Agaricus blazei extract FA-2b-β inhibits microglial pyroptosis by regulating the activation of the NF-κB signaling pathway mediated by Aβ 1-42 through the NLRP3 pathway

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Alzheimer's disease (AD) is a progressive neurodegenerative disorder. Intracellular neurofibrillary tangles (NFTs) and neuroinflammatory plaques formed by amyloid-β (Aβ) are the main pathological features of AD. FA-2b-β, a selenium mushroom extract from Qinba, had strong anti-inflammatory activity and could protect against various inflammatory diseases by regulating multiple signaling pathways. However, whether FA-2b-β can modulate Aβ1−42-mediated neuroinflammation by inhibiting the NF-κB signaling pathway has not been systematically investigated. The present study aimed to explore the effect and mechanism of action of FA-2b-β on Aβ1−42-mediated microglia inflammation. The results showed that FA-2b-β reduced Aβ1−42-mediated release of tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β), and the expression of key proteins of NF-κB signaling pathway TLR4 and p-IκB-α, and NLRP3 Inflammasome associated with NLRP3 and Caspase1. However, activation of the NF-κB signaling pathway activates NLRP3 inflammasome and leads to increased expression of pyroptosis key protein GSDMD. Further, knockout of NLRP3 and FA-2b-β intervention, respectively, in BV2 cells resulted in a corresponding reduction in the levels of inflammatory mediators, including NLRP3, Casp1, ASC, TNF-α, and IL-1β. Mechanistically, FA-2b-β inhibited activation of nuclear factor kappa B (NF-κB) and downregulated the Nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) protein expression to suppress pyroptosis of BV2 cells. These findings suggested that FA-2b-β might represent a potential therapeutic agent for anti-neuroinflammation.
Full text 96,187 characters · extracted from preprint-html · click to expand
Agaricus blazei extract FA-2b-β inhibits microglial pyroptosis by regulating the activation of the NF-κB signaling pathway mediated by Aβ 1-42 through the NLRP3 pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Agaricus blazei extract FA-2b-β inhibits microglial pyroptosis by regulating the activation of the NF-κB signaling pathway mediated by Aβ 1-42 through the NLRP3 pathway Zujun Xi, Jin Yuan, Junshun Fan, Yanqing Sun This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5902281/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Alzheimer's disease (AD) is a progressive neurodegenerative disorder. Intracellular neurofibrillary tangles (NFTs) and neuroinflammatory plaques formed by amyloid-β (Aβ) are the main pathological features of AD. FA-2b-β, a selenium mushroom extract from Qinba, had strong anti-inflammatory activity and could protect against various inflammatory diseases by regulating multiple signaling pathways. However, whether FA-2b-β can modulate Aβ 1−42 -mediated neuroinflammation by inhibiting the NF-κB signaling pathway has not been systematically investigated. The present study aimed to explore the effect and mechanism of action of FA-2b-β on Aβ 1−42 -mediated microglia inflammation. The results showed that FA-2b-β reduced Aβ 1−42 -mediated release of tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β), and the expression of key proteins of NF-κB signaling pathway TLR4 and p-IκB-α, and NLRP3 Inflammasome associated with NLRP3 and Caspase1. However, activation of the NF-κB signaling pathway activates NLRP3 inflammasome and leads to increased expression of pyroptosis key protein GSDMD. Further, knockout of NLRP3 and FA-2b-β intervention, respectively, in BV2 cells resulted in a corresponding reduction in the levels of inflammatory mediators, including NLRP3, Casp1, ASC, TNF-α, and IL-1β. Mechanistically, FA-2b-β inhibited activation of nuclear factor kappa B (NF-κB) and downregulated the Nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) protein expression to suppress pyroptosis of BV2 cells. These findings suggested that FA-2b-β might represent a potential therapeutic agent for anti-neuroinflammation. FA-2b-β Alzheimer's disease neuroinflammatory NF-κB microglia NLRP3 inflammasome pyroptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Alzheimer's disease (AD) is a neurodegenerative disease with memory impairment, cognitive decline, and behavioral abnormalities as its main clinical manifestations, which seriously affects the quality of life of the elderly[ 1 ]. The pathological features of AD include the accumulation of beta-Amyloid (Aβ) and the formation of neurofibrillary tangles in the brain, with the aggregation of Aβ considered to be one of the central factors in the pathogenesis of AD[ 2 , 3 ]. Aβ 1−42 is a highly neurotoxic Aβ isoform that can exacerbate the development of AD by triggering pathological processes such as oxidative stress, inflammatory responses, and neuronal damage[ 4 , 5 ]. Neuroinflammation, one of the most important pathological processes in AD, is mainly mediated by innate immune cells-microglia in the brain[ 6 ]. Microglia play a dual role in the Aβ pathogenesis of AD. Normally, microglia eliminate Aβ aggregated in the brain by phagocytosis. However, overproduction of Aβ under pathological conditions leads to the overactivation of microglia, and these overactivated microglia produce more reactive oxygen species and pro-inflammatory factors and exhibit degraded phagocytosis, ultimately leading to increased neuronal damage[ 7 , 8 ]. Cell contents released from injured cells further promote microglia activation and enhance the inflammatory response[ 9 ]. At this stage, removing the initial inflammatory stimulus, such as Aβ, does not alleviate neuroinflammation[ 10 ], which may explain the ineffectiveness of anti-amyloid therapeutic strategies in the late stages of AD pathogenesis. Therefore, inhibition of Aβ-induced neuroinflammation, particularly through pathways modulating microglia polarisation, may be an important strategy for combatting AD. In the inflammatory signaling pathway, nuclear factor-κB (NF-κB) is a key transcription factor in regulating multiple inflammation-related genes' expression[ 11 ]. Hyperactivation of the NF-κB signaling pathway promotes microglia polarisation and exacerbates neuropathological changes in AD[ 12 , 13 ]. Therefore, inhibition of the activation of the NF-κB signaling pathway may be an effective anti-inflammatory strategy with potential therapeutic value in the treatment of AD. Nucleotide-binding oligomerization domain-like receptor protein 3 inflammasome (NLRP3 inflammasome) is one of the best-characterized inflammasomes that responds to a wide range of stimuli, including invading pathogens, host-cell-derived danger signals, and environmental stimuli and is composed of the receptor protein NLRP3, apoptosis-associated speckled-like protein (ASC), and cysteine-asparagine-specific protease 1 precursor (pro-casp1) a multimeric protein complex. Past studies have shown that alterations in the NF-κB signaling pathway often accompany activation of NLRP3 inflammasome. Natural products have recently received much attention in therapeutic research for neurodegenerative diseases. Agaricus blazei is a selenium-rich herbal medicine with active components showing significant biological effects in antioxidant, anti-inflammatory, and immunomodulatory properties[ 14 ]. In particular, FA-2b-β, a selenium mushroom extract from Qinba, had strong anti-inflammatory activity and could protect against various inflammatory diseases by regulating multiple cell signaling pathways[ 15 ]. However, whether FA-2b-β, a Qinba selenium mushroom extract, can modulate Aβ 1−42 -mediated neuroinflammation by inhibiting the NF-κB signaling pathway has not been systematically investigated. This study aimed to investigate the potential neuroprotective effects of FA-2b-β, a selenium mushroom extract from Qinba, in the pathological setting of AD, focusing on whether it modulates Aβ 1−42 -mediated microglia activation and its induced neuroinflammatory response through inhibition of the NF-κB signaling pathway. Providing new theoretical basis and potential therapeutic targets for the prevention and treatment of AD through in-depth analysis of the mechanism of action of FA-2b-β. Materials and methods 1. Reagents and antibodies Agaricus blazei extract FA-2b-β was separated, extracted, and identified by the Natural Products Research Laboratory, Lanzhou Institute of Physical Chemistry, Chinese Academy of Sciences, China. Aβ 1−42 was purchased from Sigma-Aldrich, USA (No. A9810). 2. Reagent Preparation Preparation of Aβ 1−42 solution: the protein lyophilized powder was dissolved in hexafluoro-isopropanol(Aladdin, Shanghai, China) to a final concentration of 1 mM, the solution was placed in a fume cupboard overnight to remove the isopropanol, and then the Aβ peptide was solubilized to a concentration of 5 mM by the addition of DMSO(Aladdin, Shanghai, China), and then diluted to 100 µM with DMEM medium[ 16 ]. FA-2b-β solution preparation: FA-2b-β particles were ground into powder form and dissolved in PBS, the large particulate matter was filtered using a sterile filter, and the PBS was diluted to 100 mg/ml and set aside. 3.BV2 Cell Culture and Treatment Mouse BV2 microglial cells were purchased from Wuhan Pricella Biotechnology Co., Ltd (Wuhan, China) and cultured in DMEM medium with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc) and 1% penicillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.) at 37°C under 5% CO 2 , and saturated humidity. (5,10) mg/ml FA-2b-β pretreated cells for 0.5h, then cultured with 1uM Aβ 1−42 . 4. Cell counting kit-8 assay The viability of BV-2 cells was evaluated using the CCK-8 assay when investigating the effects of FA-2b-β and Aβ 1−42 on BV-2 cell proliferation. In summary, BV-2 cells were seeded in 96-well plates at a density of 5 × 10 3 cells per well (5.0 × 10 4 cells/mL) and allowed to incubate for 24 to 36 hours. Subsequently, the cells were treated with Aβ 1−42 or FA-2b-β at varying concentration gradients for either 24 or 36 hours. Following treatment, the cells were exposed to 10 µL of CCK-8 solution (JingXin Biological Technology, Guangzhou, China) at 37°C for 1 to 2 hours, shielded from light. The absorbance of the samples at 450 nm was quantified utilizing a microplate reader. 5. Cell transfection The full-length NLRP3 fragment was inserted into the pcDNA3.1(+) vector (Invitrogen) and subsequently complexed with Lipofectamine 2000 reagent (Invitrogen), after which the DNA-liposome complex was introduced to BV2 microglial cells for transfection. BV2 cells were inoculated in 6-well plates at a density of 2 × 10 5 cells/well. Cells were transfected with siRNA to knockdown NLRP3 using Lipofectamine 2000 according to the manufacturer's instructions. Assessment of transfection efficiency through Western Blot analysis. 6. Immunofluorescent Staining The cell suspension containing 1–2×10 4 cells was seeded on the cell crawler in the six-well plate. 4h later, 1mL of complete medium was added to each well and placed in a 5% CO 2 incubator at 37℃ for 24h. After the corresponding treatment, each group's cells were treated, the medium was discarded, and 4% paraformaldehyde was added for fixation for 15 min. Clean with 1×PBS solution 3 times, permeate with 0.2% Triton X-100 at room temperature for 15 min, wash with PBS 3 times to remove residue, and block with 10% goat serum at room temperature for 1h. Then, cells were incubated with the primary antibody overnight at 4℃ and re-warmed at 37 ℃ for 30 min the next day, and the secondary antibody was added for incubation for 1 h in dark light. DAPI was used as a counterstain to mark the nuclei on BV2 cells. The fluorescence intensity of each group was observed under fluorescence microscope and photographed. 7. ELISA Cells were collected and lysed in RIPA lysis buffer, then centrifuged at 13,000×g for 10 min at 4°C. The supernatant was collected and the protein concentration was determined using the BCA protein concentration assay kit (Boster Biological Technology, Wuhan, China). Detection of TNF-α, IL-1β, and IL-6 levels using ELISA kits according to the manufacturer's instructions. 8. Reverse transcription polymerase chain reaction (RT-PCR) Total microglia RNA was extracted using TaKaRa MiniBEST Universal RNA Extraction Kit, after which the extracted total RNA was reverse transcribed into cDNA. PCR reaction conditions were set according to the manufacturer's instructions to detect mRNA expression levels, and the test was repeated three times. The RT-qPCR results were analyzed using the ΔΔCT method, where the ΔCT value is the difference between the CT value of the target gene and the CT value of the internal reference gene (GAPDH), and the ΔΔCT is the difference between the ΔCT of each experimental group and the ΔCT of the blank control group. Mean relative content = 2 −ΔΔCT was used to evaluate the expression level of target genes. The primers were designed by Sangon Biotech (Shanghai) Co., Ltd., and the primer sequences are shown in Table 1 . Table 1 PCR primer sequences. Gene Forward (5'-3') Reverse (5'-3') NLRP3 GGTGACTGTTGTGGCTGGTTCC CCTTCTGCTGCTTCCCTGGTTTAG casp-1 TGTATCCTGCCATTGTTGCCATCG TTTGCTGCCACCATCTCTGTCAC IkB-a CGAAGAGAAGCCGCTGACCATG CGTGCTACATCTGACTCCACCAAG P65 TGGAGTTGGGAGGCAAGAAGGG GGTCTGGATTCGCTGGCTAATGG ASC ACAATGACTGTGCTTAGAGACA CACAGCTCCAGACTCTTCTTTA TLR4 AACCTGCTCTACCTACACCT CCGAGAGATTGAGGAATCGAAG GAPDH AATGGATTTGGACGCATTGGT TTTGCACTGGTACGTGTTGAT 9. Western blot Total protein extraction from BV2 cells using RIPA lysis buffer (Beyotime, Shanghai, China) containing protease inhibitors and phosphatase inhibitors. After quantification of BCA proteins, the proteins were separated by electrophoresis on a 10% PAGE gel according to a sample volume of 20 µg of protein per well, and the separated proteins were transferred to a methanol pre-treated PVDF membrane (Millipore, Billerica, USA). After being closed with 5% skimmed milk solution for 2 hours at room temperature, the membranes were incubated with diluted primary antibodies overnight at 4°C. The next day, PVDF membranes were incubated with secondary antibodies for 2h at a 4℃ refrigerator. The membrane was eluted and exposed with ECL luminescent solution. 10. Transmission electron microscopy After the BV2 cells were treated with drugs, the cells were fixed by suspension in 2.5% glutaraldehyde solution for 1 h at room temperature and then transferred to 4°C for overnight storage to enhance fixation. 1% molybdenum tetroxide fixed at room temperature for 1 hour after PBS wash. The samples were sequentially dehydrated in gradient ethanol (50%, 70%, 90%, and 100%) for 15 min and then embedded in resin respectively, and cut into a thickness of 50–60 nm. The sections were transferred to a copper grid, stained with uranyl acetate and lead citrate, and visualized under a transmission electron microscope. 11. Statistical analysis Analyses of significant differences were performed by using one-way ANOVA and the T-test. All data were presented as means ± Standard Deviation (SD) from three independent repeated experiments. P value < 0.05 was defined as statistically significant. Statistics were performed using GraphPad Prism 8.0 Software. Results 1. Effect of Aβ 1−42 and FA-2b-β on the activity of BV2 microglial cells We first explored the cytotoxic effects of Aβ 1−42 and FA-2b-β on BV2 microglia successively using the CCK8 (Cell Counting Kit-8) assay—screening of optimal administration concentrations of FA-2b-β and Aβ 1−42 by drug effects on cellular activity. The drugs were grouped in concentration gradient settings and the absorbance at 450 nm was measured after treating BV2 microglia for 24 h or 48 h. The results showed that BV2 microglia activity was unaffected by the concentration of FA-2b-β at 5 mg/ml (Fig. 1 A). 0.25–1 µM Aβ 1−42 treatment for 24 h, or 0.5–1 µM Aβ 1−42 treatment for 48 h did not influence the BV2 cell viability (Fig. 1 B, C). Subsequent experimental administration concentrations were 5 mg/ml FA-2b-β, 1 µM Aβ 1−42 . 2. Effect of FA-2b-β on Aβ 1−42 -mediated inflammatory levels in microglia IL-6 and IL-1β are two pro-inflammatory cytokines that play an essential role in pyroptosis and are released through the activation of caspase-1 and inflammasomes[ 17 ]. TNF-α activates microglia by affecting the permeability of the blood-brain barrier and subsequently induces central nervous system inflammation[ 18 ]. We found that 1 µM Aβ 1−42 evoked increased release of TNF-α and IL-1β significantly at 18 h and 2 h after the stimulation, respectively (Fig. 2 A, B). We then treated the cells with FA-2b-β (5 mg/ml) for 30 min, followed by the Aβ 1−42 stimulation for 24 h. As shown in Fig. 2 A, C, FA-2b-β treatment decreases Aβ 1−42 -induced TNF-α and IL-1β secretion. 3. Effect of FA-2b-β on Aβ 1−42 -mediated NF-κB activation and NLRP3 inflammasomes levels in microglia P65, TLR4, and p-IκB-α are key proteins of the NF-κB signaling pathway and are widely involved in inflammatory response processes. NLRP3 combines with caspase-1 and ASC to form the NLRP3 inflammasomes, which become pro-inflammatory. It was showed that FA-2b-β pretreatment significantly restrained the NF-κB signaling pathway-related protein levels of P65, TLR4, and p-IκB-α in Aβ 1−42 -treated BV2 cells (Fig. 3 A, B, C), and significantly inhibited the activation of NLRP3 inflammasomes (Fig. 3 B, C). Transmission electron microscopy observed that the organelles of Aβ-treated BV2 cells were obviously swollen, and there were also perforations in the cell membranes. Still, these changes were significantly attenuated when FA-2b-β treatment was added (Fig. 3 D). This suggests that FA-2b-β may regulate Aβ 1−42 -mediated inflammatory responses and pyroptosis by inhibiting the activation of the NF-κB signaling pathway. 4. The NF-κB signaling pathway affects microglial cell pyroptosis and inflammation through the regulation of NLRP3 To elucidate whether the NF-κB pathway modulates microglial cell pyroptosis and inflammation through the targeting of NLRP3, we conducted both overexpression and knockdown of NLRP3 in microglial cells, with the transfection results illustrated in Fig. 4 A and Fig. 4 B. ELISA results showed that overexpression of microglial NLRP3 and NF-κB agonist intervention in BV2 cells showed equal levels of release of TNF-α, IL-1β, and IL-6, but after knockdown of microglial NLRP3, the effect of NF-κB agonist treatment was significantly suppressed (Fig. 4 C). Pyroptosis is mediated by the Pyroptosis execution protein GSDMD and triggered by the activation of NLRP3. It was shown that overexpression of NLRP3 in BV2 cells promotes the expression of p65, a key protein in the NF-κB signaling pathway that forms an NF-κB dimer with p50 and enters the nucleus to regulate inflammation, and NF-κB agonist treatment activates NLRP3 inflammasomes, increasing the production of caspase-1, both of which interventions lead to an increase in the expression of the key protein for pyroptosis, GSDMD (Fig. 4 D, E). All of these effects are significantly suppressed after knocking down NLRP3. These results suggest that activation of the NF-κB signaling pathway to promote microglial cell pyroptosis and inflammation is achieved through modulation of NLRP3 inflammasomes. 5. FA-2b-β regulates Aβ 1−42 -mediated NF-κB activation and inflammatory responses to inhibit microglial cell pyroptosis via the NLRP3 pathway According to the above results, Aβ 1−42 treatment of BV2 microglia triggers their inflammatory response, and FA-2b-β inhibits this process. After our previous study, we found that NLRP3 plays a key role in this process. Previous research has shown that the activation of NLRP3 inflammasomes cleaves Caspase-1 precursors, producing active Caspase-1, subsequently leading to elevated levels of IL-1β and IL-18. We knocked down microglial NLRP3 expression and examined transfection efficiency using immunoblotting (Fig. 4 A). Changes in effects induced by FA-2b-β treatment and knockdown of NLRP3 in the context of Aβ 1−42 intervention in BV2 cells were compared using Aβ 1−42 as a control. It was shown that knockout of NLRP3 and FA-2b-β treatment in BV2 cells resulted in the same level of inhibition of the NF-κB signaling pathway protein p65 (Figure. 5A), and pyroptosis-related proteins including NLRP3, Casp1, and ASC (Figure. 5A, C, D). Furthermore, the release of cytokines TNF-α and IL-1β exhibited a similar inhibitory effect from both interventions (Fig. 5 B). These results suggest that FA-2b-β may regulate Aβ 1−42 -mediated NF-κB activation and inflammatory responses to inhibit microglial cell pyroptosis via the NLRP3 pathway. Discussion In the pathogenesis of AD, Aβ 1−42 is considered the key causative factor, which damages neurons through its direct toxicity and accelerates disease progression by activating the inflammatory response[ 19 ]. Neuroinflammation plays a crucial role in Aβ 1−42 -mediated neurodegeneration, and the NLRP3 inflammasome and NF-κB signaling pathway, as the main inflammatory regulatory mechanisms[ 20 ], are important targets for study. NLRP3 is a pattern recognition receptor that senses the aggregation of Aβ 1−42 and activates an inflammatory response, ultimately exacerbating neuroinflammation by inducing the release of pro-inflammatory factors such as IL-1β and IL-18[ 21 ]. The NF-κB signaling pathway, however, acts as a central regulatory pathway of the inflammatory response, further exacerbating the inflammatory state of the nervous system through its downstream effector protein activation and the transcription of pro-inflammatory genes[ 22 ]. Thus, the interaction of the NLRP3 inflammasome with the NF-κB signaling pathway becomes a key component in the regulation of Aβ 1−42 -mediated neuroinflammation. Qinba selenium mushroom is a selenium-rich edible fungus, and its extract FA-2b-β has significant antioxidant, anti-inflammatory, and immunomodulatory activities[ 23 – 25 ]. In this study, we investigated for the first time the mechanism by which FA-2b-β regulates Aβ 1−42 -mediated NF-κB activation through the NLRP3 pathway to inhibit microglial cell pyroptosis. The results showed that Aβ 1−42 -induced NLRP3 inflammasome activation was significantly inhibited by FA-2b-β treatment. Also, FA-2b-β significantly inhibited the activation of the NF-κB signaling pathway, as evidenced by a reduction in nuclear translocation of p65 and significant inhibition of IκB-α degradation. However, GSDMD expression was no longer affected by activation of the NF-κB signaling pathway after the knockdown of NLRP3. In addition, the expression levels of the pro-inflammatory factors IL-1β, IL-6, and TNF-α were also significantly reduced after FA-2b-β treatment, further supporting the modulating effect of FA-2b-β on the inflammatory response. These results suggest that FA-2b-β may inhibit the occurrence of microglial cell pyroptosis by directly modulating the activation of NLRP3 inflammasome and NF-κB signaling pathways, which ultimately reduces Aβ 1−42 -induced neuroinflammation. This finding provides a new perspective on applying Qinba selenium mushroom extract in AD therapy. The mechanism of action of FA-2b-β in inhibiting NLRP3 inflammasome by modulating the NF-κB signaling pathway may involve several aspects. Firstly, as one of the main active components of FA-2b-β, selenium may affect NF-κB activation through its antioxidant and anti-inflammatory effects. Selenium has been shown to inhibit the activation of the NF-κB signaling pathway by modulating glutathione peroxidase (GPx) activity and reducing oxidative stress levels[ 26 , 27 ]. In addition, selenium can inhibit the activation of the NF-κB signaling pathway by modulating mitochondrial function and reducing oxidative stress production[ 28 ]. In turn, inhibiting the NF-κB signaling pathway by FA-2b-β may have blocked the transcription of its downstream pro-inflammatory genes by reducing the activation of NLRP3, further reducing the release of inflammatory factors. This study expands the understanding of the anti-inflammatory effects of FA-2b-β. Compared with traditional anti-inflammatory drugs, FA-2b-β, as a natural product, has the advantages of low toxicity and multi-target action and shows a good application prospect. Although this study reveals a potential mechanism by which FA-2b-β regulates Aβ 1−42 -mediated NF-κB activation through the NLRP3 pathway to inhibit microglial pyroptosis, some limitations remain. Firstly, this study was conducted mainly based on an in vitro cellular model, and the anti-inflammatory effect of FA-2b-β has not yet been validated in an animal model of AD. The pathological process of AD is complex, involving multiple cell types and signaling pathways, and future studies are needed further to validate the effects of FA-2b-β in animal models and evaluate its impact on cognitive function. Secondly, the inhibitory mechanism of FA-2b-β on NLRP3 inflammasome was not thoroughly analyzed in this study. Although the experimental results show that FA-2b-β can significantly inhibit the expression of NLRP3, ASC, and caspase-1, its specific action site and regulation mode still need further study. Future studies can further explore the direct action mechanism of FA-2b-β on NLRP3 inflammasome utilizing proteomics and molecular docking techniques. In addition, whether FA-2b-β acts by regulating other inflammation-related signaling pathways is also a concern. The Aβ 1−42 -mediated inflammatory response depends on NLRP3 and NF-κB signaling pathways but also MAPK, JAK/STAT, and PI3K/Akt signaling pathways also play an important role in regulating inflammation[ 29 – 31 ]. Therefore, future studies should comprehensively examine the regulatory effects of FA-2b-β on various inflammatory signaling pathways to understand its anti-inflammatory mechanism. Declarations Ethics approval and consent to participate: Not applicable Consent for publication: Not applicable Competing interests: The authors declare that they have no competing interests Funding: This work was supported by the Gansu Provincial Hospital cultivation program (No. ZX-62000001-2022-691), Gansu Youth Science and Technology Fund (No. 22JR11RA269), Postgraduate Innovation and Entrepreneurship Fund Programme of Gansu University of Traditional Chinese Medicine. Author Contribution Z.X. was a major contributor in writing the manuscript, and J.Y. prepared figures 1-3. J.F.prepared figures 4-5 Acknowledgements: Not applicable Data Availability The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. References Scheltens P, De Strooper B, Kivipelto M, Holstege H, Chételat G, Teunissen CE, et al. Alzheimer's disease. Lancet. 2021;397(10284):1577–90. 10.1016/s0140-6736(20)32205-4 . Lanznaster D, Hergesheimer RC, Bakkouche SE, Beltran S, Vourc’h P, Andres CR, et al. Aβ1–42 and Tau as Potential Biomarkers for Diagnosis and Prognosis of Amyotrophic Lateral Sclerosis. Int J Mol Sci. 2020;21(8). 10.3390/ijms21082911 . Rostagno AA. Pathogenesis of Alzheimer’s Disease. Int J Mol Sci. 2022;24(1). 10.3390/ijms24010107 . Chen Z, Balachandran YL, Chong WP, Chan KWY. Roles of Cytokines in Alzheimer’s Disease. Int J Mol Sci. 2024;25(11). 10.3390/ijms25115803 . Ng J, Kaur H, Collier T, Chang K, Brooks AES, Allison JR, et al. Site-specific glycation of Aβ1–42 affects fibril formation and is neurotoxic. J Biol Chem. 2019;294(22):8806–18. 10.1074/jbc.RA118.006846 . Leng F, Edison P. Neuroinflammation and microglial activation in Alzheimer disease: where do we go from here? Nat Rev Neurol. 2020;17(3):157–72. 10.1038/s41582-020-00435-y . Hansen DV, Hanson JE, Sheng M. Microglia in Alzheimer’s disease. J Cell Biol. 2018;217(2):459–72. 10.1083/jcb.201709069 . Li Q, Barres BA. Microglia and macrophages in brain homeostasis and disease. Nat Rev Immunol. 2017;18(4):225–42. 10.1038/nri.2017.125 . Gao C, Jiang J, Tan Y, Chen S. Microglia in neurodegenerative diseases: mechanism and potential therapeutic targets. Signal Transduct Target Ther. 2023;8(1). 10.1038/s41392-023-01588-0 . Zieneldien T, Kim J, Sawmiller D, Cao C. The Immune System as a Therapeutic Target for Alzheimer’s Disease. Life (Basel). 2022;12(9). 10.3390/life12091440 . Guo Q, Jin Y, Chen X, Ye X, Shen X, Lin M, et al. NF-κB in biology and targeted therapy: new insights and translational implications. Signal Transduct Target Ther. 2024;9(1). 10.1038/s41392-024-01757-9 . Gao C, Jiang J, Tan Y, Chen S. Microglia in neurodegenerative diseases: mechanism and potential therapeutic targets. Brain Behav Immun. 2023;8(1). 10.1038/s41392-023-01588-0 . Zhao K, Liu J, Sun T, Zeng L, Cai Z, Li Z, et al. The miR-25802/KLF4/NF-κB signaling axis regulates microglia-mediated neuroinflammation in Alzheimer’s disease. Brain Behav Immun. 2024;118:31–48. 10.1016/j.bbi.2024.02.016 . Hetland G, Tangen J-M, Mahmood F, Mirlashari MR, Nissen-Meyer LSH, Nentwich I, et al. Antitumor, Anti-inflammatory and Antiallergic Effects of Agaricus blazei Mushroom Extract and the Related Medicinal Basidiomycetes Mushrooms, Hericium erinaceus and Grifola frondosa: A Review of Preclinical and Clinical Studies. Nutrients. 2020;12(5):1339. 10.3390/nu12051339 . Sun Y, Cheng M, Dong L, Yang K, Ma Z, Yu S, et al. Agaricus blazei extract (FA–2–b–β) induces apoptosis in chronic myeloid leukemia cells. Oncol Lett. 2020;20(5):1. 10.3892/ol.2020.12133 . Fa M, Orozco IJ, Francis YI, Saeed F, Gong Y, Arancio O. Preparation of oligomeric beta-amyloid 1–42 and induction of synaptic plasticity impairment on hippocampal slices. J Vis Exp. 2010;4110.3791/1884. Hooftman A, Angiari S, Hester S, Corcoran SE, Runtsch MC, Ling C, et al. The Immunomodulatory Metabolite Itaconate Modifies NLRP3 and Inhibits Inflammasome Activation. Cell Metab. 2020;32(3):468–e787. 10.1016/j.cmet.2020.07.016 . Brás JP, Bravo J, Freitas J, Barbosa MA, Santos SG, Summavielle T, et al. TNF-alpha-induced microglia activation requires miR-342: impact on NF-kB signaling and neurotoxicity. Cell Death Dis. 2020;11(6). 10.1038/s41419-020-2626-6 . De Steffi ERB, Schaeverbeke J, Reinartz M, Luckett ES, Adamczuk K, Laere KV, Dupont P, Teunissen CE. Rik Vandenberghe and Koen Poesen. Longitudinal associations of serum biomarkers with early cognitive, amyloid and grey matter changes Brain. 2024;147(3):936–48. 10.1093/brain/awad330/7287977 Jin X, Liu MY, Zhang DF, Zhong X, Du K, Qian P, et al. Baicalin mitigates cognitive impairment and protects neurons from microglia-mediated neuroinflammation via suppressing NLRP3 inflammasomes and TLR4/NF‐κB signaling pathway. CNS Neurosci Ther. 2019;25(5):575–90. 10.1111/cns.13086 . Zhang D, Zhang Y, Pan J, Cao J, Sun X, Li X, et al. Degradation of NLRP3 by p62-dependent‐autophagy improves cognitive function in Alzheimer's disease by maintaining the phagocytic function of microglia. CNS Neurosci Ther. 2023;29(10):2826–42. 10.1111/cns.14219 . Li K, Ling H, Wang X, Xie Q, Gu C, Luo W, et al. The role of NF-κB signaling pathway in reactive astrocytes among neurodegeneration after methamphetamine exposure by integrated bioinformatics. Prog Neuropsychopharmacol Biol Psychiatry. 2024;129. 10.1016/j.pnpbp.2023.110909 . Hetland G, Tangen J-M, Mahmood F, Mirlashari MR, Nissen-Meyer LSH, Nentwich I, et al. Antitumor, Anti-inflammatory and Antiallergic Effects of Agaricus blazei Mushroom Extract and the Related Medicinal Basidiomycetes Mushrooms, Hericium erinaceus and Grifola frondosa: A Review of Preclinical and Clinical Studies. Nutrients. 2020;12(5). 10.3390/nu12051339 . Câmara Neto JF, Campelo MS, Cerqueira GS, de Miranda JAL, Guedes JAC, de Almeida RR, et al. Gastroprotective effect of hydroalcoholic extract from Agaricus blazei Murill against ethanol-induced gastric ulcer in mice. J Ethnopharmacol. 2022;292. 10.1016/j.jep.2022.115191 . Val CH, Brant F, Miranda AS, Rodrigues FG, Oliveira BCL, Santos EA, et al. Effect of mushroom Agaricus blazei on immune response and development of experimental cerebral malaria. Malar J. 2015;14(1). 10.1186/s12936-015-0832-y . Cheng H-L, Yen C-C, Huang L-W, Hu Y-C, Huang T-C, Hsieh B-S, et al. Selenium Lessens Osteoarthritis by Protecting Articular Chondrocytes from Oxidative Damage through Nrf2 and NF-κB Pathways. Int J Mol Sci. 2024;25(5). 10.3390/ijms25052511 . Xu R, Cao J-w, Xu T-c, Liu T-j, Zhu M-r, Guo M-y. Selenium deficiency induced inflammation and apoptosis via NF-κB and MAPKs pathways in muscle of common carp (Cyprinus carpio L). Fish Shellfish Immunol. 2023;138. 10.1016/j.fsi.2023.108847 . Yang H, Wang Z, Li L, Wang X, Wei X, Gou S, et al. Mannose coated selenium nanoparticles normalize intestinal homeostasis in mice and mitigate colitis by inhibiting NF-κB activation and enhancing glutathione peroxidase expression. J Nanobiotechnol. 2024;22(1). 10.1186/s12951-024-02861-2 . Xie Z, Park SY, Kim HY, Park HJ, Shin HK, Hong KW, et al. Concurrent Treatment with Taxifolin and Cilostazol on the Lowering of β-Amyloid Accumulation and Neurotoxicity via the Suppression of P-JAK2/P-STAT3/NF-κB/BACE1 Signaling Pathways. PLoS ONE. 2016;11(12). 10.1371/journal.pone.0168286 . Hu Y, Zhang X, Zhang J, Xia X, Li H, Qiu C, et al. Activated STAT3 signaling pathway by ligature-induced periodontitis could contribute to neuroinflammation and cognitive impairment in rats. J Neuroinflammation. 2021;18(1). 10.1186/s12974-021-02071-9 . Zhao X, Sun J, Xiong L, She L, Li L, Tang H, et al. β-amyloid binds to microglia Dectin-1 to induce inflammatory response in the pathogenesis of Alzheimer's disease. Int J Biol Sci. 2023;19(10):3249–65. 10.7150/ijbs.81900 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5902281","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":408154488,"identity":"dd1304e9-71b7-41f1-ab92-479b64c3321d","order_by":0,"name":"Zujun Xi","email":"","orcid":"","institution":"The First Clinical College of Gansu University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zujun","middleName":"","lastName":"Xi","suffix":""},{"id":408154489,"identity":"9ced82d0-0bb6-4626-9452-b532bad8d25d","order_by":1,"name":"Jin Yuan","email":"","orcid":"","institution":"The First Clinical College of Gansu University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jin","middleName":"","lastName":"Yuan","suffix":""},{"id":408154490,"identity":"40e11807-c3b5-4be5-ae69-4c9214555bdb","order_by":2,"name":"Junshun Fan","email":"","orcid":"","institution":"The First Clinical College of Gansu University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Junshun","middleName":"","lastName":"Fan","suffix":""},{"id":408154491,"identity":"98cc7c67-48eb-4b4a-b334-d9a5aaac49a5","order_by":3,"name":"Yanqing Sun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIie3RsQrCMBDG8QtCuhzOhUL7BEIlIBSKz5Ii1EVEcHEzodCp7gqCDyE4RwJu7l1FsEsXN11ER50aN8H89x8fxwHYbD9Y4Eh5vj/iOXUyZUa6hc4Y0JS38cANZ8ph7gHV3HdHoZkgIhHeBNMxhdG1rKHvd0QDcWAv2NKNpxSO22gNA9ZTTStSCo5hSnKy2HkIKtk1EdBEKOSa5C28GJIDkRkqneQUqRnpFiQjK5Gyl2DROjS4JQiq6nYVsR9szqeynvX9RvKRi4aveSffCpvNZvuLnufyQqJRm87cAAAAAElFTkSuQmCC","orcid":"","institution":"The First Clinical College of Gansu University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Yanqing","middleName":"","lastName":"Sun","suffix":""}],"badges":[],"createdAt":"2025-01-25 14:38:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5902281/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5902281/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":75097542,"identity":"e66b5ef5-b264-4875-aca5-dc450214c0bc","added_by":"auto","created_at":"2025-01-30 12:24:00","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":84723,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of FA-2b-β and Aβ\u003csub\u003e1-42\u003c/sub\u003e on the survival of BV2 microglial cells. (A) BV-2 cells were incubated with 0, 1, 2, 3, 4, 5, 6, 7,\u0026nbsp;and 8 mg/ml FA-2b-β for 24 h. Viability was determined by CCK-8 assay.\u0026nbsp;(B,\u0026nbsp;C) BV-2 cells were incubated with 0, 0.25, 0.5, 1, 2, 4, 6, 8, and 10 μM Aβ\u003csub\u003e1-42 \u003c/sub\u003efor 24 h or 48 h. Viability was determined by CCK-8 assay. *P\u0026lt;0.05, **P\u0026lt;0.01, compared with the Control group.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-5902281/v1/b505c64d166c7de3104fd2dc.png"},{"id":75097546,"identity":"ff3b3a1a-db0a-4750-a6dc-226d04019c02","added_by":"auto","created_at":"2025-01-30 12:24:00","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":28885,"visible":true,"origin":"","legend":"\u003cp\u003eFA-2b-β represses Aβ\u003csub\u003e1-42\u003c/sub\u003e-mediated inflammatory responses in BV2 cells. BV2 cells were pretreated with FA-2b-β (5 mg/ml) for 30 min and then exposed to Aβ\u003csub\u003e1-42\u003c/sub\u003e (1 μM) for 24 h. (A,\u0026nbsp;B) Levels of cytokines IL-1β and TNF-α in Aβ\u003csub\u003e1-42\u003c/sub\u003e-treated microglia for 0, 2, 6, 12, 18, and 24 h. (C,\u0026nbsp;D) The release of IL-1β and TNF-α was measured by using ELISA kits. *P\u0026lt;0.05,**P\u0026lt;0.01, compared with the Control group. \u003csup\u003e#\u003c/sup\u003eP \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared with the Aβ\u003csub\u003e1-42\u003c/sub\u003e group. Data are expressed as mean ± standard deviation (n = 3).\u003c/p\u003e","description":"","filename":"Onlinefloatimage22.png","url":"https://assets-eu.researchsquare.com/files/rs-5902281/v1/2503295821d112c8d2486ebd.png"},{"id":75097473,"identity":"050171ff-c54b-4c56-8db6-cfd1f8004b35","added_by":"auto","created_at":"2025-01-30 12:23:53","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":247374,"visible":true,"origin":"","legend":"\u003cp\u003eFA-2b-β represses Aβ\u003csub\u003e1-42\u003c/sub\u003e-mediated inflammatory responses in BV2 cells by inhibiting the activation of the NF-κB signaling pathway. (A) BV2 cells were subjected to immunofluorescent staining for P65 and the nuclei were stained using DAPI. Scale bar = 50 μm. (B) The mRNA level of Caspase-1, NLRP3, p-IκB-α, and TLR4 was measured by qRT-PCR. (C) The protein expression of caspase-1, NLRP3, p-IκB-α, and TLR4 were estimated by western blotting. (D) Representative transmission electron micrographs of pyroptosis. Red arrowhead: membrane pores. Scale bar: 2 μm. *P\u0026lt;0.05, **P\u0026lt;0.01, compared with the Control group. \u003csup\u003e#\u003c/sup\u003eP \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared with the Aβ\u003csub\u003e1-42\u003c/sub\u003e group. Data are expressed as mean ± standard deviation (n = 3).\u003c/p\u003e","description":"","filename":"Onlinefloatimage31.png","url":"https://assets-eu.researchsquare.com/files/rs-5902281/v1/078f8994c5c1fe19ea00cc23.png"},{"id":75097535,"identity":"21dde4d2-8156-4f13-acd4-eaea4ede6807","added_by":"auto","created_at":"2025-01-30 12:23:58","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":117577,"visible":true,"origin":"","legend":"\u003cp\u003eNF-κB signaling pathway targets NLRP3 to inhibit pyroptosis of BV2 microglia. Overexpression of NLRP3 in BV2 cells and use of an NF-kB agonist (Diprovocim). (A) The BV2 cells were transfected with NLRP3 siRNAs. The expression level of NLRP3 was detected by western blotting to verify the knockdown efficacy. (B) The expression level of NLRP3 was detected by western blotting to verify the transfection effect. (C) The release of TNF-α, IL-1β, and IL-6 was measured by using ELISA kits. (D) The mRNA level of P65, NLRP3, Caspase-1, and GSDMD was measured by qRT-PCR. (E) The protein expression of P65, NLRP3, Caspase-1, and GSDMD were estimated by western blotting. *P\u0026lt;0.05, **P\u0026lt;0.01, compared with the Control group. \u003csup\u003e#\u003c/sup\u003eP \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared with the Diprovocim group. Data are expressed as mean ± standard deviation (n = 3).\u003c/p\u003e","description":"","filename":"Onlinefloatimage42.png","url":"https://assets-eu.researchsquare.com/files/rs-5902281/v1/eba7fb222ff809592e42e3c2.png"},{"id":75097543,"identity":"13560319-c5c5-4fda-aceb-2ddb9d6daa3e","added_by":"auto","created_at":"2025-01-30 12:24:00","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":95647,"visible":true,"origin":"","legend":"\u003cp\u003eFA-2b-β inhibits microglial pyroptosis by regulating Aβ\u003csub\u003e1-42\u003c/sub\u003e-mediated NF-κB activation through the NLRP3 pathway. BV2 cells were pretreated with knockdown NLRP3 or FA-2b-β (5 mg/ml) and then exposed to Aβ\u003csub\u003e1-42\u003c/sub\u003e (1 μM) for 24h. (A) BV2 cells were subjected to immunofluorescent staining for P65 and ASC, and the nuclei were stained using DAPI. Scale bar = 50 μm. (B) The release of TNF-α and IL-1β was measured by using ELISA kits. (C) The protein expression of NLRP3, Caspase-1, and ASC were estimated by western blotting. (D) The mRNA level of NLRP3, Caspase-1, and ASC was measured by qRT-PCR. *P\u0026lt;0.05, **P\u0026lt;0.01, compared with the Aβ\u003csub\u003e1-42\u003c/sub\u003e group. \u003csup\u003e#\u003c/sup\u003eP \u0026lt; 0.05, \u003csup\u003e##\u003c/sup\u003eP\u0026lt;0.01, compared with the Aβ\u003csub\u003e1-42\u003c/sub\u003e+ si-NLRP3 group. Data are expressed as mean ± standard deviation (n = 3).\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5902281/v1/ee5b105ebd7265839433ee29.png"},{"id":75097709,"identity":"9549a6d3-cf44-48b7-bd33-a9eee48589df","added_by":"auto","created_at":"2025-01-30 12:32:01","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":934009,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5902281/v1/08b5d150-cae0-4ec3-b505-226d510700a0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Agaricus blazei extract FA-2b-β inhibits microglial pyroptosis by regulating the activation of the NF-κB signaling pathway mediated by Aβ 1-42 through the NLRP3 pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAlzheimer's disease (AD) is a neurodegenerative disease with memory impairment, cognitive decline, and behavioral abnormalities as its main clinical manifestations, which seriously affects the quality of life of the elderly[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The pathological features of AD include the accumulation of beta-Amyloid (Aβ) and the formation of neurofibrillary tangles in the brain, with the aggregation of Aβ considered to be one of the central factors in the pathogenesis of AD[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e is a highly neurotoxic Aβ isoform that can exacerbate the development of AD by triggering pathological processes such as oxidative stress, inflammatory responses, and neuronal damage[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Neuroinflammation, one of the most important pathological processes in AD, is mainly mediated by innate immune cells-microglia in the brain[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Microglia play a dual role in the Aβ pathogenesis of AD. Normally, microglia eliminate Aβ aggregated in the brain by phagocytosis. However, overproduction of Aβ under pathological conditions leads to the overactivation of microglia, and these overactivated microglia produce more reactive oxygen species and pro-inflammatory factors and exhibit degraded phagocytosis, ultimately leading to increased neuronal damage[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Cell contents released from injured cells further promote microglia activation and enhance the inflammatory response[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. At this stage, removing the initial inflammatory stimulus, such as Aβ, does not alleviate neuroinflammation[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], which may explain the ineffectiveness of anti-amyloid therapeutic strategies in the late stages of AD pathogenesis. Therefore, inhibition of Aβ-induced neuroinflammation, particularly through pathways modulating microglia polarisation, may be an important strategy for combatting AD. In the inflammatory signaling pathway, nuclear factor-κB (NF-κB) is a key transcription factor in regulating multiple inflammation-related genes' expression[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Hyperactivation of the NF-κB signaling pathway promotes microglia polarisation and exacerbates neuropathological changes in AD[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Therefore, inhibition of the activation of the NF-κB signaling pathway may be an effective anti-inflammatory strategy with potential therapeutic value in the treatment of AD. Nucleotide-binding oligomerization domain-like receptor protein 3 inflammasome (NLRP3 inflammasome) is one of the best-characterized inflammasomes that responds to a wide range of stimuli, including invading pathogens, host-cell-derived danger signals, and environmental stimuli and is composed of the receptor protein NLRP3, apoptosis-associated speckled-like protein (ASC), and cysteine-asparagine-specific protease 1 precursor (pro-casp1) a multimeric protein complex. Past studies have shown that alterations in the NF-κB signaling pathway often accompany activation of NLRP3 inflammasome.\u003c/p\u003e \u003cp\u003eNatural products have recently received much attention in therapeutic research for neurodegenerative diseases. Agaricus blazei is a selenium-rich herbal medicine with active components showing significant biological effects in antioxidant, anti-inflammatory, and immunomodulatory properties[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In particular, FA-2b-β, a selenium mushroom extract from Qinba, had strong anti-inflammatory activity and could protect against various inflammatory diseases by regulating multiple cell signaling pathways[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. However, whether FA-2b-β, a Qinba selenium mushroom extract, can modulate Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated neuroinflammation by inhibiting the NF-κB signaling pathway has not been systematically investigated. This study aimed to investigate the potential neuroprotective effects of FA-2b-β, a selenium mushroom extract from Qinba, in the pathological setting of AD, focusing on whether it modulates Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated microglia activation and its induced neuroinflammatory response through inhibition of the NF-κB signaling pathway. Providing new theoretical basis and potential therapeutic targets for the prevention and treatment of AD through in-depth analysis of the mechanism of action of FA-2b-β.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e1. Reagents and antibodies\u003c/p\u003e \u003cp\u003eAgaricus blazei extract FA-2b-β was separated, extracted, and identified by the Natural Products Research Laboratory, Lanzhou Institute of Physical Chemistry, Chinese Academy of Sciences, China. Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e was purchased from Sigma-Aldrich, USA (No. A9810).\u003c/p\u003e \u003cp\u003e2. Reagent Preparation\u003c/p\u003e \u003cp\u003ePreparation of Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e solution: the protein lyophilized powder was dissolved in hexafluoro-isopropanol(Aladdin, Shanghai, China) to a final concentration of 1 mM, the solution was placed in a fume cupboard overnight to remove the isopropanol, and then the Aβ peptide was solubilized to a concentration of 5 mM by the addition of DMSO(Aladdin, Shanghai, China), and then diluted to 100 \u0026micro;M with DMEM medium[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. FA-2b-β solution preparation: FA-2b-β particles were ground into powder form and dissolved in PBS, the large particulate matter was filtered using a sterile filter, and the PBS was diluted to 100 mg/ml and set aside.\u003c/p\u003e \u003cp\u003e3.BV2 Cell Culture and Treatment\u003c/p\u003e \u003cp\u003eMouse BV2 microglial cells were purchased from Wuhan Pricella Biotechnology Co., Ltd (Wuhan, China) and cultured in DMEM medium with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc) and 1% penicillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.) at 37\u0026deg;C under 5% CO\u003csub\u003e2\u003c/sub\u003e, and saturated humidity. (5,10) mg/ml FA-2b-β pretreated cells for 0.5h, then cultured with 1uM Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003e4. Cell counting kit-8 assay\u003c/p\u003e \u003cp\u003eThe viability of BV-2 cells was evaluated using the CCK-8 assay when investigating the effects of FA-2b-β and Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e on BV-2 cell proliferation. In summary, BV-2 cells were seeded in 96-well plates at a density of 5 \u0026times; 10\u003csup\u003e3\u003c/sup\u003e cells per well (5.0 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/mL) and allowed to incubate for 24 to 36 hours. Subsequently, the cells were treated with Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e or FA-2b-β at varying concentration gradients for either 24 or 36 hours. Following treatment, the cells were exposed to 10 \u0026micro;L of CCK-8 solution (JingXin Biological Technology, Guangzhou, China) at 37\u0026deg;C for 1 to 2 hours, shielded from light. The absorbance of the samples at 450 nm was quantified utilizing a microplate reader.\u003c/p\u003e \u003cp\u003e5. Cell transfection\u003c/p\u003e \u003cp\u003eThe full-length NLRP3 fragment was inserted into the pcDNA3.1(+) vector (Invitrogen) and subsequently complexed with Lipofectamine 2000 reagent (Invitrogen), after which the DNA-liposome complex was introduced to BV2 microglial cells for transfection. BV2 cells were inoculated in 6-well plates at a density of 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/well. Cells were transfected with siRNA to knockdown NLRP3 using Lipofectamine 2000 according to the manufacturer's instructions. Assessment of transfection efficiency through Western Blot analysis.\u003c/p\u003e \u003cp\u003e6. Immunofluorescent Staining\u003c/p\u003e \u003cp\u003eThe cell suspension containing 1\u0026ndash;2\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells was seeded on the cell crawler in the six-well plate. 4h later, 1mL of complete medium was added to each well and placed in a 5% CO\u003csub\u003e2\u003c/sub\u003e incubator at 37℃ for 24h. After the corresponding treatment, each group's cells were treated, the medium was discarded, and 4% paraformaldehyde was added for fixation for 15 min. Clean with 1\u0026times;PBS solution 3 times, permeate with 0.2% Triton X-100 at room temperature for 15 min, wash with PBS 3 times to remove residue, and block with 10% goat serum at room temperature for 1h. Then, cells were incubated with the primary antibody overnight at 4℃ and re-warmed at 37 ℃ for 30 min the next day, and the secondary antibody was added for incubation for 1 h in dark light. DAPI was used as a counterstain to mark the nuclei on BV2 cells. The fluorescence intensity of each group was observed under fluorescence microscope and photographed.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e7. ELISA\u003c/h2\u003e \u003cp\u003eCells were collected and lysed in RIPA lysis buffer, then centrifuged at 13,000\u0026times;g for 10 min at 4\u0026deg;C. The supernatant was collected and the protein concentration was determined using the BCA protein concentration assay kit (Boster Biological Technology, Wuhan, China). Detection of TNF-α, IL-1β, and IL-6 levels using ELISA kits according to the manufacturer's instructions.\u003c/p\u003e \u003cp\u003e8. Reverse transcription polymerase chain reaction (RT-PCR)\u003c/p\u003e \u003cp\u003eTotal microglia RNA was extracted using TaKaRa MiniBEST Universal RNA Extraction Kit, after which the extracted total RNA was reverse transcribed into cDNA. PCR reaction conditions were set according to the manufacturer's instructions to detect mRNA expression levels, and the test was repeated three times. The RT-qPCR results were analyzed using the ΔΔCT method, where the ΔCT value is the difference between the CT value of the target gene and the CT value of the internal reference gene (GAPDH), and the ΔΔCT is the difference between the ΔCT of each experimental group and the ΔCT of the blank control group. Mean relative content\u0026thinsp;=\u0026thinsp;2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e was used to evaluate the expression level of target genes. The primers were designed by Sangon Biotech (Shanghai) Co., Ltd., and the primer sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCR primer sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eForward (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse (5'-3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNLRP3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eGGTGACTGTTGTGGCTGGTTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCTTCTGCTGCTTCCCTGGTTTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ecasp-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eTGTATCCTGCCATTGTTGCCATCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTTGCTGCCACCATCTCTGTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIkB-a\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eCGAAGAGAAGCCGCTGACCATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGTGCTACATCTGACTCCACCAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eTGGAGTTGGGAGGCAAGAAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGTCTGGATTCGCTGGCTAATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eASC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eACAATGACTGTGCTTAGAGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACAGCTCCAGACTCTTCTTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTLR4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACCTGCTCTACCTACACCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCGAGAGATTGAGGAATCGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAATGGATTTGGACGCATTGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTTTGCACTGGTACGTGTTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e9. Western blot\u003c/p\u003e \u003cp\u003eTotal protein extraction from BV2 cells using RIPA lysis buffer (Beyotime, Shanghai, China) containing protease inhibitors and phosphatase inhibitors. After quantification of BCA proteins, the proteins were separated by electrophoresis on a 10% PAGE gel according to a sample volume of 20 \u0026micro;g of protein per well, and the separated proteins were transferred to a methanol pre-treated PVDF membrane (Millipore, Billerica, USA). After being closed with 5% skimmed milk solution for 2 hours at room temperature, the membranes were incubated with diluted primary antibodies overnight at 4\u0026deg;C. The next day, PVDF membranes were incubated with secondary antibodies for 2h at a 4℃ refrigerator. The membrane was eluted and exposed with ECL luminescent solution.\u003c/p\u003e \u003cp\u003e10. Transmission electron microscopy\u003c/p\u003e \u003cp\u003eAfter the BV2 cells were treated with drugs, the cells were fixed by suspension in 2.5% glutaraldehyde solution for 1 h at room temperature and then transferred to 4\u0026deg;C for overnight storage to enhance fixation. 1% molybdenum tetroxide fixed at room temperature for 1 hour after PBS wash. The samples were sequentially dehydrated in gradient ethanol (50%, 70%, 90%, and 100%) for 15 min and then embedded in resin respectively, and cut into a thickness of 50\u0026ndash;60 nm. The sections were transferred to a copper grid, stained with uranyl acetate and lead citrate, and visualized under a transmission electron microscope.\u003c/p\u003e \u003cp\u003e11. Statistical analysis\u003c/p\u003e \u003cp\u003eAnalyses of significant differences were performed by using one-way ANOVA and the T-test. All data were presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;Standard Deviation (SD) from three independent repeated experiments. P value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was defined as statistically significant. Statistics were performed using GraphPad Prism 8.0 Software.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e1. Effect of Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e and FA-2b-β on the activity of BV2 microglial cells\u003c/p\u003e \u003cp\u003eWe first explored the cytotoxic effects of Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e and FA-2b-β on BV2 microglia successively using the CCK8 (Cell Counting Kit-8) assay\u0026mdash;screening of optimal administration concentrations of FA-2b-β and Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e by drug effects on cellular activity. The drugs were grouped in concentration gradient settings and the absorbance at 450 nm was measured after treating BV2 microglia for 24 h or 48 h. The results showed that BV2 microglia activity was unaffected by the concentration of FA-2b-β at 5 mg/ml (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). 0.25\u0026ndash;1 \u0026micro;M Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e treatment for 24 h, or 0.5\u0026ndash;1 \u0026micro;M Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e treatment for 48 h did not influence the BV2 cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, C). Subsequent experimental administration concentrations were 5 mg/ml FA-2b-β, 1 \u0026micro;M Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e2. Effect of FA-2b-β on Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated inflammatory levels in microglia\u003c/p\u003e \u003cp\u003eIL-6 and IL-1β are two pro-inflammatory cytokines that play an essential role in pyroptosis and are released through the activation of caspase-1 and inflammasomes[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. TNF-α activates microglia by affecting the permeability of the blood-brain barrier and subsequently induces central nervous system inflammation[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. We found that 1 \u0026micro;M Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e evoked increased release of TNF-α and IL-1β significantly at 18 h and 2 h after the stimulation, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B). We then treated the cells with FA-2b-β (5 mg/ml) for 30 min, followed by the Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e stimulation for 24 h. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, C, FA-2b-β treatment decreases Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-induced TNF-α and IL-1β secretion.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e3. Effect of FA-2b-β on Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated NF-κB activation and NLRP3 inflammasomes levels in microglia\u003c/p\u003e \u003cp\u003eP65, TLR4, and p-IκB-α are key proteins of the NF-κB signaling pathway and are widely involved in inflammatory response processes. NLRP3 combines with caspase-1 and ASC to form the NLRP3 inflammasomes, which become pro-inflammatory. It was showed that FA-2b-β pretreatment significantly restrained the NF-κB signaling pathway-related protein levels of P65, TLR4, and p-IκB-α in Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-treated BV2 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B, C), and significantly inhibited the activation of NLRP3 inflammasomes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, C). Transmission electron microscopy observed that the organelles of Aβ-treated BV2 cells were obviously swollen, and there were also perforations in the cell membranes. Still, these changes were significantly attenuated when FA-2b-β treatment was added (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). This suggests that FA-2b-β may regulate Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated inflammatory responses and pyroptosis by inhibiting the activation of the NF-κB signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e4. The NF-κB signaling pathway affects microglial cell pyroptosis and inflammation through the regulation of NLRP3\u003c/p\u003e \u003cp\u003eTo elucidate whether the NF-κB pathway modulates microglial cell pyroptosis and inflammation through the targeting of NLRP3, we conducted both overexpression and knockdown of NLRP3 in microglial cells, with the transfection results illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB. ELISA results showed that overexpression of microglial NLRP3 and NF-κB agonist intervention in BV2 cells showed equal levels of release of TNF-α, IL-1β, and IL-6, but after knockdown of microglial NLRP3, the effect of NF-κB agonist treatment was significantly suppressed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Pyroptosis is mediated by the Pyroptosis execution protein GSDMD and triggered by the activation of NLRP3. It was shown that overexpression of NLRP3 in BV2 cells promotes the expression of p65, a key protein in the NF-κB signaling pathway that forms an NF-κB dimer with p50 and enters the nucleus to regulate inflammation, and NF-κB agonist treatment activates NLRP3 inflammasomes, increasing the production of caspase-1, both of which interventions lead to an increase in the expression of the key protein for pyroptosis, GSDMD (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, E). All of these effects are significantly suppressed after knocking down NLRP3. These results suggest that activation of the NF-κB signaling pathway to promote microglial cell pyroptosis and inflammation is achieved through modulation of NLRP3 inflammasomes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e5. FA-2b-β regulates Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated NF-κB activation and inflammatory responses to inhibit microglial cell pyroptosis via the NLRP3 pathway\u003c/p\u003e \u003cp\u003eAccording to the above results, Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e treatment of BV2 microglia triggers their inflammatory response, and FA-2b-β inhibits this process. After our previous study, we found that NLRP3 plays a key role in this process. Previous research has shown that the activation of NLRP3 inflammasomes cleaves Caspase-1 precursors, producing active Caspase-1, subsequently leading to elevated levels of IL-1β and IL-18. We knocked down microglial NLRP3 expression and examined transfection efficiency using immunoblotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Changes in effects induced by FA-2b-β treatment and knockdown of NLRP3 in the context of Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e intervention in BV2 cells were compared using Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e as a control. It was shown that knockout of NLRP3 and FA-2b-β treatment in BV2 cells resulted in the same level of inhibition of the NF-κB signaling pathway protein p65 (Figure. 5A), and pyroptosis-related proteins including NLRP3, Casp1, and ASC (Figure. 5A, C, D). Furthermore, the release of cytokines TNF-α and IL-1β exhibited a similar inhibitory effect from both interventions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). These results suggest that FA-2b-β may regulate Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated NF-κB activation and inflammatory responses to inhibit microglial cell pyroptosis via the NLRP3 pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the pathogenesis of AD, Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e is considered the key causative factor, which damages neurons through its direct toxicity and accelerates disease progression by activating the inflammatory response[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Neuroinflammation plays a crucial role in Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated neurodegeneration, and the NLRP3 inflammasome and NF-κB signaling pathway, as the main inflammatory regulatory mechanisms[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], are important targets for study. NLRP3 is a pattern recognition receptor that senses the aggregation of Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e and activates an inflammatory response, ultimately exacerbating neuroinflammation by inducing the release of pro-inflammatory factors such as IL-1β and IL-18[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The NF-κB signaling pathway, however, acts as a central regulatory pathway of the inflammatory response, further exacerbating the inflammatory state of the nervous system through its downstream effector protein activation and the transcription of pro-inflammatory genes[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Thus, the interaction of the NLRP3 inflammasome with the NF-κB signaling pathway becomes a key component in the regulation of Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated neuroinflammation.\u003c/p\u003e \u003cp\u003eQinba selenium mushroom is a selenium-rich edible fungus, and its extract FA-2b-β has significant antioxidant, anti-inflammatory, and immunomodulatory activities[\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In this study, we investigated for the first time the mechanism by which FA-2b-β regulates Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated NF-κB activation through the NLRP3 pathway to inhibit microglial cell pyroptosis. The results showed that Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-induced NLRP3 inflammasome activation was significantly inhibited by FA-2b-β treatment. Also, FA-2b-β significantly inhibited the activation of the NF-κB signaling pathway, as evidenced by a reduction in nuclear translocation of p65 and significant inhibition of IκB-α degradation. However, GSDMD expression was no longer affected by activation of the NF-κB signaling pathway after the knockdown of NLRP3. In addition, the expression levels of the pro-inflammatory factors IL-1β, IL-6, and TNF-α were also significantly reduced after FA-2b-β treatment, further supporting the modulating effect of FA-2b-β on the inflammatory response. These results suggest that FA-2b-β may inhibit the occurrence of microglial cell pyroptosis by directly modulating the activation of NLRP3 inflammasome and NF-κB signaling pathways, which ultimately reduces Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-induced neuroinflammation. This finding provides a new perspective on applying Qinba selenium mushroom extract in AD therapy. The mechanism of action of FA-2b-β in inhibiting NLRP3 inflammasome by modulating the NF-κB signaling pathway may involve several aspects. Firstly, as one of the main active components of FA-2b-β, selenium may affect NF-κB activation through its antioxidant and anti-inflammatory effects. Selenium has been shown to inhibit the activation of the NF-κB signaling pathway by modulating glutathione peroxidase (GPx) activity and reducing oxidative stress levels[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In addition, selenium can inhibit the activation of the NF-κB signaling pathway by modulating mitochondrial function and reducing oxidative stress production[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In turn, inhibiting the NF-κB signaling pathway by FA-2b-β may have blocked the transcription of its downstream pro-inflammatory genes by reducing the activation of NLRP3, further reducing the release of inflammatory factors. This study expands the understanding of the anti-inflammatory effects of FA-2b-β. Compared with traditional anti-inflammatory drugs, FA-2b-β, as a natural product, has the advantages of low toxicity and multi-target action and shows a good application prospect.\u003c/p\u003e \u003cp\u003eAlthough this study reveals a potential mechanism by which FA-2b-β regulates Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated NF-κB activation through the NLRP3 pathway to inhibit microglial pyroptosis, some limitations remain. Firstly, this study was conducted mainly based on an in vitro cellular model, and the anti-inflammatory effect of FA-2b-β has not yet been validated in an animal model of AD. The pathological process of AD is complex, involving multiple cell types and signaling pathways, and future studies are needed further to validate the effects of FA-2b-β in animal models and evaluate its impact on cognitive function. Secondly, the inhibitory mechanism of FA-2b-β on NLRP3 inflammasome was not thoroughly analyzed in this study. Although the experimental results show that FA-2b-β can significantly inhibit the expression of NLRP3, ASC, and caspase-1, its specific action site and regulation mode still need further study. Future studies can further explore the direct action mechanism of FA-2b-β on NLRP3 inflammasome utilizing proteomics and molecular docking techniques. In addition, whether FA-2b-β acts by regulating other inflammation-related signaling pathways is also a concern. The Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated inflammatory response depends on NLRP3 and NF-κB signaling pathways but also MAPK, JAK/STAT, and PI3K/Akt signaling pathways also play an important role in regulating inflammation[\u003cspan additionalcitationids=\"CR30\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Therefore, future studies should comprehensively examine the regulatory effects of FA-2b-β on various inflammatory signaling pathways to understand its anti-inflammatory mechanism.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eEthics approval and consent to participate:\u003c/h2\u003e \u003cp\u003eNot applicable\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication:\u003c/strong\u003e \u003cp\u003eNot applicable\u003c/p\u003e \u003ch2\u003eCompeting interests:\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e \u003cp\u003eThis work was supported by the Gansu Provincial Hospital cultivation program (No. ZX-62000001-2022-691), Gansu Youth Science and Technology Fund (No. 22JR11RA269), Postgraduate Innovation and Entrepreneurship Fund Programme of Gansu University of Traditional Chinese Medicine.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eZ.X. was a major contributor in writing the manuscript, and J.Y. prepared figures 1-3. J.F.prepared figures 4-5\u003c/p\u003e\u003ch2\u003eAcknowledgements:\u003c/h2\u003e \u003cp\u003eNot applicable\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eScheltens P, De Strooper B, Kivipelto M, Holstege H, Ch\u0026eacute;telat G, Teunissen CE, et al. Alzheimer's disease. Lancet. 2021;397(10284):1577\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0140-6736(20)32205-4\u003c/span\u003e\u003cspan address=\"10.1016/s0140-6736(20)32205-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLanznaster D, Hergesheimer RC, Bakkouche SE, Beltran S, Vourc\u0026rsquo;h P, Andres CR, et al. Aβ1\u0026ndash;42 and Tau as Potential Biomarkers for Diagnosis and Prognosis of Amyotrophic Lateral Sclerosis. Int J Mol Sci. 2020;21(8). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms21082911\u003c/span\u003e\u003cspan address=\"10.3390/ijms21082911\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRostagno AA. Pathogenesis of Alzheimer\u0026rsquo;s Disease. Int J Mol Sci. 2022;24(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms24010107\u003c/span\u003e\u003cspan address=\"10.3390/ijms24010107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Z, Balachandran YL, Chong WP, Chan KWY. Roles of Cytokines in Alzheimer\u0026rsquo;s Disease. Int J Mol Sci. 2024;25(11). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms25115803\u003c/span\u003e\u003cspan address=\"10.3390/ijms25115803\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNg J, Kaur H, Collier T, Chang K, Brooks AES, Allison JR, et al. Site-specific glycation of Aβ1\u0026ndash;42 affects fibril formation and is neurotoxic. J Biol Chem. 2019;294(22):8806\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1074/jbc.RA118.006846\u003c/span\u003e\u003cspan address=\"10.1074/jbc.RA118.006846\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeng F, Edison P. Neuroinflammation and microglial activation in Alzheimer disease: where do we go from here? Nat Rev Neurol. 2020;17(3):157\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41582-020-00435-y\u003c/span\u003e\u003cspan address=\"10.1038/s41582-020-00435-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHansen DV, Hanson JE, Sheng M. Microglia in Alzheimer\u0026rsquo;s disease. J Cell Biol. 2018;217(2):459\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1083/jcb.201709069\u003c/span\u003e\u003cspan address=\"10.1083/jcb.201709069\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Q, Barres BA. Microglia and macrophages in brain homeostasis and disease. Nat Rev Immunol. 2017;18(4):225\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nri.2017.125\u003c/span\u003e\u003cspan address=\"10.1038/nri.2017.125\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao C, Jiang J, Tan Y, Chen S. Microglia in neurodegenerative diseases: mechanism and potential therapeutic targets. Signal Transduct Target Ther. 2023;8(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-023-01588-0\u003c/span\u003e\u003cspan address=\"10.1038/s41392-023-01588-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZieneldien T, Kim J, Sawmiller D, Cao C. The Immune System as a Therapeutic Target for Alzheimer\u0026rsquo;s Disease. Life (Basel). 2022;12(9). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/life12091440\u003c/span\u003e\u003cspan address=\"10.3390/life12091440\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Q, Jin Y, Chen X, Ye X, Shen X, Lin M, et al. NF-κB in biology and targeted therapy: new insights and translational implications. Signal Transduct Target Ther. 2024;9(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-024-01757-9\u003c/span\u003e\u003cspan address=\"10.1038/s41392-024-01757-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao C, Jiang J, Tan Y, Chen S. Microglia in neurodegenerative diseases: mechanism and potential therapeutic targets. Brain Behav Immun. 2023;8(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41392-023-01588-0\u003c/span\u003e\u003cspan address=\"10.1038/s41392-023-01588-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao K, Liu J, Sun T, Zeng L, Cai Z, Li Z, et al. The miR-25802/KLF4/NF-κB signaling axis regulates microglia-mediated neuroinflammation in Alzheimer\u0026rsquo;s disease. Brain Behav Immun. 2024;118:31\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbi.2024.02.016\u003c/span\u003e\u003cspan address=\"10.1016/j.bbi.2024.02.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHetland G, Tangen J-M, Mahmood F, Mirlashari MR, Nissen-Meyer LSH, Nentwich I, et al. Antitumor, Anti-inflammatory and Antiallergic Effects of Agaricus blazei Mushroom Extract and the Related Medicinal Basidiomycetes Mushrooms, Hericium erinaceus and Grifola frondosa: A Review of Preclinical and Clinical Studies. Nutrients. 2020;12(5):1339. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/nu12051339\u003c/span\u003e\u003cspan address=\"10.3390/nu12051339\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun Y, Cheng M, Dong L, Yang K, Ma Z, Yu S, et al. Agaricus blazei extract (FA\u0026ndash;2\u0026ndash;b\u0026ndash;β) induces apoptosis in chronic myeloid leukemia cells. Oncol Lett. 2020;20(5):1. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/ol.2020.12133\u003c/span\u003e\u003cspan address=\"10.3892/ol.2020.12133\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFa M, Orozco IJ, Francis YI, Saeed F, Gong Y, Arancio O. Preparation of oligomeric beta-amyloid 1\u0026ndash;42 and induction of synaptic plasticity impairment on hippocampal slices. J Vis Exp. 2010;4110.3791/1884.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHooftman A, Angiari S, Hester S, Corcoran SE, Runtsch MC, Ling C, et al. The Immunomodulatory Metabolite Itaconate Modifies NLRP3 and Inhibits Inflammasome Activation. Cell Metab. 2020;32(3):468\u0026ndash;e787. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cmet.2020.07.016\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2020.07.016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBr\u0026aacute;s JP, Bravo J, Freitas J, Barbosa MA, Santos SG, Summavielle T, et al. TNF-alpha-induced microglia activation requires miR-342: impact on NF-kB signaling and neurotoxicity. Cell Death Dis. 2020;11(6). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41419-020-2626-6\u003c/span\u003e\u003cspan address=\"10.1038/s41419-020-2626-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Steffi ERB, Schaeverbeke J, Reinartz M, Luckett ES, Adamczuk K, Laere KV, Dupont P, Teunissen CE. Rik Vandenberghe and Koen Poesen. Longitudinal associations of serum biomarkers with early cognitive, amyloid and grey matter changes Brain. 2024;147(3):936\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/brain/awad330/7287977\u003c/span\u003e\u003cspan address=\"10.1093/brain/awad330/7287977\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin X, Liu MY, Zhang DF, Zhong X, Du K, Qian P, et al. Baicalin mitigates cognitive impairment and protects neurons from microglia-mediated neuroinflammation via suppressing NLRP3 inflammasomes and TLR4/NF‐κB signaling pathway. CNS Neurosci Ther. 2019;25(5):575\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cns.13086\u003c/span\u003e\u003cspan address=\"10.1111/cns.13086\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang D, Zhang Y, Pan J, Cao J, Sun X, Li X, et al. Degradation of NLRP3 by p62-dependent‐autophagy improves cognitive function in Alzheimer's disease by maintaining the phagocytic function of microglia. CNS Neurosci Ther. 2023;29(10):2826\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/cns.14219\u003c/span\u003e\u003cspan address=\"10.1111/cns.14219\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi K, Ling H, Wang X, Xie Q, Gu C, Luo W, et al. The role of NF-κB signaling pathway in reactive astrocytes among neurodegeneration after methamphetamine exposure by integrated bioinformatics. Prog Neuropsychopharmacol Biol Psychiatry. 2024;129. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pnpbp.2023.110909\u003c/span\u003e\u003cspan address=\"10.1016/j.pnpbp.2023.110909\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHetland G, Tangen J-M, Mahmood F, Mirlashari MR, Nissen-Meyer LSH, Nentwich I, et al. Antitumor, Anti-inflammatory and Antiallergic Effects of Agaricus blazei Mushroom Extract and the Related Medicinal Basidiomycetes Mushrooms, Hericium erinaceus and Grifola frondosa: A Review of Preclinical and Clinical Studies. Nutrients. 2020;12(5). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/nu12051339\u003c/span\u003e\u003cspan address=\"10.3390/nu12051339\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC\u0026acirc;mara Neto JF, Campelo MS, Cerqueira GS, de Miranda JAL, Guedes JAC, de Almeida RR, et al. Gastroprotective effect of hydroalcoholic extract from Agaricus blazei Murill against ethanol-induced gastric ulcer in mice. J Ethnopharmacol. 2022;292. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jep.2022.115191\u003c/span\u003e\u003cspan address=\"10.1016/j.jep.2022.115191\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVal CH, Brant F, Miranda AS, Rodrigues FG, Oliveira BCL, Santos EA, et al. Effect of mushroom Agaricus blazei on immune response and development of experimental cerebral malaria. Malar J. 2015;14(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12936-015-0832-y\u003c/span\u003e\u003cspan address=\"10.1186/s12936-015-0832-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng H-L, Yen C-C, Huang L-W, Hu Y-C, Huang T-C, Hsieh B-S, et al. Selenium Lessens Osteoarthritis by Protecting Articular Chondrocytes from Oxidative Damage through Nrf2 and NF-κB Pathways. Int J Mol Sci. 2024;25(5). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms25052511\u003c/span\u003e\u003cspan address=\"10.3390/ijms25052511\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu R, Cao J-w, Xu T-c, Liu T-j, Zhu M-r, Guo M-y. Selenium deficiency induced inflammation and apoptosis via NF-κB and MAPKs pathways in muscle of common carp (Cyprinus carpio L). Fish Shellfish Immunol. 2023;138. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.fsi.2023.108847\u003c/span\u003e\u003cspan address=\"10.1016/j.fsi.2023.108847\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang H, Wang Z, Li L, Wang X, Wei X, Gou S, et al. Mannose coated selenium nanoparticles normalize intestinal homeostasis in mice and mitigate colitis by inhibiting NF-κB activation and enhancing glutathione peroxidase expression. J Nanobiotechnol. 2024;22(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12951-024-02861-2\u003c/span\u003e\u003cspan address=\"10.1186/s12951-024-02861-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie Z, Park SY, Kim HY, Park HJ, Shin HK, Hong KW, et al. Concurrent Treatment with Taxifolin and Cilostazol on the Lowering of β-Amyloid Accumulation and Neurotoxicity via the Suppression of P-JAK2/P-STAT3/NF-κB/BACE1 Signaling Pathways. PLoS ONE. 2016;11(12). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0168286\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0168286\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Y, Zhang X, Zhang J, Xia X, Li H, Qiu C, et al. Activated STAT3 signaling pathway by ligature-induced periodontitis could contribute to neuroinflammation and cognitive impairment in rats. J Neuroinflammation. 2021;18(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12974-021-02071-9\u003c/span\u003e\u003cspan address=\"10.1186/s12974-021-02071-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao X, Sun J, Xiong L, She L, Li L, Tang H, et al. β-amyloid binds to microglia Dectin-1 to induce inflammatory response in the pathogenesis of Alzheimer's disease. Int J Biol Sci. 2023;19(10):3249\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7150/ijbs.81900\u003c/span\u003e\u003cspan address=\"10.7150/ijbs.81900\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"FA-2b-β, Alzheimer's disease, neuroinflammatory, NF-κB, microglia, NLRP3 inflammasome, pyroptosis","lastPublishedDoi":"10.21203/rs.3.rs-5902281/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5902281/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAlzheimer's disease (AD) is a progressive neurodegenerative disorder. Intracellular neurofibrillary tangles (NFTs) and neuroinflammatory plaques formed by amyloid-β (Aβ) are the main pathological features of AD. FA-2b-β, a selenium mushroom extract from Qinba, had strong anti-inflammatory activity and could protect against various inflammatory diseases by regulating multiple signaling pathways. However, whether FA-2b-β can modulate Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated neuroinflammation by inhibiting the NF-κB signaling pathway has not been systematically investigated. The present study aimed to explore the effect and mechanism of action of FA-2b-β on Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated microglia inflammation. The results showed that FA-2b-β reduced Aβ\u003csub\u003e1\u0026minus;42\u003c/sub\u003e-mediated release of tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β), and the expression of key proteins of NF-κB signaling pathway TLR4 and p-IκB-α, and NLRP3 Inflammasome associated with NLRP3 and Caspase1. However, activation of the NF-κB signaling pathway activates NLRP3 inflammasome and leads to increased expression of pyroptosis key protein GSDMD. Further, knockout of NLRP3 and FA-2b-β intervention, respectively, in BV2 cells resulted in a corresponding reduction in the levels of inflammatory mediators, including NLRP3, Casp1, ASC, TNF-α, and IL-1β. Mechanistically, FA-2b-β inhibited activation of nuclear factor kappa B (NF-κB) and downregulated the Nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) protein expression to suppress pyroptosis of BV2 cells. These findings suggested that FA-2b-β might represent a potential therapeutic agent for anti-neuroinflammation.\u003c/p\u003e","manuscriptTitle":"Agaricus blazei extract FA-2b-β inhibits microglial pyroptosis by regulating the activation of the NF-κB signaling pathway mediated by Aβ 1-42 through the NLRP3 pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-30 12:23:25","doi":"10.21203/rs.3.rs-5902281/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cb2dad2a-baf2-4531-8917-250fca83e09c","owner":[],"postedDate":"January 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-30T12:23:42+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-30 12:23:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5902281","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5902281","identity":"rs-5902281","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00