FruR-controlled antisense RNA -downregulation of isocitrate dehydrogenase in Escherichia coli

FruR-controlled antisense RNA -downregulation of isocitrate dehydrogenase in Escherichia coli | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article FruR-controlled antisense RNA -downregulation of isocitrate dehydrogenase in Escherichia coli Jisha Elias, Vikas Sharma, G. Archana, G. Naresh Kumar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4854438/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract In E. coli , catabolite repressor activator (Cra) protein (formerly called FruR) is known to regulate the expression of many genes positively and negatively; this effect is modulated by intracellular levels of fructose-1-phosphate (F-1-P) and fructose-1,6-bisphopahate (F-1,6-bisP). In this paper, we report conditionally expressed antisense RNA corresponding to 101bp of isocitrate dehydrogenase ( icd) gene (as- icd ) under Cra (FruR) responsive promoter fruB (P fruB as- icd construct denoted as pVS2K3) in E. coli K-12 (DH5α) and E. coli B (BL21) strains. Previously studies have shown that ICDH mutants failed to grow on glucose in absence of glutamate and accumulated citrate intracellularly. Hence, a conditional downregulation of icd gene could overcome this lethality and also help in understanding the flux towards citrate accumulation. Effect of P fruB as- icd (pVS2k3) construct was monitored in E. coli K-12 (DH5α) and E. coli B (BL21) during growth on carbon sources wherein the fruB promoter is active (glucose) or repressed (glycerol). A 3–4 fold decrease in ICDH activity was observed in E. coli DH5α expressing pVS2K3 on glucose but P fruB as- icd expression differed in E. coli BL21 on glucose. This alteration could be attributed to the anomalous Cra regulation seen in E. coli B strain which could be a crucial factor while choosing fru B promoter for expression studies. Isocitrate dehydrogenase conditional down-regulation antisense RNA catabolite repressor activator (Cra) protein E. coli B & K derived strains Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Escherichia coli have been genetically engineered so as to reapportion the carbon flux towards secretion of different low molecular weight organic acids. It is an extensively used model system to study the regulation of central carbon metabolism (Zhou et al. 2003 ; Wendisch et al. 2006 ). Over-expression of critical genes, an important means of manipulation of metabolic end-products has proved to be highly effective, for instance, in the over-production of succinate (Vemuri et al. 2002 ; Singh et al. 2011 ; Wang et al. 2011 ). Natural antisense RNA regulation is emerging as an important feature of gene regulation in bacteria operating in diverse physiological states (Georg 2011 ; Saberi et al., 2016 ). Down-regulation of expression of crucial genes by antisense RNA ( as RNA) is a potential tool to modulate microbial metabolism. Several studies have demonstrated the effectiveness of as RNA strategy in prokaryotes (Coleman et al. 1984 ; Pestka et al. 1984 ; Ellison et al. 1985 ; Engdahl et al. 1997 ; Kernodle et al. 1997 ) and it was efficiently exploited for over-production of industrially important products (Desai and Papoutsakis 1999 ). AsRNA technology is considered advantageous than gene inactivation technology since complete loss of protein function is not achieved and as a result possible lethal or detrimental effects associated with gene knockout mutants are avoided. Moreover, expression of asRNAs could decrease target gene expression conditionally (Coleman et al. 1984 ; Yin and Ji 2002 ). The present study tries to understand the possible metabolic changes under conditional downregulation of icd gene. NADP + -dependent isocitrate dehydrogenase (ICDH), encoded by icd gene, catalyse the conversion of isocitrate to α-ketoglutarate and CO 2 and regulates the TCA-glyoxylate bypass shift. Mutations within the icd gene result in lethality and manifest an auxotrophic dependency on glutamate, leading to the accumulation of citric acid in both E. coli K and B strains (Lakshmi and Helling, 1976 ; Helling 1995 ; Aoshima et al., 2003 ; Kabir and Shimizu, 2004 ).Conditional downregulation of icd gene under Catabolite repressor activator (Cra) repressed promoters could help in overcoming the lethal effect and the auxotrophic requirement for glutamate as observed in case of icd mutants and yet allow citric acid accumulation. Catabolite repressor activator (Cra) protein represses the genes of glycolytic pathway and activates the genes of gluconeogenesis and glyoxalate pathways (Saier and Ramseier, 1996 ). Fructose-1-phosphate (F-1-P) and fructose-1,6-bisphosphate (F-1,6-P) counteract the function of Cra by binding to Cra protein and prevent it from binding to DNA. One of the Cra repressed promoters is that of the fruBKA operon which is involved in the catabolism of fructose (Ramseier 1996 ; Chavarria and de Lorenzo 2018). P fruB is switched on when E. coli is grown on glucose or fructose and is repressed on glycerol in response to the low levels of F-1-P and F-1,6-P (Holms, 2001 ). The present study hypothesized the use of fru B promoter for conditional down-regulation of icd gene in E. coli K leading to citrate accumulation. Extending the study to E. coli B strain suggested that the differential Cra regulation background could play a crucial role while choosing P fru B promoter for expression studies in E. coli. 2. Materials and methods 2.1 Microbial Strains and Plasmids. Table 1 lists all bacterial strains and plasmids exercised in this study. E. coli DH5α and E. coli BL21(λDE3) and E. coli BL21 were used as representatives of the K and B strains, respectively. 2.2 Media for growth and maintenance. E. coli DH5α, E. coli BL21 and E. coli BL21(λDE3) transformants were maintained on Luria Agar with ampicillin (50 µg/ml). 2.3 PCR primer design for construction of P fruB as-i cd chimera. Four primers were designed, analogous to the upstream and downstream regions of the targeted regions of icd gene and fruB promoter (Table 2 ). Sequence information of E. coli K-12 strain was used for generating primers. EC fruB L1 primer (5’cg gaattc TGCTCATAACTTTACGGCTT 3’) carried an Eco R1 site at the 5’ end (bold highlighted in the sequence) followed by 20 nucleotides corresponding to − 158 to − 139 region of fruB promoter. The EC fruB R1 (5’ G TTCCGGCACAAGGC GGATAACTGGA 3’) primer contained 14 nucleotides corresponding to + 19 to + 33 region of icd gene (underlined in sequence) followed by 11 nucleotides corresponding to + 15 to + 5 of fruB gene. EC icd L1 (5’ ATGTTCCAGTTATCC GCCTTGTGCCGGAA 3’) primer contains 15 bp corresponding to atg + 5 to + 15 (15 nucleotides) of fruB gene at the 5’ region (bold highlighted in sequence) followed by 14 nucleotides corresponding to + 33 to + 19 nucleotides corresponding to icd gene. The EC icd R1 (5’ cg ggatcc TATCGCAGGACGCAAAC 3’) primer carried the Bam H1 site (bold highlighted in the sequence) followed by 17 nucleotides corresponding to − 72 to − 56. Primers EC fruB R1 and EC icd L1 have 14 nucleotides corresponding to icd and 11 nucleotides corresponding to fruB that are complementary to each other (Elias J., ( 2009 , unpublished Ph.D thesis). Taq DNA polymerase, along with its respective buffer, dNTPs, and primers, were sourced from Bangalore Genei Pvt. Ltd., India, and Sigma Chemicals Pvt. Ltd., respectively. These components were employed following the guidelines outlined by the respective manufacturers. The PCR (Techne, USA) was carried out at initial denaturation of 94°C- 5 min, 40cycles of denaturation 94°C- 30 sec, annealing 62°C − 30sec, elongation 72°C − 45sec, final elongation 72°C- 10 min (Elias J., ( 2009 , unpublished Ph.D thesis). 2.4 Construction of pVS2k3 ( P fruB as- icd ). Construction of P fruB as- icd was carried out as depicted schematically in Fig. 1. First, PCR amplification of E. coli DH5α genomic DNA was carried out separately using pairs of EC fruB L1 and EC fruB R1 as well as EC icd L1 and EC icd R1 primers. The fragments corresponding to 192 bp region encompassing the fruB promoter and 122 bp region of the icd gene were obtained. The 192 bp amplicon of fruB contained 170 bp region of fruB promoter, 14 bp of icd region at one end and additional 8 bp containing an Eco R1 site on the other end. Similarly, icd amplicon had 103 bp regions of icd with 11 bp corresponding to fruB and 8 bp extra with a Bam H1 recognition site on either end. Recombinant PCR was carried out using the EC fruB L1 and EC icd R1 primers and the previously obtained amplicons. This resulted in a 289 bp fragment containing fruB promoter and as- icd flanked by Eco R1 and Bam H1 sites (Fig. 1). The amplified product was inserted into the pTZ57R vector using the InsT/Aclone™ PCR product cloning kit (MBI Fermentas) and subsequently transformed into E. coli DH5α. The presence of the correct plasmid was verified through PCR analysis using ECfruBL1 and ECicd R1 primers. Digestion of the plasmid with Eco R1 released an insert of 290 bp confirming correctness of the construct (data not shown), which was denoted as pVS2K3 (Elias J., ( 2009 , unpublished Ph.D thesis). 2.5 Construction of pJE6 ( P tac as- icd ). PCR amplification of E. coli DH5α genomic DNA was carried out using EC icd L1 and EC icd R1 primers (Table 2 ). The fragments corresponding to 122 bp region of the icd gene were obtained. The, icd amplicon had 103 bp regions of icd with 11 bp corresponding to fruB and 8bp extra with a Bam H1 recognition site on either end. The amplified product was cloned into the pTZ57R (pJE4) vector using the InsT/Aclone™ PCR product cloning kit from MBI Fermentas, and then transformed into E. coli DH5α. Verification of the correct plasmid presence was performed through PCR analysis utilizing EC icd L1 and EC icd R1 primers. Digestion of the plasmid with Bam H1 released an insert of 125bp corresponding to as -icd which was subcloned into pTTQ18 vector (Elias J., ( 2009 , unpublished Ph.D thesis). Presence of the insert was verified by PCR using EC icd L1 and EC icd R1 primers and by restriction digestion with Bam H1. The orientation of the icd gene with respect to P tac promoter was further confirmed by PCR amplification using 5’GGTGATCAAGCTGTTGACAATTAATCATCGG3' Primer BF1 and EC icd R1. 2.6 Plasmid DNA isolation and transformation. Plasmid DNA was isolated from E. coli and used for transformation by CaCl 2 method using standard protocols (Sambrook et al., 2001 ). 2.7 Growth experiments. For comparison of growth of transformed and native strains, E. coli cultures (Table 1 ) grown overnight in Luria-Bertrani (LB) broth for 24 h were washed with 0.9% saline, resuspended in saline solution and used to inoculate (0.1%) media containing M9 minimal media either glucose (50 mM), glycerol (100 mM), acetate (50mM) and following micronutrients (mg/L): ZnSO 4 .7H 2 O (0.16), H 3 BO 3 (0.5), CuSO 4 .5H 2 O (0.08), FeSO 4 .7H 2 O (3.5), MnSO 4 .4H 2 O (0.4) and CaCl 2 .2H 2 O (0.03) (Elias J., ( 2009 , unpublished Ph.D thesis). Growth was monitored by absorbance at 600 nm. IPTG (1 µg/ml) was used for induction of expression of as - icd in plasmid pJE6. Cultures were nurtured on a rotary shaker at 37⁰C and pH of culture supernatant was recorded at regular intervals. 2.8 Analytical methods. Variations in cell density were used as an indicator of growth, measured spectrophotometrically as absorbance at 600 nm using a Helios λ spectrophotometer (Thermo Spectronics, Cambridge, United Kingdom). As decrease in media pH was associated with acid production, observations were recorded until the media pH dropped below 5 or the optical density (O.D.) at 600 nm exceeded 1.9. Aseptically, 1 ml aliquots were withdrawn at predetermined time intervals and promptly frozen at -20°C for later biochemical analyses. Prior to analysis, the stored samples were centrifuged at 9,200 × g for 1 minute at 4°C using a Heraeus multifuge 15R (rotor-75003348/75002006). The resulting culture supernatants were then utilized to measure residual glucose and organic acids.Organic acids were analyzed using HPLC (Merck-Hitachi L-7100). The culture supernatants were filtered using 0.2 µm nylon membranes (MDI Advanced Microdevices, India) prior to HPLC analysis. The organic acids present in the filtered supernatants were identified and quantified using high-performance liquid chromatography (HPLC) with a Varian Microsorb RP-18 column at ambient temperature. The mobile phase consisted of 0.01 M Na2HPO4 and 5% acetonitrile, delivered at a flow rate of 0.2 ml/min. Detection of the column effluents was carried out using a UV detector set at 210 nm.GOD-POD kit (Enzopak, Reckon Diagnostics Pvt. Ltd, India) was used to determine concentration of residual glucose in the medium (Adhikary et al. 2014) Table 1 Bacterial strains and plasmids used in this study. Strains or Plasmids Genotype References E. coli Strains DH5α ( nal[r])F[-]thi[-]recAgyrA (Sambrook et al. 2001 ) BL21(DE3) F- gal [ dcm ][ lon ] ompT hsdSB (rB- mB-); an E. coli B-strain) with DE3 a prophage carries the T7 RNA polymerase gene (Sambrook et al. 2001 ) BL21 F- gal [ dcm ][ lon ] ompT hsdSB (rB- mB-) (Sambrook et al. 2001 ) Plasmids pTZ57R Cloning vector Amp r MBI, fermentas pVS2K3 Amp r ; P fruB as- icd in pTZ57R Present study pTTQ18 P tac promoter, Amp r (Stark 1987 ) pJE6 pTTQ18 carrying as-icd , P tac promoter, Amp r Present study Amp r , Ampicilin resistance Table 2 Primers used for the construction of P fruB as-i cd chimera Primers Sequence Remarks ECIcd L1 (5’ atgttccagttatcc gccttgtgccggaa 3’) + 5 to + 15 atg of the fruB promoter (bold highlighted) followed by + 33 to + 19 region of the icd gene ECIcd R1 (5’ cgggatcctatcgcaggacgcaaac 3’) BamH1 site at the 5’end (bold highlighted) followed by − 72 to − 56 region of the icd gene ECFruB L1 (5’ cg gaattc tgctcataactttacggctt 3’) Eco R1 site at 5’end (bold highlighted, -158 to − 139 of fruB promoter. EcFruB R1 (5’ gttccggcacaaggc ggataactgga 3’) + 19 to + 33 of icd gene (underlined) followed by + 15 to + 5 of the fruB promoter The physiological parameters assessed included specific glucose depletion rate, growth rate and biomass yield, as outlined by Chao and Liao ( 1993 ). The total glucose and glycerol consumption was calculated by subtracting the final substrate concentrations in the culture medium from the initial concentrations. Organic acid yields were quantified as grams of organic acid produced per gram of glucose consumed per gram of dry cell weight. Statistical analysis of all parameters was performed using GraphPad Prism software (version 3.0). 2.9 Preparation of cells, cell free extracts and enzymatic assays. M9 medium grown cells were collected by centrifugation at 9,200 x g for 2 min at 4 o C at an appropriate growth phase from 30 ml cultures. The cells were resuspended in sonication buffer (10 mM potassium phosphate buffer, pH 7.7 containing 500 mM NaCl and 2 mM MgCl 2 ) and lysed using a Branson sonifier 450. CS, ICL and ICDH were assayed at late log phase while G-6-PDH was assayed at mid log phase (Elias J., ( 2009 , unpublished Ph.D thesis). The activity of citrate synthase (CS, EC 4.1.3.7) was assessed by measuring the absorbance of 5,5-dithiobis (2-nitrobenzoic acid) at 412 nm, which undergoes a change upon interaction with the sulfhydryl group of coenzyme A (CoA) (Srere 1969 ; Jain et al. 2013 ). The 1.0 ml assay mixture consisted of the following components: 93 mM Tris-HCl (pH 8.0), 0.16 mM acetyl CoA, 0.2 mM oxaloacetate, 0.1 mM 5-dithiobis (2-nitrobenzoic acid), and cell lysate. Oxaloacetate was used to initiate the reaction. The molar absorbance coefficient was 13.6 mM − 1 cm − 1 at 412 nm. Glucose-6-phosphate dehydrogenase (G-6-PDH, EC 1.1.1.49) (Eisenberg and Dobrogosz, 1967 ) and isocitrate dehydrogenase (ICDH, EC 1.1.1.42) (Garnak and Reeves, 1979 ) enzyme activities were measured by observing the reduction of NADP at 340 nm. Isocitrate lyase (ICL, EC 4.1.3.1) activity was ascertained by quantifying glyoxylate formation at 324 nm in presence of phenylhydrazine HCl (Dixon 1959 ). Spectrophotometrically quantification of total protein concentration was determined by the modified method of Folin-Lowry; bovine serum albumin was used as the standard (Peterson, 1979 ). 2.10 Enzymatic measurement of organic acids. Cell extracts were obtained from stationary phase cultures of E. coli transformants cultivated on M9-glucose and M9-glycerol mediums, following the same preparation steps as for enzyme assays. These extracts were filtered using a 0.2 µm nitrocellulose membrane and were either kept on an ice bath or frozen until further analysis. The filtrates were used to assess intracellular citric acid levels, while the filtered supernatants from the same cultures were used to determine extracellular acetic acid (Buch et al., 2009 ). The spectrophotometric measurement of intracellular citric acid was carried out based on the method adapted from Petrarulo et al. ( 1995 ), with minor modifications from Elias J's (2009) unpublished Ph.D. thesis. The assay used a 1.0 ml mixture consisting of 50 mM phosphate buffer, 0.02 ml of 246 mM phenylhydrazine, 0.02 ml of citrate lyase (0.27U from a 13.3 units/ml stock), and either citric acid standard or cell extract. The phosphate buffer contained 50 mM buffer (pH 6.5), 0.1 mM ZnSO4·7H2O, and 0.2 g/L sodium azide. A standard curve was created using citric acid standards from 5 µM to 20 µM (Buch et al. 2009 ). Optical density (O.D.) at 330 nm was recorded after 3 minutes of citrate lyase addition, and the intracellular citrate concentration (in mM) was calculated. The cellular volume was assumed to be 1.63 µl/mg dry cell weight (dcw), according to Emmerling et al. ( 1999 ). 3. Results 3.1 Effect of P fruB as-i cd (pVS2k3) on Isocitrate dehydrogenase (ICDH) activity in E. coli DH5α and E. coli BL21. On glucose P fru B as- icd expression in E. coli DH5α down-regulated ICD activity by 3–4 fold decrease (Fig. 2a) but no effect was discernible in case of this strain on glycerol (Fig. 2a). The enzyme activity of ICDH activity remained unchanged in E. coli BL21 (λDE3) expressing pVS2k3 (Fig. 2b). To validate that the dysfunction of Cra could be a probable reason for the failure of P fruB as- icd in BL21(λDE3) as- icd was expressed under IPTG inducible promoter (P tac ). P tac as-i cd expression in E. coli BL21 monitored a 3–4 fold reduction in ICDH activity (Fig. 2b). Higher ICDH activity was observed in E. coli BL21 on both glucose and acetate (Fig. 2c). E. coli DH5α showed no ICDH activity on acetate. 3.2 Effect of P fruB as-i cd on physiological parameters in E. coli DH5α. Reduced ICDH activity by P fru B as- icd did not alter the growth rate (0.37 ± 0.08 h − 1 ) but significantly improved the glucose consumption rate (5.7 ± 1.25 g glc.g − 1 dcw.h − 1 ) when compared to the E. coli harboring the control plasmid pTZ57R (Fig. 3, Table 3 ). 3.3 Effect of P fruB as-i cd on Citrate synthase (CS), Glucose 6 phosphate dehydrogenase (G-6-PDH) and isocitrate lyase (ICL) activities in E. coli DH5α on glucose. Down-regulation of ICDH activity by P fru B as- icd demonstrated a significant increase in CS activity (0.079 ± 0.008 U) compared to its plasmid control (0.04 ± 0.002 U). G-6-PDH activity significantly decreased in response to the P fru B as- icd down regulation of icd gene (Fig. 4). No ICL activity was detected on glucose. 3.4 Effect of P fruB as-i cd on organic acid secretion in E. coli DH5α. Antisense RNA mediated down regulation of icd gene was reflected in the increased citrate accumulation in (1.32 ± 0.013 mM) as compared to plasmid control strain (0. 65 ± 0.05 mM) (Table 4 ). No extracellular citrate was detected in E. coli DH5α Table 3 Physiological parameters demonstrating the effect of P fru B -as icd expression in E. coli DH5α on glucose. E. coli strains Growth rate (µ)h -1 Specific glucose consumption rate (Q glc ) Total glucose consumed (mM) Biomass Y dcw /glc (g dcw.g -1 .h -1 ) DH5α 0.26 ± 0.02 7.0 ± 1.5 48 ± 2.5 0.023 ± 0.010 DH5α: pTZ57R 0.32 ± 0.08 3.2 ± 1.0 42 ± 5 0.025 ± 0.010 DH5α: pVS2k3 0.37 ± 0.08 ns 5.7 ± 1.25 ** 35 ± 1.5 0.033 ± 0.015 a ** The results are expressed as Mean ± SD of 8–10 independent observations. Carbon source used is 50mM glucose for E. coli DH5α. Specific growth rate (µ(h − 1 )), specific glucose consumption rate ( Q Glc ) and Biomass (Y dcw /glc) were determined from mid log phase of each experiment. Total glucose utilized was determined at the end of growth curve. Significance calculated with respect to the respective plasmid control ** p < 0.01, ns- non significant Table 4 Organic acid formation in E. coli DH5α transformants expressing P fru B -as icd on 50 mM glucose. E. coli strains Intracellular citrate (mM) Extracellular Acetate (mM) DH5α 0.65 ± 0.06 ND DH5α pTZ57R 0.69 ± 0.1 1.04 ± 0.25 DH5α pVS2k3 1.32 ± 0.13 a ** 1.95 ± 0.65 a ns The table depicts the citrate (intracellular) and acetate (extracellular) levels in the late stationary phase cultures of E. coli DH5α transformants (plasmid control and test) grown on M9 minimal media with 50mM as carbon source. All the values are represented as Mean ± SD of n = 8 observations. ** p < 0.01and ns non-significant. Low levels of acetate were found on 50mM glucose in E. coli DH5α. E. coli DH5α pVS2k3 (1.95 ± 0.65 mM) expressing P fruB as- icd had slight increase in acetate levels compared to its plasmid control bearing E. coli DH5α (1.04 ± 0.25 mM) (Table 4 ). 4. Discussion Antisense RNA offers a tool to partially down-regulate the expression of bacterial genes thus overcoming the problems encountered with null mutants (Kernodle et al. 1997 ; Kurreck 2003 ). Conditional antisense RNA expressing systems are considered to be more effective as they exhibit leaky phenotype. A tetracycline (tet) controlled antisense RNA expressing system was developed; it allowed selective genes of the chromosome to be switched on and off and even control their expression levels. This offered a potential tool to generate a quantitative data of the gene product (Yin and Ji 2002 ). Parish and Stoker ( 1997 ), demonstrated that conditional regulation of antisense RNA expression under an inducible promoter in mycobacteria facilitated the elucidation of the role of essential genes. Present study deals with designing of a conditionally regulated antisense RNA against the icd gene of E. coli where carbon source availability controls the antisense RNA expression. The strategy exploits the natural mechanism of Cra protein-mediated control of fruB promoter which connects carbon source availability through intracellular F-1-P and F-1,6-P concentrations to gene expression (Fig. 5). The conditional antisense RNA strategy employed in this study is novel in that (a) it avoids the use of external inducers for the down- regulation of target genes and (b) depends upon the nature and amount of the available carbon sources. fru B promoter has been used to quantify the amount of nutrients available to the microbial residents in the phyllosphere (Leveau and Lindow 2001 ). In this study they expressed the promoter from E. coli in Erwinia herbicola as they are closely related bacteria but in the present study, we report that the constitutive Cra expression as seen in E. coli B could restrict its use among E. coli strains. P fruB as- icd expression down-regulated ICDH enzyme activity by 3-4fold in E. coli DH5α on glucose but not on glycerol as fruB promoter is known to get de-repressed by increased F-1,6-P levels seen in E. coli when grown on glucose. This de-repression of the fru B promoter produces as- icd RNA (Fig. 5). However, when glycerol is used, the fruB promoter stays inhibited by the Cra protein because of the low levels of fructose-1,6-phosphate, resulting in no alteration in ICDH activity. This finding could be supported with earlier reports that fruB promoter responded to the fructose in the medium but failed to express on galactose (Leveau and Lindow 2001 ). E. coli K and B strains are known to differ in the manner in which the regulation of glyoxylate pathway and Cra protein takes place (Phue et al. 2005 ; Son et al. 2011 ). E. coli B strains secrete low levels of acetate as compared to E. coli K strains this property supports efficient recombinant protein expression in E. coli B strains (Shiloach et al. 1996 ). In contrast to E. coli K strain, P fruB as- icd had no effect on the ICD activity in E. coli B strain when grown on glucose. This suggested that there could be alteration in Cra regulation hence to validate that the dysfunction of Cra could be a probable reason for the failure of P fruB as- icd in BL21(λDE3) as- icd was expressed under IPTG inducible promoter. P tac as- icd expression in E. coli BL21 downregulated the ICDH activity by 3-4fold. Moreover the growth of E. coli BL21 on acetate supported the anamalous Cra protein as E. coli Cra mutants could not grow on acetate. These results support that a dysfunctional Cra regulation could restrict the universal use of fru B promoter in E.coli strains. Hence the physiological experiments to monitor the effects of conditional downregulation of icd gene were carried out in E. coli DH5α. Down-regulation of ICDH by P fruB as- icd in E. coli DH5α increased CS activity which is in agreement with the earlier results related to E. coli icd mutants (Lakshmi and Helling 1976 ; Kabir and Shimizu 2004 ). This increase in icd mutants was proposed to enhance NAD(P)H levels which were generated by ICDH in wild type (Park et al. 1994 ). Conditional as icd demonstrated increased growth along with high CS activity compared to the E. coli icd mutants (Lakshmi and Helling 1976 ; Kabir and Shimizu 2004 ). Lower G-6-PDH activity in E. coli expressing as- icd could be attributed to the partial block that suffices the requirements of NADPH. Absence of ICL activity in E. coli on glucose irrespective of antisense expression is well supported by the reports that on glucose there is no ICL activity in E. coli K-12 derivative (Phue et al. 2005 ). P fruB as- icd expression significantly increased intracellular citrate levels which supports that blocking ICD could be a probable target for citrate accumulation in E. coli strains and these finding were similar to the icd mutant. High acetate levels were observed in E. coli expressing antisense as compared to that of icd mutant (Kabir and Shimizu 2004 ). E. coli has a reportedly low TCA flux and the partial block in the ICDH activity probably leads to further decrease in the TCA flux resulting in pyruvate accumulation in large amount which could be directed to acetate formation. Absence of citrate in the extracellular medium is due to the absence of a citrate efflux mechanism in E. coli (Lakshmi and Helling 1976 ). The present study reports that down regulation of icd gene using antisense technology controlled by fruB (Table 5 ) was capable of accumulating citrate without altering the growth of E. coli K strain as seen in case of icd mutants (Lakshmi and Helling 1976 ; Aoshima et al. 2003 ; Kabir and Shimizu 2004 ). Cra dysfunction in E. coli BL21was reported earlier (Phue et al. 2005 ; Son et al. 2011 ) the present study supports this report as P fruB was not found to be a suitable promoter for expression studies in E. coli BL21. Thus, E. coli K and B strains differ distinctly in the metabolism, proteome and the genome sequence of B strains (Jeong et al. 2009 ; Han, 2016 ) could facilitate in unraveling these differences. Table 5 Characteristic differences between an E. coli icd mutant and E. coli expressing as- icd gene under fru B promoter. Parameters E. coli icd mutant (Lakshmi and Helling 1976 ; Kabir and Shimizu 2004 ) E. coli DH5α pVS2k3 Growth rate Slow No change Glucose consumption rate Low ∼2 fold increase Glucose consumed Required No change Glucose 6 phosphate dehydrogenase ND ∼1.2 fold decrease Citrate Synthase High ∼2 fold increase Isocitrate Dehydrogenase High ∼3–4 fold decrease Isocitrate lyase High ND Citrate (Intracellular) 11 mM ∼ 1.32 ± 0.13 mM 2 fold increase Acetate Low ∼ 2 fold increase ND- not detected and NA-not available Three overlapping antisense genes in Escherichia coli O157:H7 EDL933 cause translationally arrest mutant phenotype (Graf et al., 2023). Escherichia coli K12 MG1655 contains 663 overlapping pairs with larger than 30 nucleotides out of them 586 are co-oriented, 75 convergent and 2 divergent (Huvet and Stumpf, 2014 ). Natural antisense RNAs in bacteria are known to post transcriptional inhibition of mRNA, direct inhibition of translation and also act as riboswitches associated with wide range of bacterial activities viz plasmid replication, metabolite sensing biofilm formation, conjugation, toxin synthesis (Saberi et al., 2016 ). Declarations Conflict of Interest statement : none Funding : The authors have no relevant financial or non-financial interests to disclose. The authors declare that no funds, grants, or other support were received during the preparation of this manuscript. Author Contribution All authors contributed to the study conception and design. Strain developments and plasmid construction were done by Vikas Sharma and Jisha Elias. Growth experiments, analytical, biochemical assays, data collection, and data analysis were performed by Jisha Elias. The first draft of the manuscript was written by Jisha Elias and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. References Adhikary H, Sanghavi PB, Macwan SR, Archana G, Naresh Kumar G (2014) Artificial citrate operon confers mineral phosphate solubilization ability to diverse Fluorescent Pseudomonads. PLoS ONE 9(9):e107554. https://doi.org/10.1371/journal.pone.0107554 Aoshima M, Ishii M, Yamagishi A, Oshima T, Igarashi Y (2003) Metabolic characteristics of an isocitrate dehydrogenase defective derivative of Escherichia coli BL21(DE3). Biotechnol Bioeng 84:732–737. 10.1002/bit.10832 Buch AD, Archana G, Kumar GN (2009) Enhanced citric acid biosynthesis in Pseudomonas fluorescens ATCC 13525 by overexpression of the Escherichia coli citrate synthase gene. Microbiol (Reading) 155:2620–2629. 10.1099/mic.0.028878-0 Chao YP, Liao JC (1993) Alteration of growth yield by overexpression of phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase in Escherichia coli . Appl Environ Microbiol 59:4261–4265. 10.1128/aem.59.12.4261-4265.1993 Chavarría M, de Lorenzo V (2018) The imbroglio of the physiological Cra effector clarified at last. Mol Microbiol 109:273–277. 10.1111/mmi.14080 Coleman J, Green PJ, Inouye M (1984) The use of RNAs complementary to specific mRNAs to regulate the expression of individual bacterial genes. Cell 37:429–436. 10.1016/0092-8674(84)90373-8 Desai RP, Papoutsakis ET (1999) Antisense RNA strategies for metabolic engineering of Clostridium acetobutylicum . Appl Environ Microbiol 65:936–945. 10.1128/AEM.65.3.936-945.1999 Dixon GH (1959) Assay methods for key enzymes of the glyoxylate cycle. Biochem J 3:72 Eisenberg RC, Dobrogosz WJ (1967) Gluconate metabolism in Escherichia coli . J Bacteriol 93:941–949. 10.1128/jb.93.3.941-949.1967 Ellison MJ, Kelleher RJ, Rich A (1985) Thermal regulation of beta-galactosidase synthesis using anti-sense RNA directed against the coding portion of the mRNA. J Biol Chem 260:9085–9087. 10.1016/S0021-9258(17)39332-8 Elias J (2009) Engineering the central carbon metabolism of Escherichia coli to enhance organic acid secretion (Ph.D thesis) http://hdl.handle.net/10603/58694 Emmerling M, Bailey JE, Sauer U (1999) Glucose catabolism of Escherichia coli Strains with increased activity and altered regulation of key glycolytic enzymes. Metab Eng 1:117–127. 10.1006/mben.1998.0109 Engdahl HM, Hjalt TA, Wagner EG (1997) A two unit antisense RNA cassette test system for silencing of target genes. Nucleic Acids Res 25:3218–3227. 10.1093/nar/25.16.3218 Garnak M, Reeves HC (1979) Purification and properties of phosphorylated isocitrate dehydrogenase of Escherichia coli . J Biol Chem 254:7915–7920. 10.1016/S0021-9258(18)36033-2 Georg J, Hess WR (2011) cis-antisense RNA, another level of gene regulation in bacteria. Microbiol Mol Biol Rev 75:286–300. 10.1128/MMBR.00032-10 Han MJ (2016) Exploring the proteomic characteristics of the Escherichia coli B and K-12 strains in different cellular compartments. J Biosci Bioeng 122(1):1–9. 10.1016/j.jbiosc.2015.12.005 Helling RB (1995) icdB mutants of Escherichia coli . J Bacteriol 177(9):2592–2593. 10.1128/jb.177.9.2592-2593 Holms H (2001) Flux analysis: a basic tool of microbial physiology. Adv Microb Physiol 45:271–340. 10.1016/s0065-2911(01)45006-5 Huvet M, Stumpf MP (2014) Overlapping genes: a window on gene evolvability. BMC Genomics 15:721. doi.org/10.1186/1471-2164-15-721 Jain R, Jha S, Adhikary H, Kumar P, Parekh V, Jha A et al (2013) Isolation and Molecular characterization of arsenite-tolerant Alishewanella sp. GIDC-5 originated from Industrial effluents. Geomicrobiol J 31:82–90. https://doi.org/10.1080/01490451.2013.811317 Jeong H, Barbe V, Lee CH et al (2009) Genome sequences of Escherichia coli B strains REL606 and BL21(DE3). J Mol Biol 394:644–652. 10.1016/j.jmb.2009.09.052 Kabir MM, Shimizu K (2004) Metabolic regulation analysis of icd-gene knockout Escherichia coli based on 2D electrophoresis with MALDI-TOF mass spectrometry and enzyme activity measurements. Appl Microbiol Biotechnol 65:84–96. 10.1007/s00253-004-1627-1 Kernodle DS, Voladri RK, Menzies BE, Hager CC, Edwards KM (1997) Expression of an antisense hla fragment in Staphylococcus aureus reduces alpha-toxin production in vitro and attenuates lethal activity in a murine model. Infect Immun 65:179–184. 10.1128/iai.65.1.179-184.1997 Kurreck J (2003) Antisense technologies: improvement through novel chemical modifications. Eur J Biochem 270:1628–1644. 10.1046/j.1432-1033.2003.03555.x Lakshmi TM, Helling RB (1976) Selection for citrate synthase deficiency in icd mutants of Escherichia coli . J Bacteriol 127:76–83. 10.1128/jb.127.1.76-83.1976 Leveau JH, Lindow SE (2001) Appetite of an epiphyte: quantitative monitoring of bacterial sugar consumption in the phyllosphere. Proc Natl Acad Sci U S A 98:3446–3453. 10.1073/pnas.061629598 Parish T, Stoker NG (1997) Development and use of a conditional antisense mutagenesis system in mycobacteria. FEMS Microbiol Lett 154:151–157. 10.1111/j.1574-6968.1997.tb12637.x Park SJ, McCabe J, Turna J, Gunsalus RP (1994) Regulation of the citrate synthase (gltA) gene of Escherichia coli in response to anaerobiosis and carbon supply: role of the arcA gene product. J Bacteriol 176:5086–5092. 10.1128/jb.176.16.5086-5092.1994 Pestka S, Daugherty BL, Jung V, Hotta K, Pestka RK (1984) Anti-mRNA: specific inhibition of translation of single mRNA molecules. Proc Natl Acad Sci U S A 81:7525–7528. 10.1073/pnas.81.23.7525 Peterson GL (1979) Review of the Folin phenol protein quantitation method of Lowry, Rosebrough, Farr and Randall. Anal Biochem 100:201–220. 10.1016/0003-2697(79)90222-7 Petrarulo M, Facchini P, Cerelli E, Marangella M, Linari F (1995) Citrate in urine determined with a new citrate lyase method. Clin Chem 410:1518–1521. 10.1093/clinchem/41.10.1518 Phue JN, Noronha SB, Hattacharyya R, Wolfe AJ, Shiloach J (2005) Glucose metabolism at high density growth of E coli B and E coli K: differences in metabolic pathways are responsible for efficient glucose utilization in E coli B as determined by microarrays and Northern blot analyses. Biotechnol Bioeng 90:805–820. 10.1002/bit.20478 Ramseier TM (1996) Cra and the control of carbon flux via metabolic pathways. Res Microbiol 147:489–493. 10.1016/0923-2508(96)84003-4 Saberi F, Kamali M, Najafi A, Yazdanparast A, Moghaddam MM (2016) Natural antisense RNAs as mRNA regulatory elements in bacteria: a review on function and applications. Cell Mol Biol Lett 21:6. 10.1186/s11658-016-0007-z Saier MHJ, Ramseier TM (1996) The catabolite repressor/activator (Cra) protein of enteric bacteria. J Bacteriol 178:3411–3417. 10.1128/jb.178.12.3411-3417.1996 Sambrook J, Russell DW, Fritsch EF, Maniatis T (2001) Molecular Cloning: a Laboratory Manual, 4th edn. Cold Spring Harb. Laboratory, New Jersey Shiloach J, Kaufman J, Guillard AS, Fass R (1996) Effect of glucose supply strategy on acetate accumulation, growth, and recombinant protein production by Escherichia coli BL21 (lambdaDE3) and Escherichia coli JM109. Biotechnol Bioeng 49:421–428. 10.1002/(SICI)1097-0290(19960220)49:43.0.CO;2-R Singh A, Cher Soh K, Hatzimanikatis V, Gill RT (2011) Manipulating redox and ATP balancing for improved production of succinate in E coli . Metab Eng 13:76–81. 10.1016/j.ymben.2010.10.006 Son YJ, Phue JN, Trinh LB, Lee SJ, Shiloach J (2011) The role of Cra in regulating acetate excretion and osmotic tolerance in E coli K-12 and E coli B at high density growth. Microb Cell Factories 10:52. 10.1186/1475-2859-10-52 Srere PA (1969) [1] Citrate synthase: [EC 4.1. 3.7. Citrate oxaloacetate-lyase (CoA-acetylating)]. In: Methods in Enzymology: Citric Acid Cycle, Vol. 13, Academic Press, pp. 3–11. 10.1016/0076-6879(69)13005-0 Stark MJ (1987) Multicopy expression vectors carrying the lac repressor gene for regulated high-level expression of genes in Escherichia coli . Gene 51:255–267. 10.1016/0378-1119(87)90314-3 Vemuri GN, Eiteman MA, Altman E (2002) Effects of growth mode and pyruvate carboxylase on succinic acid production by metabolically engineered strains of Escherichia coli . Appl Environ Microbiol 68:1715–1727. 10.1128/AEM.68.4.1715-1727.2002 Wang J, Zhu J, Bennett GN, San KY (2011) Succinate production from different carbon sources under anaerobic conditions by metabolic engineered Escherichia coli strains. Metab Eng 13:328–335. 10.1016/j.ymben.2011.03.004 Wendisch VF, Bott M, Eikmanns BJ (2006) Metabolic engineering of Escherichia coli and Corynebacterium glutamicum for biotechnological production of organic acids and amino acids. Curr Opin Microbiol 9:268–274. 10.1016/j.mib.2006.03.001 Yin D, Ji Y (2002) Genomic analysis using conditional phenotypes generated by antisense RNA. Curr Opin Microbiol 5:330–333. 10.1016/s1369-5274(02)00315-6 Zhou S, Causey TB, Hasona A, Shanmugam KT, Ingram LO (2003) Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110. Appl Environ Microbiol 69:399–407. 10.1128/AEM.69.1.399-407.2003 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4854438","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":336813485,"identity":"09d731f7-239a-40fe-8738-6b82c11d401a","order_by":0,"name":"Jisha Elias","email":"","orcid":"","institution":"The Maharaja Sayajirao University of Baroda","correspondingAuthor":false,"prefix":"","firstName":"Jisha","middleName":"","lastName":"Elias","suffix":""},{"id":336813486,"identity":"de47ab16-0ad6-49d9-a485-928a8763a084","order_by":1,"name":"Vikas Sharma","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIiWNgGAWjYDACZgYGaRDNxgMkPoAY7KRoYZwBYjATYRFYCwNQCzMP1BC8QL6d9+DtwrZ7iX08hx9/tvm1TZ6PmYHxw8cc3FoMDvMlW89sK05s420zk87tu23YxszALDlzGx4tzDxm0rxtCcZs/AxmzLk9txmBWtiYefFokW+Ga2H//Nmy57Y9QS0MhyFa5Nh4ewykGX7cTiSoxeAwj7E1zzmgFp4zZZK9DbeT25gZm/H6Rb7/jOFtnrIEHvme9M0ffvy5bTu/vfngh4/4HIYCGNvAZAOx6kHgDymKR8EoGAWjYKQAAC8uQ6sKKxsnAAAAAElFTkSuQmCC","orcid":"","institution":"The Maharaja Sayajirao University of Baroda","correspondingAuthor":true,"prefix":"","firstName":"Vikas","middleName":"","lastName":"Sharma","suffix":""},{"id":336813487,"identity":"88d26ecf-cc4c-49e5-8f66-572bd5f2de5d","order_by":2,"name":"G. Archana","email":"","orcid":"","institution":"The Maharaja Sayajirao University of Baroda","correspondingAuthor":false,"prefix":"","firstName":"G.","middleName":"","lastName":"Archana","suffix":""},{"id":336813488,"identity":"4946e91a-0d5f-4170-9d2f-c70939cf1d73","order_by":3,"name":"G. Naresh Kumar","email":"","orcid":"","institution":"The Maharaja Sayajirao University of Baroda","correspondingAuthor":false,"prefix":"","firstName":"G.","middleName":"Naresh","lastName":"Kumar","suffix":""}],"badges":[],"createdAt":"2024-08-03 18:08:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4854438/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4854438/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63785499,"identity":"2d43ffb1-d0d7-4296-9599-d343bbb062b5","added_by":"auto","created_at":"2024-09-02 10:30:09","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":314252,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4854438/v1/cd2c0cdebb10af9c76eb96d4.jpg"},{"id":63785497,"identity":"0e5284dd-3611-46ed-9dc5-74e0be8f520e","added_by":"auto","created_at":"2024-09-02 10:30:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":182323,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4854438/v1/1d319124b6a25c96511e1445.png"},{"id":63785500,"identity":"c5fada9b-6c94-478f-8838-9e7a3259354b","added_by":"auto","created_at":"2024-09-02 10:30:09","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":128225,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4854438/v1/3faffac8d189824db6a033f1.jpg"},{"id":63785501,"identity":"f12d3b85-9f3a-4e7e-a3a7-204cdb7072d2","added_by":"auto","created_at":"2024-09-02 10:30:09","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":240003,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4854438/v1/172bc58c0868f42812bdd577.jpg"},{"id":63785498,"identity":"ed76e875-d543-4c7c-94ab-275166304634","added_by":"auto","created_at":"2024-09-02 10:30:09","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":62905,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4854438/v1/73a6f0211d565236d174b9df.jpg"},{"id":74809696,"identity":"76126e53-ac25-4f44-a49a-7af3a784afb5","added_by":"auto","created_at":"2025-01-27 06:16:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2223388,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4854438/v1/6a75b0a5-b7d2-4068-aade-aa212718e58d.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"FruR-controlled antisense RNA -downregulation of isocitrate dehydrogenase in Escherichia coli","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cem\u003eEscherichia coli\u003c/em\u003e have been genetically engineered so as to reapportion the carbon flux towards secretion of different low molecular weight organic acids. It is an extensively used model system to study the regulation of central carbon metabolism (Zhou et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Wendisch et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Over-expression of critical genes, an important means of manipulation of metabolic end-products has proved to be highly effective, for instance, in the over-production of succinate (Vemuri et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Singh et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Natural antisense RNA regulation is emerging as an important feature of gene regulation in bacteria operating in diverse physiological states (Georg \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Saberi et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Down-regulation of expression of crucial genes by antisense RNA (\u003cem\u003eas\u003c/em\u003eRNA) is a potential tool to modulate microbial metabolism. Several studies have demonstrated the effectiveness of \u003cem\u003eas\u003c/em\u003eRNA strategy in prokaryotes (Coleman et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1984\u003c/span\u003e; Pestka et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e1984\u003c/span\u003e; Ellison et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e1985\u003c/span\u003e; Engdahl et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Kernodle et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1997\u003c/span\u003e) and it was efficiently exploited for over-production of industrially important products (Desai and Papoutsakis \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). AsRNA technology is considered advantageous than gene inactivation technology since complete loss of protein function is not achieved and as a result possible lethal or detrimental effects associated with gene knockout mutants are avoided. Moreover, expression of asRNAs could decrease target gene expression conditionally (Coleman et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1984\u003c/span\u003e; Yin and Ji \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2002\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe present study tries to understand the possible metabolic changes under conditional downregulation of \u003cem\u003eicd\u003c/em\u003e gene. NADP\u003csup\u003e+\u003c/sup\u003e-dependent isocitrate dehydrogenase (ICDH), encoded by \u003cem\u003eicd\u003c/em\u003e gene, catalyse the conversion of isocitrate to α-ketoglutarate and CO\u003csub\u003e2\u003c/sub\u003e and regulates the TCA-glyoxylate bypass shift. Mutations within the icd gene result in lethality and manifest an auxotrophic dependency on glutamate, leading to the accumulation of citric acid in both \u003cem\u003eE. coli\u003c/em\u003e K and B strains (Lakshmi and Helling, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1976\u003c/span\u003e; Helling \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Aoshima et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Kabir and Shimizu, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).Conditional downregulation of \u003cem\u003eicd\u003c/em\u003e gene under Catabolite repressor activator (Cra) repressed promoters could help in overcoming the lethal effect and the auxotrophic requirement for glutamate as observed in case of \u003cem\u003eicd\u003c/em\u003e mutants and yet allow citric acid accumulation.\u003c/p\u003e \u003cp\u003eCatabolite repressor activator (Cra) protein represses the genes of glycolytic pathway and activates the genes of gluconeogenesis and glyoxalate pathways (Saier and Ramseier, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). Fructose-1-phosphate (F-1-P) and fructose-1,6-bisphosphate (F-1,6-P) counteract the function of Cra by binding to Cra protein and prevent it from binding to DNA. One of the Cra repressed promoters is that of the \u003cem\u003efruBKA\u003c/em\u003e operon which is involved in the catabolism of fructose (Ramseier \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e1996\u003c/span\u003e; Chavarria and de Lorenzo 2018). \u003cem\u003eP\u003c/em\u003e\u003csub\u003efruB\u003c/sub\u003e is switched on when \u003cem\u003eE. coli\u003c/em\u003e is grown on glucose or fructose and is repressed on glycerol in response to the low levels of F-1-P and F-1,6-P (Holms, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). The present study hypothesized the use of \u003cem\u003efru\u003c/em\u003eB promoter for conditional down-regulation of \u003cem\u003eicd\u003c/em\u003e gene in \u003cem\u003eE. coli\u003c/em\u003e K leading to citrate accumulation. Extending the study to \u003cem\u003eE. coli\u003c/em\u003e B strain suggested that the differential Cra regulation background could play a crucial role while choosing P\u003cem\u003efru\u003c/em\u003eB promoter for expression studies in \u003cem\u003eE. coli.\u003c/em\u003e\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cp\u003e\u003cspan\u003e\u003cstrong\u003e2.1 Microbial Strains and Plasmids.\u003c/strong\u003e Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e lists all bacterial strains and plasmids exercised in this study. \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; and \u003cem\u003eE. coli\u003c/em\u003e BL21(\u0026lambda;DE3) and\u0026nbsp;\u003cem\u003eE. coli\u003c/em\u003e BL21 were used as representatives of the K and B strains, respectively.\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2 Media for growth and maintenance.\u003c/strong\u003e \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha;, \u003cem\u003eE. coli\u003c/em\u003e BL21 and \u003cem\u003eE. coli\u003c/em\u003e BL21(\u0026lambda;DE3) transformants were maintained on Luria Agar with ampicillin (50 \u0026micro;g/ml).\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3 PCR primer design for construction of\u003c/strong\u003e P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e \u003cstrong\u003eas-i\u003c/strong\u003e\u003cstrong\u003ecd\u003c/strong\u003e \u003cstrong\u003echimera.\u003c/strong\u003e Four primers were designed, analogous to the upstream and downstream regions of the targeted regions of \u003cem\u003eicd\u003c/em\u003e gene and \u003cem\u003efruB\u003c/em\u003e promoter (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Sequence information of \u003cem\u003eE. coli\u003c/em\u003e K-12 strain was used for generating primers. EC\u003cem\u003efruB\u003c/em\u003e L1 primer (5\u0026rsquo;cg\u003cstrong\u003egaattc\u003c/strong\u003eTGCTCATAACTTTACGGCTT 3\u0026rsquo;) carried an \u003cem\u003eEco\u003c/em\u003eR1 site at the 5\u0026rsquo; end (bold highlighted in the sequence) followed by 20 nucleotides corresponding to \u0026minus;\u0026thinsp;158 to \u0026minus;\u0026thinsp;139 region of \u003cem\u003efruB\u003c/em\u003e promoter. The EC \u003cem\u003efruB\u003c/em\u003e R1 (5\u0026rsquo; G\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eTTCCGGCACAAGGC\u003c/span\u003eGGATAACTGGA 3\u0026rsquo;) primer contained 14 nucleotides corresponding to +\u0026thinsp;19 to +\u0026thinsp;33 region of \u003cem\u003eicd\u003c/em\u003e gene (underlined in sequence) followed by 11 nucleotides corresponding to +\u0026thinsp;15 to +\u0026thinsp;5 of \u003cem\u003efruB\u003c/em\u003e gene. EC\u003cem\u003eicd\u003c/em\u003e L1 (5\u0026rsquo; \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eATGTTCCAGTTATCC\u003c/span\u003eGCCTTGTGCCGGAA 3\u0026rsquo;) primer contains 15 bp corresponding to atg\u0026thinsp;+\u0026thinsp;5 to +\u0026thinsp;15 (15 nucleotides) of \u003cem\u003efruB\u003c/em\u003e gene at the 5\u0026rsquo; region (bold highlighted in sequence) followed by 14 nucleotides corresponding to +\u0026thinsp;33 to +\u0026thinsp;19 nucleotides corresponding to \u003cem\u003eicd\u003c/em\u003e gene. The EC \u003cem\u003eicd\u003c/em\u003eR1 (5\u0026rsquo; cg\u003cstrong\u003eggatcc\u003c/strong\u003eTATCGCAGGACGCAAAC 3\u0026rsquo;) primer carried the \u003cem\u003eBam\u003c/em\u003eH1 site (bold highlighted in the sequence) followed by 17 nucleotides corresponding to \u0026minus;\u0026thinsp;72 to \u0026minus;\u0026thinsp;56. Primers EC\u003cem\u003efruB\u003c/em\u003e R1 and EC\u003cem\u003eicd\u003c/em\u003e L1 have 14 nucleotides corresponding to \u003cem\u003eicd\u003c/em\u003e and 11 nucleotides corresponding to \u003cem\u003efruB\u003c/em\u003e that are complementary to each other (Elias J., (\u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e, unpublished Ph.D thesis). Taq DNA polymerase, along with its respective buffer, dNTPs, and primers, were sourced from Bangalore Genei Pvt. Ltd., India, and Sigma Chemicals Pvt. Ltd., respectively. These components were employed following the guidelines outlined by the respective manufacturers. The PCR (Techne, USA) was carried out at initial denaturation of 94\u0026deg;C- 5 min, 40cycles of denaturation 94\u0026deg;C- 30 sec, annealing 62\u0026deg;C \u0026minus;\u0026thinsp;30sec, elongation 72\u0026deg;C \u0026minus;\u0026thinsp;45sec, final elongation 72\u0026deg;C- 10 min (Elias J., (\u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e, unpublished Ph.D thesis).\u003c/p\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e2.4 Construction of pVS2k3 (\u003c/strong\u003eP\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e \u003cstrong\u003eas-\u003c/strong\u003e\u003cstrong\u003eicd\u003c/strong\u003e\u003cstrong\u003e).\u003c/strong\u003e Construction of P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e was carried out as depicted schematically in Fig. 1. First, PCR amplification of \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; genomic DNA was carried out separately using pairs of EC\u003cem\u003efruB\u003c/em\u003eL1 and EC\u003cem\u003efruB\u003c/em\u003eR1 as well as EC\u003cem\u003eicd\u003c/em\u003eL1 and EC\u003cem\u003eicd\u003c/em\u003eR1 primers. The fragments corresponding to 192 bp region encompassing the \u003cem\u003efruB\u003c/em\u003e promoter and 122 bp region of the \u003cem\u003eicd\u003c/em\u003e gene were obtained. The 192 bp amplicon of \u003cem\u003efruB\u003c/em\u003e contained 170 bp region of \u003cem\u003efruB\u003c/em\u003e promoter, 14 bp of \u003cem\u003eicd\u003c/em\u003e region at one end and additional 8 bp containing an \u003cem\u003eEco\u003c/em\u003eR1 site on the other end. Similarly, \u003cem\u003eicd\u003c/em\u003e amplicon had 103 bp regions of \u003cem\u003eicd\u003c/em\u003e with 11 bp corresponding to \u003cem\u003efruB\u003c/em\u003e and 8 bp extra with a \u003cem\u003eBam\u003c/em\u003eH1 recognition site on either end. Recombinant PCR was carried out using the EC\u003cem\u003efruB\u003c/em\u003e L1 and EC\u003cem\u003eicd\u003c/em\u003eR1 primers and the previously obtained amplicons. This resulted in a 289 bp fragment containing \u003cem\u003efruB\u003c/em\u003e promoter and as-\u003cem\u003eicd\u003c/em\u003e flanked by \u003cem\u003eEco\u003c/em\u003eR1 and \u003cem\u003eBam\u003c/em\u003eH1 sites (Fig. 1). The amplified product was inserted into the pTZ57R vector using the InsT/Aclone\u0026trade; PCR product cloning kit (MBI Fermentas) and subsequently transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha;. The presence of the correct plasmid was verified through PCR analysis using ECfruBL1 and ECicd R1 primers. Digestion of the plasmid with \u003cem\u003eEco\u003c/em\u003eR1 released an insert of 290 bp confirming correctness of the construct (data not shown), which was denoted as pVS2K3 (Elias J., (\u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e, unpublished Ph.D thesis).\u003c/p\u003e\n\u003c/span\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e2.5 Construction of pJE6 (\u003c/strong\u003eP\u003csub\u003e\u003cem\u003etac\u003c/em\u003e\u003c/sub\u003e \u003cstrong\u003eas-\u003c/strong\u003e\u003cstrong\u003eicd\u003c/strong\u003e\u003cstrong\u003e).\u003c/strong\u003e PCR amplification of \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; genomic DNA was carried out using EC\u003cem\u003eicd\u003c/em\u003eL1 and EC\u003cem\u003eicd\u003c/em\u003eR1 primers (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The fragments corresponding to 122 bp region of the \u003cem\u003eicd\u003c/em\u003e gene were obtained. The, \u003cem\u003eicd\u003c/em\u003e amplicon had 103 bp regions of \u003cem\u003eicd\u003c/em\u003e with 11 bp corresponding to \u003cem\u003efruB\u003c/em\u003e and 8bp extra with a \u003cem\u003eBam\u003c/em\u003eH1 recognition site on either end. The amplified product was cloned into the pTZ57R (pJE4) vector using the InsT/Aclone\u0026trade; PCR product cloning kit from MBI Fermentas, and then transformed into \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha;. Verification of the correct plasmid presence was performed through PCR analysis utilizing EC\u003cem\u003eicd\u003c/em\u003eL1 and EC\u003cem\u003eicd\u003c/em\u003e R1 primers. Digestion of the plasmid with \u003cem\u003eBam\u003c/em\u003eH1 released an insert of 125bp corresponding to as\u003cem\u003e-icd\u003c/em\u003e which was subcloned into pTTQ18 vector (Elias J., (\u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e, unpublished Ph.D thesis). Presence of the insert was verified by PCR using EC\u003cem\u003eicd\u003c/em\u003eL1 and EC\u003cem\u003eicd\u003c/em\u003e R1 primers and by restriction digestion with \u003cem\u003eBam\u003c/em\u003eH1. The orientation of the \u003cem\u003eicd\u003c/em\u003e gene with respect to P\u003csub\u003e\u003cem\u003etac\u003c/em\u003e\u003c/sub\u003e promoter was further confirmed by PCR amplification using 5\u0026rsquo;GGTGATCAAGCTGTTGACAATTAATCATCGG3\u0026apos; Primer BF1 and EC\u003cem\u003eicd\u003c/em\u003e R1.\u003c/p\u003e\n\u003c/span\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e2.6 Plasmid DNA isolation and transformation.\u003c/strong\u003e Plasmid DNA was isolated from \u003cem\u003eE. coli\u003c/em\u003e and used for transformation by CaCl\u003csub\u003e2\u003c/sub\u003e method using standard protocols (Sambrook et al., \u003cspan class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e\n\u003c/span\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e2.7 Growth experiments.\u003c/strong\u003e For comparison of growth of transformed and native strains, \u003cem\u003eE. coli\u003c/em\u003e cultures (Table \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e) grown overnight in Luria-Bertrani (LB) broth for 24 h were washed with 0.9% saline, resuspended in saline solution and used to inoculate (0.1%) media containing M9 minimal media either glucose (50 mM), glycerol (100 mM), acetate (50mM) and following micronutrients (mg/L): ZnSO\u003csub\u003e4\u003c/sub\u003e.7H\u003csub\u003e2\u003c/sub\u003eO (0.16), H\u003csub\u003e3\u003c/sub\u003eBO\u003csub\u003e3\u003c/sub\u003e (0.5), CuSO\u003csub\u003e4\u003c/sub\u003e.5H\u003csub\u003e2\u003c/sub\u003eO (0.08), FeSO\u003csub\u003e4\u003c/sub\u003e.7H\u003csub\u003e2\u003c/sub\u003eO (3.5), MnSO\u003csub\u003e4\u003c/sub\u003e.4H\u003csub\u003e2\u003c/sub\u003eO (0.4) and CaCl\u003csub\u003e2\u003c/sub\u003e.2H\u003csub\u003e2\u003c/sub\u003eO (0.03) (Elias J., (\u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e, unpublished Ph.D thesis). Growth was monitored by absorbance at 600 nm. IPTG (1 \u0026micro;g/ml) was used for induction of expression of \u003cem\u003eas\u003c/em\u003e-\u003cem\u003eicd\u003c/em\u003e in plasmid pJE6. Cultures were nurtured on a rotary shaker at 37⁰C and pH of culture supernatant was recorded at regular intervals.\u003c/p\u003e\n\u003c/span\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e2.8 Analytical methods.\u003c/strong\u003e Variations in cell density were used as an indicator of growth, measured spectrophotometrically as absorbance at 600 nm using a Helios \u0026lambda; spectrophotometer (Thermo Spectronics, Cambridge, United Kingdom). As decrease in media pH was associated with acid production, observations were recorded until the media pH dropped below 5 or the optical density (O.D.) at 600 nm exceeded 1.9. Aseptically, 1 ml aliquots were withdrawn at predetermined time intervals and promptly frozen at -20\u0026deg;C for later biochemical analyses. Prior to analysis, the stored samples were centrifuged at 9,200 \u0026times; g for 1 minute at 4\u0026deg;C using a Heraeus multifuge 15R (rotor-75003348/75002006). The resulting culture supernatants were then utilized to measure residual glucose and organic acids.Organic acids were analyzed using HPLC (Merck-Hitachi L-7100). The culture supernatants were filtered using 0.2 \u0026micro;m nylon membranes (MDI Advanced Microdevices, India) prior to HPLC analysis. The organic acids present in the filtered supernatants were identified and quantified using high-performance liquid chromatography (HPLC) with a Varian Microsorb RP-18 column at ambient temperature. The mobile phase consisted of 0.01 M Na2HPO4 and 5% acetonitrile, delivered at a flow rate of 0.2 ml/min. Detection of the column effluents was carried out using a UV detector set at 210 nm.GOD-POD kit (Enzopak, Reckon Diagnostics Pvt. Ltd, India) was used to determine concentration of residual glucose in the medium (Adhikary et al. \u003cspan class=\"CitationRef\"\u003e2014)\u003c/span\u003e\u003c/p\u003e\n\u003c/span\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003e\u003cstrong\u003eBacterial strains and plasmids used in this study.\u003c/strong\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eStrains or Plasmids\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGenotype\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReferences\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e Strains\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDH5\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(\u003cem\u003enal[r])F[-]thi[-]recAgyrA\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(Sambrook et al. \u003cspan class=\"CitationRef\"\u003e2001\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBL21(DE3)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF- \u003cem\u003egal\u003c/em\u003e [\u003cem\u003edcm\u003c/em\u003e][\u003cem\u003elon\u003c/em\u003e] \u003cem\u003eompT hsdSB\u003c/em\u003e(rB- mB-); an \u003cem\u003eE. coli\u003c/em\u003e B-strain) with DE3\u003c/p\u003e\n \u003cp\u003ea prophage carries the T7 RNA polymerase gene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(Sambrook et al. \u003cspan class=\"CitationRef\"\u003e2001\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBL21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF- \u003cem\u003egal\u003c/em\u003e [\u003cem\u003edcm\u003c/em\u003e][\u003cem\u003elon\u003c/em\u003e] \u003cem\u003eompT hsdSB\u003c/em\u003e(rB- mB-)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(Sambrook et al. \u003cspan class=\"CitationRef\"\u003e2001\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePlasmids\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epTZ57R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCloning vector Amp\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMBI, fermentas\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epVS2K3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAmp\u003csup\u003er\u003c/sup\u003e; P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e in pTZ57R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePresent study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epTTQ18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eP\u003csub\u003e\u003cem\u003etac\u003c/em\u003e\u003c/sub\u003e promoter, Amp\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(Stark \u003cspan class=\"CitationRef\"\u003e1987\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epJE6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003epTTQ18 carrying \u003cem\u003eas-icd\u003c/em\u003e, P\u003csub\u003e\u003cem\u003etac\u003c/em\u003e\u003c/sub\u003e promoter, Amp\u003csup\u003er\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePresent study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\"\u003eAmp\u003csup\u003er\u003c/sup\u003e, Ampicilin resistance\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimers used for the construction of\u003c/strong\u003e P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e \u003cstrong\u003eas-i\u003c/strong\u003e\u003cstrong\u003ecd\u003c/strong\u003e \u003cstrong\u003echimera\u003c/strong\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimers\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eRemarks\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eECIcd L1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(5\u0026rsquo; \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003eatgttccagttatcc\u003c/span\u003egccttgtgccggaa 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e+\u0026thinsp;5 to +\u0026thinsp;15 atg of the fruB promoter (bold highlighted) followed by +\u0026thinsp;33 to +\u0026thinsp;19 region of the \u003cem\u003eicd\u003c/em\u003e gene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eECIcd R1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(5\u0026rsquo; \u003cspan type=\"BoldUnderline\" class=\"BoldUnderline\" name=\"Emphasis\"\u003ecgggatcctatcgcaggacgcaaac\u003c/span\u003e 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBamH1 site at the 5\u0026rsquo;end (bold highlighted) followed by \u0026minus;\u0026thinsp;72 to \u0026minus;\u0026thinsp;56 region of the \u003cem\u003eicd\u003c/em\u003e gene\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eECFruB L1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(5\u0026rsquo; cg\u003cstrong\u003egaattc\u003c/strong\u003etgctcataactttacggctt 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eEco\u003c/em\u003eR1 site at 5\u0026rsquo;end (bold highlighted, -158 to \u0026minus;\u0026thinsp;139 of \u003cem\u003efruB\u003c/em\u003e promoter.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eEcFruB R1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e(5\u0026rsquo; \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003egttccggcacaaggc\u003c/span\u003eggataactgga 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e+\u0026thinsp;19 to +\u0026thinsp;33 of \u003cem\u003eicd\u003c/em\u003e gene (underlined) followed by +\u0026thinsp;15 to +\u0026thinsp;5 of the \u003cem\u003efruB\u003c/em\u003e promoter\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eThe physiological parameters assessed included specific glucose depletion rate, growth rate and biomass yield, as outlined by Chao and Liao (\u003cspan class=\"CitationRef\"\u003e1993\u003c/span\u003e). The total glucose and glycerol consumption was calculated by subtracting the final substrate concentrations in the culture medium from the initial concentrations. Organic acid yields were quantified as grams of organic acid produced per gram of glucose consumed per gram of dry cell weight. Statistical analysis of all parameters was performed using GraphPad Prism software (version 3.0).\u003c/p\u003e\n\u003cp\u003e\u003cspan\u003e\u003cstrong\u003e2.9 Preparation of cells, cell free extracts and enzymatic assays.\u003c/strong\u003e M9 medium grown cells were collected by centrifugation at 9,200 x \u003cem\u003eg\u003c/em\u003e for 2 min at 4\u003csup\u003eo\u003c/sup\u003e C at an appropriate growth phase from 30 ml cultures. The cells were resuspended in sonication buffer (10 mM potassium phosphate buffer, pH 7.7 containing 500 mM NaCl and 2 mM MgCl\u003csub\u003e2\u003c/sub\u003e) and lysed using a Branson sonifier 450. CS, ICL and ICDH were assayed at late log phase while G-6-PDH was assayed at mid log phase (Elias J., (\u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e, unpublished Ph.D thesis). The activity of citrate synthase (CS, EC 4.1.3.7) was assessed by measuring the absorbance of 5,5-dithiobis (2-nitrobenzoic acid) at 412 nm, which undergoes a change upon interaction with the sulfhydryl group of coenzyme A (CoA) (Srere \u003cspan class=\"CitationRef\"\u003e1969\u003c/span\u003e; Jain et al. \u003cspan class=\"CitationRef\"\u003e2013\u003c/span\u003e). The 1.0 ml assay mixture consisted of the following components: 93 mM Tris-HCl (pH 8.0), 0.16 mM acetyl CoA, 0.2 mM oxaloacetate, 0.1 mM 5-dithiobis (2-nitrobenzoic acid), and cell lysate. Oxaloacetate was used to initiate the reaction. The molar absorbance coefficient was 13.6 mM\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003ecm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e at 412 nm. Glucose-6-phosphate dehydrogenase (G-6-PDH, EC 1.1.1.49) (Eisenberg and Dobrogosz, \u003cspan class=\"CitationRef\"\u003e1967\u003c/span\u003e) and isocitrate dehydrogenase (ICDH, EC 1.1.1.42) (Garnak and Reeves, \u003cspan class=\"CitationRef\"\u003e1979\u003c/span\u003e) enzyme activities were measured by observing the reduction of NADP at 340 nm. Isocitrate lyase (ICL, EC 4.1.3.1) activity was ascertained by quantifying glyoxylate formation at 324 nm in presence of phenylhydrazine HCl (Dixon \u003cspan class=\"CitationRef\"\u003e1959\u003c/span\u003e). Spectrophotometrically quantification of total protein concentration was determined by the modified method of Folin-Lowry; bovine serum albumin was used as the standard (Peterson,\u0026nbsp;\u003cspan class=\"CitationRef\"\u003e1979\u003c/span\u003e).\u003cbr\u003e\u003c/span\u003e\u003cspan\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.10 Enzymatic measurement of organic acids.\u003c/strong\u003e Cell extracts were obtained from stationary phase cultures of \u003cem\u003eE. coli\u003c/em\u003e transformants cultivated on M9-glucose and M9-glycerol mediums, following the same preparation steps as for enzyme assays. These extracts were filtered using a 0.2 \u0026micro;m nitrocellulose membrane and were either kept on an ice bath or frozen until further analysis. The filtrates were used to assess intracellular citric acid levels, while the filtered supernatants from the same cultures were used to determine extracellular acetic acid (Buch et al., \u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cp\u003eThe spectrophotometric measurement of intracellular citric acid was carried out based on the method adapted from Petrarulo et al. (\u003cspan class=\"CitationRef\"\u003e1995\u003c/span\u003e), with minor modifications from Elias J\u0026apos;s (2009) unpublished Ph.D. thesis. The assay used a 1.0 ml mixture consisting of 50 mM phosphate buffer, 0.02 ml of 246 mM phenylhydrazine, 0.02 ml of citrate lyase (0.27U from a 13.3 units/ml stock), and either citric acid standard or cell extract. The phosphate buffer contained 50 mM buffer (pH 6.5), 0.1 mM ZnSO4\u0026middot;7H2O, and 0.2 g/L sodium azide. A standard curve was created using citric acid standards from 5 \u0026micro;M to 20 \u0026micro;M (Buch et al. \u003cspan class=\"CitationRef\"\u003e2009\u003c/span\u003e). Optical density (O.D.) at 330 nm was recorded after 3 minutes of citrate lyase addition, and the intracellular citrate concentration (in mM) was calculated. The cellular volume was assumed to be 1.63 \u0026micro;l/mg dry cell weight (dcw), according to Emmerling et al. (\u003cspan class=\"CitationRef\"\u003e1999\u003c/span\u003e).\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cspan\u003e\u003cstrong\u003e3.1 Effect of P\u003c/strong\u003e \u003csub\u003e\u0026nbsp;\u003cstrong\u003efruB\u003c/strong\u003e\u0026nbsp;\u003c/sub\u003e \u003cstrong\u003eas-i\u003c/strong\u003e\u003cstrong\u003ecd\u003c/strong\u003e \u003cstrong\u003e(pVS2k3) on Isocitrate dehydrogenase (ICDH) activity in\u003c/strong\u003e \u003cstrong\u003eE. coli\u003c/strong\u003e \u003cstrong\u003eDH5\u0026alpha; and\u003c/strong\u003e \u003cstrong\u003eE. coli\u003c/strong\u003e \u003cstrong\u003eBL21.\u003c/strong\u003e On glucose P\u003csub\u003e\u003cem\u003efru\u003c/em\u003eB\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e expression in \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; down-regulated ICD activity by 3\u0026ndash;4 fold decrease (Fig. 2a) but no effect was discernible in case of this strain on glycerol (Fig. 2a). The enzyme activity of ICDH activity remained unchanged in \u003cem\u003eE. coli\u003c/em\u003e BL21 (\u0026lambda;DE3) expressing pVS2k3 (Fig. 2b). To validate that the dysfunction of Cra could be a probable reason for the failure of P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e in BL21(\u0026lambda;DE3) as-\u003cem\u003eicd\u003c/em\u003e was expressed under IPTG inducible promoter (P\u003csub\u003e\u003cem\u003etac\u003c/em\u003e\u003c/sub\u003e). P\u003csub\u003e\u003cem\u003etac\u003c/em\u003e\u003c/sub\u003e as-i\u003cem\u003ecd\u003c/em\u003e expression in \u003cem\u003eE. coli\u003c/em\u003e BL21 monitored a 3\u0026ndash;4 fold reduction in ICDH activity (Fig. 2b). Higher ICDH activity was observed in \u003cem\u003eE. coli\u003c/em\u003e BL21 on both glucose and acetate (Fig. 2c).\u0026nbsp;\u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; showed no ICDH activity on acetate.\u003cbr\u003e\u003c/span\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2 Effect of P\u003c/strong\u003e \u003csub\u003e\u0026nbsp;\u003cstrong\u003efruB\u003c/strong\u003e\u0026nbsp;\u003c/sub\u003e \u003cstrong\u003eas-i\u003c/strong\u003e\u003cstrong\u003ecd\u003c/strong\u003e \u003cstrong\u003eon physiological parameters in\u003c/strong\u003e \u003cstrong\u003eE. coli\u003c/strong\u003e \u003cstrong\u003eDH5\u0026alpha;.\u003c/strong\u003e Reduced ICDH activity by P\u003csub\u003e\u003cem\u003efru\u003c/em\u003eB\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e did not alter the growth rate (0.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08 h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) but significantly improved the glucose consumption rate (5.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.25 g glc.g\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003edcw.h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e) when compared to the \u003cem\u003eE. coli\u003c/em\u003e harboring the control plasmid pTZ57R (Fig. 3, Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e3.3 Effect of P\u003c/strong\u003e \u003csub\u003e\u0026nbsp;\u003cstrong\u003efruB\u003c/strong\u003e\u0026nbsp;\u003c/sub\u003e \u003cstrong\u003eas-i\u003c/strong\u003e\u003cstrong\u003ecd\u003c/strong\u003e \u003cstrong\u003eon Citrate synthase (CS), Glucose 6 phosphate dehydrogenase (G-6-PDH) and isocitrate lyase (ICL) activities in\u003c/strong\u003e \u003cstrong\u003eE. coli\u003c/strong\u003e \u003cstrong\u003eDH5\u0026alpha; on glucose.\u003c/strong\u003e Down-regulation of ICDH activity by P\u003csub\u003e\u003cem\u003efru\u003c/em\u003eB\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e demonstrated a significant increase in CS activity (0.079\u0026thinsp;\u0026plusmn;\u0026thinsp;0.008 U) compared to its plasmid control (0.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002 U). G-6-PDH activity significantly decreased in response to the P\u003csub\u003e\u003cem\u003efru\u003c/em\u003eB\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e down regulation of \u003cem\u003eicd\u003c/em\u003e gene (Fig. 4). No ICL activity was detected on glucose.\u003c/p\u003e\n\u003c/span\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e3.4 Effect of P\u003c/strong\u003e \u003csub\u003e\u0026nbsp;\u003cstrong\u003efruB\u003c/strong\u003e\u0026nbsp;\u003c/sub\u003e \u003cstrong\u003eas-i\u003c/strong\u003e\u003cstrong\u003ecd\u003c/strong\u003e \u003cstrong\u003eon organic acid secretion in\u003c/strong\u003e \u003cstrong\u003eE. coli\u003c/strong\u003e \u003cstrong\u003eDH5\u0026alpha;.\u003c/strong\u003e Antisense RNA mediated down regulation of \u003cem\u003eicd\u003c/em\u003e gene was reflected in the increased citrate accumulation in (1.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.013 mM) as compared to plasmid control strain (0. 65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 mM) (Table \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e). No extracellular citrate was detected in \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha;\u003c/p\u003e\n\u003c/span\u003e\u0026nbsp;\u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhysiological parameters demonstrating the effect of P\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003efru\u003c/strong\u003e\u003cstrong\u003eB\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e-as\u003c/strong\u003e\u003cstrong\u003eicd\u003c/strong\u003e \u003cstrong\u003eexpression in\u003c/strong\u003e \u003cstrong\u003eE. coli\u003c/strong\u003e \u003cstrong\u003eDH5\u0026alpha; on glucose.\u003c/strong\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e strains\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGrowth rate (\u0026micro;)h\u003csup\u003e-1\u003c/sup\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSpecific glucose consumption rate (Q\u003csub\u003eglc\u003c/sub\u003e)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTotal glucose consumed (mM)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eBiomass\u003c/p\u003e\n \u003cp\u003eY\u003csub\u003edcw\u003c/sub\u003e/glc\u003c/p\u003e\n \u003cp\u003e(g dcw.g\u003csup\u003e-1\u003c/sup\u003e.h\u003csup\u003e-1\u003c/sup\u003e)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDH5\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.26\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e7.0\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e48\u0026thinsp;\u0026plusmn;\u0026thinsp;2.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.023\u0026thinsp;\u0026plusmn;\u0026thinsp;0.010\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDH5\u0026alpha;: pTZ57R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e3.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.0\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e42\u0026thinsp;\u0026plusmn;\u0026thinsp;5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.025\u0026thinsp;\u0026plusmn;\u0026thinsp;0.010\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDH5\u0026alpha;: pVS2k3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003csup\u003ens\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e5.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.25 **\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e35\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.033\u0026thinsp;\u0026plusmn;\u0026thinsp;0.015\u003csup\u003ea\u003c/sup\u003e**\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\"\u003eThe results are expressed as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of 8\u0026ndash;10 independent observations. Carbon source used is 50mM glucose for \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha;. Specific growth rate (\u0026micro;(h\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e)), specific glucose consumption rate (\u003cstrong\u003eQ\u003c/strong\u003e\u003csub\u003eGlc\u003c/sub\u003e) and Biomass (Y\u003csub\u003edcw\u003c/sub\u003e/glc) were determined from mid log phase of each experiment. Total glucose utilized was determined at the end of growth curve. Significance calculated with respect to the respective plasmid control ** p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ns- non significant\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n\u003c/table\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab4\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003e\u003cstrong\u003eOrganic acid formation in\u003c/strong\u003e \u003cstrong\u003eE. coli\u003c/strong\u003e \u003cstrong\u003eDH5\u0026alpha; transformants expressing P\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003efru\u003c/strong\u003e\u003cstrong\u003eB\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e-as\u003c/strong\u003e\u003cstrong\u003eicd\u003c/strong\u003e on \u003cstrong\u003e50 mM glucose.\u003c/strong\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e strains\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eIntracellular citrate\u003c/p\u003e\n \u003cp\u003e(mM)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eExtracellular Acetate (mM)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDH5\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eND\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDH5\u0026alpha; pTZ57R\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.69\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDH5\u0026alpha; pVS2k3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13\u003csup\u003ea\u003c/sup\u003e**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65\u003csup\u003ea ns\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"3\"\u003eThe table depicts the citrate (intracellular) and acetate (extracellular) levels in the late stationary phase cultures of \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; transformants (plasmid control and test) grown on M9 minimal media with 50mM as carbon source. All the values are represented as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD of n\u0026thinsp;=\u0026thinsp;8 observations. ** p\u0026thinsp;\u0026lt;\u0026thinsp;0.01and \u003csup\u003ens\u003c/sup\u003e non-significant.\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003eLow levels of acetate were found on 50mM glucose in \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha;. \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; pVS2k3 (1.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65 mM) expressing P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e had slight increase in acetate levels compared to its plasmid control bearing \u003cem\u003eE. coli\u003c/em\u003e DH5\u0026alpha; (1.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25 mM) (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eAntisense RNA offers a tool to partially down-regulate the expression of bacterial genes thus overcoming the problems encountered with null mutants (Kernodle et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Kurreck \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Conditional antisense RNA expressing systems are considered to be more effective as they exhibit leaky phenotype. A tetracycline (tet) controlled antisense RNA expressing system was developed; it allowed selective genes of the chromosome to be switched on and off and even control their expression levels. This offered a potential tool to generate a quantitative data of the gene product (Yin and Ji \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Parish and Stoker (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1997\u003c/span\u003e), demonstrated that conditional regulation of antisense RNA expression under an inducible promoter in mycobacteria facilitated the elucidation of the role of essential genes. Present study deals with designing of a conditionally regulated antisense RNA against the \u003cem\u003eicd\u003c/em\u003e gene of \u003cem\u003eE. coli\u003c/em\u003e where carbon source availability controls the antisense RNA expression. The strategy exploits the natural mechanism of Cra protein-mediated control of \u003cem\u003efruB\u003c/em\u003e promoter which connects carbon source availability through intracellular F-1-P and F-1,6-P concentrations to gene expression (Fig.\u0026nbsp;5). The conditional antisense RNA strategy employed in this study is novel in that (a) it avoids the use of external inducers for the down- regulation of target genes and (b) depends upon the nature and amount of the available carbon sources. \u003cem\u003efru\u003c/em\u003eB promoter has been used to quantify the amount of nutrients available to the microbial residents in the phyllosphere (Leveau and Lindow \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). In this study they expressed the promoter from \u003cem\u003eE. coli\u003c/em\u003e in \u003cem\u003eErwinia herbicola\u003c/em\u003e as they are closely related bacteria but in the present study, we report that the constitutive Cra expression as seen in \u003cem\u003eE. coli\u003c/em\u003e B could restrict its use among \u003cem\u003eE. coli\u003c/em\u003e strains.\u003c/p\u003e \u003cp\u003eP\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e expression down-regulated ICDH enzyme activity by 3-4fold in \u003cem\u003eE. coli\u003c/em\u003e DH5α on glucose but not on glycerol as \u003cem\u003efruB\u003c/em\u003e promoter is known to get de-repressed by increased F-1,6-P levels seen in \u003cem\u003eE. coli\u003c/em\u003e when grown on glucose. This de-repression of the \u003cem\u003efru\u003c/em\u003eB promoter produces as-\u003cem\u003eicd\u003c/em\u003e RNA (Fig.\u0026nbsp;5). However, when glycerol is used, the fruB promoter stays inhibited by the Cra protein because of the low levels of fructose-1,6-phosphate, resulting in no alteration in ICDH activity. This finding could be supported with earlier reports that \u003cem\u003efruB\u003c/em\u003e promoter responded to the fructose in the medium but failed to express on galactose (Leveau and Lindow \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2001\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eE. coli\u003c/em\u003e K and B strains are known to differ in the manner in which the regulation of glyoxylate pathway and Cra protein takes place (Phue et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Son et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). \u003cem\u003eE. coli\u003c/em\u003e B strains secrete low levels of acetate as compared to \u003cem\u003eE. coli\u003c/em\u003e K strains this property supports efficient recombinant protein expression in \u003cem\u003eE. coli\u003c/em\u003e B strains (Shiloach et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1996\u003c/span\u003e). In contrast to \u003cem\u003eE. coli\u003c/em\u003e K strain, P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e had no effect on the ICD activity in \u003cem\u003eE. coli\u003c/em\u003e B strain when grown on glucose. This suggested that there could be alteration in Cra regulation hence to validate that the dysfunction of Cra could be a probable reason for the failure of P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e in BL21(λDE3) as-\u003cem\u003eicd\u003c/em\u003e was expressed under IPTG inducible promoter. P\u003csub\u003e\u003cem\u003etac\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e expression in \u003cem\u003eE. coli\u003c/em\u003e BL21 downregulated the ICDH activity by 3-4fold. Moreover the growth of \u003cem\u003eE. coli\u003c/em\u003e BL21 on acetate supported the anamalous Cra protein as \u003cem\u003eE. coli\u003c/em\u003e Cra mutants could not grow on acetate. These results support that a dysfunctional Cra regulation could restrict the universal use of \u003cem\u003efru\u003c/em\u003eB promoter in \u003cem\u003eE.coli\u003c/em\u003e strains. Hence the physiological experiments to monitor the effects of conditional downregulation of \u003cem\u003eicd\u003c/em\u003e gene were carried out in \u003cem\u003eE. coli\u003c/em\u003e DH5α.\u003c/p\u003e \u003cp\u003eDown-regulation of ICDH by P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e in \u003cem\u003eE. coli\u003c/em\u003e DH5α increased CS activity which is in agreement with the earlier results related to \u003cem\u003eE. coli icd\u003c/em\u003e mutants (Lakshmi and Helling \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1976\u003c/span\u003e; Kabir and Shimizu \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). This increase in \u003cem\u003eicd\u003c/em\u003e mutants was proposed to enhance NAD(P)H levels which were generated by ICDH in wild type (Park et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e1994\u003c/span\u003e). Conditional as\u003cem\u003eicd\u003c/em\u003e demonstrated increased growth along with high CS activity compared to the \u003cem\u003eE. coli icd\u003c/em\u003e mutants (Lakshmi and Helling \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1976\u003c/span\u003e; Kabir and Shimizu \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Lower G-6-PDH activity in \u003cem\u003eE. coli\u003c/em\u003e expressing as-\u003cem\u003eicd\u003c/em\u003e could be attributed to the partial block that suffices the requirements of NADPH. Absence of ICL activity in \u003cem\u003eE. coli\u003c/em\u003e on glucose irrespective of antisense expression is well supported by the reports that on glucose there is no ICL activity in \u003cem\u003eE. coli\u003c/em\u003e K-12 derivative (Phue et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eP\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e expression significantly increased intracellular citrate levels which supports that blocking ICD could be a probable target for citrate accumulation in \u003cem\u003eE. coli\u003c/em\u003e strains and these finding were similar to the \u003cem\u003eicd\u003c/em\u003e mutant. High acetate levels were observed in \u003cem\u003eE. coli\u003c/em\u003e expressing antisense as compared to that of \u003cem\u003eicd\u003c/em\u003e mutant (Kabir and Shimizu \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). \u003cem\u003eE. coli\u003c/em\u003e has a reportedly low TCA flux and the partial block in the ICDH activity probably leads to further decrease in the TCA flux resulting in pyruvate accumulation in large amount which could be directed to acetate formation. Absence of citrate in the extracellular medium is due to the absence of a citrate efflux mechanism in \u003cem\u003eE. coli\u003c/em\u003e (Lakshmi and Helling \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1976\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe present study reports that down regulation of \u003cem\u003eicd\u003c/em\u003e gene using antisense technology controlled by \u003cem\u003efruB\u003c/em\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) was capable of accumulating citrate without altering the growth of \u003cem\u003eE. coli\u003c/em\u003e K strain as seen in case of \u003cem\u003eicd\u003c/em\u003e mutants (Lakshmi and Helling \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1976\u003c/span\u003e; Aoshima et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Kabir and Shimizu \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). Cra dysfunction in \u003cem\u003eE. coli\u003c/em\u003e BL21was reported earlier (Phue et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Son et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) the present study supports this report as P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e was not found to be a suitable promoter for expression studies in \u003cem\u003eE. coli\u003c/em\u003e BL21. Thus, \u003cem\u003eE. coli\u003c/em\u003e K and B strains differ distinctly in the metabolism, proteome and the genome sequence of B strains (Jeong et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Han, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) could facilitate in unraveling these differences.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003eCharacteristic differences between an\u003c/b\u003e \u003cb\u003eE. coli icd\u003c/b\u003e \u003cb\u003emutant and\u003c/b\u003e \u003cb\u003eE. coli\u003c/b\u003e \u003cb\u003eexpressing as-\u003c/b\u003e\u003cb\u003eicd\u003c/b\u003e \u003cb\u003egene under\u003c/b\u003e \u003cb\u003efru\u003c/b\u003e\u003cb\u003eB promoter.\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eParameters\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eE. coli icd\u003c/em\u003e mutant\u003c/p\u003e \u003cp\u003e(Lakshmi and Helling \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1976\u003c/span\u003e; Kabir and Shimizu \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2004\u003c/span\u003e)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e DH5α pVS2k3\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGrowth rate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSlow\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eNo change\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGlucose consumption rate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e\u0026sim;2 fold increase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGlucose consumed\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRequired\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eNo change\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGlucose 6 phosphate dehydrogenase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e\u0026sim;1.2 fold decrease\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCitrate Synthase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e\u0026sim;2 fold increase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIsocitrate Dehydrogenase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e\u0026sim;3\u0026ndash;4 fold decrease\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIsocitrate lyase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHigh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eND\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCitrate (Intracellular)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11 mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e\u0026sim; 1.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13 mM\u003c/p\u003e \u003cp\u003e2 fold increase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAcetate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLow\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003e\u0026sim; 2 fold increase\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"4\"\u003eND- not detected and NA-not available\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThree overlapping antisense genes in \u003cem\u003eEscherichia coli\u003c/em\u003e O157:H7 EDL933 cause translationally arrest mutant phenotype (Graf et al., 2023). \u003cem\u003eEscherichia coli\u003c/em\u003e K12 MG1655 contains 663 overlapping pairs with larger than 30 nucleotides out of them 586 are co-oriented, 75 convergent and 2 divergent (Huvet and Stumpf, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Natural antisense RNAs in bacteria are known to post transcriptional inhibition of mRNA, direct inhibition of translation and also act as riboswitches associated with wide range of bacterial activities viz plasmid replication, metabolite sensing biofilm formation, conjugation, toxin synthesis (Saberi et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eConflict of Interest statement\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003enone\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose. The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Strain developments and plasmid construction were done by Vikas Sharma and Jisha Elias. Growth experiments, analytical, biochemical assays, data collection, and data analysis were performed by Jisha Elias. The first draft of the manuscript was written by Jisha Elias and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAdhikary H, Sanghavi PB, Macwan SR, Archana G, Naresh Kumar G (2014) Artificial citrate operon confers mineral phosphate solubilization ability to diverse Fluorescent Pseudomonads. PLoS ONE 9(9):e107554. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0107554\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0107554\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAoshima M, Ishii M, Yamagishi A, Oshima T, Igarashi Y (2003) Metabolic characteristics of an isocitrate dehydrogenase defective derivative of \u003cem\u003eEscherichia coli\u003c/em\u003e BL21(DE3). Biotechnol Bioeng 84:732\u0026ndash;737. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bit.10832\u003c/span\u003e\u003cspan address=\"10.1002/bit.10832\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuch AD, Archana G, Kumar GN (2009) Enhanced citric acid biosynthesis in \u003cem\u003ePseudomonas fluorescens\u003c/em\u003e ATCC 13525 by overexpression of the \u003cem\u003eEscherichia coli\u003c/em\u003e citrate synthase gene. Microbiol (Reading) 155:2620\u0026ndash;2629. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1099/mic.0.028878-0\u003c/span\u003e\u003cspan address=\"10.1099/mic.0.028878-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChao YP, Liao JC (1993) Alteration of growth yield by overexpression of phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase in \u003cem\u003eEscherichia coli\u003c/em\u003e. Appl Environ Microbiol 59:4261\u0026ndash;4265. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/aem.59.12.4261-4265.1993\u003c/span\u003e\u003cspan address=\"10.1128/aem.59.12.4261-4265.1993\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChavarr\u0026iacute;a M, de Lorenzo V (2018) The imbroglio of the physiological Cra effector clarified at last. Mol Microbiol 109:273\u0026ndash;277. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/mmi.14080\u003c/span\u003e\u003cspan address=\"10.1111/mmi.14080\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eColeman J, Green PJ, Inouye M (1984) The use of RNAs complementary to specific mRNAs to regulate the expression of individual bacterial genes. Cell 37:429\u0026ndash;436. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0092-8674(84)90373-8\u003c/span\u003e\u003cspan address=\"10.1016/0092-8674(84)90373-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDesai RP, Papoutsakis ET (1999) Antisense RNA strategies for metabolic engineering of \u003cem\u003eClostridium acetobutylicum\u003c/em\u003e. Appl Environ Microbiol 65:936\u0026ndash;945. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.65.3.936-945.1999\u003c/span\u003e\u003cspan address=\"10.1128/AEM.65.3.936-945.1999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDixon GH (1959) Assay methods for key enzymes of the glyoxylate cycle. Biochem J 3:72\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEisenberg RC, Dobrogosz WJ (1967) Gluconate metabolism in \u003cem\u003eEscherichia coli\u003c/em\u003e. J Bacteriol 93:941\u0026ndash;949. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jb.93.3.941-949.1967\u003c/span\u003e\u003cspan address=\"10.1128/jb.93.3.941-949.1967\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEllison MJ, Kelleher RJ, Rich A (1985) Thermal regulation of beta-galactosidase synthesis using anti-sense RNA directed against the coding portion of the mRNA. J Biol Chem 260:9085\u0026ndash;9087. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0021-9258(17)39332-8\u003c/span\u003e\u003cspan address=\"10.1016/S0021-9258(17)39332-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElias J (2009) Engineering the central carbon metabolism of \u003cem\u003eEscherichia coli\u003c/em\u003e to enhance organic acid secretion (Ph.D thesis) \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://hdl.handle.net/10603/58694\u003c/span\u003e\u003cspan address=\"http://hdl.handle.net/10603/58694\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEmmerling M, Bailey JE, Sauer U (1999) Glucose catabolism of \u003cem\u003eEscherichia coli\u003c/em\u003e Strains with increased activity and altered regulation of key glycolytic enzymes. Metab Eng 1:117\u0026ndash;127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/mben.1998.0109\u003c/span\u003e\u003cspan address=\"10.1006/mben.1998.0109\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEngdahl HM, Hjalt TA, Wagner EG (1997) A two unit antisense RNA cassette test system for silencing of target genes. Nucleic Acids Res 25:3218\u0026ndash;3227. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/25.16.3218\u003c/span\u003e\u003cspan address=\"10.1093/nar/25.16.3218\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGarnak M, Reeves HC (1979) Purification and properties of phosphorylated isocitrate dehydrogenase of \u003cem\u003eEscherichia coli\u003c/em\u003e. J Biol Chem 254:7915\u0026ndash;7920. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0021-9258(18)36033-2\u003c/span\u003e\u003cspan address=\"10.1016/S0021-9258(18)36033-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeorg J, Hess WR (2011) cis-antisense RNA, another level of gene regulation in bacteria. Microbiol Mol Biol Rev 75:286\u0026ndash;300. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/MMBR.00032-10\u003c/span\u003e\u003cspan address=\"10.1128/MMBR.00032-10\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan MJ (2016) Exploring the proteomic characteristics of the \u003cem\u003eEscherichia coli\u003c/em\u003e B and K-12 strains in different cellular compartments. J Biosci Bioeng 122(1):1\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jbiosc.2015.12.005\u003c/span\u003e\u003cspan address=\"10.1016/j.jbiosc.2015.12.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHelling RB (1995) icdB mutants of \u003cem\u003eEscherichia coli\u003c/em\u003e. J Bacteriol 177(9):2592\u0026ndash;2593. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jb.177.9.2592-2593\u003c/span\u003e\u003cspan address=\"10.1128/jb.177.9.2592-2593\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHolms H (2001) Flux analysis: a basic tool of microbial physiology. Adv Microb Physiol 45:271\u0026ndash;340. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s0065-2911(01)45006-5\u003c/span\u003e\u003cspan address=\"10.1016/s0065-2911(01)45006-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuvet M, Stumpf MP (2014) Overlapping genes: a window on gene evolvability. BMC Genomics 15:721. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003edoi.org/10.1186/1471-2164-15-721\u003c/span\u003e\u003cspan address=\"10.1186/1471-2164-15-721\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJain R, Jha S, Adhikary H, Kumar P, Parekh V, Jha A et al (2013) Isolation and Molecular characterization of arsenite-tolerant \u003cem\u003eAlishewanella\u003c/em\u003e sp. GIDC-5 originated from Industrial effluents. Geomicrobiol J 31:82\u0026ndash;90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/01490451.2013.811317\u003c/span\u003e\u003cspan address=\"10.1080/01490451.2013.811317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJeong H, Barbe V, Lee CH et al (2009) Genome sequences of \u003cem\u003eEscherichia coli\u003c/em\u003e B strains REL606 and BL21(DE3). J Mol Biol 394:644\u0026ndash;652. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jmb.2009.09.052\u003c/span\u003e\u003cspan address=\"10.1016/j.jmb.2009.09.052\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKabir MM, Shimizu K (2004) Metabolic regulation analysis of icd-gene knockout \u003cem\u003eEscherichia coli\u003c/em\u003e based on 2D electrophoresis with MALDI-TOF mass spectrometry and enzyme activity measurements. Appl Microbiol Biotechnol 65:84\u0026ndash;96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00253-004-1627-1\u003c/span\u003e\u003cspan address=\"10.1007/s00253-004-1627-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKernodle DS, Voladri RK, Menzies BE, Hager CC, Edwards KM (1997) Expression of an antisense hla fragment in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e reduces alpha-toxin production \u003cem\u003ein vitro\u003c/em\u003e and attenuates lethal activity in a murine model. Infect Immun 65:179\u0026ndash;184. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/iai.65.1.179-184.1997\u003c/span\u003e\u003cspan address=\"10.1128/iai.65.1.179-184.1997\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurreck J (2003) Antisense technologies: improvement through novel chemical modifications. Eur J Biochem 270:1628\u0026ndash;1644. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1046/j.1432-1033.2003.03555.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1432-1033.2003.03555.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLakshmi TM, Helling RB (1976) Selection for citrate synthase deficiency in icd mutants of \u003cem\u003eEscherichia coli\u003c/em\u003e. J Bacteriol 127:76\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jb.127.1.76-83.1976\u003c/span\u003e\u003cspan address=\"10.1128/jb.127.1.76-83.1976\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeveau JH, Lindow SE (2001) Appetite of an epiphyte: quantitative monitoring of bacterial sugar consumption in the phyllosphere. Proc Natl Acad Sci U S A 98:3446\u0026ndash;3453. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.061629598\u003c/span\u003e\u003cspan address=\"10.1073/pnas.061629598\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParish T, Stoker NG (1997) Development and use of a conditional antisense mutagenesis system in mycobacteria. FEMS Microbiol Lett 154:151\u0026ndash;157. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1574-6968.1997.tb12637.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1574-6968.1997.tb12637.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark SJ, McCabe J, Turna J, Gunsalus RP (1994) Regulation of the citrate synthase (gltA) gene of \u003cem\u003eEscherichia coli\u003c/em\u003e in response to anaerobiosis and carbon supply: role of the arcA gene product. J Bacteriol 176:5086\u0026ndash;5092. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jb.176.16.5086-5092.1994\u003c/span\u003e\u003cspan address=\"10.1128/jb.176.16.5086-5092.1994\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePestka S, Daugherty BL, Jung V, Hotta K, Pestka RK (1984) Anti-mRNA: specific inhibition of translation of single mRNA molecules. Proc Natl Acad Sci U S A 81:7525\u0026ndash;7528. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.81.23.7525\u003c/span\u003e\u003cspan address=\"10.1073/pnas.81.23.7525\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeterson GL (1979) Review of the Folin phenol protein quantitation method of Lowry, Rosebrough, Farr and Randall. Anal Biochem 100:201\u0026ndash;220. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0003-2697(79)90222-7\u003c/span\u003e\u003cspan address=\"10.1016/0003-2697(79)90222-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePetrarulo M, Facchini P, Cerelli E, Marangella M, Linari F (1995) Citrate in urine determined with a new citrate lyase method. Clin Chem 410:1518\u0026ndash;1521. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/clinchem/41.10.1518\u003c/span\u003e\u003cspan address=\"10.1093/clinchem/41.10.1518\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhue JN, Noronha SB, Hattacharyya R, Wolfe AJ, Shiloach J (2005) Glucose metabolism at high density growth of \u003cem\u003eE coli\u003c/em\u003e B and \u003cem\u003eE coli\u003c/em\u003e K: differences in metabolic pathways are responsible for efficient glucose utilization in \u003cem\u003eE coli\u003c/em\u003e B as determined by microarrays and Northern blot analyses. Biotechnol Bioeng 90:805\u0026ndash;820. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bit.20478\u003c/span\u003e\u003cspan address=\"10.1002/bit.20478\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamseier TM (1996) Cra and the control of carbon flux via metabolic pathways. Res Microbiol 147:489\u0026ndash;493. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0923-2508(96)84003-4\u003c/span\u003e\u003cspan address=\"10.1016/0923-2508(96)84003-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaberi F, Kamali M, Najafi A, Yazdanparast A, Moghaddam MM (2016) Natural antisense RNAs as mRNA regulatory elements in bacteria: a review on function and applications. Cell Mol Biol Lett 21:6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s11658-016-0007-z\u003c/span\u003e\u003cspan address=\"10.1186/s11658-016-0007-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaier MHJ, Ramseier TM (1996) The catabolite repressor/activator (Cra) protein of enteric bacteria. J Bacteriol 178:3411\u0026ndash;3417. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/jb.178.12.3411-3417.1996\u003c/span\u003e\u003cspan address=\"10.1128/jb.178.12.3411-3417.1996\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSambrook J, Russell DW, Fritsch EF, Maniatis T (2001) Molecular Cloning: a Laboratory Manual, 4th edn. Cold Spring Harb. Laboratory, New Jersey\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShiloach J, Kaufman J, Guillard AS, Fass R (1996) Effect of glucose supply strategy on acetate accumulation, growth, and recombinant protein production by \u003cem\u003eEscherichia coli\u003c/em\u003e BL21 (lambdaDE3) and \u003cem\u003eEscherichia coli\u003c/em\u003e JM109. Biotechnol Bioeng 49:421\u0026ndash;428. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/(SICI)1097-0290(19960220)49:4\u0026lt;421::AID-BIT9\u0026gt;3.0.CO;2-R\u003c/span\u003e\u003cspan address=\"10.1002/(SICI)1097-0290(19960220)49:4%3C421::AID-BIT9%3E3.0.CO;2-R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh A, Cher Soh K, Hatzimanikatis V, Gill RT (2011) Manipulating redox and ATP balancing for improved production of succinate in \u003cem\u003eE coli\u003c/em\u003e. Metab Eng 13:76\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ymben.2010.10.006\u003c/span\u003e\u003cspan address=\"10.1016/j.ymben.2010.10.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSon YJ, Phue JN, Trinh LB, Lee SJ, Shiloach J (2011) The role of Cra in regulating acetate excretion and osmotic tolerance in \u003cem\u003eE coli\u003c/em\u003e K-12 and \u003cem\u003eE coli\u003c/em\u003e B at high density growth. Microb Cell Factories 10:52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1475-2859-10-52\u003c/span\u003e\u003cspan address=\"10.1186/1475-2859-10-52\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSrere PA (1969) [1] Citrate synthase: [EC 4.1. 3.7. Citrate oxaloacetate-lyase (CoA-acetylating)]. In: Methods in Enzymology: Citric Acid Cycle, Vol. 13, Academic Press, pp. 3\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0076-6879(69)13005-0\u003c/span\u003e\u003cspan address=\"10.1016/0076-6879(69)13005-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStark MJ (1987) Multicopy expression vectors carrying the lac repressor gene for regulated high-level expression of genes in \u003cem\u003eEscherichia coli\u003c/em\u003e. Gene 51:255\u0026ndash;267. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/0378-1119(87)90314-3\u003c/span\u003e\u003cspan address=\"10.1016/0378-1119(87)90314-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVemuri GN, Eiteman MA, Altman E (2002) Effects of growth mode and pyruvate carboxylase on succinic acid production by metabolically engineered strains of \u003cem\u003eEscherichia coli\u003c/em\u003e. Appl Environ Microbiol 68:1715\u0026ndash;1727. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.68.4.1715-1727.2002\u003c/span\u003e\u003cspan address=\"10.1128/AEM.68.4.1715-1727.2002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Zhu J, Bennett GN, San KY (2011) Succinate production from different carbon sources under anaerobic conditions by metabolic engineered \u003cem\u003eEscherichia coli\u003c/em\u003e strains. Metab Eng 13:328\u0026ndash;335. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ymben.2011.03.004\u003c/span\u003e\u003cspan address=\"10.1016/j.ymben.2011.03.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWendisch VF, Bott M, Eikmanns BJ (2006) Metabolic engineering of \u003cem\u003eEscherichia coli\u003c/em\u003e and \u003cem\u003eCorynebacterium glutamicum\u003c/em\u003e for biotechnological production of organic acids and amino acids. Curr Opin Microbiol 9:268\u0026ndash;274. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mib.2006.03.001\u003c/span\u003e\u003cspan address=\"10.1016/j.mib.2006.03.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin D, Ji Y (2002) Genomic analysis using conditional phenotypes generated by antisense RNA. Curr Opin Microbiol 5:330\u0026ndash;333. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/s1369-5274(02)00315-6\u003c/span\u003e\u003cspan address=\"10.1016/s1369-5274(02)00315-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou S, Causey TB, Hasona A, Shanmugam KT, Ingram LO (2003) Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered \u003cem\u003eEscherichia coli\u003c/em\u003e W3110. Appl Environ Microbiol 69:399\u0026ndash;407. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1128/AEM.69.1.399-407.2003\u003c/span\u003e\u003cspan address=\"10.1128/AEM.69.1.399-407.2003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Isocitrate dehydrogenase, conditional down-regulation, antisense RNA, catabolite repressor activator (Cra) protein, E. coli B \u0026 K derived strains","lastPublishedDoi":"10.21203/rs.3.rs-4854438/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4854438/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn \u003cem\u003eE. coli\u003c/em\u003e, catabolite repressor activator (Cra) protein (formerly called FruR) is known to regulate the expression of many genes positively and negatively; this effect is modulated by intracellular levels of fructose-1-phosphate (F-1-P) and fructose-1,6-bisphopahate (F-1,6-bisP). In this paper, we report conditionally expressed antisense RNA corresponding to 101bp of isocitrate dehydrogenase (\u003cem\u003eicd)\u003c/em\u003e gene (as-\u003cem\u003eicd\u003c/em\u003e) under Cra (FruR) responsive promoter \u003cem\u003efruB\u003c/em\u003e (P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e construct denoted as pVS2K3) in \u003cem\u003eE. coli\u003c/em\u003e K-12 (DH5α) and \u003cem\u003eE. coli\u003c/em\u003e B (BL21) strains. Previously studies have shown that ICDH mutants failed to grow on glucose in absence of glutamate and accumulated citrate intracellularly. Hence, a conditional downregulation of \u003cem\u003eicd\u003c/em\u003e gene could overcome this lethality and also help in understanding the flux towards citrate accumulation. Effect of P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e (pVS2k3) construct was monitored in \u003cem\u003eE. coli\u003c/em\u003e K-12 (DH5α) and \u003cem\u003eE. coli\u003c/em\u003e B (BL21) during growth on carbon sources wherein the \u003cem\u003efruB\u003c/em\u003e promoter is active (glucose) or repressed (glycerol). A 3\u0026ndash;4 fold decrease in ICDH activity was observed in \u003cem\u003eE. coli\u003c/em\u003e DH5α expressing pVS2K3 on glucose but P\u003csub\u003e\u003cem\u003efruB\u003c/em\u003e\u003c/sub\u003e as-\u003cem\u003eicd\u003c/em\u003e expression differed in \u003cem\u003eE. coli\u003c/em\u003e BL21 on glucose. This alteration could be attributed to the anomalous Cra regulation seen in \u003cem\u003eE. coli\u003c/em\u003e B strain which could be a crucial factor while choosing \u003cem\u003efru\u003c/em\u003eB promoter for expression studies.\u003c/p\u003e","manuscriptTitle":"FruR-controlled antisense RNA -downregulation of isocitrate dehydrogenase in Escherichia coli","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-02 10:30:04","doi":"10.21203/rs.3.rs-4854438/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1ad2b4e4-d90e-40f7-998a-7cf9c512e3c6","owner":[],"postedDate":"September 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-01-27T06:08:46+00:00","versionOfRecord":[],"versionCreatedAt":"2024-09-02 10:30:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4854438","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4854438","identity":"rs-4854438","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}