated differentiation marker is an essential host factor for human parechovirus PeV-A3 entry. Nat Commun 14:1817 Himeda T, Hosomi T, Okuwa T, Muraki Y, Ohara Y (2013) Saffold virus type 3 (SAFV-3) persists in HeLa cells. PLoS ONE 8:e53194 Joung J et al (2017) Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat Protoc 12:828–863 Okuwa T, Himeda T, Utani K, Higuchi M (2023) Generation of a recombinant Saffold Virus expressing UnaG as a marker for the visualization of viral infection. Virol J 20:175 van der Most RG, Corver J, Strauss JH (1999) Mutagenesis of the RGD motif in the yellow fever virus 17D envelope protein. Virology 265:83–95 Campbell MG et al (2020) Cryo-EM Reveals Integrin-Mediated TGF-β Activation without Release from Latent TGF-β. Cell 180:490–501 Rothman JE (2022) The gripping story of integrins. Cell 185:3844–3848 Pulli T et al (1997) Cell-surface interactions of echovirus 22. J Biol Chem 272:21176–21180 Seitsonen J et al (2010) Interaction of aVb3 and aVb6 integrins with human parechovirus 1. J Virol 84:8509–8519 Triantafilou K, Triantafilou M, Takada Y, Fernandez N (2000) Human parechovirus 1 utilizes integrins aVb3 and aVb1 as receptors. J Virol 74:5856–5862 Roivainen M et al (1994) Entry of coxsackievirus A9 into host cells: specific interactions with avb3 integrin, the vitronectin receptor. Virology 203:357–365 Williams ÇH et al (2004) Integrin aVb6 is an RGD-dependent receptor for coxsackievirus A9. J Virol 78:6967–6973 Wang G et al (2015) How foot-and-mouth disease virus receptor mediates foot-and-mouth disease virus infection. Virol J 12:9 Jackson T et al (2000) Foot-and-mouth disease virus is a ligand for the high-affinity binding conformation of integrin a5b1: influence of the leucine residue within the RGDL motif on selectivity of integrin binding. J Gen Virol 81:1383–1391 Hussein HA et al (2015) Beyond RGD: virus interactions with integrins. Arch Virol 160:2669–2681 Barczyk M, Carracedo S, Gullberg D, Integrins (2010) Cell Tissue Res 339:269–280 Takeda K et al (2023) Chronic encephalomyelitis virus exhibits cellular tropism and evades pDCs by binding to sialylated integrins as the cell surface receptors. Eur J Immunol 53:e2350452 Cagno V et al (2019) Heparan sulfate proteoglycans and viral attachment: true receptors or adaptation bias? Viruses 11:596 Clausen TM et al (2020) SARS-CoV-2 infection depends on cellular heparan sulfate and ACE2. Cell 183:1043–1057 Ramos-Martínez IE et al (2022) Heparan Sulfate and Sialic Acid in Viral Attachment: Two Sides of the Same Coin? Int J Mol Sci 23:9842 Higuchi M et al (2007) Cooperation of NF-kB2/p100 activation and the PDZ domain binding motif signal in human T-cell leukemia virus type 1 (HTLV-1) Tax1 but not HTLV-2 Tax2 is crucial for interleukin-2-independent growth transformation of a T-cell line. J Virol 81:11900–11907 Taniura N, Saito M, Okuwa T, Saito K, Ohara Y (2009) Different subcellular localization of Theiler's murine encephalomyelitis virus leader proteins of GDVII and DA strains in BHK-21 cells. J Virol 83:6624–6630 Watanabe K, Oie M, Higuchi M, Nishikawa M, Fujii M (2007) Isolation and characterization of novel human parechovirus from clinical samples. Emerg Infect Dis 13:889–895 Itagaki T et al (2018) Detection of Saffold viruses from children with acute respiratory infections in Yamagata, Japan, between 2008 and 2015. J Med Virol 90:34–40 Aoki Y et al (2015) Isolation of Saffold virus type 2 from children with acute respiratory infections by using the RD-18S-Niigata cell line. Jpn J Infect Dis 68:438–441 Sun J, Nishiyama T, Shimizu K, Kadota K (2013) TCC: an R package for comparing tag count data with robust normalization strategies. BMC Bioinformatics 14:219 Bloh K et al (2021) Deconvolution of complex DNA repair (DECODR): Establishing a novel deconvolution algorithm for comprehensive analysis of CRISPR-edited sanger sequencing data. CRISPR J 4:120–131 Brinkman EK, Chen T, Amendola M, van Steensel B (2014) Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 42:e168 Isogawa M et al (2008) Rearranged NF-kB2 gene in an adult T-cell leukemia cell line. Cancer Sci 99:792–798 Hatakeyama S et al (2005) Enhanced Expression of an α2,6-Linked Sialic Acid on MDCK Cells Improves Isolation of Human Influenza Viruses and Evaluation of Their Sensitivity to a Neuraminidase Inhibitor. J Clin Microbiol 43:4139–4146 Kärber G (1931) Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Archiv f Exp Pathol u Pharmakol 162:480–483 Additional Declarations There is NO Competing Interest. Supplementary Files OkuwaetalSAFVreceptorfigsExtend.pdf Extended Data Fig. 1 Alignment of nucleic acid sequences at sgRNA targeting sites in clonal HeLaN-∆SLC, HeLaN-∆AV, and HeLaN-∆B8cells compared to HeLaN-WT cells. sgRNA-targeting sites are highlighted in blue. Dashed lines represent deleted bases in KO cells, while black “^” characters denote inserted bases in KO cells. PAM sites are marked in red. Extended Data Fig. 2 a, Expression of integrin aV and integrin b8 in HeLaN-∆AV, HeLaN-∆SLC∆AV, HeLaN-∆B8and HeLaN-∆SLC∆B8 clonal cells. The cells were stained with anti-integrin aV or anti-integrin aVb8 antibodies and analyzed by flow cytometry. b, HeLaN-∆AV, HeLaN-∆SLC∆AV, HeLaN-∆B8 and HeLaN-∆SLC∆B8clonal cells were infected with 10-fold serial dilutions of SAFV-3 and incubated for 5 days, and viable cells were stained with crystal violet to assess infection levels. Extended Data Fig. 3 Susceptibility analysis using SAF/UnaG in HeLaN-∆AV, HeLaN-∆SLC∆AV, HeLaN-∆B8 and HeLaN-∆SLC∆B8 clonal cells. UnaG-positive cells (green, upper panel) and nuclei stained with Hoechst (blue, lower panel) were imaged at 16 h post-infection. Extended Data Fig. 4 Expression of HS and integrin aVb8 in HeLa-N and HeLa-R cells. The cells were stained with the indicated antibodies and analyzed using flow cytometry. Extended Data Fig. 5 a, Alignment of nucleic acid sequences at the sgRNA targeting sites in clonal BHK-∆SLC cells compared to WT BHK-21 cells. sgRNA-targeting sites are highlighted in blue. Dashed lines represent deleted bases in KO cells, while black “^” characters denote inserted bases in KO cells. PAM sites are marked in red. b, Expression of HS and integrin b8 in BHK+human AVB8, BHK-∆SLC, BHK-∆SLC+human AVB8 and revertant cells expressing human SLC35B2 (BHK-∆SLC+human AVB8+SLC). The cells were stained with anti-HS or anti-integrin aVb8 antibodies and analyzed by flow cytometry. c, Susceptibility analysis using SAF/UnaG in BHK-∆SLC+human AVB8 cells and BHK-∆SLC+human AVB8+SLC cells. The cells used in this experiment were sorted to equalize the expression level of integrin aVb8 in BHK+human AVB8 and BHK-∆SLC+human AVB8 cells. UnaG-positive cells (green, upper panel) and the nuclei stained with Hoechst (blue, lower panel) were imaged at 16 h post-infection. The percentage of infected cells was determined by examining at least 800 cells per well (n=4). Scale bar, 200 mm. Statistical significance was determined using a one-way ANOVA with Dunnett’s multiple comparison test. **, P < 0.01, n.s., not significant. Extended Data Fig. 6 Expression of integrin b8 in HeLaN-∆SLCand HeLaN-∆SLC+human AVB8 cells. HeLaN-∆SLC cells lentivirally transduced with integrin aV and b8 were stained with anti-integrin aVb8 antibodies and analyzed using flow cytometry. Extended Data Fig. 7 Upper panel, The amino acid sequences of CD loops I and II on VP1 of SAFV-2 and 3. Lower panel, The amino acid sequences of puffs A and B on VP2 of SAFV-2 and 3. Extended Data Fig. 8 Graphical summary of results. Sulfated GAGs and integrin aVb8 function in parallel as receptors for SAFV infection in HeLa-N cells. SAFV can directly bind to either sulfated GAGs or integrin aVb8, while a portion of viruses bound to sulfated GAGs may subsequently interact with integrin aVb8. In addition, the data suggested the existence of a downstream molecule (factor X) required for SAFV uncoating or entry following sulfated GAG binding. RS2479766.pdf Reporting summary Cite Share Download PDF Status: Published Journal Publication published 15 Dec, 2025 Read the published version in Nature Communications → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5450276","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":388669824,"identity":"a059ead7-bb10-4a37-bb1f-8dd7420900cd","order_by":0,"name":"Toshiki HIMEDA","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABB0lEQVRIiWNgGAWjYBACA2YgwcNgY4AiCCKYCWhJI0ULA1jLYUwtOIE5O3figzc15435Zzc//vCzzY5Bt715A8OPGgZ2cxxaLJt5NxvOOXbbTOLOMQPD3rZkBrMzxwoYe44xMFs24HDYYd5t0jxst20YbiQYJPBuY67fdiPHgIG3gYHZ4ABOLdt/8/w7ZyN/I/3Dwb/b6hnM7r8xYPyLX8s2Zt62A2YGN3IMm3m3HWYwu8FjwEzAls2Sc/uSjQ1v5BQzy/47DvRLWsFhmWMSuP1y/uzGD2++2RnOu5G++eObM9UMZscPb3z4psYmGVeIYQdAJ0kk448dbMCOdC2jYBSMglEwTAEAomxcJVPaiI0AAAAASUVORK5CYII=","orcid":"https://orcid.org/0009-0005-2970-1972","institution":"Kanazawa Medical University School of Medicine","correspondingAuthor":true,"prefix":"","firstName":"Toshiki","middleName":"","lastName":"HIMEDA","suffix":""},{"id":388669825,"identity":"91ad9ec7-4937-47c7-a4bd-e276b2d2727a","order_by":1,"name":"Takako Okuwa","email":"","orcid":"https://orcid.org/0009-0004-3981-4674","institution":"Kanazawa Medical University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Takako","middleName":"","lastName":"Okuwa","suffix":""},{"id":388669826,"identity":"4228e3e1-5509-4c8e-b4f5-d1933f8931b9","order_by":2,"name":"Kyousuke Kobayashi","email":"","orcid":"","institution":"Institute of Medical Science, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Kyousuke","middleName":"","lastName":"Kobayashi","suffix":""},{"id":388669827,"identity":"fbfdaee2-cd99-4e0c-8d3b-91dcbf86c834","order_by":3,"name":"Namiko Nomura","email":"","orcid":"","institution":"Tokyo Metropolitan Institute of Medical Science","correspondingAuthor":false,"prefix":"","firstName":"Namiko","middleName":"","lastName":"Nomura","suffix":""},{"id":388669828,"identity":"14800c33-02bb-4bb2-9292-760c7024744c","order_by":4,"name":"Kouichi Utani","email":"","orcid":"","institution":"Kanazawa Medical University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Kouichi","middleName":"","lastName":"Utani","suffix":""},{"id":388669829,"identity":"b2999842-f9c2-4af5-ad2e-67648c6f93e9","order_by":5,"name":"Satoshi Koike","email":"","orcid":"https://orcid.org/0000-0002-2745-5254","institution":"Tokyo Metropolitan Institute of Medical Science","correspondingAuthor":false,"prefix":"","firstName":"Satoshi","middleName":"","lastName":"Koike","suffix":""},{"id":388669830,"identity":"8e591eed-7e53-4856-8c6f-4ca39789cfe1","order_by":6,"name":"Akira Nakamura","email":"","orcid":"","institution":"Tohoku Medical and Pharmaceutical University","correspondingAuthor":false,"prefix":"","firstName":"Akira","middleName":"","lastName":"Nakamura","suffix":""},{"id":388669831,"identity":"a9de4616-8367-4c22-9204-4c58bb45d3f3","order_by":7,"name":"Masaya Higuchi","email":"","orcid":"","institution":"Kanazawa Medical University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Masaya","middleName":"","lastName":"Higuchi","suffix":""}],"badges":[],"createdAt":"2024-11-14 02:25:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5450276/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5450276/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41467-025-67236-z","type":"published","date":"2025-12-15T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":78882869,"identity":"60d86fa4-f5ba-4108-bb2a-e58431af52e6","added_by":"auto","created_at":"2025-03-20 09:07:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":635345,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eSLC35B2\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eKO reduces but does not completely inhibit SAFV-3 infection in HeLa-N cells. a\u003c/strong\u003e, Volcano plot displaying the log2 fold-change and adjusted p-values for all sgRNAs identified in the CRISPR-Cas9 screen comparing uninfected and SAFV-3 (JPN08-404 strain) infected HeLa-N cells. Candidate genes were extracted and exhibited by setting the threshold line to \"q-value\u0026lt;0.01 and log2(fold change)\u0026gt;4\". \u003cstrong\u003eb\u003c/strong\u003e, HS expression in HeLaN-∆SLC cells. Non-permeabilized cells were stained with anti-HS antibody and analyzed by flow cytometry. \u003cstrong\u003ec\u003c/strong\u003e, WT, HeLaN-∆SLC and HeLaN-∆EXT1 cells were infected with 10-fold serial dilutions of SAFV-3, and viable cells were stained with crystal violet to assess infection levels. \u003cstrong\u003ed\u003c/strong\u003e, Multi-step growth kinetics of SAFV-3 in HeLaN-∆SLC and HeLaN-WT cells. Cells were infected with SAFV-3 and incubated for up to 5 days. Data are presented as mean viral titers with standard deviations (s.d.), (n=3). Statistical significance was determined using Welch’s t-test. **, P \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"OkuwaetalSAFVreceptorfigs1.png","url":"https://assets-eu.researchsquare.com/files/rs-5450276/v1/f2a3d6b3e750c010c3b89247.png"},{"id":78882859,"identity":"983ee4fb-62e0-4dec-ba2e-764732c8f680","added_by":"auto","created_at":"2025-03-20 09:07:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":861027,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eITGAV\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eITGB8\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e are other major factors for SAFV-3 infection. a\u003c/strong\u003e, Volcano plot displaying the log2 fold-change and adjusted p-values for all sgRNAs identified in the screen comparing uninfected and SAFV-3 (JPN08-404 strain or JPN08-356 strain) infected HeLaN-∆SLCcells. Candidate genes were extracted and exhibited by setting the threshold line to \"q-value\u0026lt;0.01 and log2(fold change)\u0026gt;4\". Genes of particular interest were highlighted in color. \u003cstrong\u003eb\u003c/strong\u003e, Expression of integrin aV and integrin b8 in HeLaN-WT, HeLaN-∆AV, HeLaN-∆SLC∆AV, HeLaN-∆B8, and HeLaN-∆SLC∆B8 cells. Cells were stained with anti-integrin aV or anti-integrin aVb8 antibodies and analyzed by flow cytometry. \u003cstrong\u003ec\u003c/strong\u003e, HeLaN-WT, HeLaN-∆AV, HeLaN-∆B8, HeLaN-∆SLC∆AV and HeLaN-∆SLC∆B8cells were infected with 10-fold serial dilutions of SAFV-3, and viable cells were stained with crystal violet to assess infection levels. \u003cstrong\u003ed\u003c/strong\u003e, Multi-step growth kinetics of SAFV-3 in HeLaN-∆B8, HeLaN-∆SLC∆B8, and HeLaN-WT cells. Cells were infected with SAFV-3 and incubated for up to 5 days. Data are presented as mean viral titers with s.d. (n=3). Statistical significance was determined using Welch’s t-test. **, P \u0026lt; 0.01, *, P \u0026lt; 0.05, n.s., not significant.\u003c/p\u003e","description":"","filename":"OkuwaetalSAFVreceptorfigs2.png","url":"https://assets-eu.researchsquare.com/files/rs-5450276/v1/9dbb475c3eb352b9c78186ac.png"},{"id":78882865,"identity":"eebe4454-551d-4583-b05c-4317e3257428","added_by":"auto","created_at":"2025-03-20 09:07:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":657837,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSAFV-3 infection in BHK-21 cells expressing integrin \u003c/strong\u003eb\u003cstrong\u003e8 or \u003c/strong\u003ea\u003cstrong\u003eV\u003c/strong\u003eb\u003cstrong\u003e8. a\u003c/strong\u003e, Western blot analysis of integrin aV (left panel) and integrin b8 (right panel) expression in BHK-21 cells. BHK-21 cells lentivirally transduced with either human integrin aV (BHK+human AV) or hamster integrin b8 (BHK+hamster B8) were used as positive controls. The anti-integrin aV antibody cross-reacts with both human and hamster integrin aV. Actin served as a loading control. \u003cstrong\u003eb\u003c/strong\u003e, Expression of HS, integrin aV, and integrin b8 in BHK-21 derivatives. BHK-21 cells were stained with anti-HS antibody (left upper panel). BHK-21 cells stably expressing human integrin aV and/or b8 (BHK+human AV, BHK+human B8, BHK+human AVB8), as well as the control, were stained with anti-integrin aV or anti-integrin aVb8antibodies. After staining, the cells were analyzed by flow cytometry. \u003cstrong\u003ec\u003c/strong\u003e, Susceptibility analysis using SAF/UnaG in BHK-21 cells expressing human integrin aV and/or b8. UnaG-positive cells (green, upper panel) and nuclei stained with Hoechst (blue, lower panel) were imaged 16 h post-infection. Scale bar, 200 mm. The percentage of infected cells was determined by examining at least 1000 cells (n=3). Statistical significance was determined usinga one-way ANOVA with Dunnett’s multiple comparison test. **, P \u0026lt; 0.01, n.s., not significant. \u003cstrong\u003ed\u003c/strong\u003e, One-step growth kinetics of SAFV-3 inBHK+human AV, BHK+human B8, BHK+human AVB8 and control BHK-21 cells. Cells were infected with SAFV-3 and incubated for up to 24h. Data are presented as mean viral titers with s.d. (n=3). Statistical significance was determined using Welch’s t-test. **, P \u0026lt; 0.01,*, P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"OkuwaetalSAFVreceptorfigs3.png","url":"https://assets-eu.researchsquare.com/files/rs-5450276/v1/aaa80241fc6fdc63a70397c3.png"},{"id":78882866,"identity":"49773fd2-eefc-4bb1-b9fb-f533c49fbf0a","added_by":"auto","created_at":"2025-03-20 09:07:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":934589,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSAFV-3 specifically utilizes integrin \u003c/strong\u003ea\u003cstrong\u003eV\u003c/strong\u003eb\u003cstrong\u003e8 of the integrin \u003c/strong\u003ea\u003cstrong\u003eV subfamily for infection. a\u003c/strong\u003e, Expression of human integrin bsubunits (b1, b3, b5, and b6) on the surface of BHK-21 derivatives. BHK-21 cells lentivirally transduced with the respective integrin b subunit were stained with the indicated antibodies and analyzed by flow cytometry. \u003cstrong\u003eb\u003c/strong\u003e, Susceptibility analysis using SAF/UnaG in human integrin aV and the indicated b subunit expressing BHK-21 cells. UnaG-positive cells (green, upper panel) and nuclei stained with Hoechst (blue, lower panel) were imaged 16 h post-infection. Scale bar, 200 mm. \u003cstrong\u003ec\u003c/strong\u003e, Western blot analysis of exogenous integrin b8 expression in BHK-21 cells lentivirally transduced with either mouse or hamster integrin b8. The anti-integrin b8 antibody cross-reacts with both mouse and hamster integrin b8. Actin served as a loading control. \u003cstrong\u003ed\u003c/strong\u003e, Susceptibility analysis using SAF/UnaG in mouse and hamster integrin b8 expressing BHK-21 cells. UnaG-positive cells (green, upper panel) and bright field images (lower panel) were captured 16 h post-infection. Bright fields were presented to show the overall image of the cells.\u003c/p\u003e","description":"","filename":"OkuwaetalSAFVreceptorfigs4.png","url":"https://assets-eu.researchsquare.com/files/rs-5450276/v1/8ebd1b04bfcd8b947099b755.png"},{"id":78882861,"identity":"bf4a501c-dc91-419a-b8d8-3db59f8c178c","added_by":"auto","created_at":"2025-03-20 09:07:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":400533,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSAFV-3 directly binds to HS and integrin \u003c/strong\u003ea\u003cstrong\u003eV\u003c/strong\u003eb\u003cstrong\u003e8 on the cell surface. a\u003c/strong\u003e, Cell surface attachment assay of SAFV-3. HeLaN-WT, HeLaN-∆SLC, HeLaN-∆B8, HeLaN-∆SLC∆B8 or HeLaN-∆SLC+human AVB8 were incubated with SAFV-3 at 4 °C for 2 h, followed by an RT-qPCR analysis of bound virus. \u003cstrong\u003eb\u003c/strong\u003e, \u003cstrong\u003ec\u003c/strong\u003e, Inhibition of SAFV-3 attachment to the cell surface by soluble heparin (\u003cstrong\u003eb\u003c/strong\u003e) or recombinant integrin aVb8 (\u003cstrong\u003ec\u003c/strong\u003e). HeLaN-WT cells (b) or HeLaN-∆SLC+human AVB8 cells (c) were incubated with SAFV-3 pretreated with 1 or 10 mg of soluble heparin or recombinant integrin aVb8, respectively. Recombinant integrin aVb3 was used as a negative control. After incubation at 4 °C for 2 h, bound virus was analyzed by RT-qPCR. \u003cstrong\u003ed\u003c/strong\u003e, Pull-down assay of SAFV-3 by heparin (left panel) and integrin aVb8 (right panel). Heparin and the Fc chimera of extracellular domains of integrin aVb8, aVb3, or the signal sequence (ss) of integrin aV (negative control) were prepared as complexes with magnetic beads. These complexes were mixed with SAFV-3 and incubated at 4 °C for 1 h, followed by a Western blot analysis of bound virus using anti-SAFV-3 antiserum (left and right upper panels). \u003cstrong\u003ee\u003c/strong\u003e, UnaG-positive cell reduction blocking assay using RGD peptide. HeLaN-∆SLC cells were pretreated with 10 or 100 mg of GRGDS peptide for 30 min and then incubated with SAF/UnaG virus for 60 min subsequently. The UnaG-positive cells were counted using the ImageJ software program (n=3). UnaG-positive cells (green) and nuclei stained with Hoechst (blue) were imaged 10 h post-infection (lower panel). \u003cstrong\u003ef\u003c/strong\u003e, Viral infection analysis using integrin b8 mutants. BHK-21 cells expressing integrin b8 mutants (∆SDL, Y172N and I208R) were inoculated with SAFV-3. After 2 days, virus titers were determined by TCID\u003csub\u003e50\u003c/sub\u003e assay. Integrin b3 was used as a negative control. Lower panel shows the results of a Western blot analysis of integrin b8 mutants and integrin b3 expression in BHK-21 cells. Bar graphs in \u003cstrong\u003ea\u003c/strong\u003e, \u003cstrong\u003eb\u003c/strong\u003e, \u003cstrong\u003ec\u003c/strong\u003e,\u003cstrong\u003e e\u003c/strong\u003e and \u003cstrong\u003ef\u003c/strong\u003e are presented as the means with s.d. (n=3). Statistical significance was determined using one-way ANOVA with Dunnett’s multiple comparison test. **, P \u0026lt; 0.01, n.s., not significant.\u003c/p\u003e","description":"","filename":"OkuwaetalSAFVreceptorfigs5.png","url":"https://assets-eu.researchsquare.com/files/rs-5450276/v1/97306fbc6c86ad203694daac.png"},{"id":78882863,"identity":"5be50877-be78-45d3-ba5e-2673d1af5b65","added_by":"auto","created_at":"2025-03-20 09:07:01","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1823945,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSAFVs commonly utilize sulfated GAGs and integrin \u003c/strong\u003ea\u003cstrong\u003eV\u003c/strong\u003eb\u003cstrong\u003e8 in parallel as receptors for infection. \u003c/strong\u003eInfectivity of SAFV clinical isolates in KO HeLa-N cell lines. HeLaN-WT, HeLaN-∆SLC, HeLaN-∆B8 and HeLaN-∆SLC∆B8 cells were infected with 10-fold serial dilutions of the indicated SAFV clinical isolates and incubated for 5 days. Viable cells were stained using crystal violet.\u003c/p\u003e","description":"","filename":"OkuwaetalSAFVreceptorfigs6.png","url":"https://assets-eu.researchsquare.com/files/rs-5450276/v1/77e74e9c1a3fd4ea4870c3ae.png"},{"id":100296093,"identity":"d3d5d592-ac7d-41c6-8d9e-4d6ef32e53af","added_by":"auto","created_at":"2026-01-15 08:12:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6348836,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5450276/v1/c5e88bbb-e327-41b0-8263-6ad757ebf877.pdf"},{"id":78882860,"identity":"d848eeb4-3e45-410a-bbac-cfc002c9554b","added_by":"auto","created_at":"2025-03-20 09:07:01","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":4017483,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 1 \u003c/strong\u003eAlignment of nucleic acid sequences at sgRNA targeting sites in clonal HeLaN-∆SLC, HeLaN-∆AV, and HeLaN-∆B8cells compared to HeLaN-WT cells. sgRNA-targeting sites are highlighted in blue. Dashed lines represent deleted bases in KO cells, while black “^” characters denote inserted bases in KO cells. PAM sites are marked in red.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 2\u003c/strong\u003e \u003cstrong\u003ea\u003c/strong\u003e, Expression of integrin aV and integrin b8 in HeLaN-∆AV, HeLaN-∆SLC∆AV, HeLaN-∆B8and HeLaN-∆SLC∆B8 clonal cells. The cells were stained with anti-integrin aV or anti-integrin aVb8 antibodies and analyzed by flow cytometry. \u003cstrong\u003eb\u003c/strong\u003e, HeLaN-∆AV, HeLaN-∆SLC∆AV, HeLaN-∆B8 and HeLaN-∆SLC∆B8clonal cells were infected with 10-fold serial dilutions of SAFV-3 and incubated for 5 days, and viable cells were stained with crystal violet to assess infection levels.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 3 \u003c/strong\u003eSusceptibility analysis using SAF/UnaG in HeLaN-∆AV, HeLaN-∆SLC∆AV, HeLaN-∆B8 and HeLaN-∆SLC∆B8 clonal cells. UnaG-positive cells (green, upper panel) and nuclei stained with Hoechst (blue, lower panel) were imaged at 16 h post-infection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 4 \u003c/strong\u003eExpression of HS and integrin aVb8 in HeLa-N and HeLa-R cells. The cells were stained with the indicated antibodies and analyzed using flow cytometry.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 5\u003c/strong\u003e \u003cstrong\u003ea\u003c/strong\u003e, Alignment of nucleic acid sequences at the sgRNA targeting sites in clonal BHK-∆SLC cells compared to WT BHK-21 cells. sgRNA-targeting sites are highlighted in blue. Dashed lines represent deleted bases in KO cells, while black “^” characters denote inserted bases in KO cells. PAM sites are marked in red. \u003cstrong\u003eb\u003c/strong\u003e,\u003cstrong\u003e \u003c/strong\u003eExpression of HS and integrin b8 in BHK+human AVB8, BHK-∆SLC, BHK-∆SLC+human AVB8 and revertant cells expressing human \u003cem\u003eSLC35B2\u003c/em\u003e(BHK-∆SLC+human AVB8+SLC). The cells were stained with anti-HS or anti-integrin aVb8 antibodies and analyzed by flow cytometry. \u003cstrong\u003ec\u003c/strong\u003e, Susceptibility analysis using SAF/UnaG in BHK-∆SLC+human AVB8 cells and BHK-∆SLC+human AVB8+SLC cells. The cells used in this experiment were sorted to equalize the expression level of integrin aVb8 in BHK+human AVB8 and BHK-∆SLC+human AVB8 cells. UnaG-positive cells (green, upper panel) and the nuclei stained with Hoechst (blue, lower panel) were imaged at 16 h post-infection. The percentage of infected cells was determined by examining at least 800 cells per well (n=4). Scale bar, 200 mm. Statistical significance was determined using a one-way ANOVA with Dunnett’s multiple comparison test. **, P \u0026lt; 0.01, n.s., not significant.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 6 \u003c/strong\u003eExpression of integrin b8 in HeLaN-∆SLCand HeLaN-∆SLC+human AVB8 cells. HeLaN-∆SLC cells lentivirally transduced with integrin aV and b8 were stained with anti-integrin aVb8 antibodies and analyzed using flow cytometry.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 7 \u003c/strong\u003eUpper panel, The amino acid sequences of CD loops I and II on VP1 of SAFV-2 and 3. Lower panel, The amino acid sequences of puffs A and B on VP2 of SAFV-2 and 3.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExtended Data Fig. 8\u003c/strong\u003e Graphical summary of results. Sulfated GAGs and integrin aVb8 function in parallel as receptors for SAFV infection in HeLa-N cells. SAFV can directly bind to either sulfated GAGs or integrin aVb8, while a portion of viruses bound to sulfated GAGs may subsequently interact with integrin aVb8. In addition, the data suggested the existence of a downstream molecule (factor X) required for SAFV uncoating or entry following sulfated GAG binding.\u003c/p\u003e","description":"","filename":"OkuwaetalSAFVreceptorfigsExtend.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5450276/v1/c98e34e98d001092e3dac72f.pdf"},{"id":78882868,"identity":"4a714fb1-19cb-4ca8-9372-b87cef714cc6","added_by":"auto","created_at":"2025-03-20 09:07:02","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":189768,"visible":true,"origin":"","legend":"Reporting summary","description":"","filename":"RS2479766.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5450276/v1/38c46bea36b5d6399a400817.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Saffold Virus Exploits Integrin αVβ8 and Sulfated Glycosaminoglycans as Two Parallel Receptors for Infection","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSaffold virus (SAFV) belongs to the species \u003cem\u003eCardiovirus saffoldi\u003c/em\u003e (formerly \u003cem\u003eCardiovirus\u003c/em\u003e D) within the genus \u003cem\u003eCardiovirus\u003c/em\u003e of the family \u003cem\u003ePicornaviridae\u003c/em\u003e. It is closely related to Theiler\u0026rsquo;s murine encephalomyelitis virus (TMEV), which is classified under the species \u003cem\u003eCardiovirus theileri\u003c/em\u003e (formerly \u003cem\u003eCardiovirus\u003c/em\u003e B) [1\u0026ndash;3]. In 2007, SAFV was first isolated from a stool sample of an eight-month-old infant with a fever of unknown origin in the United States [4]. To date, 11 different SAFV genotypes have been identified, with SAFV-2 and SAFV-3 being highly prevalent in humans [5]. SAFV is primarily detected in pediatric patients with acute respiratory illness and gastroenteritis, but it has also been found in specimens from severe cases, including acute flaccid paralysis, aseptic meningitis, myocarditis, acute pancreatitis, and cerebellitis [5\u0026ndash;10]. In addition, SAFV infection has been associated with hand, foot, and mouth disease (HFMD), where an increased frequency of severe nervous system manifestations has been reported [11]. SAFV co-infection exacerbates the severity of HFMD caused by enterovirus 71 infection [11]. However, the pathogenicity of SAFV, which causes a range of mild to severe symptoms, remains poorly understood.\u003c/p\u003e \u003cp\u003eThe capsid of SAFV is composed of 60 capsomers, each containing four subunits: VP1, VP2, VP3, and VP4. The fourth capsid protein, VP4, is located inside the capsid [12]. Surface-exposed capsid proteins bind to receptors on target cells, thereby initiating the first step of infection. This virus-receptor interaction is followed by viral entry, uncoating, replication, assembly, and ultimately the release of progeny viruses from infected cells. Thus, the receptors and their distribution are the most important factors in defining the host range and tissue tropism, playing a crucial role in viral pathogenicity. However, the SAFV receptor has not been identified.\u003c/p\u003e \u003cp\u003eTo identify SAFV receptors, we employed genome-wide CRISPR-Cas9 knockout (KO) screens, a widely used method of identifying critical host factors for viral infection, including receptors [13\u0026ndash;18], using HeLa-N cells, which are a HeLa-subline highly susceptible to SAFV-3 infection [19].\u003c/p\u003e \u003cp\u003eWe herein report the identification of sulfated glycosaminoglycans (GAGs) and integrin aVb8 as SAFV receptors, and further demonstrate that these two pathways function in parallel during SAFV infection.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of genes involved in sulfated GAG synthesis as host factors for efficient SAFV-3 infection\u003c/h2\u003e \u003cp\u003eTo identify the host factors required for SAFV infection, we used the human CRISPR KO pooled library (GeCKO v2) [20] and HeLa-N cells, which are highly susceptible to SAFV infection [19], along with the JPN08-404 strain of SAFV-3. To strengthen the reliability of the screening, we conducted two independent screens using separately established HeLa-N KO cell libraries. We isolated six candidate genes that are essential host factors for SAFV infection. However, it is important to note that the number of surviving cells following SAFV infection was very low in both screens, suggesting the possibility of multiple pathways being involved in infection. Notably, three of these genes are involved in the synthesis of sulfated GAGs, including the genes required for the synthesis of heparan sulfate (HS) substrates (uridine diphosphate glucose dehydrogenase, \u003cem\u003eUGDH\u003c/em\u003e), elongation of the HS chain (exostosin-2, \u003cem\u003eEXT-2\u003c/em\u003e), and transport of the sulfate donor 3\u0026prime;-phosphoadenosine-5\u0026prime;-phosphosulfate (solute carrier family 35 member B2, \u003cem\u003eSLC35B2\u003c/em\u003e), which was isolated on both screens (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo determine whether or not sulfated GAGs are critical for SAFV infection, we established \u003cem\u003eSLC35B2\u003c/em\u003e KO and \u003cem\u003eEXT1\u003c/em\u003e KO HeLa-N cell lines (HeLaN-∆SLC and HeLaN-∆EXT1, respectively) and confirmed that HS was absent on the surface of these cells and that frameshift mutations were introduced in the target region (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb and Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). We examined the susceptibility of these cells to SAFV-3 infection by inoculating them with serially diluted viruses. The susceptibility of HeLaN-∆SLC cells to SAFV-3 was reduced by 3-log compared to that of wild-type (WT) cells, yet HeLaN-∆SLC cells were still eradicated by high-titer viral inoculation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, upper panel). A similar reduction in SAFV-3 susceptibility in HeLaN-∆SLC cells was observed when they were infected with SAF/UnaG virus, a recombinant virus expressing the green fluorescent protein UnaG in infected cells [21] (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In addition, the susceptibility of HeLaN-∆EXT1 cells to SAFV-3 was reduced by two logs compared to WT cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, lower panel), suggesting that the decreased susceptibility caused by \u003cem\u003eSLC35B2\u003c/em\u003e KO was largely due to the deletion of sulfated GAGs, particularly HS proteoglycans. Next, we assessed the growth kinetics of SAFV-3 in HeLaN-∆SLC and WT HeLa-N cells. Consistent with the reduced susceptibility of HeLaN-∆SLC cells, they also supported SAFV-3 infection and replication, albeit with approximately 2-log lower efficiency than that of WT cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese findings indicate that sulfated GAGs are required for efficient SAFV-3 infection, but strongly suggest the further presence of another major receptor that functions in cooperation with sulfated GAGs or independently of them.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIdentification of integrin\u003c/b\u003e a\u003cb\u003eV and integrin\u003c/b\u003e b\u003cb\u003e8 as critical factors for SAFV-3 infection\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo identify the major receptors for SAFV-3 infection other than sulfated GAGs, we conducted a second genome-wide CRISPR screening using HeLaN-∆SLC cells with two SAFV-3 strains (JPN08-404 and JPN08-356). The top two most enriched candidate genes identified in both screens were \u003cem\u003eITGAV\u003c/em\u003e and \u003cem\u003eITGB8\u003c/em\u003e genes, which encode the integrin subunits aV and b8, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003ea), and their products form integrin aVb8 heterodimer. These two genes were significantly enriched, prompting us to focus on \u003cem\u003eITGAV\u003c/em\u003e and \u003cem\u003eITGB8\u003c/em\u003e in further studies.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo verify the role of integrin aVb8 in SAFV infection, we knocked out \u003cem\u003eITGAV\u003c/em\u003e or \u003cem\u003eITGB8\u003c/em\u003e in WT and HeLaN-∆SLC cells (resulting in HeLaN-∆AV, HeLaN-∆B8, HeLaN-∆SLC∆AV, and HeLaN-∆SLC∆B8 cells) and established KO clones, in which the loss of target gene expression on the cell surface was validated, and frameshift mutations were confirmed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eb and Extended Data Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e). First, we examined their susceptibility to SAFV-3 by inoculating cells with serially diluted viruses (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Although HeLaN-∆AV and HeLaN-∆B8 cells were eradicated by high-titer viral inoculation, their susceptibility to SAFV-3 was 3-log lower than that of WT. In contrast, HeLaN-∆SLC∆AV and HeLaN-∆SLC∆B8 cells were completely resistant to SAFV-3 even at the highest viral multiplicity of infection (MOI). Two additional clones from each KO cell line showed similar susceptibility to SAFV-3 (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eb). When infected with the SAF/UnaG virus, UnaG-positive cells were detected in HeLaN-∆AV and HeLaN-∆B8 cells, albeit at a lower frequency than in WT, whereas no UnaG-positive cells were observed in HeLaN-∆SLC∆AV and HeLaN-∆SLC∆B8 double KO cells (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Next, we assessed the growth kinetics of SAFV-3 in HeLaN-∆B8 single-KO and HeLaN-∆SLC∆B8 double-KO cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003ed, viral growth in HeLaN-∆B8 cells was considerably reduced, exhibiting delayed replication and decreased titers; viral growth still occurred, similar to that was observed in HeLaN-∆SLC cells. In contrast, no viral growth was detected in the HeLaN-∆SLC∆B8 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003ed).\u003c/p\u003e \u003cp\u003eThese results indicated that in HeLa-N cells, knocking out either \u003cem\u003eSLC35B2\u003c/em\u003e or integrin alone retained some susceptibility to SAFV-3. However, knocking out \u003cem\u003eITGAV\u003c/em\u003e or \u003cem\u003eITGB8\u003c/em\u003e in addition to \u003cem\u003eSLC35B2\u003c/em\u003e resulted in a complete loss of susceptibility to SAFV-3. This suggests that the sulfated GAG-dependent and integrin aVb8-dependent pathways function in parallel for SAFV-3 infection. In our previous study, we reported that HeLa cells obtained from RIKEN BRC (RCB0007, referred to as HeLa-R) showed low susceptibility to SAFV-3 infection [19]. When we assessed the expression of HS and integrin aVb8 on the surface of HeLa-R cells, we found that the amount of HS was extremely low compared to that in HeLa-N cells, whereas integrin aVb8 expression was comparable (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). This result suggests that the low susceptibility of HeLa-R cells to SAFV-3 is due to the low expression of HS on the cell surface and that efficient SAFV-3 infection requires sufficient expression of both HS and integrin aVb8.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eExpression of integrin\u003c/b\u003e a\u003cb\u003eV\u003c/b\u003eb\u003cb\u003e8 confers susceptibility to SAFV-3 in BHK-21 cells\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBHK-21 cells are resistant to SAFV-3 infection, even at a high MOI, but can produce progeny viruses when transfected with infectious SAFV-3 RNA [21]. This suggests that BHK-21 cells lack the key host factors involved in the attachment, internalization, or uncoating of SAFV-3. We hypothesized that if integrin aVb8 is a missing factor, expressing it would confer SAFV-3 susceptibility to BHK-21 cells.\u003c/p\u003e \u003cp\u003eFirst, we analyzed the expression of integrins aV and b8 in BHK-21 cells. As antibodies to hamster integrins aV and b8 for flow cytometry were not available, we employed Western blotting using anti-human integrin aV and anti-mouse integrin b8 antibodies, which are cross-reactive to hamster integrins (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). We detected endogenous hamster integrin aV, as well as exogenously expressed human integrin aV, but could not detect endogenously expressed hamster integrin b8, demonstrating that BHK-21 cells express integrin aV but not b8 at detectable levels. Flow cytometry showed that HS was abundantly present on the cell surface of BHK-21 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eb), indicating that sulfated GAGs alone were insufficient for SAFV-3 infection in these cells.\u003c/p\u003e \u003cp\u003eNext, we exogenously expressed human integrin aV and/or b8 in WT BHK-21 cells via lentiviral transduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eb) and assessed SAFV-3 susceptibility using the SAF/UnaG virus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). The expression of integrin b8 alone (BHK\u0026thinsp;+\u0026thinsp;human B8) conferred susceptibility to SAFV-3 in BHK-21 cells, whereas the expression of integrin aV alone (BHK\u0026thinsp;+\u0026thinsp;human AV) did not. The co-expression of integrin aV and b8 (BHK\u0026thinsp;+\u0026thinsp;human AVB8) further increased SAFV-3 susceptibility in BHK-21 cells. Finally, we examined the growth kinetics of SAFV-3 in integrin-expressing BHK-21 and control cells. No viral growth was observed in control or BHK\u0026thinsp;+\u0026thinsp;human AV cells. However, drastic viral growth was observed in BHK\u0026thinsp;+\u0026thinsp;human B8 and BHK\u0026thinsp;+\u0026thinsp;human AVB8 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). These results confirmed that integrin aVb8 is a critical factor in SAFV-3 infection.\u003c/p\u003e \u003cp\u003eInterestingly, integrin aVb8-expressing ∆SLC35B2 BHK-21 (BHK\u0026thinsp;+\u0026thinsp;human AVB8-∆SLC) cells exhibited lower susceptibility to SAFV-3 compared to BHK\u0026thinsp;+\u0026thinsp;human AVB8 cells. This decreased susceptibility to SAFV-3 was rescued by complementing \u003cem\u003eSLC35B2\u003c/em\u003e (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), suggesting that sulfated GAGs enhance integrin-mediated SAFV-3 infection in BHK-21 cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSAFV-3 specifically utilizes integrin\u003c/b\u003e a\u003cb\u003eV\u003c/b\u003eb\u003cb\u003e8 among the integrin\u003c/b\u003e a\u003cb\u003eV subfamily for infection\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIntegrin aV forms heterodimers with not only integrin b8 but also b1, b3, b5, and b6, constituting the integrin aV subfamily. Since some picornaviruses, such as foot-and-mouth disease virus (FMDV), utilize multiple members of the integrin aV subfamily as receptors, we investigated whether or not SAFV-3 can utilize other integrin b subunits besides b8 for infection. We generated BHK-21 cells co-expressing integrin aV with each b subunit (b1, b3, b5, or b6) by lentiviral transduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea) and assessed their susceptibility to SAFV-3 using the SAF/UnaG virus. No obvious increase in the number of UnaG-positive cells was observed in cells expressing b subunits other than b8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). These results indicate that SAFV-3 specifically utilizes integrin aVb8 among the aV subfamily members for infection.\u003c/p\u003e \u003cp\u003eNext, we explored whether the b subunit determines the species specificity of SAFV-3 infection by assessing SAFV-3 susceptibility of BHK-21 cells expressing hamster or mouse integrin b8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec), using SAF/UnaG virus (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). We observed a remarkable increase in the number of UnaG-positive cells in both hamster and mouse integrin b8-expressing cells, comparable to those expressing human integrin b8. These data suggest that differences in integrin aVb8 among species do not determine the species specificity of SAFV-3 infection.\u003c/p\u003e \u003cp\u003e \u003cb\u003eHS, as the representative sulfated GAG, and integrin\u003c/b\u003e a\u003cb\u003eV\u003c/b\u003eb\u003cb\u003e8 interact directly with SAFV-3\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo determine whether SAFV-3 binds to sulfated GAGs and integrin aVb8 on the cell surface, we conducted a virus attachment assay using HeLaN-∆SLC, HeLaN-∆B8, HeLaN-∆SLC∆B8, integrin aVb8-overexpressing HeLaN-∆SLC (HeLaN-∆SLC\u0026thinsp;+\u0026thinsp;human AVB8), and WT HeLa-N cells. Flow cytometry confirmed the overexpression of integrin aVb8 in HeLaN-∆SLC\u0026thinsp;+\u0026thinsp;human AVB8 cells generated by lentiviral transduction (Extended Data Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). These cells were incubated with SAFV-3 at 4\u0026deg;C, and the viruses attached to the cells were quantified using quantitative reverse transcription polymerase chain reaction (RT-qPCR) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). The amount of virus attached to the cells was significantly reduced in HeLaN-∆SLC and HeLaN-∆SLC∆B8 cells but not in HeLaN-∆B8 cells, suggesting that sulfated GAGs play a major role in the attachment of SAFV-3 in HeLa-N cells, whereas integrin b8 plays a minor role. However, a significant increase in viral attachment was observed in HeLaN-∆SLC\u0026thinsp;+\u0026thinsp;human AVB8 cells, indicating that integrin aVb8 does indeed have the potential to bind to SAFV-3 on the cell surface.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo confirm that sulfated GAGs and integrin aVb8 directly bind to SAFV-3, we first examined the effect of pretreating the viruses with soluble heparin, a structural analog of HS, on SAFV binding (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). Pretreatment with soluble heparin strongly inhibited the binding of SAFV-3 to WT HeLa-N cells. Next, we assessed the effect of pretreatment with soluble integrin aVb8 on SAFV binding in HeLaN-∆SLC\u0026thinsp;+\u0026thinsp;human AVB8 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec). Pretreatment with soluble integrin aVb8, but not soluble integrin aVb3, inhibited virus binding in a dose-dependent manner. These results indicate that both sulfated GAGs and integrin aVb8 mediate SAFV-3 attachment to the cell surface.\u003c/p\u003e \u003cp\u003eTo further clarify these interactions, we examined the direct binding of SAFV-3 to heparin and integrin aVb8 using a pull-down assay with biotinylated heparin and Fc-tagged soluble integrin aVb8, respectively. Western blotting detected SAFV-3 antigen in the sample pulled down by heparin beads (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed, left panel). Furthermore, the SAFV-3 antigen was detected in a Ca2+/Mg2+-dependent manner in the sample pulled down by the integrin aVb8 beads but not by the integrin aVb3 beads (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed, right panel). These data clearly demonstrate that SAFV-3 can directly bind to sulfated GAGs and integrin aVb8 at the cell surface.\u003c/p\u003e \u003cp\u003e \u003cb\u003eSAFV-3 binds to the RGD binding site of integrin\u003c/b\u003e a\u003cb\u003eV\u003c/b\u003eb\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSeveral picornaviruses use an RGD sequence in their capsid to bind to integrins during infection. Although SAFV-3 lacks an RGD sequence, it carries an RAD sequence in the puff A region of VP2, whereas SAFV-2 has an RLD sequence in the CD loop I of VP1 (Extended Data Fig.\u0026nbsp;7). These regions, referred to as loops and puffs, protrude from the surface of the virion. However, RAD is generally thought to reduce the integrin-binding affinity [22]. Since it is possible that the RAD sequence might still facilitate SAFV-3 binding to integrin aVb8, we first examined whether the RGD peptide, which masks the RGD-binding site on integrin aVb8, could block SAFV-3 infection using the SAF/UnaG virus. Pretreatment of HeLaN-ΔSLC with the RGD peptide clearly reduced the number of UnaG-positive cells in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee), suggesting that SAFV-3 interacts with integrin aVb8 through the RGD-binding site. To further verify this, we generated BHK-21 cells transiently expressing integrin b8 mutants (∆SDL, Y172N, and I208R), which are known to lose their ability to bind latent-TGF-β [23], and inoculated them with SAFV-3. No viral propagation was observed in BHK-21 cells expressing the b8 mutants, whereas robust viral propagation was detected in WT integrin b8-expressing cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ef). These findings suggest that the SAFV-3-binding region of integrin aVb8 is indeed an RGD-binding site.\u003c/p\u003e \u003cp\u003e \u003cb\u003eOther clinical isolates and genotypes also utilize both sulfated GAGs and integrin\u003c/b\u003e a\u003cb\u003eV\u003c/b\u003eb\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo determine whether or not the parallel infection pathway mediated by sulfated GAGs and integrin aVb8 is commonly used for SAFV infection, we analyzed the infectivity of two additional clinical isolates of genotype 3 (JPN08-356 and 987/Niigata/2007) and one clinical isolate of genotype 2 (1801-Yamagata-2009) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The infectivity of the JPN08-356 strain was reduced by two logs in HeLaN-∆SLC cells and by two logs in HeLaN-∆B8 cells compared to control (WT) cells. For the 987/Niigata/2007 strain, infectivity was 1 log lower in HeLaN-∆SLC cells and 3 logs lower in HeLaN-∆B8 cells than in WT cells. Similarly, the infectivity of SAFV-2 strain 1801-Yamagata-2009 was reduced by 3 logs in HeLaN-∆SLC cells and by 2 logs in HeLaN-∆B8 cells compared to WT cells. Notably, none of the strains were able to infect the HeLaN-∆SLC∆B8 cells. These results indicate that the infections of all strains examined in this study are mediated by both sulfated GAGs and integrin pathways, at least in genotypes 2 and 3.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eVirus-host interactions critical for SAFV pathogenicity remain largely unknown. In this study, our data showed that double KO of \u003cem\u003eITGAV\u003c/em\u003e or \u003cem\u003eITGB8\u003c/em\u003e together with \u003cem\u003eSLC35B2\u003c/em\u003e led to a complete loss of susceptibility to SAFV-3. In contrast, KO of either \u003cem\u003eSLC35B2\u003c/em\u003e or integrin alone reduced susceptibility but did not result in complete resistance. Based on these findings, we proposed a model for SAFV infection mediated by two receptors functioning in parallel (Extended Data Fig.\u0026nbsp;8).\u003c/p\u003e \u003cp\u003eIntegrins function as heterodimers formed by combinations of a and b chains, with 18 known types of a chains, 8 types of b chains, and 24 confirmed ab heterodimers on cell membranes [24]. Integrin aV is the most versatile subunit among a chains, forming heterodimers with five types of b subunits (b1, b3, b5, b6 or b8). Our study demonstrated that SAFV specifically utilizes integrin aVb8 for infection, distinguishing it from many other viruses that can interact with multiple b subunits. For example, parechovirus A1 (PeV-A1) uses aVb1, aVb3, and aVb6 [25\u0026ndash;27], coxsackievirus A9 (CVA9) uses aVb3 and aVb6 [28, 29]; and FMDV uses aVb1, aVb3, aVb6, aVb8, and a5b1 as receptors [30, 31]. In addition, our results showed that both mouse and hamster integrin b8 functions as receptors for SAFV infection, similar to human integrin b8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb), suggesting that the differences in integrin β8 are not a determinant of species specificity. Other unknown factors may also determine the species specificity of SAFV infections.\u003c/p\u003e \u003cp\u003eIntegrin heterodimers containing the aV subunit (aVb1, aVb3, aVb5, aVb6, aVb8) are known as \u0026lsquo;RGD receptors\u0026rsquo; due to their ability to bind to proteins with an RGD motif, such as vitronectin and fibronectin [32, 33]. Recently, sialylated integrins (aXb2 and aMb2) have been identified as receptors for TMEV-DA strain infection [34]. FMDV utilizes the five types of integrin heterodimers described above, and for both TMEV-DA and FMDV, the RGD motif on the protruding loop of the capsid protein plays a key role in integrin binding [30, 34]. Similar RGD motif-dependent interactions between virions and integrins have also been observed in PeVA1 and CVA9 [25\u0026ndash;29]. However, the capsid protein of SAFV-3 lacks an RGD motif. Our data from the RGD peptide-blocking assay and integrin b8 mutant analysis clearly demonstrated that the virus-binding region of integrin aVb8 is the RGD-binding site (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee, f). RGD-like sequences (e.g. RAD, RLD, or an alternative sequence) in the capsid protein of SAFV may be responsible for generating an integrin aVb8-specific interaction. Further studies using mutant viruses are required to resolve this issue.\u003c/p\u003e \u003cp\u003eCell surface sulfated GAGs, including HS, are ubiquitous negatively charged molecules that are commonly used by many viruses as attachment and entry receptors [35\u0026ndash;37]. In HeLa-N cells, KO of \u003cem\u003eSLC35B2\u003c/em\u003e resulted in reduced susceptibility to SAFV infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, d). BHK-21 cells, which express HS on their surface, were not susceptible to SAFV (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003ec, d), indicating that binding to HS alone is insufficient for SAFV infection. Given that SAFV-3 infection still occurred through sulfated GAGs even in integrin-deficient HeLa-N cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, d), this suggests the presence of additional factor X involved in the post-adsorption process in the sulfated GAGs-mediated pathway of SAFV infection in HeLa-N cells, but not in BHK-21 cells. Identifying this factor, which operates downstream of the interaction between SAFV and sulfated GAGs but is independent of integrin aVb8, remains an important future research focus (Extended Data Fig.\u0026nbsp;8).\u003c/p\u003e \u003cp\u003eIn summary, this study identified two key receptors for SAFV infection: integrin aVb8 and sulfated GAGs and demonstrated that they function in parallel. Our findings suggest that sulfated GAGs primarily serve as attachment receptors, whereas other factors, including integrin aVb8, play a role in the subsequent process. Although integrin aVb8 is clearly involved in attachment, its role in the later stages of infection, such as entry and uncoating, remains unclear. Further elucidation of these mechanisms is essential for a deeper understanding of SAFV pathogenesis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by JSPS KAKENHI (Grant Number 21K07045) from the Japan Society for the Promotion of Science, Grant for Promoted Research from Kanazawa Medical University (S2023-4), Grant for Assistance KAKEN from Kanazawa Medical University (K2024-3), and a grant from Yakult Honsha Co., Ltd. We thank Dr. Hiroyuki Shimizu from the National Institute of Infectious Diseases, Dr. Katsumi\u0026nbsp;Mizuta from Yamagata Prefectural Institute of Public Health, and Dr. Chika Hirokawa from the Niigata Prefectural Institute of Public Health and Environmental Sciences for kindly providing the clinical isolate of SAFV. We thank Ms. Sumie Saito for technical assistance. We extend special thanks to Dr. Yoshiro Ohara for his support as an observer.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor’s contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTO established the cell lines and performed the virological experiments. TH made a proposal for this study, performed virological experiments, and wrote the manuscript. KK and NN performed genome-wide gene-KO screening. KU supported the various experiments. SK supervised the design of this study and performed virological experiments. AN supported the analysis of viral binding to integrins through computer simulations. MH established the cell lines, was responsible for budget execution, and edited the final version of the manuscript. All authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eCells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHeLa-N is a HeLa subline that is highly susceptible to SAFV-3, whereas HeLa-R is a less susceptible subline obtained from RIKEN BRC (RCB0007) [19]. HeLa-N and 293T [38] cells were maintained in Dulbecco's modified Eagle’s medium (DMEM, Nacalai Tesque) supplemented with 10% fetal calf serum (FCS) containing 100 U/ml penicillin and 100\u0026nbsp;mg/ml streptomycin. HeLa-R cells were maintained in Eagle’s minimum essential medium (MEM, Nissui) supplemented with 10% calf serum (CS) and 0.03% l-glutamine.\u0026nbsp;BHK-21 (C-13) was obtained from\u0026nbsp;JCRB Cell Bank (JCRB9020).\u0026nbsp;BHK-21[39] and\u0026nbsp;BHK-21 (C-13)\u0026nbsp;cells were maintained in MEM supplemented with 5% CS and 0.03% l-glutamine. Caco-2 cells [40] were maintained in MEM with 20% FCS, 0.03% l-glutamine, and 0.1 mM non-essential amino acids (Gibco).\u0026nbsp;RD-18S-Niigata (RD-18S-N) [41] cells were maintained in MEM with 8% FCS, 0.03% l-glutamine, and 0.5%\u0026nbsp;Fangizon. All cell lines were incubated at 37 °C in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eViruses\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSAFV genotype 3 (SAFV-3) was prepared from the infectious cDNA clone pSAF404 derived from the JPN08-404 strain [7]. The virus was propagated in HeLa-N cells, and the sequence of the viral RNA was confirmed to be identical to that of the pSAF404 cDNA clone. The other SAFV-3 strains used in this study were as follows: JPN08-356, isolated from pharyngeal swabs and kindly provided by Dr. Hiroyuki Shimizu\u0026nbsp;at the National Institute of Infectious Diseases; and 987/Niigata/2007 [6], isolated from cerebrospinal fluid and kindly provided by Dr. Chika Hirokawa at the Niigata Prefectural Institute of Public Health and Environmental Sciences. These viruses were also propagated in HeLa-N cells. The SAFV-2 isolate (1801-Yamagata-2009), isolated from pharyngeal swabs, was kindly\u0026nbsp;provided by Dr. Katsumi Mizuta at the Yamagata Prefectural Institute of Public Health and propagated in RD-18S-N cells [41, 42]. Viral titers were determined using a standard plaque\u0026nbsp;assay in HeLa-N\u0026nbsp;cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGenome-wide CRISPR-Cas9 knockout screen\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe screened the genes required for SAFV-3 infection using a previously described method, with some modifications [20]. In brief, for genome-wide CRISPR-Cas9 knockout (KO) screening, we used the GeCKO v2.0 two-vector system (Addgene #1000000049).\u0026nbsp;HeLa-N and HeLaN-∆SLC cells were stably transduced with lentiCas9-Blast (Addgene #52962) and subsequently selected in a medium containing 4 mg/ml Blasticidin S for 7 days. Next, 210 million HeLa-N and HeLaN-∆SLC cells constitutively expressing Cas9 were transduced with lentiGuide-Puro from the human CRISPR KO pooled lentiviral library at a multiplicity of infection (MOI) of 0.3 in the presence of 8 mg/ml polybrene. The cells were then selected with 1 mg/ml puromycin for 7 days. For CRISPR screening, 30 million cells were infected with SAFV-3 (JPN08-404 strain and JPN08-356 strain) at a high MOI, causing 95% CPE in untransduced HeLa-N cells within 24 hours and in untransduced HeLaN-∆SLC cells within 48 hours. Surviving cells were subjected to a second infection at high MOI. Genomic DNA was extracted from the pooled surviving cells using the Blood \u0026amp; Cell Culture DNA Maxi Kit (13362, Qiagen). The sgRNA sequences were amplified from the genomic DNA using NEBNext High-Fidelity 2× PCR Master Mix (M0541S, NEB) with 10 NGS-Lib-Fwd primers and 1 barcoded NGS-Lib-KO-Rev primer [20]. The PCR product was concentrated by isopropanol precipitation and electrophoresed on a 3% agarose gel. DNA between 200 and 300 base pairs was extracted using a QIAquick Gel Extraction Kit (28704, Qiagen) and further purified with AMPure XP (A63880, Beckman Coulter). Sequencing of the PCR products was performed using next-generation sequencing (NGS; Illumina MiSeq instrument; Illumina). Acquired fastq files were cleaned by trimming and removing low-quality reads using the Prinseq software\u0026nbsp;program, version 0.20.4 (http://prinseq.sourceforge.net/index.html). Count data for sgRNA were extracted from fastq files using count_spacers.py [20]. Because six sgRNAs were designed for each gene in the GeCKO library, we searched for genes for which the number of remaining sgRNAs were significantly different between uninfected samples and those infected with SAFV-3. To achieve this, the edgeR included in the TCC R package was used [43].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLentiviral transduction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor lentivirus production, 293T cells were transfected with the lentiviral plasmid and\u0026nbsp;packaging plasmids (pCAG-HIVgp and pCMV-VSV-G-RSV-Rev from RIKEN BRC) using PEI max transfection reagent (24765, Polysciences), and cultured for 72 hours.\u0026nbsp;The resulting lentivirus-containing culture supernatant was added to the target cells with 8 mg/ml polybrene. The cells were then cultured in selection medium supplemented with the appropriate antibiotics: 1 mg/ml puromycin (ant-pr-1, Invivogen), 1 mg/ml G418 (074-05963, Fujifilm Wako Pure Chemical), and 10 mg/ml Blasticidin S (ant-bl-1, Invivogen)\u0026nbsp;for HeLa-N, and 20 mg/ml Blasticidin S, 800 mg/ml G418, and 400 mg/ml\u0026nbsp;Zeocin (R25001, Thermo Fisher Scientific) for BHK-21 cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEstablishment of KO cell lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo establish the \u003cem\u003eSLC35B2\u003c/em\u003e KO cell lines (HeLaN-∆SLC and BHK-∆SLC), the pGuide-it-ZsGreen1 plasmid (632601, Takara Bio) containing human (5′- AGAGTGATGACCCGCAGCTA -3′) or hamster (5′- GCTCGCCGCGCTCCCGTCTT -3′) \u003cem\u003eSLC35B2\u003c/em\u003e sgRNA sequences was transfected into HeLa-N and BHK-21 cells, respectively, using Lipofectamine 2000 transfection reagent (11668019, Thermo Fisher Scientific). For the \u003cem\u003eEXT1\u003c/em\u003e KO HeLa cell line (HeLaN-∆EXT1), the pGuide-it-ZsGreen1 plasmid containing the \u003cem\u003eEXT1\u003c/em\u003e sgRNA sequence (5’- CGCAGAGCGTCCGGGAAGCG -3’) was used. Forty-eight hours after transfection, ZsGreen-positive cells were sorted using an SH800 cell sorter (SONY) and cloned using limiting dilution. ∆SLC and ∆EXT1 clonal cells were assessed for HS expression on the cell surface by flow cytometry (see below). The genomic DNA surrounding the target sequence was PCR-amplified and sequenced using Sanger sequencing. Chromatograms were analyzed using DECODR v3.0 [44] (https://decodr.org/) and TIDE [45] (https://tide.nki.nl/).\u003c/p\u003e\n\u003cp\u003eTo establish \u003cem\u003eITGAV\u003c/em\u003e and \u003cem\u003eITGB8\u003c/em\u003e KO cell lines (HeLaN-∆AV, HeLaN-∆B8, HeLaN-∆SLC∆AV, and HeLaN-∆SLC∆B8), sgRNA sequences (\u003cem\u003eITGAV\u003c/em\u003e: 5′- AAATTCCAATGGATCATCCT -3′, \u003cem\u003eITGB8\u003c/em\u003e: 5′- CAAATGCAGCATCCTGTGCC -3′) were cloned into lentiGuide-Puro (Addgene #52963). The lentivirus\u0026nbsp;was added to Cas9-expressing HeLa-N and HeLaN-∆SLC cells, which were cultured in a selection medium containing 1 mg/ml puromycin for 7 days and then cloned by limiting dilution. To confirm the depletion of integrins, cell surface expression was examined by flow cytometry (see below). Genomic DNA surrounding the target sequence was PCR-amplified and analyzed as described above.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were detached using Accutase (12679-54, Nacalai Tesque) and incubated with primary antibodies for 30 minutes on ice, followed by incubation with secondary antibodies for an additional 30 minutes on ice, if required. The cells were analyzed using FACS Canto II (BD Biosciences) and the WinMDI software\u0026nbsp;program. To detect HS, cells were stained with biotinylated mouse anti-heparan sulfate antibody (10E4 epitope) (370255-B, amsbio) or biotinylated mouse IgMk\u0026nbsp;Isotype control (401621, BioLegend), followed by PE-streptavidin (405203, BioLegend) staining. For the detection of integrin\u0026nbsp;aV, b1, b3, b5, and b6, cells were stained with PE-conjugated antibodies against CD51 (integrin aV) (327910, BioLegend), CD29 (integrin b1) (303003, BioLegend), CD61 (integrin b3) (336405, BioLegend), and integrin b5 (345203, BioLegend), as well as an APC-conjugated antibody against integrin\u0026nbsp;b6 (FAB4155A, R\u0026amp;D Systems). PE-conjugated mouse\u0026nbsp;IgG1k (981804, BioLegend) and IgG2ak\u0026nbsp;(400213, BioLegend)\u0026nbsp;isotype-matched antibodies were used as the controls.\u0026nbsp;For integrin\u0026nbsp;b8 detection, cells were stained with anti-integrin aVb8 (clone EM13309) (ZRB1192, Sigma Aldrich), followed by PE-conjugated donkey anti-rabbit IgG secondary antibody (406421, BioLegend). A Rabbit Polyclonal Isotype antibody (910801, BioLegend) was used as the control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCloning\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from HeLa-N, Caco-2, and BHK-21 (C-13) cells using\u0026nbsp;an RNeasy Mini Kit (74104, Qiagen) following the manufacturer's instructions. cDNAs for human \u003cem\u003eITGAV\u003c/em\u003e and \u003cem\u003eITGB8\u003c/em\u003e from HeLa-N, human \u003cem\u003eITGB1\u003c/em\u003e and \u003cem\u003eITGB5\u003c/em\u003e from Caco-2, and hamster \u003cem\u003eItgb8\u003c/em\u003e from BHK-21 (C-13) cells were synthesized and amplified using the PrimeScript II High Fidelity One Step RT-PCR Kit (R026A, Takara Bio). cDNAs for human \u003cem\u003eITGB3\u003c/em\u003e and \u003cem\u003eITGB6\u003c/em\u003e and mouse \u003cem\u003eItgb8\u003c/em\u003e were PCR-amplified from plasmids MHS6278-211691048, MHS6278-211690966, and MMM1013-211691535, respectively (Horizon). The cDNAs were subsequently cloned into the pENTR-2B or pENTR/D-TOPO vector (K240020SP, Thermo Fisher Scientific) and transferred to the lentiviral expression vectors CSII-EF-IN-RfA [18] or CSII-EF-IB-RfA [38] using LR Clonase (11791020, Thermo Fisher Scientific). \u003cem\u003eSLC35B2\u003c/em\u003e cDNA was amplified from Caco-2 RNA and ligated into CSII-PGK-IZ, in which the human PGK promoter and IRES-Zeocin resistance gene cassette were assembled into the backbone of the lentiviral vector plasmid CS-CDF-CG-PRE (RIKEN BRC). Fc-tagged integrins, consisting of the extracellular domains\u0026nbsp;of integrin\u0026nbsp;aV,\u0026nbsp;b8, or\u0026nbsp;b3 fused to the mouse IgG2a Fc\u0026nbsp;tag\u0026nbsp;from pFUSEss-CHIg-mG2a_M18 (105930, Addgene), were cloned into the pENTR-2B vector and subsequently transferred to the expression vector\u0026nbsp;pEFneo-RfA [46] using LR Clonase, resulting in pEFneo-ITGaV-Fc,\u0026nbsp;pEFneo-ITGb8-Fc, and\u0026nbsp;pEFneo-ITGb3-Fc. pEFneo-ss-Fc containing only the signal sequence (ss) of integrin αV was constructed in the same manner.\u0026nbsp;Full-length cDNA of human \u003cem\u003eITGB8\u003c/em\u003e and \u003cem\u003eITGB3\u003c/em\u003e with a FLAG tag at the 3’ end was cloned into \u003cem\u003eEco\u003c/em\u003eRI site of pCAGGS-PUR (pCAG-hITGb8-F and pCAG-hITGb3-F) [47]. Mutations that disrupt the RGD binding site (DSDL, Y172N and I208R) are described in ref. 23. The same mutations were introduced in pCAG-hITGb8-F.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eViral susceptibility analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo examine the susceptibility of KO cell lines to SAFV-3 (cDNA-derived JPN08-404) and SAFV clinical isolates, 50\u0026nbsp;ml of 10-fold serial dilutions of viruses and 100\u0026nbsp;ml of 5 × 10\u003csup\u003e3\u003c/sup\u003e cells were added to each well of uncoated or collagen-coated 96-well plates and incubated at 37 °C with 5% CO\u003csub\u003e2\u003c/sub\u003e for 6 days. The cells were subsequently fixed with 10% neutral-buffered formalin and stained with 1% crystal violet/20% methanol solution. To assess susceptibility to SAFV, 4 × 10\u003csup\u003e5\u003c/sup\u003e cells were seeded in collagen-coated 6-well plates and incubated at 37 °C for at least 24 hours. The cells were then washed with phosphate-buffered saline (PBS) (-) and inoculated with 200\u0026nbsp;ml of SAF/UnaG (8 × 10\u003csup\u003e6\u003c/sup\u003e PFU/well) for 1 hour at 37 °C with\u0026nbsp;5% CO\u003csub\u003e2\u003c/sub\u003e. After\u0026nbsp;inoculation, the cells were washed with serum-free DMEM and incubated at 37 °C in\u0026nbsp;1 mL 1% FCS DMEM. At 16 hours post-infection, the expression of UnaG in the infected cells was captured by fluorescence microscopy, with nuclear staining using Hoechst 33342. For BHK-21 and its derivatives, 50\u0026nbsp;ml of SAF/UnaG virus (2 × 10\u003csup\u003e5\u003c/sup\u003e PFU/well\u0026nbsp;diluted in\u0026nbsp;5% CS MEM) and 100\u0026nbsp;ml of 2 × 10\u003csup\u003e4\u003c/sup\u003e cells were added to each well of 96-well plates and incubated at 37 °C.\u0026nbsp;After 16 hours of incubation, UnaG expression in the infected cells was captured by fluorescence microscopy, with nuclear staining using Hoechst 33342 when necessary. The number of UnaG-positive cells was quantified using the ImageJ software\u0026nbsp;program. The PFU values of viral titers shown in the experiments using BHK-21 cells were determined in HeLa-N cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eViral growth kinetics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo measure SAFV-3 growth in HeLa-N and its derivatives, cells were seeded at a density of 1 × 10\u003csup\u003e5\u003c/sup\u003e cells/well in 24-well plates and cultured for 1 day. Cells were then inoculated with SAFV-3 at 1 × 10\u003csup\u003e4\u003c/sup\u003e PFU/well and incubated at 37 °C with\u0026nbsp;5% CO\u003csub\u003e2\u0026nbsp;\u003c/sub\u003efor 0, 1, 2, 3, 4, or 5 days before collection. Samples were prepared by subjecting the cells to three freeze-thaw cycles to release virions, followed by centrifugation to remove cell debris. Viral titers were determined in HeLa-N cells by the 50% tissue culture infectious dose (TCID\u003csub\u003e50\u003c/sub\u003e) assay using the Kärber method [48].\u0026nbsp;For\u0026nbsp;BHK-21 and its derivatives,\u0026nbsp;cells were seeded at a density of 4 × 10\u003csup\u003e5\u003c/sup\u003e cells/well in 6-well plates and cultured for 1 day. After washing the cells with PBS (-), they were inoculated with 200 ml of SAFV-3 (8 × 10\u003csup\u003e6\u003c/sup\u003e PFU/well) and incubated for 1 hour at 37\u0026nbsp;°C with\u0026nbsp;5% CO\u003csub\u003e2\u003c/sub\u003e. After inoculation, the cells were washed twice with PBS (-) and incubated at 37 °C in 1 mL of 1% CS MEM. The cells and supernatants were collected at 0, 3, 6, 12, and 24 hours post-infection. Samples were prepared by three freeze-thaw cycles and centrifuged to remove cell debris. Viral titers were determined using a standard plaque assay with HeLa-N cells. The PFU values were used in the experiment using BHK-21 cells, as described above.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were lysed using 1× sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample loading buffer (786-701, G-Biosciences), supplemented with 2-mercaptoethanol and complete mini protease inhibitor cocktail tablets (11836153001, Roche) and boiled for 5 minutes. Samples were separated by SDS-PAGE using 10%–20% Extra PAGE One precast gels (13068-24, Nacalai Tesque) and transferred onto a polyvinylidene difluoride (PVDF) membrane (Trans-Blot Turbo Mimi PVDF Transfer Packs; 1704156, Bio-Rad Laboratories) using the Trans-Blot Turbo Transfer System (1704150, Bio-Rad Laboratories). The membrane was blocked with 5% skim milk in TBS-T (T9142, Takara Bio) and incubated with primary and secondary antibodies. The antibodies used were rabbit anti-integrin\u0026nbsp;aV polyclonal antibody (27096-1-AP, Proteintech), rabbit anti-integrin\u0026nbsp;b8 (D1V7M) monoclonal antibody (88300, Cell Signaling Technology), rabbit-anti-integrin\u0026nbsp;aVb8 monoclonal antibody (clone EM13309), rabbit-anti-integrin\u0026nbsp;aVb3 monoclonal antibody (clone EM22703) (ZRB1190, Sigma-Aldrich), mouse anti-actin (AC-40) monoclonal antibody (A3853, Sigma Aldrich), rabbit anti-SAFV-3 antiserum [19], and horseradish peroxidase-conjugated anti-mouse or rabbit IgG (170-6516 and 170-6515, respectively, Bio-Rad Laboratories). Signals were detected using the ECL prime Western blotting detection reagent (RPN2236, Cytiva).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eViral attachment and inhibition assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were seeded at 5 × 10\u003csup\u003e4\u003c/sup\u003e cells/well in 24-well plates and cultured for 2 days. The cells\u0026nbsp;were then incubated with SAFV-3 (2 × 10\u003csup\u003e6\u003c/sup\u003e PFU/well)\u0026nbsp;at 4 °C for 2 hours to allow viral attachment.\u0026nbsp;Following adsorption, the cells were washed three times with cold DMEM containing 10% FCS to remove unbound viruses. Total RNA was extracted using the RNeasy Mini Kit and bound viral RNA was quantified by RT-qPCR.\u0026nbsp;For the\u0026nbsp;viral binding inhibition assay, SAFV-3 (1 × 10\u003csup\u003e6\u003c/sup\u003e PFU/well) was pretreated with either 1\u0026nbsp;mg or 10\u0026nbsp;mg of\u0026nbsp;heparin sodium salt (17513-96, Nacalai Tesque), or recombinant human integrin\u0026nbsp;aVb8\u0026nbsp;(4135-AV, R\u0026amp;D\u0026nbsp;Systems). Recombinant human integrin\u0026nbsp;aVb3\u0026nbsp;(3050-AV, R\u0026amp;D\u0026nbsp;Systems) was used as a negative control. The mixtures were incubated at 4\u0026nbsp;°C for 2 hours and then inoculated into cells that had been pre-seeded in 24-well plates.\u0026nbsp;After adsorption at 4\u0026nbsp;°C for 2 hours, the cells were washed three times with cold DMEM containing 10% FCS. Total RNA was extracted, and bound viral RNA was quantified by RT-qPCR. cDNA was synthesized using PrimeScript RT Master Mix (RR036A, Takara Bio), and quantification was performed using THUNDERBIRD SYBR qPCR Mix (QPS-201, Toyobo).\u0026nbsp;The following primers\u0026nbsp;were used: SAFV forward primer, 5′-TGTAGCGACCTCACAGTAGCAG-3′, and SAFV reverse primer, 5′-AGGACATTCTTGGCTTCTCTACCG-3′.\u0026nbsp;For the blocking assay using RGD peptide, cells were seeded at 1.5 × 10\u003csup\u003e4\u0026nbsp;\u003c/sup\u003ecells/well in 48-well plates and\u0026nbsp;cultured for 2 days. The cells were pre-incubated with the GRGDS synthetic peptide (4189, Peptide institute)\u0026nbsp;at 4 °C for 30 minutes and then 50\u0026nbsp;ml of SAF/UnaG (5,000 UnaG-positive units in HeLaN-∆SLC+human AVB8 cells) was added and incubated at 37 °C\u0026nbsp;for 1 hour (total volume of 300\u0026nbsp;ml).\u0026nbsp;The cells were subsequently\u0026nbsp;washed three times with DMEM containing 10% FCS and incubated in growth medium\u0026nbsp;at 37 °C for 10 hours. UnaG expression in infected cells was captured by fluorescence microscopy with nuclear staining using Hoechst 33342. The number of UnaG-positive cells was quantified using the ImageJ software\u0026nbsp;program.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIntegrin\u0026nbsp;\u003c/strong\u003eb\u003cstrong\u003e8 mutant analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBHK-21 cells (1 × 10\u003csup\u003e5\u0026nbsp;\u003c/sup\u003ecells/well) were seeded in 24-well plates. The next day, the plasmids expressing WT human integrin\u0026nbsp;b8, pCAG-hITGb8-F, and its mutants, pCAG-hITGb8-DSDL, pCAG-hITGb8-Y172N, pCAG-hITGb8-I208R, and pCAG-hITGb3-F as a negative control (0.5mg/well) were transfected in triplicate using FuGENE HD (E2311, Promega). One day after transfection, SAFV (1 ×\u0026nbsp;10\u003csup\u003e4\u003c/sup\u003e PFU/well) was inoculated for 2 hours, and washed once, and then fresh medium was added and incubated at 37\u0026nbsp;°C. The cells and supernatants were frozen\u0026nbsp;two\u0026nbsp;days later, and viral titers were determined.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePull-down assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo prepare heparin-biotin-streptavidin (SA)-magnetic bead complexes, 50\u0026nbsp;ml of SA-magnetic beads (S1420, NEB) were incubated with 400\u0026nbsp;mg (25\u0026nbsp;ml) of biotinylated heparin (B9806, Sigma Aldrich) at 4 °C for 1 hour with rotation. For the pull-down of SAFV-3 by heparin, SAFV-3 (1 × 10\u003csup\u003e6\u003c/sup\u003e PFU) was mixed with 50\u0026nbsp;ml of heparin-biotin-SA-beads or biotin-SA-beads without heparin (negative control). The mixture was incubated at 4 °C for 1 hour with rotation. After incubation, the beads were washed three times with 0.1% BSA-PBS (-). The precipitates were boiled in 2× SDS-PAGE sample loading buffer and subjected to a\u0026nbsp;Western blot analysis using\u0026nbsp;an\u0026nbsp;anti-SAFV-3 antiserum.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo prepareFc-tagged integrin beads, 293T cells were transfected with pEFneo-ss-Fc, pEFneo-ITGaV-Fc, pEFneo-ITGb8-Fc, or\u0026nbsp;pEFneo-ITGb3-Fc in the selected combinations using\u0026nbsp;PEI max. After 4 hours of incubation, the\u0026nbsp;medium was replaced with 2 ml of 1% FCS-DMEM per\u0026nbsp;well.\u0026nbsp;Seventy-two hours after transfection, the culture supernatants containing soluble Fc-tagged integrins were harvested. A total of\u0026nbsp;200\u0026nbsp;ml of the\u0026nbsp;supernatant was incubated with\u0026nbsp;20\u0026nbsp;ml of\u0026nbsp;protein A\u0026nbsp;magnetic Dynabeads (10002D, Thermo Fisher Scientific) at 4\u0026nbsp;°C for 2 hours with rotation. The integrin-Fc-bead complexes were washed three times with 0.5% BSA-PBS (-). The binding of Fc-tagged integrin\u0026nbsp;aVb8 or\u0026nbsp;aVb3 to the beads was confirmed by Western blotting\u0026nbsp;using a horseradish peroxidase-conjugated anti-mouse IgG antibody under both reducing and non-reducing\u0026nbsp;conditions.\u0026nbsp;For the pull-down of SAFV-3 by integrins\u0026nbsp;aVb8 and\u0026nbsp;aVb3, half of the prepared integrin-Fc-bead complexes were suspended in 1 ml of 0.5% BSA-PBS, with or without 1.5 mM CaCl\u003csub\u003e2\u003c/sub\u003e and 1 mM MgCl\u003csub\u003e2\u003c/sub\u003e (PBS(-) or (+)), and mixed with SAFV-3 (1 × 10\u003csup\u003e6\u003c/sup\u003e PFU). The mixture was incubated at 4\u0026nbsp;°C for 2 hours with rotation. After incubation, the beads were washed three times with 0.5% BSA-PBS (-) or 0.5% BSA-PBS (+) and once with PBS (-) or PBS (+), respectively. The precipitates were boiled in 2× SDS-PAGE sample loading buffer and subjected to a\u0026nbsp;Western blot analysis using\u0026nbsp;an\u0026nbsp;anti-SAFV-3 antiserum. The ss-Fc\u0026nbsp;beads were used as negative controls.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData were analyzed for statistical significance using one-way analysis of variance (ANOVA) with Dunnett’s multiple comparison test and two-sided Welch’s t-test.\u0026nbsp;A P-value of \u0026lt; 0.05 or \u0026lt; 0.01 was considered statistically significant or highly significant.\u0026nbsp;The GraphPad Prism software program, version 7 (GraphPad Software) was used for all statistical analyses.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZoll J et al (2009) Saffold virus, a human Theiler's-like cardiovirus, is ubiquitous and causes infection early in life. PLoS Pathog 5:e1000416\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang Z, Kumar AS, Jones MS, Knowles NJ (2008) Lipton H. L. Phylogenetic analysis of the species Theilovirus: emerging murine and human pathogens. J Virol 82:11545\u0026ndash;11554\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInternational Committee on Taxonomy of Viruses (ICTV) (2024) \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://ictv.global/taxonomy\u003c/span\u003e\u003cspan address=\"https://ictv.global/taxonomy\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (accessed on 3\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJones MS, Lukashov VV, Ganac RD, Schnurr DP (2007) Discovery of a novel human picornavirus in a stool sample from a pediatric patient presenting with fever of unknown origin. J Clin Microbiol 45:2144\u0026ndash;2150\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNaeem A et al (2014) Genetic diversity of circulating Saffold Viruses in Pakistan and Afghanistan. J Gen Virol 95:1945\u0026ndash;1957\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUgai S et al (2019) Clinical characteristics of Saffold virus infection in children. Pediatr Infect Dis J 38:781\u0026ndash;785\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHimeda T et al (2011) The preparation of an infectious full-length cDNA clone of Saffold virus. Virol J 8:110\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNielsen TS et al (2016) Saffold virus infection associated with human myocarditis. J Clin Virol 74:78\u0026ndash;81\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIto H et al (2017) Saffold cardiovirus infection in a 2-year-old boy with acute pancreatitis. Jpn J Infect Dis 70:105\u0026ndash;107\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNielsen ACY et al (2012) Serious invasive Saffold virus infections in children, 2009. Emerg Infect Dis 18:7\u0026ndash;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang XA et al (2015) Prevalence and genetic characteristics of Saffold cardiovirus in China from 2009 to 2012. Sci Rep 5:7704\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMullapudi E et al (2016) Structure and genome release mechanism of the human cardiovirus Saffold virus 3. J Virol 90:7628\u0026ndash;7639\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDudek AM et al (2020) GPR108 is a highly conserved AAV entry factor. Mol Ther 28:367\u0026ndash;381\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarakus U et al (2019) MHC class II proteins mediate cross-species entry of bat influenza viruses. Nature 567:109\u0026ndash;112\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang R et al (2018) Mxra8 is a receptor for multiple arthritogenic alphaviruses. Nature 557:570\u0026ndash;574\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark RJ et al (2017) A genome-wide CRISPR screen identifies a restricted set of HIV host dependency factors. Nat Genet 49:193\u0026ndash;203\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaga K et al (2016) Functional receptor molecules CD300lf and CD300ld within the CD300 family enable murine noroviruses to infect cells. \u003cem\u003eProc\u003c/em\u003e. \u003cem\u003eNatl\u003c/em\u003e. \u003cem\u003eAcad\u003c/em\u003e. \u003cem\u003eSci\u003c/em\u003e. \u003cem\u003eU\u003c/em\u003e.\u003cem\u003eS\u003c/em\u003e.\u003cem\u003eA\u003c/em\u003e. 113, E6248\u0026ndash;E6255\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatanabe K et al (2023) Myeloid-associated differentiation marker is an essential host factor for human parechovirus PeV-A3 entry. Nat Commun 14:1817\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHimeda T, Hosomi T, Okuwa T, Muraki Y, Ohara Y (2013) Saffold virus type 3 (SAFV-3) persists in HeLa cells. PLoS ONE 8:e53194\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJoung J et al (2017) Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening. Nat Protoc 12:828\u0026ndash;863\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkuwa T, Himeda T, Utani K, Higuchi M (2023) Generation of a recombinant Saffold Virus expressing UnaG as a marker for the visualization of viral infection. Virol J 20:175\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Most RG, Corver J, Strauss JH (1999) Mutagenesis of the RGD motif in the yellow fever virus 17D envelope protein. Virology 265:83\u0026ndash;95\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCampbell MG et al (2020) Cryo-EM Reveals Integrin-Mediated TGF-β Activation without Release from Latent TGF-β. Cell 180:490\u0026ndash;501\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRothman JE (2022) The gripping story of integrins. Cell 185:3844\u0026ndash;3848\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePulli T et al (1997) Cell-surface interactions of echovirus 22. J Biol Chem 272:21176\u0026ndash;21180\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeitsonen J et al (2010) Interaction of aVb3 and aVb6 integrins with human parechovirus 1. J Virol 84:8509\u0026ndash;8519\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTriantafilou K, Triantafilou M, Takada Y, Fernandez N (2000) Human parechovirus 1 utilizes integrins aVb3 and aVb1 as receptors. J Virol 74:5856\u0026ndash;5862\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoivainen M et al (1994) Entry of coxsackievirus A9 into host cells: specific interactions with avb3 integrin, the vitronectin receptor. Virology 203:357\u0026ndash;365\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilliams \u0026Ccedil;H et al (2004) Integrin aVb6 is an RGD-dependent receptor for coxsackievirus A9. J Virol 78:6967\u0026ndash;6973\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang G et al (2015) How foot-and-mouth disease virus receptor mediates foot-and-mouth disease virus infection. Virol J 12:9\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJackson T et al (2000) Foot-and-mouth disease virus is a ligand for the high-affinity binding conformation of integrin a5b1: influence of the leucine residue within the RGDL motif on selectivity of integrin binding. J Gen Virol 81:1383\u0026ndash;1391\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHussein HA et al (2015) Beyond RGD: virus interactions with integrins. Arch Virol 160:2669\u0026ndash;2681\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarczyk M, Carracedo S, Gullberg D, Integrins (2010) Cell Tissue Res 339:269\u0026ndash;280\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakeda K et al (2023) Chronic encephalomyelitis virus exhibits cellular tropism and evades pDCs by binding to sialylated integrins as the cell surface receptors. Eur J Immunol 53:e2350452\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCagno V et al (2019) Heparan sulfate proteoglycans and viral attachment: true receptors or adaptation bias? Viruses 11:596\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClausen TM et al (2020) SARS-CoV-2 infection depends on cellular heparan sulfate and ACE2. Cell 183:1043\u0026ndash;1057\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamos-Mart\u0026iacute;nez IE et al (2022) Heparan Sulfate and Sialic Acid in Viral Attachment: Two Sides of the Same Coin? Int J Mol Sci 23:9842\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHiguchi M et al (2007) Cooperation of NF-kB2/p100 activation and the PDZ domain binding motif signal in human T-cell leukemia virus type 1 (HTLV-1) Tax1 but not HTLV-2 Tax2 is crucial for interleukin-2-independent growth transformation of a T-cell line. J Virol 81:11900\u0026ndash;11907\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaniura N, Saito M, Okuwa T, Saito K, Ohara Y (2009) Different subcellular localization of Theiler's murine encephalomyelitis virus leader proteins of GDVII and DA strains in BHK-21 cells. J Virol 83:6624\u0026ndash;6630\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWatanabe K, Oie M, Higuchi M, Nishikawa M, Fujii M (2007) Isolation and characterization of novel human parechovirus from clinical samples. Emerg Infect Dis 13:889\u0026ndash;895\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eItagaki T et al (2018) Detection of Saffold viruses from children with acute respiratory infections in Yamagata, Japan, between 2008 and 2015. J Med Virol 90:34\u0026ndash;40\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAoki Y et al (2015) Isolation of Saffold virus type 2 from children with acute respiratory infections by using the RD-18S-Niigata cell line. Jpn J Infect Dis 68:438\u0026ndash;441\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun J, Nishiyama T, Shimizu K, Kadota K (2013) TCC: an R package for comparing tag count data with robust normalization strategies. BMC Bioinformatics 14:219\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBloh K et al (2021) Deconvolution of complex DNA repair (DECODR): Establishing a novel deconvolution algorithm for comprehensive analysis of CRISPR-edited sanger sequencing data. CRISPR J 4:120\u0026ndash;131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrinkman EK, Chen T, Amendola M, van Steensel B (2014) Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 42:e168\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsogawa M et al (2008) Rearranged NF-kB2 gene in an adult T-cell leukemia cell line. Cancer Sci 99:792\u0026ndash;798\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHatakeyama S et al (2005) Enhanced Expression of an α2,6-Linked Sialic Acid on MDCK Cells Improves Isolation of Human Influenza Viruses and Evaluation of Their Sensitivity to a Neuraminidase Inhibitor. J Clin Microbiol 43:4139\u0026ndash;4146\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK\u0026auml;rber G (1931) Beitrag zur kollektiven Behandlung pharmakologischer Reihenversuche. Archiv f Exp Pathol u Pharmakol 162:480\u0026ndash;483\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"nature-portfolio","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"","title":"Nature Portfolio","twitterHandle":"","acdcEnabled":false,"dfaEnabled":false,"editorialSystem":"ejp","reportingPortfolio":"","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-5450276/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5450276/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSaffold virus (SAFV), a member of the species \u003cem\u003eCardiovirus saffoldi\u003c/em\u003e within the \u003cem\u003ePicornaviridae\u003c/em\u003e family, causes acute respiratory and gastrointestinal illnesses, as well as hand, foot, and mouth diseases. It is also suspected to be associated with neuronal disorders such as encephalitis and meningitis in severe cases. Despite its clinical significance, the virus-host interactions underlying SAFV pathogenicity remain largely unknown. Using a genome-wide CRISPR-Cas9 knockout screen, we identified receptors for SAFV infection: sulfated glycosaminoglycans (GAGs) and integrin aVb8. Single knockouts of \u003cem\u003eSLC35B2\u003c/em\u003e, an essential gene for sulfated GAG synthesis, or the integrin genes, \u003cem\u003eITGAV\u003c/em\u003e or \u003cem\u003eITGB8\u003c/em\u003e partially reduced SAFV-3 susceptibility in HeLa cells, and double knockout conferred complete resistance. Furthermore, we demonstrated that SAFV-3 virions bind directly to sulfated GAGs and integrin aVb8. Based on these findings, we propose a model of SAFV infection, in which sulfated GAGs and integrin aVb8 function in parallel pathways during viral entry.\u003c/p\u003e","manuscriptTitle":"Saffold Virus Exploits Integrin αVβ8 and Sulfated Glycosaminoglycans as Two Parallel Receptors for Infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-20 09:06:56","doi":"10.21203/rs.3.rs-5450276/v1","editorialEvents":[],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"nature-communications","isNatureJournal":true,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"NCOMMS","sideBox":"Learn more about [Nature Communications](http://www.nature.com/ncomms/)","snPcode":"","submissionUrl":"https://mts-ncomms.nature.com/","title":"Nature Communications","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature Communications","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"732857d5-6b8c-4c9d-b33d-4c4c1e9517d7","owner":[],"postedDate":"March 20th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":41423154,"name":"Biological sciences/Microbiology/Virology/Virus\u0026#x2013;host interactions"},{"id":41423155,"name":"Biological sciences/Microbiology/Virology/Viral pathogenesis"}],"tags":[],"updatedAt":"2026-01-15T08:12:20+00:00","versionOfRecord":{"articleIdentity":"rs-5450276","link":"https://doi.org/10.1038/s41467-025-67236-z","journal":{"identity":"nature-communications","isVorOnly":false,"title":"Nature Communications"},"publishedOn":"2025-12-15 05:00:00","publishedOnDateReadable":"December 15th, 2025"},"versionCreatedAt":"2025-03-20 09:06:56","video":"","vorDoi":"10.1038/s41467-025-67236-z","vorDoiUrl":"https://doi.org/10.1038/s41467-025-67236-z","workflowStages":[]},"version":"v1","identity":"rs-5450276","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5450276","identity":"rs-5450276","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}