Role of transforming growth factor-β1 in regulating adipocyte progenitors | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Role of transforming growth factor-β1 in regulating adipocyte progenitors Nguyen Quynh Phuong, Muhammad Bilal, Allah Nawaz, Le Duc Anh, and 16 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4672547/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Jan, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Adipose tissue (AT) metabolism involves coordinating various cells and cellular processes to regulate energy storage, release, and overall metabolic homeostasis. Therein, macrophage and its cytokine are important in controlling tissue homeostasis. Among cytokines, the role of transforming growth factor-β1 (Tgf-β1), a cytokine abundantly expressed in CD206 + M2 macrophage and correlated with the expansion of AT and fibrosis, in AT metabolism remains unknown. We used CD206CreER T 2 ; Tgf-β1 f/f mouse model in which the Tgf-β1 gene was conditionally deleted in CD206 + M2 macrophages followed by tamoxifen administration, to investigate the role of the Tgf-β1 gene in glucose and insulin metabolism. Our data demonstrated that lack of CD206 + M2 macrophages derived Tgf-β1 gene improved glucose metabolism and insulin sensitivity by enhancing adipogenesis via hyperplasia expansion. The Tgf-β1 gene, specifically from CD206 + M2 macrophages, deletion stimulated APs’ proliferation and differentiation, leading to the generation of smaller mature adipocytes, therefore maintaining insulin sensitivity and improving glucose metabolism under normal chow conditions. Our study brings a new perspective that Tgf-β1 gene deletion specific from CD206 + M2 macrophage promotes adipocyte hyperplasia, improving glucose homeostasis. Thus, deletion of the Tgf-β1 gene derived from CD206 + M2 macrophage might be a potential strategy for preventing obesity and type 2 diabetes. Tgf-β1 CD206+ M2 macrophage adipocyte progenitors hyperplasia adipogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Adipose tissue (AT) metabolism involves coordinating various cells and cellular processes to regulate energy storage, release, and overall metabolic homeostasis. AT includes adipocytes, a stromal vascular fraction (SVF), and an extracellular matrix. Excess nutrients are associated with an expansion of white adipose tissue (WAT) 1 – 3 , leading to adipose tissue (AT) dysfunction, insulin resistance, type 2 diabetes, and other metabolic disorders 4 , 5 . WAT expands in two ways: adipocyte hypertrophy (increased adipocyte size) or adipocyte hyperplasia ( de novo adipogenesis) 6 , 7 . The expansion of adipocytes is closely related to SVF. SVF, which is located in the connective tissue surrounding adipocytes, contains heterogeneous cell populations such as adipocyte progenitors (APs) and immune cells. A large number of APs, which give rise to mature adipocytes with a higher number of smaller adipocytes, preserves AT function and enhances insulin sensitivity 8 , 9 . Epididymal WAT (eWAT), a major visceral WAT depot, has the function of energy storage and expands through cellular hypertrophy, increasing inflammation and inflammatory cytokine and leading to insulin resistance 10 . Thus, ameliorating the expansion of eWAT brings a promising therapy for obesity-related disorders. WAT is a source of adipokines, including immune modulatory cytokines, chemokines, and growth hormones. M1-polarized macrophages provide acute pro-inflammatory effector functions by expressing reactive oxygen species, nitric oxide, and secretion of type-1 cytokines such as TNF-α, IFN-γ, and interleukin 1 beta (IL-1β). Previous studies demonstrated that M1 marker genes such as tumor necrosis factor-alpha (TNFα), C-C motif chemokine receptor (CCR) 2, or CD11c resulted in the development of insulin resistance 11 – 13 . In contrast, macrophages are activated towards M2 polarization characterized by the relatively high expression of CD206, arginase-1, Mgl1, and IL-10, which are involved in the repair or remodeling of tissues 14 , 15 . A recent study reported that depletion of CD206 + M2 macrophage improves glucose and insulin metabolism 8 . Another study showed that ablation of IL10 secreted from macrophages protects from obesity development 16 . However, the role of transforming growth factor-β1 (Tgf-β1), a cytokine abundantly expressed in CD206 + M2 macrophage within adipose tissue and correlated with the expansion of AT and fibrosis 17 – 19 , in AT metabolism remains unknown. Precious study reported that Tgf-β signaling induces hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells 20 , 21 , suggesting the essential role of Tgf-β1 in regulating APs to respond with adipocyte expansion. Thus, we hypothesize that deletion of Tgf-β1 gene-specific from CD206 + M2 macrophages might improve glucose metabolism and insulin sensitivity by enhancing adipogenesis via stimulating APs proliferation and differentiation. Results 1. The Tgf-β1 gene was successfully deleted in our mouse model. To investigate the role of the Tgf-β1 gene in CD206 + M2 macrophage, we used the mice CD206CreER T 2 ; Tgf-β1 f/f in which Tgf-β1 gene was conditionally deleted from CD206 + M2 macrophage by tamoxifen treatment as schema in Fig. 1A. To investigate the role of the Tgf-β1 gene, 18-week-old mice were administered tamoxifen (TAM) for 5 consecutive days. After 1 week of recovery, we performed GTT and ITT. Finally, mice were sacrificed at 22 weeks as the schematic protocol described in Fig. 1B. Before and after 5 times TAM treatment, the body weights of both groups were comparable (Supplementary Fig. 1A-B). From 6 weeks to 18 weeks of normal chow diet, both food intake and body weight also showed no significant difference between the two groups (Supplementary Fig. 1C-D). When sacrificed, body weight, eWAT, and inguinal white adipose tissue (iWAT) were also comparable between both groups (Supplementary Fig. 2A-C). To evaluate our mouse model, we examined Tgf-β1 gene expression and found it downregulated significantly in the eWAT whole tissue of Tgf-β1 KO mice (Fig. 1C). For further confirmation, we performed immunohistochemistry stained with anti-CD206 and anti-Tgf-β1. The result revealed that CD206 and Tgf-β1 double-positive expression was reduced significantly in Tgf-β1 KO mice (Fig. 1D-E). Collectively, our data confirmed that the Tgf-β1 gene was successfully deleted in CD206 + M2 macrophage in our mouse model. 2. Deleting the Tgf-β1 gene in CD206 M2 macrophage improves glucose metabolism and insulin sensitivity. We next investigate whether deleting the Tgf-β1 gene derived from CD206 + M2 macrophage affects glucose and insulin metabolism. As expected, in GTT, we found glucose levels were lower in Tgf-β1 KO mice (Fig. 2A), and the area under the GTT curve was also significantly lower in Tgf-β1 KO mice (Fig. 2B). We also found that ITT was improved in Tgf-β1 KO mice (Fig. 2C-D), suggesting Tgf-β1 KO enhances glucose metabolism and insulin sensitivity. Consistent with this, gene analysis revealed that all metabolically favorable genes’ expressions were upregulated significantly in Tgf-β1 KO mice (Fig. 2E). In addition, we also found that the expression of adipogenesis-related genes was elevated significantly in Tgf-β1 KO mice (Fig. 2F). Collectively, our data demonstrated that Tgf-β1 deletion in CD206 M2 + macrophage improved glucose metabolism and insulin sensitivity. 3. Lack of CD206 M2 macrophage-derived Tgf-β1 gene generates smaller adipocytes. We further aimed to find the mechanism behind the lack of the Tgf-β1 gene to promote glucose and insulin tolerance. Previous studies reported that M1 pro-inflammatory marker genes are involved in insulin resistance 11 – 13 . M2 macrophages are reported to maintain homeostasis and adapt to energy surplus conditions 22 , 23 . Thus, we examine whether macrophage remodeling was responsible for the improvement. However, we found no significant difference in M1 and M2 macrophage-related gene expression between both groups (Fig. 3A). We next confirmed the CD206 + signal by immunohistochemistry and found that there were no significant differences between both groups (Supplementary Fig. 3), suggesting that there was no macrophage remodeling in response to Tgf-β1 gene deletion under normal chow conditions. Another report demonstrated that hyperplasia was involved in insulin sensitivity 7 , 8 . Our data reported that the adipogenesis marker ( C/EBPα, Pparγ ) was elevated significantly in Tgf-β1 KO mice (Fig. 2E). We next investigated small adipocyte-related gene expression and found that it was elevated dramatically in Tgf-β1 KO mice (Fig. 3B). As expected, we found that Tgf-β1 KO increased smaller adipocytes with an elevated number of adipocytes and reduced average adipocyte size (Fig. 3B-E). Collectively, our data demonstrated that deletion of Tgf-β1 in CD206 + M2 macrophage stimulated adipogenesis and generated smaller adipocytes. 4. CD206 M2 macrophage-derived Tgf-β1 gene deletion enhanced APs proliferations. APs are the population that gives rise to mature adipocytes. TGF-β signaling was reported to control cell proliferation 24 – 26 . Other studies also reported that TGF-β signaling induces hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells 20 , 21 . Therefore, we hypothesize that the APs pool was hibernated by CD206 + M2 macrophage-derived Tgf-β1 gene, thus Tgf-β1 gene deletion stimulated APs proliferation. We investigated the cell cycle-related genes in SVF of eWAT and found that the expression of mKi-67 and cyclin d1 were increased significantly (Fig. 4A). Platelet-derived growth factor receptor alpha (PDGFRα) is a marker of APs and preadipocytes that can differentiate into functional adipocytes in vivo 27 – 29 . We next isolated PDGFRα + cells using magnetic-activated cell sorting (MACS) (Fig. 4B) from eWAT then examined cell cycle-related gene expression and found that almost genes elevated dramatically (Fig. 4C). We next examined immunohistochemistry by staining with anti-Ki-67 and anti-PDGFRα and found that PDGFRα + Ki-67 + DAPI + signals were significantly elevated in Tgf-β1 KO mice (Fig. 4D, E). Our data demonstrated that deletion of the Tgf-β1 gene in CD206 + M2 macrophage stimulated APs proliferation. 5. Impact of CD206 M2 macrophage-derived Tgf-β1 gene on APs differentiation. A previous study reported that the TGF-β family inhibits Dpp4 + APs, stem cell-like progenitors, from differentiating into Icam1 + APs, committed preadipocytes 30 , 31 . Thus, we hypothesize that Tgf-β1 also inhibited APs differentiation. We examined APs-related gene expression and found that almost all genes were increased significantly in the SVF of Tgf-β1 KO mice (Fig. 5A). We further confirmed the expression of APs-related genes and also found that almost all genes were elevated significantly in Pdgfrα + cells of Tgf-β1 KO mice (Fig. 5B). We next performed flow cytometry using the strategy described in Supplementary Fig. 4. Consistent with previous data, we found the significant upregulation of Dpp4 and Icam1 double-positive cells in Tgf-β1 KO mice, suggesting the shifting from stem cell-like progenitors to committed adipocytes, resulting in generating more small adipocytes (Fig. 5C-D). Collectively, our data demonstrated that Tgf-β1 gene deletion stimulated stem cell-like progenitors to differentiate into committed preadipocytes, thus generating smaller mature adipocytes, stimulating the expression of metabolically favorable genes, and finally improving glucose metabolism and insulin sensitivity. Discussion Adipose tissue metabolism involves coordinating various cells and cellular processes to regulate energy storage, release, and overall metabolic homeostasis. These include adipocytes, preadipocytes/adipocyte progenitors (APs), endothelial cells, and immune cells. Therein, macrophages have an essential role in regulating homeostasis and AT metabolism. AT macrophages (ATMs) maintain tissue homeostasis by scavenging debris, pathogens, and apoptotic or necrotic cells; this efferocytotic process maintains an anti-inflammatory environment 32 . ATMs show highly heterogeneous characteristics and include at least two major populations called the classically activated, or M1, ATMs and alternatively activated, or M2, ATMs 33 . M1 macrophages are mainly induced by Th1 signaling and express high levels of inflammatory cytokines such as TNFα and IL-6, While M2 macrophages are induced by Th2 signaling and are associated with anti-inflammatory reactions 34 . Previous reports showed that TNFα, a cytokine released from M1 macrophage, increases phosphorylation of PLIN1, promoting basal lipolysis and thus releasing fatty acids (FAs) into plasma 35 – 37 . These FAs activate the JNK pathway to increase releasing pro-inflammatory factors, resulting in insulin resistance 38 . Another cytokine from the M1 macrophage, IL-6, was also reported to increase insulin resistance by promoting lipolysis 39 , 40 . M2 macrophages, on the other hand, were reported to be involved in maintaining insulin sensitivity through their anti-inflammatory functions 22 , 23 . However, recent reports demonstrated that depletion of CD206 + M2 macrophage or ablation IL10 derived from M2 macrophage leads to improved glucose metabolism and insulin sensitivity, suggesting that not all M2 macrophages were good. From the current study perspective, our data demonstrated that deletion of the Tgf-β1 gene, a cytokine mainly secreted from CD206 + M2 macrophage, improves glucose and insulin sensitivity without macrophage remodeling. Previous studies reported that TGF-β signaling was involved in inducing hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells 20 , 21 . In addition, Merrick et al. reported that TGF-β signaling inhibits the differentiation from stem cell-like progenitors APs (Dpp4 + APs) into committed preadipocytes (Icam1 + APs) 30 . Agreed with them, our data demonstrated that the Tgf-β1 gene-specific from CD206 + M2 macrophage kept APs in hibernation and prevented unnecessary cell division and potential cell senescence, resulting in preserving the adipogenic precursor pool. Tgf-β1 transmits its signal to the nucleus through a transcriptional factor called SMAD 41 , 42 . Roh et al. reported that the TGF-β activated SMAD repressor complex downregulates Pparγ at the transcriptional level via histone deacetylation after binding to a novel TGF-β inhibitory element and canonical SMAD-binding elements 43 . Agreed with them, we also found that Pparγ, the master regular of adipogenesis 44 , 45 , expression was elevated in response to Tgf-β1 gene deletion, suggesting that Tgf-β1 controls the APs pool via interacting with Pparγ. In conclusion, our study brings a new perspective that Tgf-β1 gene deletion specific from CD206 + M2 macrophage promotes adipocyte hyperplasia, improving glucose homeostasis (Fig. 6). Thus, deletion of the Tgf-β1 gene derived from CD206 + M2 macrophage might be a potential strategy for preventing obesity and type 2 diabetes. Material and Methods Mice We generated CD206CreER T 2 ; Tgf-β1 f/f mice by crossing CD206 CreER T 2 mice and Tgf-β1 flox/flox (Tgf-β1 f/f ) as previously described by Nawaz et al 46 . All animals were housed, 6 mice in one cage, in a room with the temperature (24 \(\:\pm\:\) 2 degrees and humidity (55 \(\:\pm\:\) 5 percentage) were controlled automatically, and the cycle of light/dark was maintained at 12:12 hours. The mice had free access to water ad libitum and food (a normal chow diet: CE-2 CLEA, Japan). Genotyping Whole genomic DNA was obtained by lysis tail tissue with Direct PCR (Tail) lysis solution (Viagen Biotech) and proteinase K (Roche Diagnostics), following the manufacturer's instructions. We performed PCR by using a Tks Gflex DNA polymerase kit from TAKARA (Shiga, Japan) with this crude DNA. PCR conditions for CD206 CreER T 2 included segment 1: 1 cycle of 94 degrees for 1 minute, segment 2: 30 cycle includes 98 degrees for 10 seconds; 58 degrees for 30 seconds; and 68 degrees for 30 seconds. Then PCR productions were kept at 4 degrees. The expected DNA fragment size is 299 bp. The primers used for PCR had the sequence GGTCGATGCAACGAGTGATGAG (primer 1) and GTGAAACAGCATTGCTGTCACTTGG (primer 2) The PCR condition for Tgf-β1 f/f included segment 1: 1 cycle of 94 degrees for 1 minute, segment 2: 40 cycle including 98 degrees for 10 seconds; 54 degrees for 30 seconds; and 68 degrees for 30 seconds. Then PCR productions were kept at 4 degrees. The expected DNA fragment sizes of WT and f/f mice were 210 bp and 338 bp, respectively. The primers' sequences were AAGACCTGGGTTGGAAGTG (primer 1) and CTTCTCCGTTTCTCTGTCACCCTAT (primer 2). Both primers for PCR were purchased from Invitrogen™ Life Technology (Tokyo, Japan). Then PCR products were separated using 1.5% Agarose gel (Nippon gel) electrophoresis for 30 minutes. Ethidium bromide (1:1000) was added to visualize DNA on the gel. Tamoxifen administration We used sunflower oil (WAKO) to dissolve tamoxifen (TAM: sigma-Aldrich) incubated at 55 degrees and vortexed every 5 minutes until dissolved. After dissolved, TAM was administered to both Tgf-β1 f/f and Tgf-β1 KO at the dose of 225mg/kg body weight for five consecutive days, as previously described 10 at the 18-week-old following schematic protocol in Fig. 1B. Glucose tolerance and Insulin tolerance test For the intraperitoneal glucose tolerance test (ip-GTT), the mice were fasted for 5 hours. Glucose was injected into both Tgf-β1 KO and Tgf- β1 f/f at a dose of 1mg/g body weight. The blood glucose level was measured at 0, 15, 30, 60, 90 and 120 minutes. For the intraperitoneal insulin tolerance test (ip- ITT), mice were fasting for 4 hours. Both Tgf-β1 KO and Tgf- β1 f/f mice were injected with human insulin (Humalin R) with a dose of 0.8 units/g. The blood glucose level was measured at 0, 15, 30, 45, 60, 90, and 120 minutes. In both ip-GTT and ip-ITT, the blood glucose level was taken from the tail vein using the STAT STRIP Express 900 (Nova Biomedical, Waltham, MA). Real-time polymerase chain reaction (RT-PCR) eWAT whole tissue was collected and extracted using the Qiagen RNeasy kit following the manufacturer's instructions. The TaKaRa PrimerScript RNA Kit was used following the company's guidance for reverse transcription. The quantitative PCR amplification reaction was performed using gene-specific primers (provided in Supplementary Table S2) and TB Green Fast Premix (Takara, Shiga Japan), followed by the manufacturer's instructions. The relative mRNA expression levels were calculated by \(\:\varDelta\:\varDelta\:\) Ct value and normalized by internal control TF2B or RPL13a. Flow cytometry analysis To isolate and prepare stromal vascular fraction (SVF) of eWAT 47 , 48 . Tissue was collected and digested in collagenase (Sigma) for 45 minutes at 37 degrees before filtering through a 100- µm strainer to harvest a single cell. The 7AAD − population was gated to analyze lineage-negative (CD31 − CD45 − ) populations, followed by Sca1 +, then separated into Dpp4 + , Icam1 + , and Dpp4 + Icam1 + populations. For justification of the gating strategy, unstained and fluorescence minus one (FMO) were used. All this experiment and cell sorting were performed using BD FACS Aria™ SORP II machine and the FlowJo offline software (v10) to analyze data. Magnetic-activated cell sorting study SVF was dissociated from eWAT tissue as previously described 8 , 47 . The SVF was processed for magnetic cell sorting with anti- Pdgfr \(\:\alpha\:\) microbeads, then we collected a positive population, extracted RNA, and performed qPCR analysis of adipocyte progenitors and cell cycle. All incubation and procedure were performed at 4 degrees for 10 to 15 minutes following the manufacturer’s instructions. Microbead Kit was purchased from Miltenyi Biotech. Histology After collection, tissue was fixed in 4%PFA, and paraffin sections were prepared with 5–10 µm thickness and then mounted on the slide. For Hematoxylin and Eosin (H/E staining), the slide was stained with hematoxylin and eosin. Hematoxylin eosin was captured using Keyence BZ-X800 with a 20x lens (scale bar 200 µm). Immunohistochemistry After collection, tissue was fixed in 4%PFA, and paraffin sections were prepared with 5–10 µm thickness and then mounted on the slide. As described previously, paraffin-embedded tissue sections were used in immunohistochemical staining. The primary and secondary antibodies are used following the manufacturer's instructions, with the ratio for primary antibody being 1:100, the secondary antibody being 1:250, and DAPI being 1:400. Primary antibodies included CD206, Tgf-β1, PDGFRα, and mKi-67. Secondary antibodies included anti-rabbit, anti-mouse, and anti-goat. All primer sources were provided in Supplementary Table S1 . All images were taken by an LSM 900 with an Arycan confocal microscope. Quantification of adipocyte size The number of adipocytes was counted at 3.9x10 5 µm 2 (area). The multi-point tool in ImageJ 1.53a (National Institute of Health, USA) was used for adipocyte counting. The “ Set Scale” function in ImageJ adipocyte size was used to analyze adipocyte size manually. We measured 4 random fields/specimens, with 4 specimens in each group. Statistical Analysis Statistical significance between the Tgf-β1 KO and Tgf-β1 f/f group was performed using two-way ANOVA followed by the Sidak multiple comparison test for GTT and ITT. Other data used two-tail unpaired Student’s t-test, *p < 0.05, ** p < 0.01, ***p < 0.001, ****p < 0.0001. Data are expressed as mean ± SEM. Declarations Ethical approval All procedures were conducted in accordance with ARRIVE guidelines. All experiments and procedures were approved by the Animal Care Committee of the University of Toyama (Approved number A2023MED-16). AUTHOR CONTRIBUTIONS N.Q.P and M.B. contributed equally, performed all experiments, acquired the data, and wrote the manuscript. M.B., A.N., and K.T. generate the hypothesis. T.K., Y.I., and H.M., generated mice. M.M., S.K., L.D.A., M.R.A., Ay.N. Y.W., Y.I. helped perform genotype and RT-qPCR analysis. K.O., A.N., I.U., and S.F. helped with manuscript writing. S.Y., K.H., help in performing histology. T.N, H.M. and R.H. helped in the discussion. K.T. supervised the project. ACKNOWLEDGMENTS This research was supported by Moonshot R&D (Grant numbers JPMJMS2021). This study was also supported by Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS) (24K02502 to K. T, 22K203737 and 24K19282 to M.B, 21K16338 and 23KJ1022 to Y.I, 22K16423 and 24K19303 to A.Nishimura, 22K16424 to Y.W.). Research Grants from The Uehara Memorial Foundation 2023 to K.T, Eli Lilly Japan KK Innovation Research Grant 2023 to K.T., and a grant from Suzuken Memorial Foundation to M.B. This work was also supported by the Young Research Grant from the Japan Diabetes Society (to A.N., T.K. and A. Nishimura), and a grant from the Japan Foundation for Applied Enzymology (a grant for Front Runner of Future Diabetes Research to M.B., A.N. and T.K.). This work was also supported by Grant from The Naito Foundation (2021-2023) to Y.I., Japan Diabetes Foundation to S.F., T.K. and A. Nishimura, Japan Society for the Study of Obesity (JASSO) to S.F., First Bank of Toyama Scholarship Foundation to S. F., Yamaguchi Endocrine Research Foundation to S.F., Japan Association for Diabetes Education and Care to S.F., a grant from Boehringer Ingelheim to T.K., a grant from Novo Nordisk Pharma to A. Nishimura., a grant from Lotte Foundation to Y.W., Hokugin Young Researchers Grant to Y.W., ONO Medical Research Foundation to T.K., and a grant for Young Researchers from Japan Association for Diabetes Education and Care to T.K. CONFLICT OF INTEREST All authors have no declared conflict of interest. Data availability The raw data generated for all figures and supplementary figures of this study are provided in the Source data file. References Blüher, M. Obesity: global epidemiology and pathogenesis. Nat Rev Endocrinol 15 , 288-298 (2019). https://doi.org:10.1038/s41574-019-0176-8 Sakers, A., De Siqueira, M. K., Seale, P. & Villanueva, C. J. Adipose-tissue plasticity in health and disease. Cell 185 , 419-446 (2022). https://doi.org:10.1016/j.cell.2021.12.016 Kahn, C. R., Wang, G. & Lee, K. Y. Altered adipose tissue and adipocyte function in the pathogenesis of metabolic syndrome. J Clin Invest 129 , 3990-4000 (2019). https://doi.org:10.1172/jci129187 Sun, K., Kusminski, C. M. & Scherer, P. E. Adipose tissue remodeling and obesity. J Clin Invest 121 , 2094-2101 (2011). https://doi.org:10.1172/jci45887 Klein, S., Gastaldelli, A., Yki-Järvinen, H. & Scherer, P. E. Why does obesity cause diabetes? Cell Metab 34 , 11-20 (2022). https://doi.org:10.1016/j.cmet.2021.12.012 Wang, Q. A., Tao, C., Gupta, R. K. & Scherer, P. E. Tracking adipogenesis during white adipose tissue development, expansion and regeneration. Nat Med 19 , 1338-1344 (2013). https://doi.org:10.1038/nm.3324 Ghaben, A. L. & Scherer, P. E. Adipogenesis and metabolic health. Nat Rev Mol Cell Biol 20 , 242-258 (2019). https://doi.org:10.1038/s41580-018-0093-z Nawaz, A. et al. CD206(+) M2-like macrophages regulate systemic glucose metabolism by inhibiting proliferation of adipocyte progenitors. Nat Commun 8 , 286 (2017). https://doi.org:10.1038/s41467-017-00231-1 Joe, A. W., Yi, L., Even, Y., Vogl, A. W. & Rossi, F. M. Depot-specific differences in adipogenic progenitor abundance and proliferative response to high-fat diet. Stem Cells 27 , 2563-2570 (2009). https://doi.org:10.1002/stem.190 Bilal, M. et al. Fate of adipocyte progenitors during adipogenesis in mice fed a high-fat diet. Mol Metab 54 , 101328 (2021). https://doi.org:10.1016/j.molmet.2021.101328 Uysal, K. T., Wiesbrock, S. M., Marino, M. W. & Hotamisligil, G. S. Protection from obesity-induced insulin resistance in mice lacking TNF-alpha function. Nature 389 , 610-614 (1997). https://doi.org:10.1038/39335 Weisberg, S. P. et al. CCR2 modulates inflammatory and metabolic effects of high-fat feeding. J Clin Invest 116 , 115-124 (2006). https://doi.org:10.1172/jci24335 Patsouris, D. et al. Ablation of CD11c-positive cells normalizes insulin sensitivity in obese insulin resistant animals. Cell Metab 8 , 301-309 (2008). https://doi.org:10.1016/j.cmet.2008.08.015 Lumeng, C. N., Bodzin, J. L. & Saltiel, A. R. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. J Clin Invest 117 , 175-184 (2007). https://doi.org:10.1172/jci29881 Lumeng, C. N., DelProposto, J. B., Westcott, D. J. & Saltiel, A. R. Phenotypic switching of adipose tissue macrophages with obesity is generated by spatiotemporal differences in macrophage subtypes. Diabetes 57 , 3239-3246 (2008). https://doi.org:10.2337/db08-0872 Rajbhandari, P. et al. IL-10 Signaling Remodels Adipose Chromatin Architecture to Limit Thermogenesis and Energy Expenditure. Cell 172 , 218-233.e217 (2018). https://doi.org:10.1016/j.cell.2017.11.019 Meng, X. M., Nikolic-Paterson, D. J. & Lan, H. Y. TGF-β: the master regulator of fibrosis. Nat Rev Nephrol 12 , 325-338 (2016). https://doi.org:10.1038/nrneph.2016.48 Samad, F. et al. Tumor necrosis factor alpha is a key component in the obesity-linked elevation of plasminogen activator inhibitor 1. Proc Natl Acad Sci U S A 96 , 6902-6907 (1999). https://doi.org:10.1073/pnas.96.12.6902 Samad, F., Yamamoto, K., Pandey, M. & Loskutoff, D. J. Elevated expression of transforming growth factor-beta in adipose tissue from obese mice. Mol Med 3 , 37-48 (1997). Yamazaki, S. et al. Nonmyelinating Schwann cells maintain hematopoietic stem cell hibernation in the bone marrow niche. Cell 147 , 1146-1158 (2011). https://doi.org:10.1016/j.cell.2011.09.053 Nishimura, E. K. et al. Key roles for transforming growth factor beta in melanocyte stem cell maintenance. Cell Stem Cell 6 , 130-140 (2010). https://doi.org:10.1016/j.stem.2009.12.010 Lumeng, C. N. & Saltiel, A. R. Inflammatory links between obesity and metabolic disease. J Clin Invest 121 , 2111-2117 (2011). https://doi.org:10.1172/jci57132 Pollard, J. W. Trophic macrophages in development and disease. Nat Rev Immunol 9 , 259-270 (2009). https://doi.org:10.1038/nri2528 Huang, S. S. & Huang, J. S. TGF-beta control of cell proliferation. J Cell Biochem 96 , 447-462 (2005). https://doi.org:10.1002/jcb.20558 Zhang, Y., Alexander, P. B. & Wang, X. F. TGF-β Family Signaling in the Control of Cell Proliferation and Survival. Cold Spring Harb Perspect Biol 9 (2017). https://doi.org:10.1101/cshperspect.a022145 Moustakas, A., Pardali, K., Gaal, A. & Heldin, C. H. Mechanisms of TGF-beta signaling in regulation of cell growth and differentiation. Immunol Lett 82 , 85-91 (2002). https://doi.org:10.1016/s0165-2478(02)00023-8 Feng, X. H. & Derynck, R. Specificity and versatility in tgf-beta signaling through Smads. Annu Rev Cell Dev Biol 21 , 659-693 (2005). https://doi.org:10.1146/annurev.cellbio.21.022404.142018 Iwayama, T. et al. PDGFRα signaling drives adipose tissue fibrosis by targeting progenitor cell plasticity. Genes Dev 29 , 1106-1119 (2015). https://doi.org:10.1101/gad.260554.115 Lee, Y. H., Petkova, A. P., Mottillo, E. P. & Granneman, J. G. In vivo identification of bipotential adipocyte progenitors recruited by β3-adrenoceptor activation and high-fat feeding. Cell Metab 15 , 480-491 (2012). https://doi.org:10.1016/j.cmet.2012.03.009 Merrick, D. et al. Identification of a mesenchymal progenitor cell hierarchy in adipose tissue. Science 364 (2019). https://doi.org:10.1126/science.aav2501 Ignotz, R. A. & Massagué, J. Type beta transforming growth factor controls the adipogenic differentiation of 3T3 fibroblasts. Proc Natl Acad Sci U S A 82 , 8530-8534 (1985). https://doi.org:10.1073/pnas.82.24.8530 Fischer-Posovszky, P., Wang, Q. A., Asterholm, I. W., Rutkowski, J. M. & Scherer, P. E. Targeted deletion of adipocytes by apoptosis leads to adipose tissue recruitment of alternatively activated M2 macrophages. Endocrinology 152 , 3074-3081 (2011). https://doi.org:10.1210/en.2011-1031 Mantovani, A. et al. The chemokine system in diverse forms of macrophage activation and polarization. Trends Immunol 25 , 677-686 (2004). https://doi.org:10.1016/j.it.2004.09.015 Fujisaka, S. The role of adipose tissue M1/M2 macrophages in type 2 diabetes mellitus. Diabetol Int 12 , 74-79 (2021). https://doi.org:10.1007/s13340-020-00482-2 Yang, X., Zhang, X., Heckmann, B. L., Lu, X. & Liu, J. Relative contribution of adipose triglyceride lipase and hormone-sensitive lipase to tumor necrosis factor-α (TNF-α)-induced lipolysis in adipocytes. J Biol Chem 286 , 40477-40485 (2011). https://doi.org:10.1074/jbc.M111.257923 Langin, D. & Arner, P. Importance of TNFalpha and neutral lipases in human adipose tissue lipolysis. Trends Endocrinol Metab 17 , 314-320 (2006). https://doi.org:10.1016/j.tem.2006.08.003 Rydén, M. & Arner, P. Tumour necrosis factor-alpha in human adipose tissue -- from signalling mechanisms to clinical implications. J Intern Med 262 , 431-438 (2007). https://doi.org:10.1111/j.1365-2796.2007.01854.x Nguyen, M. T. et al. A subpopulation of macrophages infiltrates hypertrophic adipose tissue and is activated by free fatty acids via Toll-like receptors 2 and 4 and JNK-dependent pathways. J Biol Chem 282 , 35279-35292 (2007). https://doi.org:10.1074/jbc.M706762200 Weisberg, S. P. et al. Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 112 , 1796-1808 (2003). https://doi.org:10.1172/jci19246 Perry, R. J. et al. Hepatic acetyl CoA links adipose tissue inflammation to hepatic insulin resistance and type 2 diabetes. Cell 160 , 745-758 (2015). https://doi.org:10.1016/j.cell.2015.01.012 Shi, Y. & Massagué, J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113 , 685-700 (2003). https://doi.org:10.1016/s0092-8674(03)00432-x Massagué, J. & Sheppard, D. TGF-β signaling in health and disease. Cell 186 , 4007-4037 (2023). https://doi.org:10.1016/j.cell.2023.07.036 Roh, H. C. et al. Adipocytes fail to maintain cellular identity during obesity due to reduced PPARγ activity and elevated TGFβ-SMAD signaling. Mol Metab 42 , 101086 (2020). https://doi.org:10.1016/j.molmet.2020.101086 Lefterova, M. I., Haakonsson, A. K., Lazar, M. A. & Mandrup, S. PPARγ and the global map of adipogenesis and beyond. Trends Endocrinol Metab 25 , 293-302 (2014). https://doi.org:10.1016/j.tem.2014.04.001 Mota de Sá, P., Richard, A. J., Hang, H. & Stephens, J. M. Transcriptional Regulation of Adipogenesis. Compr Physiol 7 , 635-674 (2017). https://doi.org:10.1002/cphy.c160022 Nawaz, A. et al. Depletion of CD206(+) M2-like macrophages induces fibro-adipogenic progenitors activation and muscle regeneration. Nat Commun 13 , 7058 (2022). https://doi.org:10.1038/s41467-022-34191-y Takikawa, A. et al. HIF-1α in Myeloid Cells Promotes Adipose Tissue Remodeling Toward Insulin Resistance. Diabetes 65 , 3649-3659 (2016). https://doi.org:10.2337/db16-0012 Fujisaka, S. et al. Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced obese mice. Diabetes 58 , 2574-2582 (2009). https://doi.org:10.2337/db08-1475 Additional Declarations No competing interests reported. Supplementary Files SupplymentaryFigures.pptx SupplementaryTable.docx Cite Share Download PDF Status: Published Journal Publication published 17 Jan, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 18 Aug, 2024 Reviews received at journal 17 Aug, 2024 Reviewers agreed at journal 06 Aug, 2024 Reviews received at journal 06 Aug, 2024 Reviewers agreed at journal 24 Jul, 2024 Reviewers invited by journal 15 Jul, 2024 Editor assigned by journal 15 Jul, 2024 Editor invited by journal 07 Jul, 2024 Submission checks completed at journal 05 Jul, 2024 First submitted to journal 02 Jul, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4672547","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":333288508,"identity":"a0db4692-75d6-442b-b294-08448c6f01ab","order_by":0,"name":"Nguyen Quynh Phuong","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Nguyen","middleName":"Quynh","lastName":"Phuong","suffix":""},{"id":333288509,"identity":"8be43d29-8af2-4bec-95b0-c115c3d8fb53","order_by":1,"name":"Muhammad Bilal","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"","lastName":"Bilal","suffix":""},{"id":333288510,"identity":"12b9fb85-df33-48e1-b1ff-7cddec60aa0a","order_by":2,"name":"Allah Nawaz","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Allah","middleName":"","lastName":"Nawaz","suffix":""},{"id":333288511,"identity":"da66dfd2-5e8a-4d74-b459-d66209d879f2","order_by":3,"name":"Le Duc Anh","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Le","middleName":"Duc","lastName":"Anh","suffix":""},{"id":333288512,"identity":"57907be4-c414-4827-ab82-ac71ca5e4ab4","order_by":4,"name":"Memoona Memoona","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Memoona","middleName":"","lastName":"Memoona","suffix":""},{"id":333288513,"identity":"db055bd6-2ab8-4d9c-b8ad-91dec2fc7a65","order_by":5,"name":"Muhammad Rahil Aslam","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Rahil","lastName":"Aslam","suffix":""},{"id":333288514,"identity":"40be0bcd-7511-4626-803e-dd40509230fb","order_by":6,"name":"Sana Khalid","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Sana","middleName":"","lastName":"Khalid","suffix":""},{"id":333288515,"identity":"798e4d9e-82d0-4eda-9035-fc79a71846dd","order_by":7,"name":"Tomonobu Kado","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Tomonobu","middleName":"","lastName":"Kado","suffix":""},{"id":333288516,"identity":"d6c999d3-c5c1-43c1-9052-81e343f919ab","order_by":8,"name":"Yoshiyuki Watanabe","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Yoshiyuki","middleName":"","lastName":"Watanabe","suffix":""},{"id":333288517,"identity":"d87c1e71-7fb6-4c14-bc3b-aec03c5b7200","order_by":9,"name":"Ayumi Nishimura","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Ayumi","middleName":"","lastName":"Nishimura","suffix":""},{"id":333288518,"identity":"6e3d2d6d-da45-4e2e-9f66-d20cfa039318","order_by":10,"name":"Yoshiko Igarashi","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Yoshiko","middleName":"","lastName":"Igarashi","suffix":""},{"id":333288520,"identity":"b97cb8e5-7b2d-4f59-863d-fcd75bf02edb","order_by":11,"name":"Keisuke Okabe","email":"","orcid":"","institution":"Toyama University Hospital","correspondingAuthor":false,"prefix":"","firstName":"Keisuke","middleName":"","lastName":"Okabe","suffix":""},{"id":333288523,"identity":"d4e75bef-5d76-4bc1-832c-72ee183745e8","order_by":12,"name":"Kenichi Hirabayashi","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Kenichi","middleName":"","lastName":"Hirabayashi","suffix":""},{"id":333288524,"identity":"5b1f6c33-832a-424c-82cd-033528fc75b2","order_by":13,"name":"Seiji Yamamoto","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Seiji","middleName":"","lastName":"Yamamoto","suffix":""},{"id":333288526,"identity":"2969a784-db48-4723-af58-7c8c9118e7b4","order_by":14,"name":"Takashi Nakagawa","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Takashi","middleName":"","lastName":"Nakagawa","suffix":""},{"id":333288527,"identity":"ceb6719e-478a-4a2b-94bf-8305203374b3","order_by":15,"name":"Hisashi Mori","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Hisashi","middleName":"","lastName":"Mori","suffix":""},{"id":333288528,"identity":"19d84b3a-dd11-4104-9a31-f148fdb6b6cc","order_by":16,"name":"Isao Usui","email":"","orcid":"","institution":"Dokkyo Medical University","correspondingAuthor":false,"prefix":"","firstName":"Isao","middleName":"","lastName":"Usui","suffix":""},{"id":333288529,"identity":"43e2be9c-3080-4b58-a26a-bb40c68cd5ba","order_by":17,"name":"Shiho Fujisaka","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Shiho","middleName":"","lastName":"Fujisaka","suffix":""},{"id":333288530,"identity":"0271a52f-3ffd-4fde-a5fe-a8252da3ed74","order_by":18,"name":"Ryuji Hayashi","email":"","orcid":"","institution":"University of Toyama","correspondingAuthor":false,"prefix":"","firstName":"Ryuji","middleName":"","lastName":"Hayashi","suffix":""},{"id":333288532,"identity":"bee5a061-a9a9-44a8-9c44-34af26c17ee7","order_by":19,"name":"Kazuyuki Tobe","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+ElEQVRIiWNgGAWjYFACHgaGDwwMjA0Yorg18DAwzoBoQdZGQAszD6YWPMCevffgY9scG9kGiQT2Bx/b7KL5G5gffmCQuYPbFp5zyca529KMgVoYG2e2JefOOMBmLMHA8wy3FokcM+ncbYcTGyTyPzbztjHnNhxgMAOKH8anxfy35bb/iSBbgFrqc+cfYP9GSIsZM+O2AzAth3M3HOAhYMuZc8mSvduSjdt4HjDOnHHueO7GwzzFEgl4/MLe3nvww89tdrL97AkMHz6UVefOO96+8cPHHtwhBgdsIIIRRDIDcWLPAcJaIOAPjPGDaC2jYBSMglEw/AEAv2lTU5zicQMAAAAASUVORK5CYII=","orcid":"","institution":"University of Toyama","correspondingAuthor":true,"prefix":"","firstName":"Kazuyuki","middleName":"","lastName":"Tobe","suffix":""}],"badges":[],"createdAt":"2024-07-02 08:11:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4672547/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4672547/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-81917-7","type":"published","date":"2025-01-17T15:57:51+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":61392021,"identity":"980d0c66-b09d-4caf-8085-d86aa57f79c8","added_by":"auto","created_at":"2024-07-30 08:14:38","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1775753,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTgf-β1 gene successfully deleted in our mouse model. \u003c/strong\u003e(A)Mouse model, (B) Schematic of the experiment protocol, (C) Relative Tgf-β1 expression in eWAT whole tissue (n=5,5), (D) Representative confocal imagesindicates Tgf-β1co-localization with CD206 (scale bar = 20μm, n=4,4), (E) Quantification of Tgf-β1 +CD206 + / total CD206 + (n=4,4).\u003c/p\u003e\n\u003cp\u003eData represent mean ± SEM. Statistical analysis was performed using a two-tail Student's \u003cem\u003et\u003c/em\u003e-test (*p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ***p\u0026lt;0,0001)\u003c/p\u003e","description":"","filename":"MainFigures1.png","url":"https://assets-eu.researchsquare.com/files/rs-4672547/v1/f71565ad22f93b29d38e28c5.png"},{"id":61392011,"identity":"ea4dfbae-b938-4cf6-8771-659d3ec2908c","added_by":"auto","created_at":"2024-07-30 08:14:38","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":511722,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDeleting the Tgf-β1 gene derived from CD206+M2 macrophage improved glucose metabolism and insulin sensitivity.\u003c/strong\u003e (A) Glucose tolerance test (n=11,11). (B) Area under the curve (AUC) of glucose tolerance test (n=11,11), (C) Insulin tolerance test (H) (n=11,11), (D) Area under the curve (AUC) of insulin tolerance test (n=11,11), (E) Relative mRNA expression of metabolically favorable genes (n=6,6), (F) Relative mRNA expression of adipogenesis-related genes in eWAT whole tissue (n= 6,6)\u003c/p\u003e\n\u003cp\u003eA, C: Data represent mean ± SEM. Statistical analysis was performed using two-way ANOVA ( **p \u0026lt; 0.01, ****p\u0026lt;0,0001),\u003c/p\u003e\n\u003cp\u003eB, D, E, F: Data represent mean ± SEM. Statistical analysis was performed using a two-tail Student's t-test (*p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ***p\u0026lt;0,0001)\u003c/p\u003e","description":"","filename":"MainFigures3.png","url":"https://assets-eu.researchsquare.com/files/rs-4672547/v1/f3de04ad68fc97ddf62fbdc8.png"},{"id":61392018,"identity":"7202df56-3c13-4843-ab25-2efd9c791c11","added_by":"auto","created_at":"2024-07-30 08:14:38","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2966254,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLack of CD206+M2 macrophage-derived Tgf-β1 gene generated smaller adipocytes. \u003c/strong\u003e(A) Relative mRNAexpression of M1, M2 macrophages-related genes in eWAT whole tissue (n= 5,5), (B) Relative mRNAexpression of small adipocyte-related genes in eWAT whole tissue (n= 6,6), (C) Representative images stain with hematoxylin and eosin (H\u0026amp;E) from eWAT (scale bar = 200μm, n=4,4), (D) Quantification of adipocyte cells between Tgf-β1f/fand Tgf-β1 KO (n=4,4), (E) Frequency distribution of adipocyte size (area μm2) in Tgf-β1f/fand Tgf-β1 KO (n=4,4), (F) Quantification of adipocyte size compared Tgf-β1f/fand Tgf-β1 KO (n=4,4)\u003c/p\u003e\n\u003cp\u003eData represent mean ± SEM. Statistical analysis was performed using a two-tail Student's t-test (*p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ***p\u0026lt;0,0001)\u003c/p\u003e","description":"","filename":"MainFigures5.png","url":"https://assets-eu.researchsquare.com/files/rs-4672547/v1/72a83b071c5cf8f516c6bb95.png"},{"id":61392926,"identity":"558c9dfb-6756-453a-8314-8b68c3e33ece","added_by":"auto","created_at":"2024-07-30 08:22:38","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2019160,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCD206+M2 macrophage-derived Tgf-β1 gene deletion enhanced APs proliferation. \u003c/strong\u003e(A) Relative mRNA expression analysis of cell cycle-related genes in SVF from eWAT (n=6,6), (B) Schematic for magnetic activated cell sorting Pdfgrα+ cells from SVF of eWAT, (C) Relative mRNA expression analysis of cell cycle-related genes in PDGFRα+ cells from eWAT (n=3,3), (D) Representative confocal imagesindicate PDGFRαco-localization with mKi67 (scale bar = 20μm, n=4,4), (E) Quantification ofPDGFRα+ mKi-67+ DAPl+ (n=4,4). Data represent mean ± SEM. Statistical analysis was performed using a two-tail Student's \u003cem\u003et\u003c/em\u003e-test (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **p\u0026lt;0.01)\u003c/p\u003e\n\u003cp\u003ePDGFRα: Platelet-derived growth factor receptor alpha\u003c/p\u003e","description":"","filename":"MainFigures7.png","url":"https://assets-eu.researchsquare.com/files/rs-4672547/v1/ee5997f33c93b0384bf1d5c0.png"},{"id":61392020,"identity":"4657a17d-70a0-42a6-8448-2fa21a9f4863","added_by":"auto","created_at":"2024-07-30 08:14:38","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":841904,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eImpact of CD206+M2 macrophage-derived Tgf-β1 gene on APs differentiation. \u003c/strong\u003e(A) Relative mRNA expression analysis of adipocyte progenitors-related genes (APs) in SVF from eWAT (n=6,6), (B) Relative mRNA expression analysis of adipocyte progenitors (APs) in Pdfgrα+ cells from eWAT (n=3,3), (C) Flow cytometry analysis of adipocyte progenitors-related genes in SVF from eWAT (n=5,5), (D) Percentage of adipocyte progenitors in SVF from eWAT (n=5,5)\u003c/p\u003e\n\u003cp\u003eData represent mean ± SEM. Statistical analysis was performed using a two-tail Student's \u003cem\u003et\u003c/em\u003e-test (*\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **p\u0026lt;0.01)\u003c/p\u003e","description":"","filename":"MainFigures9.png","url":"https://assets-eu.researchsquare.com/files/rs-4672547/v1/e058fbd7149a09bafa114176.png"},{"id":61392927,"identity":"17584177-8137-4408-ae62-49c411db63ce","added_by":"auto","created_at":"2024-07-30 08:22:38","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":905930,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical Abstract\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"MainFigures11.png","url":"https://assets-eu.researchsquare.com/files/rs-4672547/v1/5720fe8f1eca21970f62dbe9.png"},{"id":74284688,"identity":"0af3ddc3-f080-4a06-9557-34f9dd047a99","added_by":"auto","created_at":"2025-01-20 16:10:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":11104038,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4672547/v1/a786a664-4ecb-4ccf-874c-ecd91fa68c87.pdf"},{"id":61392023,"identity":"4528c069-65c1-46a1-b572-b917499f8e84","added_by":"auto","created_at":"2024-07-30 08:14:39","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1074722,"visible":true,"origin":"","legend":"","description":"","filename":"SupplymentaryFigures.pptx","url":"https://assets-eu.researchsquare.com/files/rs-4672547/v1/be7e42658ead490403b09f71.pptx"},{"id":61392016,"identity":"8ebb8958-852d-4e32-91ea-09feb2e3553a","added_by":"auto","created_at":"2024-07-30 08:14:38","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":26404,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable.docx","url":"https://assets-eu.researchsquare.com/files/rs-4672547/v1/297a45c4a112907b6a2562c6.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Role of transforming growth factor-β1 in regulating adipocyte progenitors","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAdipose tissue (AT) metabolism involves coordinating various cells and cellular processes to regulate energy storage, release, and overall metabolic homeostasis. AT includes adipocytes, a stromal vascular fraction (SVF), and an extracellular matrix. Excess nutrients are associated with an expansion of white adipose tissue (WAT) \u003csup\u003e\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e, leading to adipose tissue (AT) dysfunction, insulin resistance, type 2 diabetes, and other metabolic disorders \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. WAT expands in two ways: adipocyte hypertrophy (increased adipocyte size) or adipocyte hyperplasia (\u003cem\u003ede novo\u003c/em\u003e adipogenesis) \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e,\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. The expansion of adipocytes is closely related to SVF. SVF, which is located in the connective tissue surrounding adipocytes, contains heterogeneous cell populations such as adipocyte progenitors (APs) and immune cells. A large number of APs, which give rise to mature adipocytes with a higher number of smaller adipocytes, preserves AT function and enhances insulin sensitivity \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Epididymal WAT (eWAT), a major visceral WAT depot, has the function of energy storage and expands through cellular hypertrophy, increasing inflammation and inflammatory cytokine and leading to insulin resistance \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Thus, ameliorating the expansion of eWAT brings a promising therapy for obesity-related disorders.\u003c/p\u003e \u003cp\u003eWAT is a source of adipokines, including immune modulatory cytokines, chemokines, and growth hormones. M1-polarized macrophages provide acute pro-inflammatory effector functions by expressing reactive oxygen species, nitric oxide, and secretion of type-1 cytokines such as TNF-α, IFN-γ, and interleukin 1 beta (IL-1β). Previous studies demonstrated that M1 marker genes such as tumor necrosis factor-alpha (TNFα), C-C motif chemokine receptor (CCR) 2, or CD11c resulted in the development of insulin resistance \u003csup\u003e\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. In contrast, macrophages are activated towards M2 polarization characterized by the relatively high expression of CD206, arginase-1, Mgl1, and IL-10, which are involved in the repair or remodeling of tissues \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. A recent study reported that depletion of CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage improves glucose and insulin metabolism \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Another study showed that ablation of IL10 secreted from macrophages protects from obesity development \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. However, the role of transforming growth factor-β1 (Tgf-β1), a cytokine abundantly expressed in CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage within adipose tissue and correlated with the expansion of AT and fibrosis \u003csup\u003e\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, in AT metabolism remains unknown.\u003c/p\u003e \u003cp\u003ePrecious study reported that Tgf-β signaling induces hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, suggesting the essential role of Tgf-β1 in regulating APs to respond with adipocyte expansion. Thus, we hypothesize that deletion of Tgf-β1 gene-specific from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophages might improve glucose metabolism and insulin sensitivity by enhancing adipogenesis via stimulating APs proliferation and differentiation.\u003c/p\u003e"},{"header":"Results","content":"\n\u003ch3\u003e1. The Tgf-β1 gene was successfully deleted in our mouse model.\u003c/h3\u003e\n\u003cp\u003eTo investigate the role of the Tgf-β1 gene in CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage, we used the mice CD206CreER\u003csup\u003eT\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e; Tgf-β1\u003csup\u003ef/f\u003c/sup\u003e in which Tgf-β1 gene was conditionally deleted from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage by tamoxifen treatment as schema in Fig.\u0026nbsp;1A. To investigate the role of the Tgf-β1 gene, 18-week-old mice were administered tamoxifen (TAM) for 5 consecutive days. After 1 week of recovery, we performed GTT and ITT. Finally, mice were sacrificed at 22 weeks as the schematic protocol described in Fig.\u0026nbsp;1B. Before and after 5 times TAM treatment, the body weights of both groups were comparable (Supplementary Fig.\u0026nbsp;1A-B). From 6 weeks to 18 weeks of normal chow diet, both food intake and body weight also showed no significant difference between the two groups (Supplementary Fig.\u0026nbsp;1C-D). When sacrificed, body weight, eWAT, and inguinal white adipose tissue (iWAT) were also comparable between both groups (Supplementary Fig.\u0026nbsp;2A-C). To evaluate our mouse model, we examined Tgf-β1 gene expression and found it downregulated significantly in the eWAT whole tissue of Tgf-β1 KO mice (Fig.\u0026nbsp;1C). For further confirmation, we performed immunohistochemistry stained with anti-CD206 and anti-Tgf-β1. The result revealed that CD206 and Tgf-β1 double-positive expression was reduced significantly in Tgf-β1 KO mice (Fig.\u0026nbsp;1D-E). Collectively, our data confirmed that the Tgf-β1 gene was successfully deleted in CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage in our mouse model.\u003c/p\u003e\n\u003ch3\u003e2. Deleting the Tgf-β1 gene in CD206 M2 macrophage improves glucose metabolism and insulin sensitivity.\u003c/h3\u003e\n\u003cp\u003eWe next investigate whether deleting the Tgf-β1 gene derived from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage affects glucose and insulin metabolism. As expected, in GTT, we found glucose levels were lower in Tgf-β1 KO mice (Fig.\u0026nbsp;2A), and the area under the GTT curve was also significantly lower in Tgf-β1 KO mice (Fig.\u0026nbsp;2B). We also found that ITT was improved in Tgf-β1 KO mice (Fig.\u0026nbsp;2C-D), suggesting Tgf-β1 KO enhances glucose metabolism and insulin sensitivity. Consistent with this, gene analysis revealed that all metabolically favorable genes\u0026rsquo; expressions were upregulated significantly in Tgf-β1 KO mice (Fig.\u0026nbsp;2E). In addition, we also found that the expression of adipogenesis-related genes was elevated significantly in Tgf-β1 KO mice (Fig.\u0026nbsp;2F). Collectively, our data demonstrated that Tgf-β1 deletion in CD206 M2\u003csup\u003e+\u003c/sup\u003e macrophage improved glucose metabolism and insulin sensitivity.\u003c/p\u003e\n\u003ch3\u003e3. Lack of CD206 M2 macrophage-derived Tgf-β1 gene generates smaller adipocytes.\u003c/h3\u003e\n\u003cp\u003eWe further aimed to find the mechanism behind the lack of the Tgf-β1 gene to promote glucose and insulin tolerance. Previous studies reported that M1 pro-inflammatory marker genes are involved in insulin resistance \u003csup\u003e\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. M2 macrophages are reported to maintain homeostasis and adapt to energy surplus conditions \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Thus, we examine whether macrophage remodeling was responsible for the improvement. However, we found no significant difference in M1 and M2 macrophage-related gene expression between both groups (Fig.\u0026nbsp;3A). We next confirmed the CD206\u003csup\u003e+\u003c/sup\u003e signal by immunohistochemistry and found that there were no significant differences between both groups (Supplementary Fig.\u0026nbsp;3), suggesting that there was no macrophage remodeling in response to Tgf-β1 gene deletion under normal chow conditions. Another report demonstrated that hyperplasia was involved in insulin sensitivity \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Our data reported that the adipogenesis marker (\u003cem\u003eC/EBPα, Pparγ\u003c/em\u003e) was elevated significantly in Tgf-β1 KO mice (Fig.\u0026nbsp;2E). We next investigated small adipocyte-related gene expression and found that it was elevated dramatically in Tgf-β1 KO mice (Fig.\u0026nbsp;3B). As expected, we found that Tgf-β1 KO increased smaller adipocytes with an elevated number of adipocytes and reduced average adipocyte size (Fig.\u0026nbsp;3B-E). Collectively, our data demonstrated that deletion of Tgf-β1 in CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage stimulated adipogenesis and generated smaller adipocytes.\u003c/p\u003e\n\u003ch3\u003e4. CD206 M2 macrophage-derived Tgf-β1 gene deletion enhanced APs proliferations.\u003c/h3\u003e\n\u003cp\u003eAPs are the population that gives rise to mature adipocytes. TGF-β signaling was reported to control cell proliferation \u003csup\u003e\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Other studies also reported that TGF-β signaling induces hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Therefore, we hypothesize that the APs pool was hibernated by CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage-derived Tgf-β1 gene, thus Tgf-β1 gene deletion stimulated APs proliferation. We investigated the cell cycle-related genes in SVF of eWAT and found that the expression of \u003cem\u003emKi-67\u003c/em\u003e and \u003cem\u003ecyclin d1\u003c/em\u003e were increased significantly (Fig.\u0026nbsp;4A). Platelet-derived growth factor receptor alpha (PDGFRα) is a marker of APs and preadipocytes that can differentiate into functional adipocytes \u003cem\u003ein vivo\u003c/em\u003e \u003csup\u003e\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. We next isolated PDGFRα\u003csup\u003e+\u003c/sup\u003e cells using magnetic-activated cell sorting (MACS) (Fig.\u0026nbsp;4B) from eWAT then examined cell cycle-related gene expression and found that almost genes elevated dramatically (Fig.\u0026nbsp;4C). We next examined immunohistochemistry by staining with anti-Ki-67 and anti-PDGFRα and found that PDGFRα\u003csup\u003e+\u003c/sup\u003eKi-67\u003csup\u003e+\u003c/sup\u003eDAPI\u003csup\u003e+\u003c/sup\u003e signals were significantly elevated in Tgf-β1 KO mice (Fig.\u0026nbsp;4D, E). Our data demonstrated that deletion of the Tgf-β1 gene in CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage stimulated APs proliferation.\u003c/p\u003e\n\u003ch3\u003e5. Impact of CD206 M2 macrophage-derived Tgf-β1 gene on APs differentiation.\u003c/h3\u003e\n\u003cp\u003eA previous study reported that the TGF-β family inhibits Dpp4\u0026thinsp;+\u0026thinsp;APs, stem cell-like progenitors, from differentiating into Icam1\u003csup\u003e+\u003c/sup\u003e APs, committed preadipocytes \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Thus, we hypothesize that Tgf-β1 also inhibited APs differentiation. We examined APs-related gene expression and found that almost all genes were increased significantly in the SVF of Tgf-β1 KO mice (Fig.\u0026nbsp;5A). We further confirmed the expression of APs-related genes and also found that almost all genes were elevated significantly in Pdgfrα\u003csup\u003e+\u003c/sup\u003e cells of Tgf-β1 KO mice (Fig.\u0026nbsp;5B). We next performed flow cytometry using the strategy described in Supplementary Fig.\u0026nbsp;4. Consistent with previous data, we found the significant upregulation of Dpp4 and Icam1 double-positive cells in Tgf-β1 KO mice, suggesting the shifting from stem cell-like progenitors to committed adipocytes, resulting in generating more small adipocytes (Fig.\u0026nbsp;5C-D). Collectively, our data demonstrated that Tgf-β1 gene deletion stimulated stem cell-like progenitors to differentiate into committed preadipocytes, thus generating smaller mature adipocytes, stimulating the expression of metabolically favorable genes, and finally improving glucose metabolism and insulin sensitivity.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAdipose tissue metabolism involves coordinating various cells and cellular processes to regulate energy storage, release, and overall metabolic homeostasis. These include adipocytes, preadipocytes/adipocyte progenitors (APs), endothelial cells, and immune cells. Therein, macrophages have an essential role in regulating homeostasis and AT metabolism. AT macrophages (ATMs) maintain tissue homeostasis by scavenging debris, pathogens, and apoptotic or necrotic cells; this efferocytotic process maintains an anti-inflammatory environment \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. ATMs show highly heterogeneous characteristics and include at least two major populations called the classically activated, or M1, ATMs and alternatively activated, or M2, ATMs \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. M1 macrophages are mainly induced by Th1 signaling and express high levels of inflammatory cytokines such as TNFα and IL-6, While M2 macrophages are induced by Th2 signaling and are associated with anti-inflammatory reactions \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Previous reports showed that TNFα, a cytokine released from M1 macrophage, increases phosphorylation of PLIN1, promoting basal lipolysis and thus releasing fatty acids (FAs) into plasma \u003csup\u003e\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e–\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. These FAs activate the JNK pathway to increase releasing pro-inflammatory factors, resulting in insulin resistance \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Another cytokine from the M1 macrophage, IL-6, was also reported to increase insulin resistance by promoting lipolysis \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e,\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. M2 macrophages, on the other hand, were reported to be involved in maintaining insulin sensitivity through their anti-inflammatory functions \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e,\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. However, recent reports demonstrated that depletion of CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage or ablation IL10 derived from M2 macrophage leads to improved glucose metabolism and insulin sensitivity, suggesting that not all M2 macrophages were good. From the current study perspective, our data demonstrated that deletion of the Tgf-β1 gene, a cytokine mainly secreted from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage, improves glucose and insulin sensitivity without macrophage remodeling.\u003c/p\u003e \u003cp\u003ePrevious studies reported that TGF-β signaling was involved in inducing hibernation of tissue stem cells such as hematopoietic and melanocyte stem cells \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. In addition, Merrick et al. reported that TGF-β signaling inhibits the differentiation from stem cell-like progenitors APs (Dpp4\u003csup\u003e+\u003c/sup\u003eAPs) into committed preadipocytes (Icam1\u003csup\u003e+\u003c/sup\u003eAPs) \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Agreed with them, our data demonstrated that the Tgf-β1 gene-specific from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage kept APs in hibernation and prevented unnecessary cell division and potential cell senescence, resulting in preserving the adipogenic precursor pool. Tgf-β1 transmits its signal to the nucleus through a transcriptional factor called SMAD \u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e,\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. Roh et al. reported that the TGF-β activated SMAD repressor complex downregulates Pparγ at the transcriptional level via histone deacetylation after binding to a novel TGF-β inhibitory element and canonical SMAD-binding elements \u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Agreed with them, we also found that Pparγ, the master regular of adipogenesis \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e,\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e, expression was elevated in response to Tgf-β1 gene deletion, suggesting that Tgf-β1 controls the APs pool via interacting with Pparγ.\u003c/p\u003e \u003cp\u003eIn conclusion, our study brings a new perspective that Tgf-β1 gene deletion specific from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage promotes adipocyte hyperplasia, improving glucose homeostasis (Fig.\u0026nbsp;6). Thus, deletion of the Tgf-β1 gene derived from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage might be a potential strategy for preventing obesity and type 2 diabetes.\u003c/p\u003e "},{"header":"Material and Methods","content":"\u003cp\u003e \u003cb\u003eMice\u003c/b\u003e \u003c/p\u003e\u003cp\u003eWe generated CD206CreER\u003csup\u003eT\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e; Tgf-β1\u003csup\u003ef/f\u003c/sup\u003e mice by crossing CD206 CreER\u003csup\u003eT\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e mice and Tgf-β1 flox/flox (Tgf-β1\u003csup\u003ef/f\u003c/sup\u003e) as previously described by Nawaz et al \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. All animals were housed, 6 mice in one cage, in a room with the temperature (24\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e2 degrees and humidity (55\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\pm\\:\\)\u003c/span\u003e\u003c/span\u003e5 percentage) were controlled automatically, and the cycle of light/dark was maintained at 12:12 hours. The mice had free access to water ad libitum and food (a normal chow diet: CE-2 CLEA, Japan).\u003c/p\u003e\u003cp\u003e \u003cb\u003eGenotyping\u003c/b\u003e \u003c/p\u003e\u003cp\u003eWhole genomic DNA was obtained by lysis tail tissue with Direct PCR (Tail) lysis solution (Viagen Biotech) and proteinase K (Roche Diagnostics), following the manufacturer's instructions. We performed PCR by using a Tks Gflex DNA polymerase kit from TAKARA (Shiga, Japan) with this crude DNA.\u003c/p\u003e\u003cp\u003ePCR conditions for CD206 CreER\u003csup\u003eT\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e included segment 1: 1 cycle of 94 degrees for 1 minute, segment 2: 30 cycle includes 98 degrees for 10 seconds; 58 degrees for 30 seconds; and 68 degrees for 30 seconds. Then PCR productions were kept at 4 degrees. The expected DNA fragment size is 299 bp. The primers used for PCR had the sequence GGTCGATGCAACGAGTGATGAG\u003c/p\u003e\u003cp\u003e(primer 1) and GTGAAACAGCATTGCTGTCACTTGG (primer 2)\u003c/p\u003e\u003cp\u003eThe PCR condition for Tgf-β1\u003csup\u003ef/f\u003c/sup\u003e included segment 1: 1 cycle of 94 degrees for 1 minute, segment 2: 40 cycle including 98 degrees for 10 seconds; 54 degrees for 30 seconds; and 68 degrees for 30 seconds. Then PCR productions were kept at 4 degrees. The expected DNA fragment sizes of WT and f/f mice were 210 bp and 338 bp, respectively. The primers' sequences were AAGACCTGGGTTGGAAGTG (primer 1) and CTTCTCCGTTTCTCTGTCACCCTAT (primer 2). Both primers for PCR were purchased from Invitrogen™ Life Technology (Tokyo, Japan). Then PCR products were separated using 1.5% Agarose gel (Nippon gel) electrophoresis for 30 minutes. Ethidium bromide (1:1000) was added to visualize DNA on the gel.\u003c/p\u003e\u003cp\u003e \u003cb\u003eTamoxifen administration\u003c/b\u003e \u003c/p\u003e\u003cp\u003eWe used sunflower oil (WAKO) to dissolve tamoxifen (TAM: sigma-Aldrich) incubated at 55 degrees and vortexed every 5 minutes until dissolved. After dissolved, TAM was administered to both Tgf-β1\u003csup\u003ef/f\u003c/sup\u003e and Tgf-β1 KO at the dose of 225mg/kg body weight for five consecutive days, as previously described \u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e at the 18-week-old following schematic protocol in Fig.\u0026nbsp;1B.\u003c/p\u003e\u003cp\u003e \u003cb\u003eGlucose tolerance and Insulin tolerance test\u003c/b\u003e \u003c/p\u003e\u003cp\u003eFor the intraperitoneal glucose tolerance test (ip-GTT), the mice were fasted for 5 hours. Glucose was injected into both Tgf-β1 KO and Tgf- β1\u003csup\u003ef/f\u003c/sup\u003e at a dose of 1mg/g body weight. The blood glucose level was measured at 0, 15, 30, 60, 90 and 120 minutes. For the intraperitoneal insulin tolerance test (ip- ITT), mice were fasting for 4 hours. Both Tgf-β1 KO and Tgf- β1\u003csup\u003ef/f\u003c/sup\u003e mice were injected with human insulin (Humalin R) with a dose of 0.8 units/g. The blood glucose level was measured at 0, 15, 30, 45, 60, 90, and 120 minutes. In both ip-GTT and ip-ITT, the blood glucose level was taken from the tail vein using the STAT STRIP Express 900 (Nova Biomedical, Waltham, MA).\u003c/p\u003e\u003cp\u003e \u003cb\u003eReal-time polymerase chain reaction (RT-PCR)\u003c/b\u003e \u003c/p\u003e\u003cp\u003eeWAT whole tissue was collected and extracted using the Qiagen RNeasy kit following the manufacturer's instructions. The TaKaRa PrimerScript RNA Kit was used following the company's guidance for reverse transcription. The quantitative PCR amplification reaction was performed using gene-specific primers (provided in Supplementary Table S2) and TB Green Fast Premix (Takara, Shiga Japan), followed by the manufacturer's instructions. The relative mRNA expression levels were calculated by \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\varDelta\\:\\varDelta\\:\\)\u003c/span\u003e\u003c/span\u003eCt value and normalized by internal control TF2B or RPL13a.\u003c/p\u003e\u003cp\u003e \u003cb\u003eFlow cytometry analysis\u003c/b\u003e \u003c/p\u003e\u003cp\u003eTo isolate and prepare stromal vascular fraction (SVF) of eWAT \u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e,\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Tissue was collected and digested in collagenase (Sigma) for 45 minutes at 37 degrees before filtering through a 100- µm strainer to harvest a single cell. The 7AAD\u003csup\u003e−\u003c/sup\u003e population was gated to analyze lineage-negative (CD31\u003csup\u003e−\u003c/sup\u003eCD45\u003csup\u003e−\u003c/sup\u003e) populations, followed by Sca1\u003csup\u003e+,\u003c/sup\u003e then separated into \u003cem\u003eDpp4\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e, \u003cem\u003eIcam1\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e,\u003c/sup\u003e and \u003cem\u003eDpp4\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eIcam1\u003c/em\u003e\u003csup\u003e\u003cem\u003e+\u003c/em\u003e\u003c/sup\u003e populations. For justification of the gating strategy, unstained and fluorescence minus one (FMO) were used. All this experiment and cell sorting were performed using BD FACS Aria™ SORP II machine and the FlowJo offline software (v10) to analyze data.\u003c/p\u003e\u003cp\u003e \u003cb\u003eMagnetic-activated cell sorting study\u003c/b\u003e \u003c/p\u003e\u003cp\u003eSVF was dissociated from eWAT tissue as previously described \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. The SVF was processed for magnetic cell sorting with anti-\u003cem\u003ePdgfr\u003c/em\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:\\alpha\\:\\)\u003c/span\u003e\u003c/span\u003e microbeads, then we collected a positive population, extracted RNA, and performed qPCR analysis of adipocyte progenitors and cell cycle. All incubation and procedure were performed at 4 degrees for 10 to 15 minutes following the manufacturer’s instructions. Microbead Kit was purchased from Miltenyi Biotech.\u003c/p\u003e\u003cp\u003e \u003cb\u003eHistology\u003c/b\u003e \u003c/p\u003e\u003cp\u003eAfter collection, tissue was fixed in 4%PFA, and paraffin sections were prepared with 5–10 µm thickness and then mounted on the slide.\u003c/p\u003e\u003cp\u003eFor Hematoxylin and Eosin (H/E staining), the slide was stained with hematoxylin and eosin. Hematoxylin eosin was captured using Keyence BZ-X800 with a 20x lens (scale bar 200 µm).\u003c/p\u003e\u003cp\u003e \u003cb\u003eImmunohistochemistry\u003c/b\u003e \u003c/p\u003e\u003cp\u003eAfter collection, tissue was fixed in 4%PFA, and paraffin sections were prepared with 5–10 µm thickness and then mounted on the slide. As described previously, paraffin-embedded tissue sections were used in immunohistochemical staining. The primary and secondary antibodies are used following the manufacturer's instructions, with the ratio for primary antibody being 1:100, the secondary antibody being 1:250, and DAPI being 1:400. Primary antibodies included CD206, Tgf-β1, PDGFRα, and mKi-67. Secondary antibodies included anti-rabbit, anti-mouse, and anti-goat. All primer sources were provided in Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. All images were taken by an LSM 900 with an Arycan confocal microscope.\u003c/p\u003e\u003cp\u003e \u003cb\u003eQuantification of adipocyte size\u003c/b\u003e \u003c/p\u003e\u003cp\u003eThe number of adipocytes was counted at 3.9x10\u003csup\u003e5\u003c/sup\u003e µm\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e (area). The multi-point tool in ImageJ 1.53a (National Institute of Health, USA) was used for adipocyte counting. The “ Set Scale” function in ImageJ adipocyte size was used to analyze adipocyte size manually. We measured 4 random fields/specimens, with 4 specimens in each group.\u003c/p\u003e\u003cp\u003e \u003cb\u003eStatistical Analysis\u003c/b\u003e \u003c/p\u003e\u003cp\u003eStatistical significance between the Tgf-β1 KO and Tgf-β1\u003csup\u003ef/f\u003c/sup\u003e group was performed using two-way ANOVA followed by the Sidak multiple comparison test for GTT and ITT. Other data used two-tail unpaired Student’s t-test, *p \u0026lt; 0.05, ** p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001. Data are expressed as mean ± SEM.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll procedures were conducted in accordance with ARRIVE guidelines.\u0026nbsp;All experiments and procedures were approved by the Animal Care Committee of the University of Toyama (Approved number A2023MED-16).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eN.Q.P and M.B. contributed equally, performed all experiments, acquired the data, and wrote the manuscript. M.B., A.N., and K.T. generate the hypothesis. T.K., Y.I., and H.M., generated mice. M.M., S.K., L.D.A., M.R.A., Ay.N. Y.W., Y.I. helped perform genotype and RT-qPCR analysis. K.O., A.N., I.U., and S.F. helped with manuscript writing. S.Y., K.H., help in performing histology. T.N, H.M. and R.H. helped in the discussion. K.T. supervised the project.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by Moonshot R\u0026amp;D (Grant numbers JPMJMS2021). This study was also supported by Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS) (24K02502 to K. T, 22K203737 and 24K19282 to M.B, 21K16338 and 23KJ1022 to Y.I, 22K16423 and 24K19303 to A.Nishimura, 22K16424 to Y.W.). Research Grants from The Uehara Memorial Foundation 2023 to K.T, Eli Lilly Japan KK Innovation Research Grant 2023 to K.T., and a grant from Suzuken Memorial Foundation to M.B. This work was also supported by the Young Research Grant from the Japan Diabetes Society (to A.N., T.K. and A. Nishimura), and a grant from the Japan Foundation for Applied Enzymology (a grant for Front Runner of Future Diabetes Research to M.B., A.N. and T.K.). This work was also supported by Grant from The Naito Foundation (2021-2023) to Y.I., \u0026nbsp;Japan Diabetes Foundation to S.F., T.K. and A. Nishimura, Japan Society for the Study of Obesity (JASSO) to S.F., First Bank of Toyama Scholarship Foundation to S. F., Yamaguchi Endocrine Research Foundation to S.F., Japan Association for Diabetes Education and Care to S.F., a grant from Boehringer Ingelheim to T.K., \u0026nbsp;a grant from \u0026nbsp;Novo Nordisk Pharma to A. Nishimura., a grant from Lotte Foundation to Y.W., Hokugin Young Researchers Grant to Y.W., \u0026nbsp;ONO Medical Research Foundation to T.K., and a grant for Young Researchers from Japan Association for Diabetes Education and Care to T.K.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eCONFLICT OF INTEREST\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have no declared conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data generated for all figures and supplementary figures of this study are provided in the Source data file.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBl\u0026uuml;her, M. Obesity: global epidemiology and pathogenesis. \u003cem\u003eNat Rev Endocrinol\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 288-298 (2019). https://doi.org:10.1038/s41574-019-0176-8\u003c/li\u003e\n\u003cli\u003eSakers, A., De Siqueira, M. K., Seale, P. \u0026amp; Villanueva, C. J. Adipose-tissue plasticity in health and disease. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e185\u003c/strong\u003e, 419-446 (2022). https://doi.org:10.1016/j.cell.2021.12.016\u003c/li\u003e\n\u003cli\u003eKahn, C. R., Wang, G. \u0026amp; Lee, K. Y. Altered adipose tissue and adipocyte function in the pathogenesis of metabolic syndrome. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e129\u003c/strong\u003e, 3990-4000 (2019). https://doi.org:10.1172/jci129187\u003c/li\u003e\n\u003cli\u003eSun, K., Kusminski, C. M. \u0026amp; Scherer, P. E. Adipose tissue remodeling and obesity. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e121\u003c/strong\u003e, 2094-2101 (2011). https://doi.org:10.1172/jci45887\u003c/li\u003e\n\u003cli\u003eKlein, S., Gastaldelli, A., Yki-J\u0026auml;rvinen, H. \u0026amp; Scherer, P. E. Why does obesity cause diabetes? \u003cem\u003eCell Metab\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 11-20 (2022). https://doi.org:10.1016/j.cmet.2021.12.012\u003c/li\u003e\n\u003cli\u003eWang, Q. A., Tao, C., Gupta, R. K. \u0026amp; Scherer, P. E. Tracking adipogenesis during white adipose tissue development, expansion and regeneration. \u003cem\u003eNat Med\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 1338-1344 (2013). https://doi.org:10.1038/nm.3324\u003c/li\u003e\n\u003cli\u003eGhaben, A. L. \u0026amp; Scherer, P. E. Adipogenesis and metabolic health. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 242-258 (2019). https://doi.org:10.1038/s41580-018-0093-z\u003c/li\u003e\n\u003cli\u003eNawaz, A.\u003cem\u003e et al.\u003c/em\u003e CD206(+) M2-like macrophages regulate systemic glucose metabolism by inhibiting proliferation of adipocyte progenitors. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 286 (2017). https://doi.org:10.1038/s41467-017-00231-1\u003c/li\u003e\n\u003cli\u003eJoe, A. W., Yi, L., Even, Y., Vogl, A. W. \u0026amp; Rossi, F. M. Depot-specific differences in adipogenic progenitor abundance and proliferative response to high-fat diet. \u003cem\u003eStem Cells\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 2563-2570 (2009). https://doi.org:10.1002/stem.190\u003c/li\u003e\n\u003cli\u003eBilal, M.\u003cem\u003e et al.\u003c/em\u003e Fate of adipocyte progenitors during adipogenesis in mice fed a high-fat diet. \u003cem\u003eMol Metab\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 101328 (2021). https://doi.org:10.1016/j.molmet.2021.101328\u003c/li\u003e\n\u003cli\u003eUysal, K. T., Wiesbrock, S. M., Marino, M. W. \u0026amp; Hotamisligil, G. S. Protection from obesity-induced insulin resistance in mice lacking TNF-alpha function. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e389\u003c/strong\u003e, 610-614 (1997). https://doi.org:10.1038/39335\u003c/li\u003e\n\u003cli\u003eWeisberg, S. P.\u003cem\u003e et al.\u003c/em\u003e CCR2 modulates inflammatory and metabolic effects of high-fat feeding. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e116\u003c/strong\u003e, 115-124 (2006). https://doi.org:10.1172/jci24335\u003c/li\u003e\n\u003cli\u003ePatsouris, D.\u003cem\u003e et al.\u003c/em\u003e Ablation of CD11c-positive cells normalizes insulin sensitivity in obese insulin resistant animals. \u003cem\u003eCell Metab\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 301-309 (2008). https://doi.org:10.1016/j.cmet.2008.08.015\u003c/li\u003e\n\u003cli\u003eLumeng, C. N., Bodzin, J. L. \u0026amp; Saltiel, A. R. Obesity induces a phenotypic switch in adipose tissue macrophage polarization. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e117\u003c/strong\u003e, 175-184 (2007). https://doi.org:10.1172/jci29881\u003c/li\u003e\n\u003cli\u003eLumeng, C. N., DelProposto, J. B., Westcott, D. J. \u0026amp; Saltiel, A. R. Phenotypic switching of adipose tissue macrophages with obesity is generated by spatiotemporal differences in macrophage subtypes. \u003cem\u003eDiabetes\u003c/em\u003e \u003cstrong\u003e57\u003c/strong\u003e, 3239-3246 (2008). https://doi.org:10.2337/db08-0872\u003c/li\u003e\n\u003cli\u003eRajbhandari, P.\u003cem\u003e et al.\u003c/em\u003e IL-10 Signaling Remodels Adipose Chromatin Architecture to Limit Thermogenesis and Energy Expenditure. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e172\u003c/strong\u003e, 218-233.e217 (2018). https://doi.org:10.1016/j.cell.2017.11.019\u003c/li\u003e\n\u003cli\u003eMeng, X. M., Nikolic-Paterson, D. J. \u0026amp; Lan, H. Y. TGF-\u0026beta;: the master regulator of fibrosis. \u003cem\u003eNat Rev Nephrol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 325-338 (2016). https://doi.org:10.1038/nrneph.2016.48\u003c/li\u003e\n\u003cli\u003eSamad, F.\u003cem\u003e et al.\u003c/em\u003e Tumor necrosis factor alpha is a key component in the obesity-linked elevation of plasminogen activator inhibitor 1. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 6902-6907 (1999). https://doi.org:10.1073/pnas.96.12.6902\u003c/li\u003e\n\u003cli\u003eSamad, F., Yamamoto, K., Pandey, M. \u0026amp; Loskutoff, D. J. Elevated expression of transforming growth factor-beta in adipose tissue from obese mice. \u003cem\u003eMol Med\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 37-48 (1997). \u003c/li\u003e\n\u003cli\u003eYamazaki, S.\u003cem\u003e et al.\u003c/em\u003e Nonmyelinating Schwann cells maintain hematopoietic stem cell hibernation in the bone marrow niche. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e147\u003c/strong\u003e, 1146-1158 (2011). https://doi.org:10.1016/j.cell.2011.09.053\u003c/li\u003e\n\u003cli\u003eNishimura, E. K.\u003cem\u003e et al.\u003c/em\u003e Key roles for transforming growth factor beta in melanocyte stem cell maintenance. \u003cem\u003eCell Stem Cell\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 130-140 (2010). https://doi.org:10.1016/j.stem.2009.12.010\u003c/li\u003e\n\u003cli\u003eLumeng, C. N. \u0026amp; Saltiel, A. R. Inflammatory links between obesity and metabolic disease. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e121\u003c/strong\u003e, 2111-2117 (2011). https://doi.org:10.1172/jci57132\u003c/li\u003e\n\u003cli\u003ePollard, J. W. Trophic macrophages in development and disease. \u003cem\u003eNat Rev Immunol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 259-270 (2009). https://doi.org:10.1038/nri2528\u003c/li\u003e\n\u003cli\u003eHuang, S. S. \u0026amp; Huang, J. S. TGF-beta control of cell proliferation. \u003cem\u003eJ Cell Biochem\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 447-462 (2005). https://doi.org:10.1002/jcb.20558\u003c/li\u003e\n\u003cli\u003eZhang, Y., Alexander, P. B. \u0026amp; Wang, X. F. TGF-\u0026beta; Family Signaling in the Control of Cell Proliferation and Survival. \u003cem\u003eCold Spring Harb Perspect Biol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e (2017). https://doi.org:10.1101/cshperspect.a022145\u003c/li\u003e\n\u003cli\u003eMoustakas, A., Pardali, K., Gaal, A. \u0026amp; Heldin, C. H. Mechanisms of TGF-beta signaling in regulation of cell growth and differentiation. \u003cem\u003eImmunol Lett\u003c/em\u003e \u003cstrong\u003e82\u003c/strong\u003e, 85-91 (2002). https://doi.org:10.1016/s0165-2478(02)00023-8\u003c/li\u003e\n\u003cli\u003eFeng, X. H. \u0026amp; Derynck, R. Specificity and versatility in tgf-beta signaling through Smads. \u003cem\u003eAnnu Rev Cell Dev Biol\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 659-693 (2005). https://doi.org:10.1146/annurev.cellbio.21.022404.142018\u003c/li\u003e\n\u003cli\u003eIwayama, T.\u003cem\u003e et al.\u003c/em\u003e PDGFR\u0026alpha; signaling drives adipose tissue fibrosis by targeting progenitor cell plasticity. \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 1106-1119 (2015). https://doi.org:10.1101/gad.260554.115\u003c/li\u003e\n\u003cli\u003eLee, Y. H., Petkova, A. P., Mottillo, E. P. \u0026amp; Granneman, J. G. In vivo identification of bipotential adipocyte progenitors recruited by \u0026beta;3-adrenoceptor activation and high-fat feeding. \u003cem\u003eCell Metab\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 480-491 (2012). https://doi.org:10.1016/j.cmet.2012.03.009\u003c/li\u003e\n\u003cli\u003eMerrick, D.\u003cem\u003e et al.\u003c/em\u003e Identification of a mesenchymal progenitor cell hierarchy in adipose tissue. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e364\u003c/strong\u003e (2019). https://doi.org:10.1126/science.aav2501\u003c/li\u003e\n\u003cli\u003eIgnotz, R. A. \u0026amp; Massagu\u0026eacute;, J. Type beta transforming growth factor controls the adipogenic differentiation of 3T3 fibroblasts. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e82\u003c/strong\u003e, 8530-8534 (1985). https://doi.org:10.1073/pnas.82.24.8530\u003c/li\u003e\n\u003cli\u003eFischer-Posovszky, P., Wang, Q. A., Asterholm, I. W., Rutkowski, J. M. \u0026amp; Scherer, P. E. Targeted deletion of adipocytes by apoptosis leads to adipose tissue recruitment of alternatively activated M2 macrophages. \u003cem\u003eEndocrinology\u003c/em\u003e \u003cstrong\u003e152\u003c/strong\u003e, 3074-3081 (2011). https://doi.org:10.1210/en.2011-1031\u003c/li\u003e\n\u003cli\u003eMantovani, A.\u003cem\u003e et al.\u003c/em\u003e The chemokine system in diverse forms of macrophage activation and polarization. \u003cem\u003eTrends Immunol\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 677-686 (2004). https://doi.org:10.1016/j.it.2004.09.015\u003c/li\u003e\n\u003cli\u003eFujisaka, S. The role of adipose tissue M1/M2 macrophages in type 2 diabetes mellitus. \u003cem\u003eDiabetol Int\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 74-79 (2021). https://doi.org:10.1007/s13340-020-00482-2\u003c/li\u003e\n\u003cli\u003eYang, X., Zhang, X., Heckmann, B. L., Lu, X. \u0026amp; Liu, J. Relative contribution of adipose triglyceride lipase and hormone-sensitive lipase to tumor necrosis factor-\u0026alpha; (TNF-\u0026alpha;)-induced lipolysis in adipocytes. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e286\u003c/strong\u003e, 40477-40485 (2011). https://doi.org:10.1074/jbc.M111.257923\u003c/li\u003e\n\u003cli\u003eLangin, D. \u0026amp; Arner, P. Importance of TNFalpha and neutral lipases in human adipose tissue lipolysis. \u003cem\u003eTrends Endocrinol Metab\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 314-320 (2006). https://doi.org:10.1016/j.tem.2006.08.003\u003c/li\u003e\n\u003cli\u003eRyd\u0026eacute;n, M. \u0026amp; Arner, P. Tumour necrosis factor-alpha in human adipose tissue -- from signalling mechanisms to clinical implications. \u003cem\u003eJ Intern Med\u003c/em\u003e \u003cstrong\u003e262\u003c/strong\u003e, 431-438 (2007). https://doi.org:10.1111/j.1365-2796.2007.01854.x\u003c/li\u003e\n\u003cli\u003eNguyen, M. T.\u003cem\u003e et al.\u003c/em\u003e A subpopulation of macrophages infiltrates hypertrophic adipose tissue and is activated by free fatty acids via Toll-like receptors 2 and 4 and JNK-dependent pathways. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e282\u003c/strong\u003e, 35279-35292 (2007). https://doi.org:10.1074/jbc.M706762200\u003c/li\u003e\n\u003cli\u003eWeisberg, S. P.\u003cem\u003e et al.\u003c/em\u003e Obesity is associated with macrophage accumulation in adipose tissue. \u003cem\u003eJ Clin Invest\u003c/em\u003e \u003cstrong\u003e112\u003c/strong\u003e, 1796-1808 (2003). https://doi.org:10.1172/jci19246\u003c/li\u003e\n\u003cli\u003ePerry, R. J.\u003cem\u003e et al.\u003c/em\u003e Hepatic acetyl CoA links adipose tissue inflammation to hepatic insulin resistance and type 2 diabetes. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e160\u003c/strong\u003e, 745-758 (2015). https://doi.org:10.1016/j.cell.2015.01.012\u003c/li\u003e\n\u003cli\u003eShi, Y. \u0026amp; Massagu\u0026eacute;, J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e113\u003c/strong\u003e, 685-700 (2003). https://doi.org:10.1016/s0092-8674(03)00432-x\u003c/li\u003e\n\u003cli\u003eMassagu\u0026eacute;, J. \u0026amp; Sheppard, D. TGF-\u0026beta; signaling in health and disease. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e186\u003c/strong\u003e, 4007-4037 (2023). https://doi.org:10.1016/j.cell.2023.07.036\u003c/li\u003e\n\u003cli\u003eRoh, H. C.\u003cem\u003e et al.\u003c/em\u003e Adipocytes fail to maintain cellular identity during obesity due to reduced PPAR\u0026gamma; activity and elevated TGF\u0026beta;-SMAD signaling. \u003cem\u003eMol Metab\u003c/em\u003e \u003cstrong\u003e42\u003c/strong\u003e, 101086 (2020). https://doi.org:10.1016/j.molmet.2020.101086\u003c/li\u003e\n\u003cli\u003eLefterova, M. I., Haakonsson, A. K., Lazar, M. A. \u0026amp; Mandrup, S. PPAR\u0026gamma; and the global map of adipogenesis and beyond. \u003cem\u003eTrends Endocrinol Metab\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 293-302 (2014). https://doi.org:10.1016/j.tem.2014.04.001\u003c/li\u003e\n\u003cli\u003eMota de S\u0026aacute;, P., Richard, A. J., Hang, H. \u0026amp; Stephens, J. M. Transcriptional Regulation of Adipogenesis. \u003cem\u003eCompr Physiol\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 635-674 (2017). https://doi.org:10.1002/cphy.c160022\u003c/li\u003e\n\u003cli\u003eNawaz, A.\u003cem\u003e et al.\u003c/em\u003e Depletion of CD206(+) M2-like macrophages induces fibro-adipogenic progenitors activation and muscle regeneration. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 7058 (2022). https://doi.org:10.1038/s41467-022-34191-y\u003c/li\u003e\n\u003cli\u003eTakikawa, A.\u003cem\u003e et al.\u003c/em\u003e HIF-1\u0026alpha; in Myeloid Cells Promotes Adipose Tissue Remodeling Toward Insulin Resistance. \u003cem\u003eDiabetes\u003c/em\u003e \u003cstrong\u003e65\u003c/strong\u003e, 3649-3659 (2016). https://doi.org:10.2337/db16-0012\u003c/li\u003e\n\u003cli\u003eFujisaka, S.\u003cem\u003e et al.\u003c/em\u003e Regulatory mechanisms for adipose tissue M1 and M2 macrophages in diet-induced obese mice. \u003cem\u003eDiabetes\u003c/em\u003e \u003cstrong\u003e58\u003c/strong\u003e, 2574-2582 (2009). https://doi.org:10.2337/db08-1475\u003cbr\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Tgf-β1, CD206+ M2 macrophage, adipocyte progenitors, hyperplasia, adipogenesis","lastPublishedDoi":"10.21203/rs.3.rs-4672547/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4672547/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAdipose tissue (AT) metabolism involves coordinating various cells and cellular processes to regulate energy storage, release, and overall metabolic homeostasis. Therein, macrophage and its cytokine are important in controlling tissue homeostasis. Among cytokines, the role of transforming growth factor-β1 (Tgf-β1), a cytokine abundantly expressed in CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage and correlated with the expansion of AT and fibrosis, in AT metabolism remains unknown. We used CD206CreER\u003csup\u003eT\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e; Tgf-β1\u003csup\u003ef/f\u003c/sup\u003e mouse model in which the Tgf-β1 gene was conditionally deleted in CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophages followed by tamoxifen administration, to investigate the role of the Tgf-β1 gene in glucose and insulin metabolism. Our data demonstrated that lack of CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophages derived Tgf-β1 gene improved glucose metabolism and insulin sensitivity by enhancing adipogenesis via hyperplasia expansion. The Tgf-β1 gene, specifically from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophages, deletion stimulated APs\u0026rsquo; proliferation and differentiation, leading to the generation of smaller mature adipocytes, therefore maintaining insulin sensitivity and improving glucose metabolism under normal chow conditions. Our study brings a new perspective that Tgf-β1 gene deletion specific from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage promotes adipocyte hyperplasia, improving glucose homeostasis. Thus, deletion of the Tgf-β1 gene derived from CD206\u003csup\u003e+\u003c/sup\u003e M2 macrophage might be a potential strategy for preventing obesity and type 2 diabetes.\u003c/p\u003e","manuscriptTitle":"Role of transforming growth factor-β1 in regulating adipocyte progenitors","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-30 08:14:34","doi":"10.21203/rs.3.rs-4672547/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-18T19:19:30+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-17T08:22:04+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"257462913026665385093489170248965863697","date":"2024-08-07T01:09:39+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-08-06T21:03:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"105680634042847365313860977943738626526","date":"2024-07-24T16:31:26+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-15T13:26:09+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-07-15T12:59:50+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-07-07T10:06:42+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-07-05T07:27:20+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-07-02T08:09:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b8c36e5b-850e-448e-bf6c-a7fc061e8b09","owner":[],"postedDate":"July 30th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-01-20T16:04:07+00:00","versionOfRecord":{"articleIdentity":"rs-4672547","link":"https://doi.org/10.1038/s41598-024-81917-7","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-01-17 15:57:51","publishedOnDateReadable":"January 17th, 2025"},"versionCreatedAt":"2024-07-30 08:14:34","video":"","vorDoi":"10.1038/s41598-024-81917-7","vorDoiUrl":"https://doi.org/10.1038/s41598-024-81917-7","workflowStages":[]},"version":"v1","identity":"rs-4672547","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4672547","identity":"rs-4672547","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.