Preparation and Serological Evaluation of an Inactivated Trivalent oil emulsion vaccine for Avian Fowl Adenovirus (FAdV) containing -8a, 8b, and 11 serotypes

Preparation and Serological Evaluation of an Inactivated Trivalent oil emulsion vaccine for Avian Fowl Adenovirus (FAdV) containing -8a, 8b, and 11 serotypes | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Preparation and Serological Evaluation of an Inactivated Trivalent oil emulsion vaccine for Avian Fowl Adenovirus (FAdV) containing -8a, 8b, and 11 serotypes Ferial Eliwa Ibrahim, Mohamed Nasr Fathi Shaheen1, Hasnaa Maged, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6907880/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract In recent years, inclusion bodies hepatitis (IBH) caused by fowl adenovirus (FAdV) species D and E led to significant economic losses in the poultry sector, worldwide. Therefore, this study aimed to assess the immunogenicity of an inactivated trivalent FAdV vaccine prepared with different payloads (10 7 TCID 50 , 10 6.8 TCID 50 , 10 6.5 TCID 50 ) in commercial broiler chickens. The effects of booster immunization and thiomersal addition on the titers of developed antibodies were also evaluated. The virus propagated on liver primary cells for virus isolation and virus infectivity. Our results showed that group which vaccinated with a higher payload of the virus presented a prolonged immune response till the 6th week, compared to birds which were vaccinated with lowest dose of the virus of the trivalent vaccine. Also, birds which were vaccinated with the same vaccine containing thiomersal as a preservative, showed no significant reduction in immune response. For booster immunization, only high payload (10 7 TCID 50 of each serotype/bird) increased the antibodies titers, specially at 2 th and 3 rd week post-vaccination. The obtained results suggested that the trivalent inactivated FAdv serotype 8a/8b/D vaccine at 10 7 TCID 50 concentration of each serotype/bird at priming and booster vaccination could be used for the prevention and control of IBH. Applied & Industrial Microbiology IBH FAdV vaccine immunization chicken Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Since the accidental discovery of Fowl adenovirus, there are a lot of efforts that were made to characterize and classify FAdV, that belong to the Aviadeno virus genus in the Adenoviridae family [ 1 ]. Fowl adenoviruses have linear double stranded DNA genome, nonenveloped capsid, icosahedral in symmetry, with size 43–45 Kb. In the middle of the last century FAdV were recognized and have been reported to infect poultry [ 1 ]. FAdVs are divided into five species (FAdV-A to FAdV-E) by their molecular structure and subdivided into 12 serotypes (FAdV-1 to 8a and 8b to 11) based on their serological relationships [ 2 ]. FAdV are significant infectious agents and responsible for severe economic losses [ 3 ], and it can spread vertically [ 4 ] via the allantoic cavity, chick embryo chorioallantoic membrane, and yolk sac as well as horizontally through contact with contaminated utensils, feed, or water [ 5 ]. Vertical transmission is considered the main route method of transmission, and the virus replicates mainly in chickens’ intestinal and respiratory systems [ 6 ]. The disease can be found year-round, with a peak prevalence during the rainy season and summer. Although majority of FAdV cause subclinical illness, some FAdV cause acute viral infections such as hepatitis-hydropericardium syndrome (HHS), inclusion body hepatitis (IBH), and gizzard erosions (GE) [ 6 ]. IBH has been reported globally, commonly influencing meat-producing chickens at 3 to 4-week-old and some layer chickens ranged between 25 and 27 weeks [ 7 ], resulting in mortality rate varies between 2% and 30%. Surveillance studies have documented that IBH is primarily caused by FdAV serotypes 2, 8a, 8b, and 11 [ 6 ], while HHS and gizzard erosion are mainly associated with FdAV serotypes 1 and 4. IBH is characterized by enlarged, friable, and swollen liver with a stellate hemorrhages [ 8 ]; bloated, pale, and mottled kidneys with a hemorrhagic renal cortex; and occasionally, hemorrhagic and an inflated spleen [ 9 ]. Fowl adenovirus (FAdV) infections are a significant concern in Egypt’s poultry industry, with several serotypes identified in different regions. Several studies have showed the circulation of various serotypes in different poultry farms in Egypt, including FAdV species E/serotype 8a [ 10 ], FAdVs species D/serotype 2–11 [ 11 , 12 ], and FAdV serotypes 1, 3 and 8b [ 13 ]. Fowl adenovirus (FAdV) vaccines are available in several forms, including inactivated, live attenuated, recombinant, and oral vaccines, each with specific advantages depending on the target poultry population and regional needs. Inactivated vaccines, which contain killed virus particles, are the most common and are typically administered via injection. These vaccines stimulate an immune response without causing disease and are highly effective in controlling FAdV infections [ 14 , 15 ]. Thus, the objectives of this study are to evaluate the immunogenicity of an inactivated trivalent FAdV vaccine following vaccination of commercial broiler chickens with different viral antigen payloads. Material and methods Molecular Detection of FAdV: Liver organs samples were collected from layers chickens that were suspected to be infected with Fowl adenovirus (FAdV) in Sharqia government in Egypt; the samples were stored in -80°c freezer for further processing. Liver samples were suspended and homogenized with phosphate buffered saline to a 10% suspension containing antibiotics at a concentration of 200U/ml penicillin and 0.2 mg/ml streptomycin. The homogenized suspension has been clarified by centrifuges at 2000 g at 4°C for 10 min. The supernatant was filtered twice, the first was through 0.45μm filter and the second with 0.2μm filter then transferred to fresh sterile falcon for molecular detection of FAdV by PCR followed by virus propagation, identification and titration in cell culture. The total DNA was extracted from the above supernatant using viral gene-spinTM viral DNA /RNA Extraction kit (Trans, China) according to the manufacturer's instructions. Conventional PCR was performed using in-house designed specific primers for the L1 region of the hexon gene of FAdVs. The specific oligonucleotide primers were used for the amplification of the L1 loop of the hexon gene of different adenovirus serotypes. The primers were synthesized by metabion (Munich, Germany). PCR amplification was accomplished using an EmeraldAmp Max PCR Master Mix (Takara, Japan) in a total volume of 25-μL consisting of 12.5 μL of EmeraldAmp Max PCR Master Mix, 1 μL of forward and reverse primers (working concentration 20 pmol), 5.5 μL of PCR-grade water, and 5 μL of extracted DNA. The reactions were run in Biometra T3000 thermal cycler as follows35 cycles of 95°C for 15 sec for denaturation, 60°C for 20 sec for annealing, and 72°C for 60 sec for extension. The predicted size of the PCR products was approximately 950 base pairs (bp). List of primers used in this study is presented in Table 1. Strong PCR Table 1. Sequences of the primers used for identification of FAdV in this study Primer ID Sequence (5’-3’) Reference AdPol F GCAGCGTGGTCTTGAAGATG This study AdPol R1 GCATGTGATTGCGACATCAAGTGC This study F0 hexone GCT GCA GTA TTT TCA CAT CGC This study AdR5 ATGTCGGCGAGCATGTACTG This study Isolation and Propagation of FAdV: Preparation of primary chicken embryo liver cell (CEL) culture: Chicken embryo liver cell culture was prepared from 13-15 days old SPF chicken eggs according to standard protocol. The embryos were removed aseptically then the livers were collected by using sterile forceps and washed several times with sterile PBS (0.1 molar PH7.4), gently trypsinized with 0.25% trypsin solution for 7 min at 37°C. The trypsinized cells were poured in sterile falcon. To get rid of the effect of residual trypsin, add small volume of the growth media, the growth medium is fresh Dulbecco`s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotic (1% penicillin-streptomycin). The cells suspension was centrifuged at 1500 rpm at 4°C for 10 min to obtain cell pellet. Withdraw The supernatant and resuspend the pellet with the growth media, cell concentration was approximately 5 x 10 6 cell/ml of the medium and cell suspension in 10ml volume was seeded in 25 cm 2 tissue culture flasks and incubated at 37°C incubator under 5% CO 2 with humidity 85%-90% until forming confluent monolayer sheet [16]. Propagation and Identification of FAdV After checking the confluency of the flasks under the microscope (80%), the flasks are ready for inoculation, throw the old media gently and inoculate 0.5ml of filtered liver tissue homogenate that was previously stored at -80°c freezer in the tissue culture flasks. Allow The adsorption of the inoculum onto the cells at 37°C for one hour, then, add 10ml of maintenance medium containing 2% FBS. The infected and control flaks were incubated at 37°C under 5% CO 2 incubator, daily inspection of the flasks under the microscope for observation of cytopathic effect (CPE) for 5days. three cycles of freezing and thawing for the inoculated flasks, centrifuged at 2000 rpm for 10min, then the supernatants were transported into sterile falcons for titration. Identification of propagated Fowl Adenoviral Isolates: The virus was identified by PCR as described above then all amplified products were subjected to DNA sequencing to confirm specific amplification of type-specific hexon genes. Titration of FAdV The FAdV infected CEL cells were titrated by the median tissue culture infective dose (TCID 50 ), according to the methods previously reported [17]. Briefly, a 10-fold serial dilution of the virus was prepared in culture medium from 10 -2 to 10 -10 of virus stock. Monolayer of CEL cells prepared in 96-well tissue culture plate (SPL life sciences, Korea) were infected by 100 ul of each dilution in 4 replicates and incubated at 37°C incubator under 5% CO2 with humidity 85%-90% for 5 days. The CPE was daily observed under an inverted microscope and confirmed by PCR. Vaccine Preparation Fowl aviadenovirus D, Fowl aviadenovirus 8a, and Fowl aviadenovirus 8b were propagated on primary chicken embryonic liver cells (CEL) and used for production of trivalent vaccine. For inactivation of FAdV serotypes, harvested virus from infected CEL cells was incubated with 0.2% formalin on stirrer for 48 h at room temperature. The formaldehyde inactivated antigen solutions were emulsified with oil adjuvant at a ratio of 30:70 and sterile saline to make different doses of 10 7 TCID 50 , 10 6.8 TCID 50 , and 10 6.5 TCID 50 of each serotype. The final volume of the vaccine dose was 0.5 mL per bird. Animal experiment and priming immunization Forty SPF chickens 10 weeks old have been divided into 4 groups (G1-G4), each group containing 10 chickens as illustrated in Fig. 1. The divided groups have been immunized with 0.5ml of the trivalent vaccine per chick with different viral loads as shown in fig.1. briefly, the G1 was immunized with 10 7 TCID 50 /dose and birds of G2 were vaccinated with the same concentration of the vaccine to which thiomersal at a concentration of 25 ug/dose has been added. However, the G3 and G4 groups have been immunized with low virus payload per dose, in concentration 10 6.8 TCID 50 /dose and 10 6.5 TCID 50 /dose, respectively, as shown in fig.1. the vaccinated groups were monitored and serum samples were collected separately from each group for 6 successive weeks post-vaccination to follow up the humeral immunity. The booster immunization This experiment has been designed to evaluate the effect of a single booster dose on the humeral immunity of the previously vaccinated groups after 6 weeks of vaccination. based on experiment 1, G1 and G3 were divided into 2 subgroups (A &B), each single group contained 5 chicks at 16 weeks old (6 weeks post-vaccination). As illustrated in fig.1, G1-A did not receive booster doses, while subgroup G1-B was immunized with a booster dose from the trivalent vaccine with a high virus payload (10 7 TCID 50 ). On the other hand, subgroup G3-A received a booster dose with a low virus payload (10 6.8 TCID 50 ), and subgroup G3-B got a high virus payload (10 7 TCID 50 ). All these subgroups have been incubated, and monitored, additionally serum samples have been collected for 3 successive weeks post boosting (until 9 weeks after the first dose) for monitoring the humeral immunity. Monitoring of Humeral immunity during the experiments: Serum samples were collected from SPF chicken vaccinated with one or two doses of vaccine intramuscularly to confirm antibody response of inactivated traivalent FAdV vaccine. Levels of FAdV-specific antibodies have been examined by a commercial enzyme-linked immunosorbent assay (ELISA) kit (Biostone, USA) according to manufacturer’s instruction. Statistical analysis: The means of antibody titers were statistically analyzed for significant differences at p-value >0.05, at different time points in each vaccinated group by Two-way ANOVA (with mixed model). The data were analyzed and visualized using GraphPad Prism version 9. Results Isolation and titration of FAdV in CELs FAdV Virus was successfully isolated from liver organs obtained from chickens that were suspected of being infected with FAdV (Figure 2) and confirmed by PCR, producing a single amplicon of 950 bp (Figure 3). Sequence analysis of the PCR-amplified products was in consistency with fowl aviadenovirus D (accession no. OR753244.1), Fowl aviadenovirus 8a (accession no. OR753245.1), and Fowl aviadenovirus 8b (accession no. OQ988005.1) that were used in our experiments. The propagated AdV-8a/8b/-D exhibited 40%, 60%, and 85% Cytopathic Effect (CPE) 24, 48 and 72 hr post-infection in CELs, respectively (Figure 4). Compared to cell control, the observed CPE included rounding, clumping, and cell detachment from the cell monolayer. The TCID 50 was found to be 10 9 /ml for AdV-8a, 10 9 /ml for AdV-8b, 10 8 /ml for AdV-D, using the Reed-Muench method. Antibody response after priming with FadV vaccine: The mean titers of the 4 vaccinated groups showed that the G1 that was vaccinated with a high payload of the virus presented a prolonged immune response till the 6th week of vaccination as shown in Figure 4, with significant variation at 6 th week in comparison to the G4 which vaccinated with the lowest diluted dose of the trivalent vaccine, as shown in figure 5. Also, it was noticed that the G2 group, which was vaccinated with the same vaccine in addition to thiomersal as a preservative, showed no significant reduction in immune response in comparison with the G1 group that was vaccinated with the same doses without thiomersal. Antibody response after boost vaccination According to experiment 1, we found a significant variation between G1 and G3 by the end of the incubation period at 6 th week post vaccination. So, we choose those groups as a base for the experiment 2 which studied the effect of the booster dose with high and low virus pay load vaccine. As, shown in figure 6, G1-A group (non-boostered) and G3-A group (boostered with low virus payload) showed no increase in the antibody levels. In contrast, there were increase in the antibody titers in sera of G1-B and G3-B groups that were boostered with high virus payload (10 7 TCID 50 ). Discussion The inclusion body hepatitis (IBH) incidence has increased in recent years, worldwide [18]. IBH is an emerging disease caused by FAdV that causes significant economic losses in the global poultry sector. Most outbreaks are linked to FAd-2, FAd-11, FAd-8a, and FAd-8b [18]. In Egypt, it was reported the co-circulation of several serotypes including FAd-1, FAd-2, FAd-5, FAd-8a, FAd-8b, and FAd-11 [13]. In this study, we developed an inactivated FAdV trivalent oil-emulsion vaccine encompassing FAdV-2/11, FAdV-8a, and FAdV-8b serotypes and the immune responses were evaluated in SPF chickens to select a promising vaccine candidate to decrease and control the prevalence of disease syndromes related to FAdV in Egypt. Because the protective efficacy of the inactivated vaccine is based on induction of antigen-specific humoral immune responses, the level of antibody in vaccinated chickens might be a helpful criterion for efficacy evaluation of inactivated vaccine [17]. After successful inactivation of virus with formaldehyde in 0.2% final concentration [15], three different formulas with three different payloads to optimize vaccine dose were prepared. The three doses achieved considerable ELISA titers; however remarkable difference was noticed for the least payload (5 x 10 6.5 TCID 50 ). The high titers continued till 6 weeks post vaccination without a sharp decline in the antibody’s titer. This finding support the results of some previous reports [17, 19-21] which showed the increasing antibody level at 1 st week and decreasing at 4 th weeks post vaccination. Steer-Cope et al. [22] demonstrated that the inactivated FAdV-8a serotype vaccine produced serum antibodies from vaccinated chickens that neutralized FAdV-8a with ELIZA titers ranging from 600-20,000 post immunization. The results obtained for inactivated FAdV trivalent vaccine under study are in consistence with those previous studies, suggesting that this vaccine could be helpful in controlling the FAdV infection [15]. Additionally, we explored the effect of booster dose following 6 weeks of the priming dose. The antibodies titer increased considerably following the boosting dose, even for the group that has lower antibodies titer. This underpins the importance of serological monitoring following the first dose vaccine administration. In case of modest results following the prime dose, a different vaccine can be used for the booster where it can restore the high titers required for an efficient protection for the flocks. The control group that didn’t receive a booster dose showed the need for receiving booster dose as antibodies titers can decline considerably. It is recommended to test the ability of vaccines to reduce or prevent the virus shedding in the environment and determining the duration of the protective efficacy prevented the organism shedding to the environment [23]. Cádiz et al. [24] showed that the booster immunization significantly reduced shedding of virus, compared with non-booster inoculation. Another study needed to test the protective efficacy of the FAdV prepared vaccine against challenge with different FAdV serotypes. Thimerosal is considered as an important preservative agent to vaccine manufacturers [25], as it is one the most used preservative for chicken and veterinary vaccines. In 2008 the World Health Organization approved the addition of thimerosal in vaccines [26]. However, the effect of thiomersal on the immunogenicity is not understood. So, an additional group was added that explore the effect of the thiomersal on inactivated vaccine efficacy. Results showed low effect on the antibodies titers. Stone, [27] showed that thimerosal at the recommended levels in commercial poultry vaccines does not significantly reduce vaccine efficacy. An important note to consider, the ELISA results is influenced by the type of antigen coated within the kit. In this study, one ELISA kit didn’t show any readings with our vaccine but gave good results with the monovalent inactivated FAdV vaccine control that contained FAdV-4 (serotype-C) as this kit coated with homologous antigen for FAdV-4 (data not shown). On the other hand, another ELISA kit showed positive results for both vaccines (vaccine under study and control vaccine). Therefore, the selection of the ELISA kit is important for vaccine manufacturers due to the limited serological relatedness between the different FAdV serotypes. Besides the above immunological findings, The FAdV cell-culture based vaccine tested in this study showed some well-known advantages over embryo-adapted vaccines. Virus propagation on chicken embryo is limited for many reasons such as its dependance on a continuous supply chain of embryonated eggs, time-consuming, and labor-intensive, which make it is not suitable for the practical manufacturing [28]. Moreover, cell-based production technology is more flexible that allows manufacturers to react quickly to pandemic, and produce greater quantities of the vaccines with lower variations among vaccine batches in less time [29]. Additionally, cell-culture based production approach does not introduce greater or new adventitious agents when compared to egg-based vaccine production system [30]. Thereby, cell-culture derived inactivated FAdV vaccine has more useful benefits than the embryo-adapted vaccine. This study gives preliminary recommendations regarding the optimal vaccine payload, the feasibility of using thiomersal preservative during formulation, and the importance of diagnostic kit selection. Still, additional work needs to be carried out to correlate the relation between antibodies ELISA titer and protection against challenge. Overall, FAdV is a continuing threat to the poultry industry and effective control measures are needed to be implemented. Effective vaccination strategies should be considered as one of the main pillars for controlling the FAdV threat. In conclusion, the inactivated FAdV trivalent FAdV-2/11, FAdV-8a, and FAdV-8b could be utilized as a vaccine to stimulate specific immunity against the FAdV-2/11, FAdV-8a, and FAdV-8b infection. Hence, humoral immunity induced by the inactivated FAdV trivalent vaccine containing the three serotypes could be a tool for IBH control in both breeders and their progenies. Declarations Disclosure statement No potential conflict of interest was reported by the authors. Funding The author(s) reported there is no funding associated with the work featured in this article. Corresponding author Correspondence to Mohamed N. F. Shaheen Ethics declarations Ethical approval The study was approved by The Institutional Animal Care and Use Committee (ARC-IACUC), Agriculture Research Centre, Egypt on the date of 01.11.2024 (Ref No: ARC AHRI 183 24). Informed consent was obtained in accordance with the Ethics Committee and approval procedures. Competing interests The authors declare no competing interests. Consent for publication All authors have consented to publish this manuscript. References Harrach, B.; Tarján, ZL.; Benkő, M. Adenoviruses across the animal kingdom: a walk in the zoo. FEBS Lett. 2019, 593, 3660–3673. Mittal, D.; Jindal, N.; Tiwari, AK.; Khokhar, RS. Characterization of fowl adenoviruses associated with hydropericardium syndrome and inclusion body hepatitis in broiler chickens. Virusdisease. 2014, 25(1), 114–119. Sohaimi, NM.; Hair-Bejo, M. A recent perspective on fiber and hexon genes proteins analyses of fowl adenovirus toward virus infectivity: a review. Open Vet J. 2021, 11, 569–580. Santander-Parra, SH.; Caza, M.; Nunez, L. Detection, quantification and molecular characterization of fowl adenoviruses circulating in Ecuadorian chicken flocks during 2019–2021. Vet Sci. 2023,10. Franzo, G.; Prentza, Z.; Paparounis, T.; Tsiouris, V.; Centonze, G.; Legnardi, M.; Catelli, E.; Tucciarone, CM.; Koutoulis, K.; Cecchinato, M. Molecular epidemiology of fowl adenoviruses in Greece. Poult Sci.2020, 99, 5983–2990. Schachner, A.; Matos, M.; Grafl, B.; Hess, M. Fowl adenovirus-induced diseases and strategies for their control – a review on the current global situation. Avian Pathol. 2018 47(2), 111–126. Abghour, S.; Zro, K.; Mouahid, M.; Tahiri, F.; Tarta, M.; Berrada, J.; Kichou, F. Isolation and characterization of fowl aviadenovirus serotype 11 from chickens with inclusion body hepatitis in Morocco. PLoS One.2019, 14(12), e0227004. Mohamed, MHA.; El-Sabagh, IM.; Abdelaziz, AM.; Al-Ali, AM.; Alramadan, M.; Lebdah, MA.; Ibrahim, AM.; Al-Ankari, AS. Molecular characterization of fowl aviadenoviruses species D and E associated with inclusion body hepatitis in chickens and falcons indicates possible cross-species transmission. Avian Pathol. 2018, 47, 384–390. Li, L.; Wang, J.; Chen, P.; Zhang, S.; Sun, J.; Yuan, W. Pathogenicity and molecular characterization of a fowl adenovirus 4 isolated from chicken associated with IBH and HPS in China. BMC Vet Res. 2018, 14, 400. Radwan, MM.; El-Deeb, AH.; Mousa, MR.; El-Sanousi, AA.; Shalaby, MA. First report of fowl adenovirus 8a from commercial broiler chickens in Egypt: Molecular characterization and pathogenicity. Poult Sci. 2019, 98(1), 97–104. Hussein, E.; Anwar, NF.; Elsebaey, HS.; Abdelmagid, MA.; Elkhair, MA.; Mahana, O. Isolation and characterization of fowl adenoviruses associated with hydro-pericardium syndrome from broiler chickens in Egypt. J World Poult Res. 2023, 13(1), 149–160. Elbestawy, AR.; Ibrahim, MH.; Ammam, H.; Noreldin, AE.; El Bahrawy, A.; Ellakany, HF. Molecular characterization of fowl adenovirus D species in broiler chickens with inclusion body hepatitis in Egypt. Alex J Vet Sci. 2020, 64(1), 110–117. Adel, A.; Mohamed, AAE.; Samir, M.; Hagag, NM.; Erfan, A.; Said, M.; Arafa, AES.; Hassan, WMM.; El Zowalaty, ME.; Shahien, MA. Epidemiological and molecular analysis of circulating fowl adenoviruses and emerging of serotypes 1, 3, and 8b in Egypt. Heliyon. 2021, 7(12), e08366. Sohaimi, NM.; Azreen, AQ.; Bejo, MH.; Abd Rahaman, NY. Safety and immunogenicity of inactivated fowl adenovirus serotype 8b isolate following different inactivation time intervals in broiler chickens. Arch Razi Inst. 2024, 79(5). Song, C.; Zhao, S.; Song, M.; Qiao, Q.; Yang, P., Wang, B.; Cong, Y.; Wang, Y.; Liu, H.; Wang, Z.; Wang, X.; Zhao, J. An (2023) An inactivated novel trivalent vaccine provides complete protection against FAdV‐4 causing hepatitis‐hydropericardium syndrome and FAdV‐8b/‐11 causing inclusion body hepatitis. Transbound Emerg Dis. 2023, (1), 5122382. Soumyalekshmi, S.; Ajith, M.K.; Chandraprakash, M. Isolation of fowl adenovirus in chicken embryo liver cell culture and its detection by hexon gene based PCR. Indian Journal of Scientific Research and Technology. 2014, 2(3), 33-36. ‏ Reed, LJ.; Muench, H. A simple method of estimating fifty percent endpoints. Am J Hyg. . 1938, 27(3), 493–7. El-Shall, NA.; El-Hamid, HAS.; Elkady, MF.; Ellakany, HF.; Elbestawy, AR.; Gado, AR.; Geneedy, AM.; Hasan, ME.; Jaremko, M.; Selim, S.; El-Tarabily, KA.; El-Hack, MEA. Epidemiology, pathology, prevention, and control strategies of inclusion body hepatitis and hepatitis-hydropericardium syndrome in poultry: A comprehensive review. Front Vet Sci. 2022, 9, 963199. Junnu, S.; Lertwatcharasarakul, P.; Jala, S.; Phattanakulanan, S.; Monkong, A.; Kulprasertsri, S.; et al. An inactivated vaccine for prevention and control of inclusion body hepatitis in broiler breeders. Thai J Vet Med. 2015, 45(1), 55–62. Sahidullah, S.; Sadeeq-ur-rahman, Rabbani, M.; Shah, MK.; Naseem, S.; Khan, SH. Development of standard protocols for preparation and evaluation of live homogenate vaccines against hydropericardium syndrome virus in poultry. Pak Vet J. 2008, 28(4), 163–6. Akhtar, M.; Ahmad, R.; Hayat, CS.; Hussain, I.; Ashfaque, M. Comparative immune response of formalin inactivated and binary ethyleneimine inactivated Angara disease vaccines. Pak J Biol Sci. 2000, 3(8), 1313–4. Steer-Cope, PA.; Sandy, JR.; O’Rourke, D.; Scott, PC.; Browning, GF.; Noormohammadi, AH. Vaccination with FAdV-8a induces protection against inclusion body hepatitis caused by homologous and heterologous strains. Avian Pathol. 2019, 48, 396–405. Kaiser, TJ.; Smiley, RA.; Fergen, B.; Eichmeyer, M.; Genzow, M. Influenza A virus shedding reduction observed at 12 weeks post-vaccination when newborn pigs are administered live-attenuated influenza virus vaccine. Influenza Other Respir Viruses. 2019, 13(3), 274–278. Cádiz, L.; Guzmán, M.; Navarrete, F.; Torres, P.; Hidalgo, H. First molecular detection and characterization of fowl aviadenovirus serotype 11 from broiler chickens in Chile. Microbial Res. 2024, 15(2), 626–633. Orenstein, WA.; Paulson, JA.; Brady, MT.; Cooper, LZ.; Seib, K. Global vaccination recommendations and thimerosal. Pediatrics. 2013, 131(1), 149–151. World Health Organization (2008) Meeting of Global Advisory Committee on Vaccine Safety, Wkly Epidemiol Rec. June 18–19, 2008, 83(32), 287–292. Stone, HD. Effect of thimerosal concentration on the efficacy of inactivated Newcastle disease oil-emulsion vaccines. Avian Dis. 1985, 29, 1030–1035. Partridge, J.; Kieny, MP. Global production capacity of seasonal influenza vaccine in 2011. Vaccine. 2013, 31(5), 728–31. Dormitzer, PR.; Tsai, TF.; Del Giudice, G. New technologies for influenza vaccines. Hum Vaccin Immunother. 2012, 8(1), 45–58. Du, D.; Zhang, P.; Li, X.; Tian, H.; Cheng, Y.; Sheng, D.; Han, X.; Shan, Y.; Li, X.; Yuan, Y.; Zhang, H.; Xue, J.; Liu, W.; Tian, K. Cell-culture derived fowl adenovirus serotype 4 inactivated vaccine provides complete protection for virus infection on SPF chickens. Virusdisease. 2017, 28(2), 182–188. Additional Declarations The authors declare no competing interests. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6907880","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":472165684,"identity":"2f9bc60b-81e7-4b96-8196-48bba7f2a96a","order_by":0,"name":"Ferial Eliwa Ibrahim","email":"","orcid":"","institution":"Vaccine Valley, Egyptian Company for Biological \u0026 Pharmaceutical Industries. 101 extension of the sixth industrial Zone-6th of October City, Giza, Egypt.","correspondingAuthor":false,"prefix":"","firstName":"Ferial","middleName":"Eliwa","lastName":"Ibrahim","suffix":""},{"id":472165685,"identity":"81009950-b227-4fe4-b767-1db3cd95d143","order_by":1,"name":"Mohamed Nasr Fathi Shaheen1","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAx0lEQVRIiWNgGAWjYNCCCgke++MNDMwkaDljI8dw5gApWhjb0owZbiQQqUW3gffYhx9shxMbZ74x/FxQYcPA396dgFeL2QG+5Jk9PIcTm6VzjKVnnEljkDhzdgMBLTzGzAwShxPbpHMMpHnbDjMYSOQSo8XgcGKP5Bnj3yRoSUgzlpDgMSPeFsaeAzZyBjxpZdY8Z9J4iPILw89/EjwG7Ic33+apsJHjb+/Fr4VB/gGMxWEAInnwK0cF7A8IKBgFo2AUjIKRCgAooUFJN6tywwAAAABJRU5ErkJggg==","orcid":"","institution":"National Research Centre","correspondingAuthor":true,"prefix":"","firstName":"Mohamed","middleName":"Nasr Fathi","lastName":"Shaheen1","suffix":""},{"id":472165686,"identity":"5b75e18d-b458-46a7-9ed2-d799048926e0","order_by":2,"name":"Hasnaa Maged","email":"","orcid":"","institution":"Vaccine Valley, Egyptian Company for Biological \u0026 Pharmaceutical Industries. 101 extension of the sixth industrial Zone-6th of October City, Giza, Egypt.","correspondingAuthor":false,"prefix":"","firstName":"Hasnaa","middleName":"","lastName":"Maged","suffix":""},{"id":472165687,"identity":"253b2c5d-9d8e-4b09-96fb-e5d27350596a","order_by":3,"name":"Mahmoud Ibrahim","email":"","orcid":"","institution":"Birds and Rabbit Medicine Department, Faculty of Veterinary Medicine, Sadat City university, 32958, Menoufia, Egypt.","correspondingAuthor":false,"prefix":"","firstName":"Mahmoud","middleName":"","lastName":"Ibrahim","suffix":""},{"id":472165688,"identity":"f7080c48-bfdc-4ae2-b5fb-7cb0d5ac6eb1","order_by":4,"name":"Yakout Abdelfatah EL-Senosi","email":"","orcid":"","institution":"Department of Biochemistry and Molecular Biology, Faculty of Veterinary Medicine, Benha University, Egypt","correspondingAuthor":false,"prefix":"","firstName":"Yakout","middleName":"Abdelfatah","lastName":"EL-Senosi","suffix":""},{"id":472165689,"identity":"02e567df-25cd-4dca-a1eb-a68e850a9055","order_by":5,"name":"Samy Ali Hussein Aziza","email":"","orcid":"","institution":"Department of Biochemistry and Molecular Biology, Faculty of Veterinary Medicine, Benha University, Egypt.","correspondingAuthor":false,"prefix":"","firstName":"Samy","middleName":"Ali Hussein","lastName":"Aziza","suffix":""},{"id":472165690,"identity":"9fea7e7f-99ee-44d0-a99b-47cf892b1bb5","order_by":6,"name":"Afaf Desoky Abdel Magid","email":"","orcid":"","institution":"Department of Biochemistry and Molecular Biology, Faculty of Veterinary Medicine, Benha University, Egypt.","correspondingAuthor":false,"prefix":"","firstName":"Afaf","middleName":"Desoky Abdel","lastName":"Magid","suffix":""},{"id":472165691,"identity":"f1350629-df91-416a-9bc1-d20dff91b0a3","order_by":7,"name":"Ahmed El-Sanousi","email":"","orcid":"","institution":"Faculty of Veterinary Medicine, Cairo University, Cairo, Egypt.","correspondingAuthor":false,"prefix":"","firstName":"Ahmed","middleName":"","lastName":"El-Sanousi","suffix":""}],"badges":[],"createdAt":"2025-06-16 18:07:33","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":true,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":true},"doi":"10.21203/rs.3.rs-6907880/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6907880/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":84884859,"identity":"263f4dd7-5028-4910-9007-d447de201f25","added_by":"auto","created_at":"2025-06-18 11:33:14","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":110431,"visible":true,"origin":"","legend":"\u003cp\u003eThe diagram of the Experimental design of the investigated work in this study\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6907880/v1/f2f238b09d0a640caf07987c.png"},{"id":84884855,"identity":"15078312-e02a-464a-9856-e82eb8d4a9cc","added_by":"auto","created_at":"2025-06-18 11:33:14","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":250877,"visible":true,"origin":"","legend":"\u003cp\u003eMorphology of liver organs of chicken suspected to be infected with FAdV (A-D) that were used for the virus isolation.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6907880/v1/228fac01b7be1d941d413952.png"},{"id":84886049,"identity":"136c9e7c-fd3e-4a36-8f51-1e3aac9a7102","added_by":"auto","created_at":"2025-06-18 11:41:14","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":104532,"visible":true,"origin":"","legend":"\u003cp\u003ePCR Gel electrophoresis photo\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6907880/v1/1d5ad98ba983b9ae3d09fd8b.png"},{"id":84887848,"identity":"42d6a867-4123-42e4-ac3f-3a9fe9758c5d","added_by":"auto","created_at":"2025-06-18 12:05:14","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":533361,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological investigation under inverted microscope of CELS infected by FAdV-8a (A1, after 24 h post infection; A2, after 48 h post infection; A3, after 72 h post infection; A4, cell control), FAdV-8b (B1, after 24 h post infection; B2, after 48 h post infection; B3, after 72 h post infection; B4, cell control), and FAdV-D (C1, after 24 h post infection; C2, after 48 h post infection; C3, after 72 h post infection; C4, cell control).\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6907880/v1/319fcd10992b3ef858f23248.png"},{"id":84887507,"identity":"5955287c-d5b3-484f-b7ca-2fdd6bcbcd88","added_by":"auto","created_at":"2025-06-18 11:57:14","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":62341,"visible":true,"origin":"","legend":"\u003cp\u003ethe mean ELISA titers of antibodies against the trivalent FAdV vaccines in the 4 vaccinated groups through 6 weeks post-vaccination. * Significant, ** strong significant variation between groups.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6907880/v1/2bde209d03a92f4191f353bd.png"},{"id":84884868,"identity":"0286d7fb-b57e-4632-acd8-839bd8c4e785","added_by":"auto","created_at":"2025-06-18 11:33:15","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":62333,"visible":true,"origin":"","legend":"\u003cp\u003ethe mean ELISA titers of antibodies against the trivalent FAdV vaccine booster dose in G1 and G3. * Significant variation between groups\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6907880/v1/e9e06f84f1fee8f917268365.png"},{"id":84887880,"identity":"74c109cc-fe4f-4a38-9b33-be6f52bddebc","added_by":"auto","created_at":"2025-06-18 12:05:20","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2013872,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6907880/v1/b0938619-1603-4e66-b71e-d897551389a7.pdf"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003ePreparation and Serological Evaluation of an Inactivated Trivalent oil emulsion vaccine for Avian Fowl Adenovirus (FAdV) containing -8a, 8b, and 11 serotypes\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSince the accidental discovery of Fowl adenovirus, there are a lot of efforts that were made to characterize and classify FAdV, that belong to the Aviadeno virus genus in the Adenoviridae family [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Fowl adenoviruses have linear double stranded DNA genome, nonenveloped capsid, icosahedral in symmetry, with size 43\u0026ndash;45 Kb. In the middle of the last century FAdV were recognized and have been reported to infect poultry [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. FAdVs are divided into five species (FAdV-A to FAdV-E) by their molecular structure and subdivided into 12 serotypes (FAdV-1 to 8a and 8b to 11) based on their serological relationships [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFAdV are significant infectious agents and responsible for severe economic losses [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], and it can spread vertically [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] via the allantoic cavity, chick embryo chorioallantoic membrane, and yolk sac as well as horizontally through contact with contaminated utensils, feed, or water [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Vertical transmission is considered the main route method of transmission, and the virus replicates mainly in chickens\u0026rsquo; intestinal and respiratory systems [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The disease can be found year-round, with a peak prevalence during the rainy season and summer. Although majority of FAdV cause subclinical illness, some FAdV cause acute viral infections such as hepatitis-hydropericardium syndrome (HHS), inclusion body hepatitis (IBH), and gizzard erosions (GE) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. IBH has been reported globally, commonly influencing meat-producing chickens at 3 to 4-week-old and some layer chickens ranged between 25 and 27 weeks [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], resulting in mortality rate varies between 2% and 30%. Surveillance studies have documented that IBH is primarily caused by FdAV serotypes 2, 8a, 8b, and 11 [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], while HHS and gizzard erosion are mainly associated with FdAV serotypes 1 and 4. IBH is characterized by enlarged, friable, and swollen liver with a stellate hemorrhages [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]; bloated, pale, and mottled kidneys with a hemorrhagic renal cortex; and occasionally, hemorrhagic and an inflated spleen [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFowl adenovirus (FAdV) infections are a significant concern in Egypt\u0026rsquo;s poultry industry, with several serotypes identified in different regions. Several studies have showed the circulation of various serotypes in different poultry farms in Egypt, including FAdV species E/serotype 8a [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], FAdVs species D/serotype 2\u0026ndash;11 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], and FAdV serotypes 1, 3 and 8b [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFowl adenovirus (FAdV) vaccines are available in several forms, including inactivated, live attenuated, recombinant, and oral vaccines, each with specific advantages depending on the target poultry population and regional needs. Inactivated vaccines, which contain killed virus particles, are the most common and are typically administered via injection. These vaccines stimulate an immune response without causing disease and are highly effective in controlling FAdV infections [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Thus, the objectives of this study are to evaluate the immunogenicity of an inactivated trivalent FAdV vaccine following vaccination of commercial broiler chickens with different viral antigen payloads.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003e\u003cstrong\u003eMolecular Detection of FAdV:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLiver organs samples were collected from layers chickens that were suspected to be infected with Fowl adenovirus (FAdV) in Sharqia government in Egypt; the samples were stored in -80\u0026deg;c freezer for further processing. Liver samples were suspended and homogenized with phosphate buffered saline to a 10% suspension containing antibiotics at a concentration of 200U/ml penicillin and 0.2 mg/ml streptomycin. The homogenized suspension has been clarified by centrifuges at 2000 g at 4\u0026deg;C for 10 min. The supernatant was filtered twice, the first was through 0.45\u0026mu;m filter and the second with 0.2\u0026mu;m filter then transferred to fresh sterile falcon for molecular detection of FAdV by PCR followed by virus propagation, identification and titration in cell culture.\u003c/p\u003e\n\u003cp\u003eThe total DNA was extracted from the above supernatant using viral gene-spinTM viral DNA /RNA Extraction kit (Trans, China) according to the manufacturer\u0026apos;s instructions. Conventional PCR was performed using in-house designed specific primers for the L1 region of the hexon gene of FAdVs. The specific oligonucleotide primers were used for the amplification of the L1 loop of the hexon gene of different adenovirus serotypes. The primers were synthesized by metabion (Munich, Germany). PCR amplification was accomplished using an EmeraldAmp Max PCR Master Mix (Takara, Japan) in a total volume of 25-\u0026mu;L consisting of 12.5 \u0026mu;L of EmeraldAmp Max PCR Master Mix, 1 \u0026mu;L of forward and reverse primers (working concentration 20 pmol), 5.5 \u0026mu;L of PCR-grade water, and 5 \u0026mu;L of extracted DNA. The reactions were run in Biometra T3000 thermal cycler as follows35 cycles of 95\u0026deg;C for 15 sec for denaturation, 60\u0026deg;C for 20 sec for annealing, and 72\u0026deg;C for 60 sec for extension. The predicted size of the PCR products was approximately 950 base pairs (bp). List of primers used in this study is presented in Table 1. Strong PCR\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTable 1. Sequences of the primers used for identification of FAdV in this study\u003c/p\u003e\n\u003cdiv align=\"Left\"\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"618\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003ePrimer ID\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 338px;\"\u003e\n \u003cp\u003eSequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003eAdPol F\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 338px;\"\u003e\n \u003cp\u003eGCAGCGTGGTCTTGAAGATG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003eAdPol R1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 338px;\"\u003e\n \u003cp\u003eGCATGTGATTGCGACATCAAGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003eF0 hexone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 338px;\"\u003e\n \u003cp\u003eGCT GCA GTA TTT TCA CAT CGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 180px;\"\u003e\n \u003cp\u003eAdR5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 338px;\"\u003e\n \u003cp\u003eATGTCGGCGAGCATGTACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 100px;\"\u003e\n \u003cp\u003eThis study\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation and Propagation of FAdV:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePreparation of primary chicken embryo liver cell (CEL) culture:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChicken embryo liver cell culture was prepared from 13-15 days old SPF chicken eggs according to standard protocol. The embryos were removed aseptically then the livers were collected by using sterile forceps and washed several times with sterile PBS (0.1 molar PH7.4), gently trypsinized with 0.25% trypsin solution for 7 min at 37\u0026deg;C. The trypsinized cells were poured in sterile falcon. To get rid of the effect of residual trypsin, add small volume of the growth media, the growth medium is fresh Dulbecco`s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotic (1% penicillin-streptomycin). The cells suspension was centrifuged at 1500 rpm at 4\u0026deg;C for 10 min to obtain cell pellet. Withdraw The supernatant and resuspend the pellet with the growth media, cell concentration was approximately \u0026nbsp; 5 x 10\u003csup\u003e6\u003c/sup\u003e cell/ml of the medium and cell suspension in 10ml volume was seeded in 25 cm\u003csup\u003e2\u003c/sup\u003e tissue culture flasks and incubated at 37\u0026deg;C incubator under 5% CO\u003csub\u003e2\u003c/sub\u003e with humidity 85%-90% until forming confluent monolayer sheet [16].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePropagation and Identification of FAdV\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter checking the confluency of the flasks under the microscope (80%), the flasks are ready for inoculation, throw the old media gently and inoculate 0.5ml of filtered liver tissue homogenate that was previously stored at -80\u0026deg;c freezer in the tissue culture flasks. Allow The adsorption of the inoculum onto the cells at 37\u0026deg;C for one hour, then, add 10ml of maintenance medium containing 2% FBS. The infected and control flaks were incubated at 37\u0026deg;C under 5% CO\u003csub\u003e2\u003c/sub\u003e incubator, daily inspection of the flasks under the microscope for observation of cytopathic effect (CPE) for 5days. three cycles of freezing and thawing for the inoculated flasks, centrifuged at 2000 rpm for 10min, then the supernatants were transported into sterile falcons for titration.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIdentification of propagated Fowl Adenoviral Isolates:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe virus was identified by PCR as described above then all amplified products were subjected to DNA sequencing to confirm specific amplification of type-specific hexon genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTitration of FAdV\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe FAdV infected CEL cells were titrated by the median tissue culture infective dose (TCID\u003csub\u003e50\u003c/sub\u003e), according to the methods previously reported [17]. Briefly, a 10-fold serial dilution of the virus was prepared in culture medium from 10\u003csup\u003e-2\u003c/sup\u003e to 10\u003csup\u003e-10\u003c/sup\u003e of virus stock. Monolayer of CEL cells prepared in 96-well tissue culture plate (SPL life sciences, Korea) were infected by 100 ul of each dilution in 4 replicates and incubated at 37\u0026deg;C incubator under 5% CO2 with humidity 85%-90% for 5 days. The CPE was daily observed under an inverted microscope and confirmed by PCR.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eVaccine Preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFowl aviadenovirus D, Fowl aviadenovirus 8a, and\u0026nbsp;Fowl aviadenovirus 8b were propagated on primary chicken embryonic liver cells (CEL) and used for production of trivalent vaccine. For inactivation of FAdV serotypes, harvested virus from infected CEL cells was incubated with 0.2% formalin on stirrer for 48 h at room temperature. The formaldehyde inactivated antigen solutions were emulsified with oil adjuvant at a ratio of 30:70 and sterile saline to make different doses of 10\u003csup\u003e7\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e, 10\u003csup\u003e6.8\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e, and 10\u003csup\u003e6.5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e of each serotype. The final volume of the vaccine dose was 0.5 mL per bird.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal experiment and priming immunization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eForty SPF chickens 10 weeks old have been divided into 4 groups (G1-G4), each group containing 10 chickens as illustrated in Fig. 1. The divided groups have been immunized with 0.5ml of the trivalent vaccine per chick with different viral loads as shown in fig.1. \u0026nbsp;briefly, the G1 was immunized with 10\u003csup\u003e7\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e/dose and birds of G2 were vaccinated with the same concentration of the vaccine to which thiomersal at a concentration of 25 ug/dose has been added. However, the G3 and G4 groups have been immunized with low virus payload per dose, in concentration 10\u003csup\u003e6.8\u0026nbsp;\u003c/sup\u003eTCID\u003csub\u003e50\u003c/sub\u003e/dose and 10\u003csup\u003e6.5\u0026nbsp;\u003c/sup\u003eTCID\u003csub\u003e50\u003c/sub\u003e/dose, respectively, as shown in fig.1. the vaccinated groups were monitored and serum samples were collected separately from each group for 6 successive weeks post-vaccination to follow up the humeral immunity. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe booster immunization\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis experiment has been designed to evaluate the effect of a\u0026nbsp;single booster dose on the humeral immunity of the previously vaccinated groups after 6 weeks of vaccination. based on experiment 1, G1 and G3 were divided into 2 subgroups (A \u0026amp;B), each single group contained 5 chicks at 16 weeks old (6 weeks post-vaccination). As illustrated in fig.1, G1-A did not receive booster doses, while subgroup G1-B was immunized with a\u0026nbsp;booster dose from the trivalent vaccine with a\u0026nbsp;high virus payload (10\u003csup\u003e7\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e). On the other hand, subgroup G3-A received a booster dose with a low virus payload (10\u003csup\u003e6.8\u0026nbsp;\u003c/sup\u003eTCID\u003csub\u003e50\u003c/sub\u003e), and subgroup G3-B got a high virus payload (10\u003csup\u003e7\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e). All these subgroups have been incubated, and monitored, additionally serum samples have been collected for 3 successive weeks post boosting (until 9 weeks after the first dose) for monitoring the humeral immunity.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMonitoring of Humeral immunity during the experiments:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSerum samples were collected from SPF chicken vaccinated with one or two doses of vaccine intramuscularly to confirm antibody response of inactivated traivalent FAdV vaccine. Levels of FAdV-specific antibodies have been examined by a commercial enzyme-linked immunosorbent assay (ELISA) kit (Biostone, USA) according to manufacturer\u0026rsquo;s instruction.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe means of antibody titers were statistically analyzed for significant differences at p-value \u0026gt;0.05, at different time points in each vaccinated group by Two-way ANOVA (with mixed model). The data were analyzed and visualized using GraphPad Prism version 9.\u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eIsolation and titration of FAdV in CELs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFAdV Virus was successfully isolated from liver organs obtained from chickens that were suspected of being infected with FAdV (Figure 2) and confirmed by PCR, producing a single amplicon of 950 bp (Figure 3). Sequence analysis of the PCR-amplified products was in consistency with fowl aviadenovirus D (accession no. OR753244.1), Fowl aviadenovirus 8a (accession no. OR753245.1), and Fowl aviadenovirus 8b (accession no. OQ988005.1) that were used in our experiments. The propagated AdV-8a/8b/-D exhibited 40%, 60%, and 85% Cytopathic Effect (CPE) 24, 48 and 72 hr post-infection in CELs, respectively (Figure 4). Compared to cell control, the observed CPE included rounding, clumping, and cell detachment from the cell monolayer. The TCID\u003csub\u003e50\u003c/sub\u003e was found to be 10\u003csup\u003e9\u003c/sup\u003e/ml for AdV-8a, 10\u003csup\u003e9\u003c/sup\u003e/ml for AdV-8b, 10\u003csup\u003e8\u003c/sup\u003e/ml for AdV-D, using the Reed-Muench method.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntibody response after priming with FadV vaccine:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mean titers of the 4 vaccinated groups showed that the G1 that was vaccinated with a high payload of the virus presented a prolonged immune response till the 6th week of vaccination as shown in Figure 4, with significant variation at 6\u003csup\u003eth\u003c/sup\u003e week in comparison to the G4 which vaccinated with the lowest diluted dose of the trivalent vaccine, as shown in figure 5. Also, it was noticed that the G2 group, which was vaccinated with the same vaccine in addition to thiomersal as a preservative, showed no significant reduction in immune response in comparison with the G1 group that was vaccinated with the same doses without thiomersal.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAntibody response after boost vaccination\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to experiment 1, we found a significant variation between G1 and G3 by the end of the incubation period at 6\u003csup\u003eth\u003c/sup\u003e week post vaccination. So, we choose those groups as a base for the experiment 2 which studied the effect of the booster dose with high and low virus pay load vaccine. As, shown in figure 6, G1-A group (non-boostered) and G3-A group (boostered with low virus payload) showed no increase in the antibody levels. \u0026nbsp;In contrast, there were increase in the antibody titers in sera of G1-B and G3-B groups that were boostered with high virus payload (10\u003csup\u003e7\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e). \u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe inclusion body hepatitis (IBH) incidence has increased in recent years, worldwide [18]. IBH is an emerging disease caused by FAdV that causes significant economic losses in the global poultry sector. Most outbreaks are linked to FAd-2, FAd-11, FAd-8a, and FAd-8b [18]. In Egypt, it was reported the co-circulation of several serotypes including FAd-1, FAd-2, FAd-5, FAd-8a, FAd-8b, and FAd-11 [13]. In this study, we developed an inactivated FAdV trivalent oil-emulsion vaccine encompassing FAdV-2/11, FAdV-8a, and FAdV-8b serotypes and the immune responses were evaluated in SPF chickens to select a promising vaccine candidate to decrease and control the prevalence of disease syndromes related to FAdV in Egypt. Because the protective efficacy of the inactivated vaccine is based on induction of antigen-specific humoral immune responses, the level of antibody in vaccinated chickens might be a helpful criterion for efficacy evaluation of inactivated vaccine [17].\u003c/p\u003e\n\u003cp\u003eAfter successful inactivation of virus with formaldehyde in 0.2% final concentration [15], three different formulas with three different payloads to optimize vaccine dose were prepared. The three doses achieved considerable ELISA titers; however remarkable difference was noticed for the least payload (5 x 10\u003csup\u003e6.5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e). The high titers continued till 6 weeks post vaccination without a sharp decline in the antibody’s titer. This finding support the results of some previous reports [17, 19-21] which showed the increasing antibody level at 1\u003csup\u003est\u003c/sup\u003e\u0026nbsp; week and decreasing at 4\u003csup\u003eth\u003c/sup\u003e weeks post vaccination.\u0026nbsp;Steer-Cope et al. [22] demonstrated that the inactivated FAdV-8a serotype vaccine produced serum antibodies from vaccinated chickens that neutralized FAdV-8a with ELIZA titers ranging from 600-20,000 post immunization.\u0026nbsp;The results obtained for inactivated FAdV trivalent vaccine under study are in consistence with those previous studies, suggesting that this vaccine could be helpful in controlling the FAdV infection [15].\u003c/p\u003e\n\u003cp\u003eAdditionally, we explored the effect of booster dose following 6 weeks of the priming dose. The antibodies titer increased considerably following the boosting dose, even for the group that has lower antibodies titer. This underpins the importance of serological monitoring following the first dose vaccine administration. In case of modest results following the prime dose, a different vaccine can be used for the booster where it can restore the high titers required for an efficient protection for the flocks. The control group that didn’t receive a booster dose showed the need for receiving booster dose as antibodies titers can decline considerably. It is recommended to test the ability of vaccines to reduce or prevent the virus shedding in the environment and determining the duration of the protective efficacy prevented the organism shedding to the environment [23]. Cádiz et al. [24] showed that the booster immunization significantly reduced shedding of virus, compared with non-booster inoculation. Another study needed to test the protective efficacy of the FAdV prepared vaccine against challenge with different FAdV serotypes.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThimerosal is considered as an important preservative agent to vaccine manufacturers [25], as it is one the most used preservative for chicken and veterinary vaccines. In 2008 the World Health Organization approved the addition of thimerosal in vaccines [26]. However, the effect of thiomersal on the immunogenicity is not understood. So, an additional group was added that explore the effect of the thiomersal on inactivated vaccine efficacy. Results showed low effect on the antibodies titers. Stone, [27] showed that thimerosal at the recommended levels in commercial poultry vaccines does not significantly reduce vaccine efficacy.\u003c/p\u003e\n\u003cp\u003eAn important note to consider, the ELISA results is influenced by the type of antigen coated within the kit. In this study, one ELISA kit didn’t show any readings with our vaccine but gave good results with the monovalent inactivated FAdV vaccine control that contained FAdV-4 (serotype-C) as this kit coated with homologous antigen for FAdV-4 (data not shown). On the other hand, another ELISA kit showed positive results for both vaccines (vaccine under study and control vaccine). Therefore, the selection of the ELISA kit is important for vaccine manufacturers due to the limited serological relatedness between the different FAdV serotypes.\u003c/p\u003e\n\u003cp\u003eBesides the above immunological findings, The FAdV cell-culture based vaccine tested in this study showed some well-known advantages over embryo-adapted vaccines. Virus propagation on chicken embryo is limited for many reasons such as\u0026nbsp;its dependance on a continuous supply chain of embryonated eggs,\u0026nbsp;time-consuming, and labor-intensive, which make it is not suitable for the practical manufacturing [28]. Moreover, cell-based production technology is more flexible that\u0026nbsp;allows manufacturers to react quickly to pandemic, and produce greater quantities of the vaccines with lower variations among vaccine batches in less time [29]. Additionally, cell-culture based production approach does not introduce greater or new adventitious agents when compared to egg-based vaccine production system [30]. Thereby, cell-culture derived inactivated FAdV vaccine has more useful benefits than the embryo-adapted vaccine.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThis study gives preliminary recommendations regarding the optimal vaccine payload, the feasibility of using thiomersal preservative during formulation, and the importance of diagnostic kit selection. Still, additional work needs to be carried out to correlate the relation between antibodies ELISA titer and protection against challenge. \u0026nbsp; Overall, FAdV is a continuing threat to the poultry industry and effective control measures are needed to be implemented. Effective vaccination strategies should be considered as one of the main pillars for controlling the FAdV threat.\u003c/p\u003e\n\u003cp\u003eIn conclusion, the inactivated FAdV trivalent FAdV-2/11, FAdV-8a, and FAdV-8b could be utilized as a vaccine to stimulate specific immunity against the FAdV-2/11, FAdV-8a, and FAdV-8b infection. Hence, humoral immunity induced by the inactivated FAdV trivalent vaccine containing the three serotypes could be a tool for IBH control in both breeders and their progenies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDisclosure statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo potential conflict of interest was reported by the authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author(s) reported there is no funding associated with the work featured in this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to Mohamed N. F. Shaheen\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by The Institutional Animal Care and Use Committee (ARC-IACUC), Agriculture Research Centre, Egypt on the date of 01.11.2024 (Ref No: ARC AHRI 183 24). Informed consent was obtained in accordance with the Ethics Committee and approval procedures.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have consented to publish this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eHarrach, B.; Tarj\u0026aacute;n, ZL.; Benkő, M. Adenoviruses across the animal kingdom: a walk in the zoo. FEBS Lett. 2019, 593, 3660\u0026ndash;3673.\u003c/li\u003e\n \u003cli\u003eMittal, D.; Jindal, N.; Tiwari, AK.; Khokhar, RS. Characterization of fowl adenoviruses associated with hydropericardium syndrome and inclusion body hepatitis in broiler chickens. Virusdisease. 2014, 25(1), 114\u0026ndash;119.\u003c/li\u003e\n \u003cli\u003eSohaimi, NM.; Hair-Bejo, M. A recent perspective on fiber and hexon genes proteins analyses of fowl adenovirus toward virus infectivity: a review. Open Vet J. 2021, 11, 569\u0026ndash;580.\u003c/li\u003e\n \u003cli\u003eSantander-Parra, SH.; Caza, M.; Nunez, L. Detection, quantification and molecular characterization of fowl adenoviruses circulating in Ecuadorian chicken flocks during 2019\u0026ndash;2021. Vet Sci. 2023,10.\u003c/li\u003e\n \u003cli\u003eFranzo, G.; Prentza, Z.; Paparounis, T.; Tsiouris, V.; Centonze, G.; Legnardi, M.; Catelli, E.; Tucciarone, CM.; Koutoulis, K.; Cecchinato, M. Molecular epidemiology of fowl adenoviruses in Greece. Poult Sci.2020, 99, 5983\u0026ndash;2990.\u003c/li\u003e\n \u003cli\u003eSchachner, A.; Matos, M.; Grafl, B.; Hess, M. Fowl adenovirus-induced diseases and strategies for their control \u0026ndash; a review on the current global situation. Avian Pathol. 2018 47(2), 111\u0026ndash;126.\u003c/li\u003e\n \u003cli\u003eAbghour, S.; Zro, K.; Mouahid, M.; Tahiri, F.; Tarta, M.; Berrada, J.; Kichou, F. Isolation and characterization of fowl aviadenovirus serotype 11 from chickens with inclusion body hepatitis in Morocco. PLoS One.2019, 14(12), e0227004.\u003c/li\u003e\n \u003cli\u003eMohamed, MHA.; El-Sabagh, IM.; Abdelaziz, AM.; Al-Ali, AM.; Alramadan, M.; Lebdah, MA.; Ibrahim, AM.; Al-Ankari, AS. Molecular characterization of fowl aviadenoviruses species D and E associated with inclusion body hepatitis in chickens and falcons indicates possible cross-species transmission. Avian Pathol. 2018, 47, 384\u0026ndash;390.\u003c/li\u003e\n \u003cli\u003eLi, L.; Wang, J.; Chen, P.; Zhang, S.; Sun, J.; Yuan, W. Pathogenicity and molecular characterization of a fowl adenovirus 4 isolated from chicken associated with IBH and HPS in China. BMC Vet Res. 2018, 14, 400.\u003c/li\u003e\n \u003cli\u003eRadwan, MM.; El-Deeb, AH.; Mousa, MR.; El-Sanousi, AA.; Shalaby, MA. First report of fowl adenovirus 8a from commercial broiler chickens in Egypt: Molecular characterization and pathogenicity. Poult Sci. 2019, 98(1), 97\u0026ndash;104.\u003c/li\u003e\n \u003cli\u003eHussein, E.; Anwar, NF.; Elsebaey, HS.; Abdelmagid, MA.; Elkhair, MA.; Mahana, O. Isolation and characterization of fowl adenoviruses associated with hydro-pericardium syndrome from broiler chickens in Egypt. J World Poult Res. 2023, 13(1), 149\u0026ndash;160.\u003c/li\u003e\n \u003cli\u003eElbestawy, AR.; Ibrahim, MH.; Ammam, H.; Noreldin, AE.; El Bahrawy, A.; Ellakany, HF. Molecular characterization of fowl adenovirus D species in broiler chickens with inclusion body hepatitis in Egypt. Alex J Vet Sci. 2020, 64(1), 110\u0026ndash;117.\u003c/li\u003e\n \u003cli\u003eAdel, A.; Mohamed, AAE.; Samir, M.; Hagag, NM.; Erfan, A.; Said, M.; Arafa, AES.; Hassan, WMM.; El Zowalaty, ME.; Shahien, MA. Epidemiological and molecular analysis of circulating fowl adenoviruses and emerging of serotypes 1, 3, and 8b in Egypt. Heliyon. 2021, 7(12), e08366.\u003c/li\u003e\n \u003cli\u003eSohaimi, NM.; Azreen, AQ.; Bejo, MH.; Abd Rahaman, NY. Safety and immunogenicity of inactivated fowl adenovirus serotype 8b isolate following different inactivation time intervals in broiler chickens. Arch Razi Inst. 2024, 79(5).\u003c/li\u003e\n \u003cli\u003eSong, C.; Zhao, S.; Song, M.; Qiao, Q.; Yang, P., Wang, B.; Cong, Y.; Wang, Y.; Liu, H.; Wang, Z.; Wang, X.; Zhao, J. An (2023) An inactivated novel trivalent vaccine provides complete protection against FAdV‐4 causing hepatitis‐hydropericardium syndrome and FAdV‐8b/‐11 causing inclusion body hepatitis. Transbound Emerg Dis. 2023, (1), 5122382.\u003c/li\u003e\n \u003cli\u003eSoumyalekshmi, S.; Ajith, M.K.; Chandraprakash, M. Isolation of fowl adenovirus in chicken embryo liver cell culture and its detection by hexon gene based PCR. Indian Journal of Scientific Research and Technology. 2014, 2(3), 33-36.\u003cspan dir=\"RTL\"\u003e\u0026rlm;\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003eReed, LJ.; Muench, H. A simple method of estimating fifty percent endpoints. Am J Hyg. . 1938, 27(3), 493\u0026ndash;7.\u003c/li\u003e\n \u003cli\u003eEl-Shall, NA.; El-Hamid, HAS.; Elkady, MF.; Ellakany, HF.; Elbestawy, AR.; Gado, AR.; Geneedy, AM.; Hasan, ME.; Jaremko, M.; Selim, S.; El-Tarabily, KA.; El-Hack, MEA. Epidemiology, pathology, prevention, and control strategies of inclusion body hepatitis and hepatitis-hydropericardium syndrome in poultry: A comprehensive review. Front Vet Sci. 2022, 9, 963199.\u003c/li\u003e\n \u003cli\u003eJunnu, S.; Lertwatcharasarakul, P.; Jala, S.; Phattanakulanan, S.; Monkong, A.; Kulprasertsri, S.; et al. An inactivated vaccine for prevention and control of inclusion body hepatitis in broiler breeders. Thai J Vet Med. 2015, 45(1), 55\u0026ndash;62.\u003c/li\u003e\n \u003cli\u003eSahidullah, S.; Sadeeq-ur-rahman, Rabbani, M.; Shah, MK.; Naseem, S.; Khan, SH. Development of standard protocols for preparation and evaluation of live homogenate vaccines against hydropericardium syndrome virus in poultry. Pak Vet J. 2008, 28(4), 163\u0026ndash;6.\u003c/li\u003e\n \u003cli\u003eAkhtar, M.; Ahmad, R.; Hayat, CS.; Hussain, I.; Ashfaque, M. Comparative immune response of formalin inactivated and binary ethyleneimine inactivated Angara disease vaccines. Pak J Biol Sci. 2000, 3(8), 1313\u0026ndash;4.\u003c/li\u003e\n \u003cli\u003eSteer-Cope, PA.; Sandy, JR.; O\u0026rsquo;Rourke, D.; Scott, PC.; Browning, GF.; Noormohammadi, AH. Vaccination with FAdV-8a induces protection against inclusion body hepatitis caused by homologous and heterologous strains. Avian Pathol. 2019, 48, 396\u0026ndash;405.\u003c/li\u003e\n \u003cli\u003eKaiser, TJ.; Smiley, RA.; Fergen, B.; Eichmeyer, M.; Genzow, M. Influenza A virus shedding reduction observed at 12 weeks post-vaccination when newborn pigs are administered live-attenuated influenza virus vaccine. Influenza Other Respir Viruses. 2019, 13(3), 274\u0026ndash;278.\u003c/li\u003e\n \u003cli\u003eC\u0026aacute;diz, L.; Guzm\u0026aacute;n, M.; Navarrete, F.; Torres, P.; Hidalgo, H. First molecular detection and characterization of fowl aviadenovirus serotype 11 from broiler chickens in Chile. Microbial Res. 2024, 15(2), 626\u0026ndash;633.\u003c/li\u003e\n \u003cli\u003eOrenstein, WA.; Paulson, JA.; Brady, MT.; Cooper, LZ.; Seib, K. Global vaccination recommendations and thimerosal. Pediatrics. 2013, 131(1), 149\u0026ndash;151.\u003c/li\u003e\n \u003cli\u003eWorld Health Organization (2008) Meeting of Global Advisory Committee on Vaccine Safety, Wkly Epidemiol Rec. June 18\u0026ndash;19, 2008, 83(32), 287\u0026ndash;292.\u003c/li\u003e\n \u003cli\u003eStone, HD. Effect of thimerosal concentration on the efficacy of inactivated Newcastle disease oil-emulsion vaccines. Avian Dis. 1985, 29, 1030\u0026ndash;1035.\u003c/li\u003e\n \u003cli\u003ePartridge, J.; Kieny, MP. Global production capacity of seasonal influenza vaccine in 2011. Vaccine. 2013, 31(5), 728\u0026ndash;31.\u003c/li\u003e\n \u003cli\u003eDormitzer, PR.; Tsai, TF.; Del Giudice, G. New technologies for influenza vaccines. Hum Vaccin Immunother. 2012, 8(1), 45\u0026ndash;58.\u003c/li\u003e\n \u003cli\u003eDu, D.; Zhang, P.; Li, X.; Tian, H.; Cheng, Y.; Sheng, D.; Han, X.; Shan, Y.; Li, X.; Yuan, Y.; Zhang, H.; Xue, J.; Liu, W.; Tian, K. Cell-culture derived fowl adenovirus serotype 4 inactivated vaccine provides complete protection for virus infection on SPF chickens. Virusdisease. 2017, 28(2), 182\u0026ndash;188.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"IBH, FAdV, vaccine, immunization, chicken","lastPublishedDoi":"10.21203/rs.3.rs-6907880/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6907880/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn recent years, inclusion bodies hepatitis (IBH) caused by fowl adenovirus (FAdV) species D and E led to significant economic losses in the poultry sector, worldwide. Therefore, this study aimed to assess the immunogenicity of an inactivated trivalent FAdV vaccine prepared with different payloads (10\u003csup\u003e7\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e, 10\u003csup\u003e6.8\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e, 10\u003csup\u003e6.5\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e) in commercial broiler chickens. The effects of booster immunization and thiomersal addition on the titers of developed antibodies were also evaluated. The virus propagated on liver primary cells for virus isolation and virus infectivity. Our results showed that group which vaccinated with a higher payload of the virus presented a prolonged immune response till the 6th week, compared to birds which were vaccinated with lowest dose of the virus of the trivalent vaccine. Also, birds which were vaccinated with the same vaccine containing thiomersal as a preservative, showed no significant reduction in immune response. For booster immunization, only high payload (10\u003csup\u003e7\u003c/sup\u003e TCID\u003csub\u003e50\u003c/sub\u003e of each serotype/bird) increased the antibodies titers, specially at 2\u003csup\u003eth\u003c/sup\u003e and 3\u003csup\u003erd\u003c/sup\u003e week post-vaccination. The obtained results suggested that the trivalent inactivated FAdv serotype 8a/8b/D vaccine at 10\u003csup\u003e7 \u003c/sup\u003eTCID\u003csub\u003e50\u003c/sub\u003e concentration of each serotype/bird at priming and booster vaccination could be used for the prevention and control of IBH.\u003c/p\u003e","manuscriptTitle":"Preparation and Serological Evaluation of an Inactivated Trivalent oil emulsion vaccine for Avian Fowl Adenovirus (FAdV) containing -8a, 8b, and 11 serotypes","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-18 11:33:09","doi":"10.21203/rs.3.rs-6907880/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f4a1f40c-7cb1-4701-89db-b6f5719a601c","owner":[],"postedDate":"June 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":50142693,"name":"Applied \u0026 Industrial Microbiology"}],"tags":[],"updatedAt":"2025-06-18T11:33:10+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-18 11:33:09","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6907880","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6907880","identity":"rs-6907880","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}