POSoligo: in vitro gene synthesis oligonucleotide software

POSoligo: in vitro gene synthesis oligonucleotide software | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article POSoligo: in vitro gene synthesis oligonucleotide software Yingying Tong, jie sun, Yang Chen, Changhua Yi, Guanghua Yang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3764402/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Oligonucleotide synthesis is crucial for molecular experiments. Bioinformatics has been applied to develop various algorithm-based tools for the in vitro synthesis of nucleotides. The primary method of synthesizing long-chain DNA molecules involves connecting short-chain oligonucleotides through ligase chain reaction (LCR) and polymerase chain reaction (PCR). Short-chain DNA molecules exhibit low mutagenesis rates, while LCR requires complementary interfaces on both ends of the two nucleic acid molecules or might alter the conformation of nucleotide chain conformation, terminating amplification. Therefore, molecular melting temperature, length, and specificity should be considered during the experimental design. Patch oligonucleotide synthesis (POS)oligo is a specialized offline tool for nucleotide fragment synthesis.. It optimizes the oligonucleotide length and specificity based on input single-stranded DNA, generating multiple contiguous long strands (COS) and short patch strands (POS) with complementary ends. This process ensures free 5′- and 3′-ends during oligonucleotide synthesis, preventing secondary structure formation and ensuring specific binding between COS and POS without stabilizing the complementary strands based on Tm values. POSoligo was used to synthesize the linear RBD sequence of SARS-CoV-2 using only one DNA strand, several POSs for LCR ligation, and two pairs of primers for PCR amplification in a time- and cost-effective manner. Biological sciences/Biological techniques/Genetic engineering Biological sciences/Biochemistry/Dna nucleotide synthesis patch oligonucleotide synthesis software package Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Long-chain DNA can be synthesized by traditional chemical methods, site-directed mutagenesis and restriction endonucleases, and a high-throughput approach using biological chips. Currently, out-of-body gene synthesis methods have been utilized. Over the past four decades, various methods for in vitro long gene synthesis have been proposed: phosphodiesterase chain-based synthesis ( 1 – 4 ) of sequences, enzyme-catalyzed methods that use DNA polymerase and other coenzymes to assemble DNA fragments ( 5 – 8 ), and photolithography-based synthesis that uses photolithographic techniques on a photosensitive carrier to synthesize DNA via UV irradiation and masking ( 9 , 10 , 11 ). Each of these methods has advantages and disadvantages. The phosphodiesterase chain- and photolithography-based methods may not be available under most laboratory conditions, while enzymatic methods combining polymerase chain reaction (PCR) and ligase chain reaction (LCR) are optimal for synthesizing longer sequences accurately from shorter DNA fragments in a cost- and time-efficient manner. Hoover and Lutkovski developed DNAWorks, an automated method for designing and optimizing oligonucleotides for PCR-based gene synthesis ( 12 ). The software accepts DNA or protein sequences as input and design-optimized oligonucleotides to match the codon bias of the chosen host for expression. Rouillard et al. designed an online tool that optimizes the synthesis of long-stranded DNA assemblies through various algorithms ( 13 ). Currently, the oligonucleotide design for LCR or PCR-synthesized genes is based on two parameters: similar thermodynamic properties (i.e., melting temperature) to ensure uniform hybridization during assembly and high specificity of oligonucleotides for the target to avoid incorrect assembly. Our POSoligo software was based on the POS method ( 14 ), with single-stranded DNA as a template, which circumvents the thermodynamic properties required for each segment in the double-stranded DNA. Additionally, the short patch chains have high specificity for adjacent template chains, thereby reducing the possibility of mutations during synthesis. In terms of versatility, this software supports the input of single-stranded DNA and RNA sequences. Materials and Methods All oligonucleotides were obtained from Sangon Biotech Bioengineering (Shanghai) Co. A comprehensive index of sequences was formulated by replicating the designs described in the procedural section. Phosphorylation of oligonucleotides The oligonucleotides (0.1 nmol) were phosphorylated at the 5′-end in a PCR tube. The reaction consisting of 3 µL of 10x PNK buffer (0.5 M Tris/HCl pH 7.6, 0.1 M MgCl 2 , 50 mM DTE), 2 µL of T4 polynucleotide kinase (10 units), 1 µL ATP (1 mM), and 23 µL nuclease-free H 2 O was carried out at 37 ℃ for 30 min. Subsequently, 70 µL of nuclease-fee H 2 O was added, and the reaction was stopped by incubation on ice. LCR LCR was carried out to covalently connect two adjacent long structured oligonucleotides (COS), thus forming full-length sequences. The LCR consisted of 1 µL phosphorylation reaction product, 2.5 µL 10x Taq ligase buffer (0.2 M Tris/HCl pH 7.6, 0.25 M potassium acetate, 0.1 M magnesium acetate, 10 mM NAD + , 10% Triton X-100), 1 µL Taq ligase (10 units), and 19.5 µL nuclease-free H 2 O in a PCR tube. The reaction was carried out on a MyGene series Peltier thermal cycler MG25+ (LongGene, Hangzhou, China) as follows: 95 ℃ for 5 min, 45 cycles of 95 ℃ for 30 s, 51 ℃ for 20 s, and 45 ℃ for 4 s, and a final incubation at 45 ℃ for 5 h. PCR amplification A partial double-stranded DNA template was obtained by PCR amplification using the outermost primer. The reaction mixture consisted of 1 µL of LCR product, 2.5 µL of dNTPs (2 mM), 1 µL of each primer (0.2 µM), 5 µL of 10x Pfu DNA polymerase buffer, high-fidelity DNA polymerase Pfu (5 U/µL, Bio-Basic Inc., Ontario, Canada), and 38.5 µL of nuclease-free H 2 O. The PCR reaction was as follows: 94°C for 3 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 2 min, and 72°C for 5 min. Amplification, cloning and sequencing of synthetic fragments The 6-well plate was lined with 3 wells of 293FT (including duplicate wells and control), 1×10 6 /mL per well; 2 µg of gel-recovered DNA and 100 µL of electro-transfection buffer were added to the electro-transfection cup and mixed well in the X-Porator H1 electro-transfer apparatus, and the cells were incubated in the incubator after transfection. RNA was extracted from 3 tubes of cytosol (C1, C2, CON) and cDNA was reverse transcribed. The cDNA was used as a template and RBD-F and RBD-R primers (Table 1 ) were used to amplify the RBD target fragment. The reaction procedure was as follows: 94°C for 3 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 2 min, and 72°C for 5 min. The DNA clone was ligated into pGEM-T vector and 2 µL of the ligation product was transformed into JM109, and the recombinant plasmid was screened by the blue/white spot selection method, and the recombinant plasmid was extracted from the white colonies and sequenced for analysis. Algorithm Our software leverages a sophisticated algorithm to transform the input sequence into oligonucleotides. This input sequence is perceived as single-stranded DNA, which is subsequently segmented into consecutive short strands of 50–120 bps. Moreover, an auxiliary complementary patch strand is computed and designed to connect the two terminal points of COS and function as a nexus or bridge. Interestingly, the two terminal regions of the original sequence are intentionally left devoid of patch strands, thereby maintaining their availability. After LCR, primers are meticulously designed in the terminal region of the long chain to facilitate PCR amplification. Implementation POSoligo has been developed using C + + programming and is accessible via direct input sequences or through .TXT in the software. The algorithmic procedure for POS primarily involves designing a series of overlapping patches, alignment based on their common sequences, and then merging them to create the final DNA sequence. This process is conducted iteratively for a satisfactory outcome. The C + + programming language employs various advanced algorithms and techniques to optimize this process: • Sequence alignment algorithms identify suitable target sequences for amplification or detection. • Primer/probe design algorithms are applied to select appropriate, specific, and efficient oligonucleotide sequences. • Secondary structure prediction algorithms prevent non-specific binding or unwanted interactions between oligonucleotides. • Simulated annealing or genetic algorithms optimize chemical synthesis and minimize errors or side reactions. C + + programs generate optimized protocols for the design and synthesis of oligonucleotides by integrating these algorithms and techniques. Application Design of an oligonucleotide set for SARS-CoV-2 To evaluate and detect POS1 oligo, we designed the nucleotide sequence of the coding region of the S1 protein gene of SARS-CoV-2 virus (GenBank registry no. QHD43416) with the RBD amino acids Arg319–Lys529, i.e., a total of 210 bp. Then, we added the CMV promoter at its 5′-end and the polyA tail at its 3′-end to construct the CMV + RBD + ployA60 expression frame (Fig. 1 ). The program yielded a total of 34 oligo-dTs (Table 1 ), of which CMV1–CMV10 and RBD1–RBD8 were long-structured oligonucleotides (COS) of 50–120 bp and P1–P7, respectively; CP1–CP9 were short structured POS of 22–30 bp. Also, the folder consisting of the program was utilized to generate the secondary structure of COS RNA and ensure that the 5′- and 3′-ends are free, while the self-linked region in the middle part is extremely short and opens directly during denaturation at high temperature (Fig. 2 ). Table 1 SARS-CoV-2 S protein 34 oligo-dTs Oligo-dT Sequences (5′– 3′) Length (nt) P1 P2 P3 P4 P5 P6 P7 CP1 CP2 CP3 CP4 CP5 CP6 CP7 CP8 CP9 CMV1 CMV2 CMV3 CMV4 CMV5 CMV6 CMV7 CMV8 CMV9 CMV10 RBD-1 RBD-2 RBD-3 RBD-4 RBD-5 RBD-6 RBD-7 RBD-8 CMV-F CMV-R RBD-F RBD-R TAGACTGACGCGAATCTGGTTGCGTTGAAT GGCTCACCCCATAACACTTAAAGG CAATCTTACCTGTTTGGCCCGGTGCAATTT TAGTTACCCCCGACTTTGCTATCAAGATT GTGCTACCAGCCTGGTATATTTCGGTA TGGTAACCAACGCCGTTTGTAGGTTGAAAT TCTAGAGGATCTTACTTCTTGGGCCCACAAACC ATACAACGTATGCAATGGGCCAAGCTCATG TAATAACTAGTCAATAATCAATGTCAACAT ATTTACCGTAAGTTATGTAACGCGGAACTC AAGTCCCTATTGGCGTTACTATGGGAACAT GGGGCGTACTTGGCATATGATACACTTGAT ATGTACTGCCAAGTAGGAAAGTCCCATAAG CAAACCGCTATCCACGCCCATTGATGTACT GAAAGTCCCGTTGATTTTGGTGCCAAAACA TAAACGAGCTCTGCTTATATAGACCTCCCA AAAGGTGTGGGTTTGGATCCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGAGCTTGGCCCATTGC ATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTTGACATTGATTATTGAC TAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAAC TTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCC AATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGC CAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTA CTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTG GATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATC AACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGA GCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGACTCTAGAG ATGCGCGTACAACCGACGGAGAGTATCGTACGATTCCCTAACATAACGAATCTCTGTCCGTTTGGAGAGGTATTCAACGCAACCAGATTCGC GTCAGTCTATGCGTGGAATCGGAAGAGAATATCTAATTGTGTTGCTGACTATTCTGTGCTGTATAACTCAGCCTCCTTTAGTACCTTTAAGTGTTATG GGGTGAGCCCGACAAAACTTAACGACCTTTGCTTTACCAACGTGTACGCCGACAGTTTTGTAATCAGGGGGGATGAAGTTAGGCAAATTGCACCGGGCC AAACAGGTAAGATTGCAGACTATAACTACAAATTGCCAGATGACTTCACTGGTTGTGTTATCGCGTGGAATTCTAACAATCTTGATAGCAAAGTCGG GGGTAACTATAACTATCTTTACCGCCTGTTTAGAAAAAGTAACCTTAAACCGTTCGAGCGAGACATAAGTACCGAAATATACCAG GCTGGTAGCACACCTTGCAATGGGGTGGAGGGGTTCAACTGTTACTTCCCCCTCCAAAGTTATGGATTTCAACCTACAAACGG CGTTGGTTACCAGCCTTACAGGGTCGTTGTACTCAGTTTCGAGTTGCTTCATGCTCCTGCTACGGTTTGTGGGCCCAA GAAGTAAGATCCTCTAGAAATAAAAGATCTTAAGTTTCATTAGATCTGTGTGTTGGTTTTTTGTGTG AAAGGTGTGGGTTTGGATCCGGCCTCGGCCTC CTCTCCGTCGGTTGTACGCGCATCTCTAGAGTCGGTGTCTTCTATGGAGG ATGCGCGTACAACCGACGGAGAGTATCGTACGATTCCC CACACAAAAAACCAACACAC 30 24 30 29 27 30 33 30 30 30 30 30 30 30 30 30 77 82 71 85 83 84 75 78 89 80 92 98 99 97 85 83 78 67 32 50 38 20 Synthesis of SARS-CoV-2 RBD gene in vitro CMV1-CMV10, RBD1-RBD8, P1-P7, CP1-CP9, and CMV-R (Table 1 ) were combined using the 2x Pfu PCR Mix system and subjected to LCR on MG25 + under the following conditions: 95°C for 5 min, 45 cycles of 95°C for 30 s, 51°C for 20 s and 45°C for 4 min, and a final incubation at 45°C overnight for high-temperature ligation. The PCR reaction mixture consisted of 1 µL of LCR product, 1 µL of each of CMV-F and RBD-R primers (Table 1 ), 12.5 µL of 2x Pfu PCR Mix, and 9.5 µL of ddH 2 O. The PCR amplification was carried out using the following program: 94°C for 3 min, 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 2 min, and 72°C for 5 min. The target bands were identified through 1% gel electrophoresis and excised using a gel recovery kit. Figure 3 shows the successful in vitro synthesis and amplification of the expression frame sequence of CMV + target antigen RBD + ployA60 (1,530 bp) after LCR + PCR reaction. The electrophoresis fragment matched the expected size, confirming the successful synthesis of the expression frame sequence. Synthesis and validation of RBD gene The LCR-PCR product was recovered from the gel, and its concentration (0.32 μg/μL) was measured spectrophotometrically. The DNA recovered from the gel was transfected into 293FT cells and incubated for 48 h. The RNA extracted and measured spectrophotometrically at a 1.3 μg/μL concentration was reverse-transcribed into cDNA. The RT-PCR products analyzed by electrophoresis matched the expected size of the RBD target gene fragment (Figure 4A). The sequencing results indicated successful synthesis of the RBD fragment with a size of 639 bp (Figure 4B ＆ Supplement 1 ). Discussion Our in vitro gene synthesis approach possesses numerous advantages compared to most of the current methodologies. Advantage 1: Most contemporary techniques require the target nucleotides to be divided into stable and homogeneous oligonucleotides with thermodynamic properties. This would preclude the formation of secondary structures resulting from nucleotide mismatches during hybridization, which might produce unstable hybrid DNA. In contrast, our software cleaved the sequences into varying lengths, specifically maintaining the 5′- and 3′-ends of each POS sequence in a free and unobstructed state. This specific design significantly facilitates the correct ligation of adjacent structural oligonucleotides by Taq DNA ligase. In case of any residual secondary structure during denaturation at 95 °C in the LCR, the free structure is released without considering the stability of the TM value. The approach can be utilized for the synthesis of long genes. Stemmer et al. synthesized a 2.7-kbp sequence in a single step (7). However, the synthesized product needs to be verified during an intermediate stage due to an increased risk of errors in long sequences, which reduces the likelihood of obtaining an accurate fragment after assembly. Therefore, shortening the long sequences is essential to improve the accuracy of assembly. Advantage 2: Most current tools design split fragments of double-stranded DNA encompassing the whole gene, indicating that POSoligo-designed sequences have reduced the cost and turnaround time in the synthesis phase compared to the traditional tool design. The POS method offers economical and time-saving advantages over other methods in the synthesis of long DNA sequences. In the current method, a single-stranded DNA template is required to construct the entire gene, reducing the cost and turnaround time compared to methods that require a double-stranded DNA template encompassing the full-stranded gene. Smith et al. (15) assembled the uX174 phage (5386 bp) using 259 oligonucleotides (40 nt each) in 14 days. Xiong et al. (16) synthesized long DNA sequences (5-6 kb) in 5–7 days. Conversely, our method synthesized full-length genes by single-step ligation and PCR in 1 day. POSoligo can be widely used for designing long DNA fragments in synthetic biology and biotechnology research. Subsequently, we will upgrade the functionality of the software. Declarations Data availability All experimental data are presented in this published article and supplementary file. The software during the current study are available in the [figshare] repository, DOI：https://doi.org/10.6084/m9.figshare.24879006.v1 Supplement RBD fragment sequencing waveform files are placed in the zip file. Author contributions Y.Y.T. designed the experiment, participated in the writing of the manuscript and created the images.J.S. completed the experiment and finished the writing of the manuscript, Y.C. participated in the experiment, C.H.Y. supervised and revised the manuscript, and G.H.Y. designed and supervised the study, interpreted data and wrote the manuscript. Funding The Special fund for cancer prevention and treatment of Shanghai Science and Technology Development Foundation (Grant number CT20200517A). Competing interests The authors declare no competing interests. References Goeddel D V , Kleid D G , Bolivar F ,et al.Expression in Escherichia coli of chemically synthesized genes for human insulin[J].Proceedings of the National Academy of Sciences, 1979, 76(1):106-110.DOI:10.1073/pnas.76.1.106. Heyneker H L , Shine J , Goodman H M ,et al.Synthetic lac operator DNA is functional in vivo[J].Nature, 1976, 263(5580):748.DOI:10.1038/263748a0. Beaucage S L , Caruthers M H .Deoxynucleoside phosphoramidites—A new class of key intermediates for deoxypolynucleotide synthesis[J].Cheminform, 1981, 12(36).DOI:10.1002/chin.198136353. Itakura K .Expression of Escherichia coli of a chemically synthesized gene for the harmone somatostatin.[J].Science, 1977, 198. Au L C , Yang F Y , Yang W J ,et al.Gene synthesis by a LCR-based approach: high-level production of leptin-L54 using synthetic gene in Escherichia coli.[J].Biochemical & Biophysical Research Communications, 1998, 248(1):200-203.DOI:10.1006/bbrc.1998.8929. Dillon P J , Rosen C A .A rapid method for the construction of synthetic genes using the polymerase chain reaction.[J].Biotechniques, 1990, 9(3):298, 300.DOI:10.1002/bmc.1130040510. Stemmer W P C , Crameri A , Ha K D ,et al.Stemmer, W. P. C. Crameri, A. Ha, K. D. Brennan, T. M. & Heyneker, H. L. Single-step PCR assembly of a gene and a whole plasmid from large numbers of oligonucleotides. Gene 164, 49-53[J].Gene, 1995, 164(1):49-53.DOI:10.1016/0378-1119(95)00511-4. Pusch C M , Ian G , Michael S .Repair of degraded duplex DNA from prehistoric samples using Escherichia coli DNA polymerase I and T4 DNA ligase.[J].Nucleic Acids Research(3):857[2023-11-10].DOI:10.1093/nar/26.3.857. Tian, J., Gong, H., Sheng, N. et al. Accurate multiplex gene synthesis from programmable DNA microchips. Nature 432, 1050–1054 (2004). https://doi.org/10.1038/nature03151 Fodor S P A, Read J L, Pirrung M C, et al. Light-directed, spatially addressable parallel chemical synthesis [J]. Science, 1991, 251(4995):767-773. Xiaolian G , Eric L P , Hua Z ,et al.A flexible light-directed DNA chip synthesis gated by deprotection using solution photogenerated acids[J].Nucleic Acids Research(22):4744-50[2023-11-10].DOI:10.1093/nar/29.22.4744. Hoover D M , Jacek L .DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis[J].Nucleic Acids Research, 2002(10):e43.DOI:10.1093/nar/30.10.e43. Jean-Marie R , Woonghee L , Gilles T ,et al.Gene2Oligo: oligonucleotide design for in vitro gene synthesis[J].Nucleic Acids Research(suppl_2):176-80[2023-11-10].DOI:10.1093/nar/gkh401. Yang G , Wang S , Wei H ,et al.Patch oligodeoxynucleotide synthesis (POS): a novel method for synthesis of long DNA sequences and full-length genes[J].Biotechnology Letters, 2012, 34(4):721-728.DOI:10.1007/s10529-011-0832-0. Smith H O , Hutchison C A , Pfannkoch C ,et al.Generating a synthetic genome by whole genome assembly: phi X174 bacteriophage from synthetic oligonucleotides[J].Proceedings of the National Academy of Sciences of the United States of America, 2003(26):100. Ai-Sheng X , Quan-Hong Y , Ri-He P ,et al.A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences[J].Nucleic Acids Research(12):e98[2023-11-10].DOI:10.1093/nar/gnh094. Yamazaki K I , Mora K D , Saitoh K .BioBrick-based 'Quick Gene Assembly' in vitro[J].Synthetic Biology, 2017.DOI:10.1093/synbio/ysx003. Zampini, M., Stevens, P., Pachebat, J. et al. RapGene: a fast and accurate strategy for synthetic gene assembly in Escherichia coli. Sci Rep 5, 11302 (2015). https://doi.org/10.1038/srep11302 Li, M., Zheng, M., Wu, S. et al. In vivo production of RNA nanostructures via programmed folding of single-stranded RNAs. Nat Commun 9, 2196 (2018). https://doi.org/10.1038/s41467-018-04652-4 Annaluru, N. et al. (2012). Assembling DNA Fragments by USER Fusion. In: Peccoud, J. (eds) Gene Synthesis. Methods in Molecular Biology, vol 852. Humana Press. https://doi.org/10.1007/978-1-61779-564-0_7 Additional Declarations No competing interests reported. Supplementary Files 001031120052304367C5CPDR.ab1 001031120052304367C5CPDR.seq Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 12 Feb, 2024 Reviews received at journal 07 Feb, 2024 Reviewers agreed at journal 31 Jan, 2024 Reviewers invited by journal 31 Jan, 2024 Editor assigned by journal 31 Jan, 2024 Editor invited by journal 20 Dec, 2023 Submission checks completed at journal 20 Dec, 2023 First submitted to journal 16 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3764402","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":261934245,"identity":"8f2813ad-7ee7-4cad-b742-4fad2210f8f9","order_by":0,"name":"Yingying Tong","email":"","orcid":"","institution":"Ministry of Science and Technology, Shanghai Ocean University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yingying","middleName":"","lastName":"Tong","suffix":""},{"id":261934246,"identity":"89d62f3f-8267-434a-ae20-a04f29618e67","order_by":1,"name":"jie sun","email":"","orcid":"","institution":"Ministry of Science and Technology, Shanghai Ocean University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"jie","middleName":"","lastName":"sun","suffix":""},{"id":261934247,"identity":"f477747d-7021-4d6a-bc21-8ea52d781a2a","order_by":2,"name":"Yang Chen","email":"","orcid":"","institution":"Ministry of Science and Technology, Shanghai Ocean University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Chen","suffix":""},{"id":261934260,"identity":"80c63c21-efa9-491a-a500-329405706579","order_by":3,"name":"Changhua Yi","email":"","orcid":"","institution":"Ministry of Science and Technology, Shanghai Ocean University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Changhua","middleName":"","lastName":"Yi","suffix":""},{"id":261934265,"identity":"c5da0bd7-b3a9-49a6-9552-3026b26d0574","order_by":4,"name":"Guanghua Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0klEQVRIiWNgGAWjYDACCQjJw8/e2PjwAwlaLGQkew43G0uQoKXCxuBGepsADzE65KN7DD8X/JLgMbj5sA2o305Ot4GAFsM7Z4ylZ/ZJ8EjeTmx7UMCQbGx2gJCWGTkG0rw9Ejx8txPbDSQYDiRuI0KL8W+QFoabB9uAJBFa5CVyzKR5fkjwCNxgJFKLgURamTVvA9AvPYnAQDYgwi/yM5I33+b5U2fPz3784cMPFXZyBLUYHOAwYGBsg3MJKAfb0sD+gIHhDxEqR8EoGAWjYOQCADFOQQxLgTEPAAAAAElFTkSuQmCC","orcid":"","institution":"Ministry of Science and Technology, Shanghai Ocean University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Guanghua","middleName":"","lastName":"Yang","suffix":""}],"badges":[],"createdAt":"2023-12-16 18:29:37","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3764402/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3764402/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":48686001,"identity":"b116df58-a6ab-4b46-9bbd-526a9dce0eb6","added_by":"auto","created_at":"2023-12-22 15:41:47","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":24669,"visible":true,"origin":"","legend":"\u003cp\u003eSARS-CoV-2 S protein primary structure and promoter CMV + target antigen RBD + ployA60 complete expression frame.\u003c/p\u003e\n\u003cp\u003eA, RBD located on the S1 subunit in S protein; B, promoter CMV + target antigen RBD + ployA60 complete expression frame.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3764402/v1/4fe8ca6727297ef3000c430c.jpg"},{"id":48685680,"identity":"f8e00eb7-32c1-4381-af44-958ff635b9d8","added_by":"auto","created_at":"2023-12-22 15:33:47","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":65501,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram of the flow of the POS method, with the secondary structure of the pos chain keeping the double ends free in the upper right corner.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3764402/v1/c29f04f94f4bf1710cac593a.jpg"},{"id":48686003,"identity":"03b7e725-2653-4c5d-ab91-41e100367d5c","added_by":"auto","created_at":"2023-12-22 15:41:47","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":14129,"visible":true,"origin":"","legend":"\u003cp\u003e1.0 % agarose gel electrophoresis to verify 1 μL LCR-PCR product.\u003c/p\u003e\n\u003cp\u003eM: Marker (1 kbp); 1: LCR-PCR product.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3764402/v1/abc6d567f2cbbae59b0210e1.jpg"},{"id":48686002,"identity":"a8a8822e-35cc-479e-9909-0664c7ca26fc","added_by":"auto","created_at":"2023-12-22 15:41:47","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":79531,"visible":true,"origin":"","legend":"\u003cp\u003eA,\u003cstrong\u003e \u003c/strong\u003e1.0% agarose gel electrophoresis to verify 1 μL cDNA-PCR product.\u003c/p\u003e\n\u003cp\u003eM: Marker (1 kbp); 1, 2: RBD fragments (C1, C2) amplified with reverse transcribed cDNA as the template; 3: negative control (CON). B,\u003cstrong\u003e \u003c/strong\u003eSequencing results.\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3764402/v1/ee1a060a0414deb1715cad01.jpg"},{"id":48686466,"identity":"d6c1918d-ec36-4569-b733-94f9d6c6e6fd","added_by":"auto","created_at":"2023-12-22 15:49:48","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":369270,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3764402/v1/02eaafa3-9e15-4aec-841d-afd6656da3da.pdf"},{"id":48685683,"identity":"4eda119e-7033-4d8c-beb5-21810b270ef5","added_by":"auto","created_at":"2023-12-22 15:33:48","extension":"ab1","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":319248,"visible":true,"origin":"","legend":"","description":"","filename":"001031120052304367C5CPDR.ab1","url":"https://assets-eu.researchsquare.com/files/rs-3764402/v1/dd0a67f3999736cd1a866bd2.ab1"},{"id":48685678,"identity":"679b9bca-4581-4411-ba4c-d6c9c2ab37f1","added_by":"auto","created_at":"2023-12-22 15:33:47","extension":"seq","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1226,"visible":true,"origin":"","legend":"","description":"","filename":"001031120052304367C5CPDR.seq","url":"https://assets-eu.researchsquare.com/files/rs-3764402/v1/fc0e60beba437dd46e8b51ad.seq"}],"financialInterests":"No competing interests reported.","formattedTitle":"POSoligo: in vitro gene synthesis oligonucleotide software","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLong-chain DNA can be synthesized by traditional chemical methods, site-directed mutagenesis and restriction endonucleases, and a high-throughput approach using biological chips. Currently, out-of-body gene synthesis methods have been utilized.\u003c/p\u003e \u003cp\u003eOver the past four decades, various methods for in vitro long gene synthesis have been proposed: phosphodiesterase chain-based synthesis (\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) of sequences, enzyme-catalyzed methods that use DNA polymerase and other coenzymes to assemble DNA fragments (\u003cspan additionalcitationids=\"CR6 CR7\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e), and photolithography-based synthesis that uses photolithographic techniques on a photosensitive carrier to synthesize DNA via UV irradiation and masking (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Each of these methods has advantages and disadvantages. The phosphodiesterase chain- and photolithography-based methods may not be available under most laboratory conditions, while enzymatic methods combining polymerase chain reaction (PCR) and ligase chain reaction (LCR) are optimal for synthesizing longer sequences accurately from shorter DNA fragments in a cost- and time-efficient manner.\u003c/p\u003e \u003cp\u003eHoover and Lutkovski developed DNAWorks, an automated method for designing and optimizing oligonucleotides for PCR-based gene synthesis (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). The software accepts DNA or protein sequences as input and design-optimized oligonucleotides to match the codon bias of the chosen host for expression. Rouillard et al. designed an online tool that optimizes the synthesis of long-stranded DNA assemblies through various algorithms (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). Currently, the oligonucleotide design for LCR or PCR-synthesized genes is based on two parameters: similar thermodynamic properties (i.e., melting temperature) to ensure uniform hybridization during assembly and high specificity of oligonucleotides for the target to avoid incorrect assembly.\u003c/p\u003e \u003cp\u003eOur POSoligo software was based on the POS method (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e), with single-stranded DNA as a template, which circumvents the thermodynamic properties required for each segment in the double-stranded DNA. Additionally, the short patch chains have high specificity for adjacent template chains, thereby reducing the possibility of mutations during synthesis. In terms of versatility, this software supports the input of single-stranded DNA and RNA sequences.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eAll oligonucleotides were obtained from Sangon Biotech Bioengineering (Shanghai) Co. A comprehensive index of sequences was formulated by replicating the designs described in the procedural section.\u003c/p\u003e\n\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003ePhosphorylation of oligonucleotides\u003c/h2\u003e\n \u003cp\u003eThe oligonucleotides (0.1 nmol) were phosphorylated at the 5\u0026prime;-end in a PCR tube. The reaction consisting of 3 \u0026micro;L of 10x PNK buffer (0.5 M Tris/HCl pH 7.6, 0.1 M MgCl\u003csub\u003e2\u003c/sub\u003e, 50 mM DTE), 2 \u0026micro;L of T4 polynucleotide kinase (10 units), 1 \u0026micro;L ATP (1 mM), and 23 \u0026micro;L nuclease-free H\u003csub\u003e2\u003c/sub\u003eO was carried out at 37 ℃ for 30 min. Subsequently, 70 \u0026micro;L of nuclease-fee H\u003csub\u003e2\u003c/sub\u003eO was added, and the reaction was stopped by incubation on ice.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\"\u003e\n \u003ch2\u003eLCR\u003c/h2\u003e\n \u003cp\u003eLCR was carried out to covalently connect two adjacent long structured oligonucleotides (COS), thus forming full-length sequences. The LCR consisted of 1 \u0026micro;L phosphorylation reaction product, 2.5 \u0026micro;L 10x Taq ligase buffer (0.2 M Tris/HCl pH 7.6, 0.25 M potassium acetate, 0.1 M magnesium acetate, 10 mM NAD\u003csup\u003e+\u003c/sup\u003e, 10% Triton X-100), 1 \u0026micro;L Taq ligase (10 units), and 19.5 \u0026micro;L nuclease-free H\u003csub\u003e2\u003c/sub\u003eO in a PCR tube. The reaction was carried out on a MyGene series Peltier thermal cycler MG25+ (LongGene, Hangzhou, China) as follows: 95 ℃ for 5 min, 45 cycles of 95 ℃ for 30 s, 51 ℃ for 20 s, and 45 ℃ for 4 s, and a final incubation at 45 ℃ for 5 h.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\"\u003e\n \u003ch2\u003ePCR amplification\u003c/h2\u003e\n \u003cp\u003eA partial double-stranded DNA template was obtained by PCR amplification using the outermost primer. The reaction mixture consisted of 1 \u0026micro;L of LCR product, 2.5 \u0026micro;L of dNTPs (2 mM), 1 \u0026micro;L of each primer (0.2 \u0026micro;M), 5 \u0026micro;L of 10x Pfu DNA polymerase buffer, high-fidelity DNA polymerase Pfu (5 U/\u0026micro;L, Bio-Basic Inc., Ontario, Canada), and 38.5 \u0026micro;L of nuclease-free H\u003csub\u003e2\u003c/sub\u003eO. The PCR reaction was as follows: 94\u0026deg;C for 3 min, 30 cycles of 94\u0026deg;C for 30 s, 55\u0026deg;C for 30 s, and 72\u0026deg;C for 2 min, and 72\u0026deg;C for 5 min.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\"\u003e\n \u003ch2\u003eAmplification, cloning and sequencing of synthetic fragments\u003c/h2\u003e\n \u003cp\u003eThe 6-well plate was lined with 3 wells of 293FT (including duplicate wells and control), 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e/mL per well; 2 \u0026micro;g of gel-recovered DNA and 100 \u0026micro;L of electro-transfection buffer were added to the electro-transfection cup and mixed well in the X-Porator H1 electro-transfer apparatus, and the cells were incubated in the incubator after transfection. RNA was extracted from 3 tubes of cytosol (C1, C2, CON) and cDNA was reverse transcribed. The cDNA was used as a template and RBD-F and RBD-R primers (Table \u003cspan\u003e1\u003c/span\u003e) were used to amplify the RBD target fragment. The reaction procedure was as follows: 94\u0026deg;C for 3 min, 30 cycles of 94\u0026deg;C for 30 s, 55\u0026deg;C for 30 s, and 72\u0026deg;C for 2 min, and 72\u0026deg;C for 5 min. The DNA clone was ligated into pGEM-T vector and 2 \u0026micro;L of the ligation product was transformed into JM109, and the recombinant plasmid was screened by the blue/white spot selection method, and the recombinant plasmid was extracted from the white colonies and sequenced for analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec7\"\u003e\n \u003ch2\u003eAlgorithm\u003c/h2\u003e\n \u003cp\u003eOur software leverages a sophisticated algorithm to transform the input sequence into oligonucleotides. This input sequence is perceived as single-stranded DNA, which is subsequently segmented into consecutive short strands of 50\u0026ndash;120 bps.\u003c/p\u003e\n \u003cp\u003eMoreover, an auxiliary complementary patch strand is computed and designed to connect the two terminal points of COS and function as a nexus or bridge. Interestingly, the two terminal regions of the original sequence are intentionally left devoid of patch strands, thereby maintaining their availability.\u003c/p\u003e\n \u003cp\u003eAfter LCR, primers are meticulously designed in the terminal region of the long chain to facilitate PCR amplification.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec8\"\u003e\n \u003ch2\u003eImplementation\u003c/h2\u003e\n \u003cp\u003ePOSoligo has been developed using C\u0026thinsp;+\u0026thinsp;+\u0026thinsp;programming and is accessible via direct input sequences or through .TXT in the software. The algorithmic procedure for POS primarily involves designing a series of overlapping patches, alignment based on their common sequences, and then merging them to create the final DNA sequence. This process is conducted iteratively for a satisfactory outcome. The C\u0026thinsp;+\u0026thinsp;+\u0026thinsp;programming language employs various advanced algorithms and techniques to optimize this process:\u003c/p\u003e\n \u003cp\u003e\u0026bull; Sequence alignment algorithms identify suitable target sequences for amplification or detection. \u0026bull; Primer/probe design algorithms are applied to select appropriate, specific, and efficient oligonucleotide sequences. \u0026bull; Secondary structure prediction algorithms prevent non-specific binding or unwanted interactions between oligonucleotides. \u0026bull; Simulated annealing or genetic algorithms optimize chemical synthesis and minimize errors or side reactions. C\u0026thinsp;+\u0026thinsp;+\u0026thinsp;programs generate optimized protocols for the design and synthesis of oligonucleotides by integrating these algorithms and techniques.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\"\u003e\n \u003ch2\u003eApplication\u003c/h2\u003e\n \u003cdiv id=\"Sec10\"\u003e\n \u003ch2\u003eDesign of an oligonucleotide set for SARS-CoV-2\u003c/h2\u003e\n \u003cp\u003eTo evaluate and detect POS1 oligo, we designed the nucleotide sequence of the coding region of the \u003cem\u003eS1\u003c/em\u003e protein gene of SARS-CoV-2 virus (GenBank registry no. QHD43416) with the RBD amino acids Arg319\u0026ndash;Lys529, i.e., a total of 210 bp. Then, we added the CMV promoter at its 5\u0026prime;-end and the polyA tail at its 3\u0026prime;-end to construct the CMV\u0026thinsp;+\u0026thinsp;RBD\u0026thinsp;+\u0026thinsp;ployA60 expression frame (Fig. \u003cspan\u003e1\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eThe program yielded a total of 34 oligo-dTs (Table \u003cspan\u003e1\u003c/span\u003e), of which CMV1\u0026ndash;CMV10 and RBD1\u0026ndash;RBD8 were long-structured oligonucleotides (COS) of 50\u0026ndash;120 bp and P1\u0026ndash;P7, respectively; CP1\u0026ndash;CP9 were short structured POS of 22\u0026ndash;30 bp. Also, the folder consisting of the program was utilized to generate the secondary structure of COS RNA and ensure that the 5\u0026prime;- and 3\u0026prime;-ends are free, while the self-linked region in the middle part is extremely short and opens directly during denaturation at high temperature (Fig. \u003cspan\u003e2\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv\u003e\u0026nbsp;\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eSARS-CoV-2 S protein 34 oligo-dTs\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eOligo-dT\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequences (5\u0026prime;\u0026ndash; 3\u0026prime;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eLength (nt)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eP1\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP2\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP3\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP4\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP5\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP6\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eP7\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCP1\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCP2\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCP3\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCP4\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCP5\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCP6\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCP7\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCP8\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCP9\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV1\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV2\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV3\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV4\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV5\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV6\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV7\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV8\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV9\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV10\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-1\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-2\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-3\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-4\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-5\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-6\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-7\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-8\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV-F\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eCMV-R\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-F\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eRBD-R\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTAGACTGACGCGAATCTGGTTGCGTTGAAT\u003c/p\u003e\n \u003cp\u003eGGCTCACCCCATAACACTTAAAGG\u003c/p\u003e\n \u003cp\u003eCAATCTTACCTGTTTGGCCCGGTGCAATTT TAGTTACCCCCGACTTTGCTATCAAGATT\u003c/p\u003e\n \u003cp\u003eGTGCTACCAGCCTGGTATATTTCGGTA\u003c/p\u003e\n \u003cp\u003eTGGTAACCAACGCCGTTTGTAGGTTGAAAT\u003c/p\u003e\n \u003cp\u003eTCTAGAGGATCTTACTTCTTGGGCCCACAAACC\u003c/p\u003e\n \u003cp\u003eATACAACGTATGCAATGGGCCAAGCTCATG\u003c/p\u003e\n \u003cp\u003eTAATAACTAGTCAATAATCAATGTCAACAT\u003c/p\u003e\n \u003cp\u003eATTTACCGTAAGTTATGTAACGCGGAACTC\u003c/p\u003e\n \u003cp\u003eAAGTCCCTATTGGCGTTACTATGGGAACAT\u003c/p\u003e\n \u003cp\u003eGGGGCGTACTTGGCATATGATACACTTGAT\u003c/p\u003e\n \u003cp\u003eATGTACTGCCAAGTAGGAAAGTCCCATAAG\u003c/p\u003e\n \u003cp\u003eCAAACCGCTATCCACGCCCATTGATGTACT\u003c/p\u003e\n \u003cp\u003eGAAAGTCCCGTTGATTTTGGTGCCAAAACA\u003c/p\u003e\n \u003cp\u003eTAAACGAGCTCTGCTTATATAGACCTCCCA\u003c/p\u003e\n \u003cp\u003eAAAGGTGTGGGTTTGGATCCGGCCTCGGCCTCTGCATAAATAAAAAAAATTAGTCAGCCATGAGCTTGGCCCATTGC\u003c/p\u003e\n \u003cp\u003eATACGTTGTATCCATATCATAATATGTACATTTATATTGGCTCATGTCCAACATTACCGCCATGTTGACATTGATTATTGAC\u003c/p\u003e\n \u003cp\u003eTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAAC\u003c/p\u003e\n \u003cp\u003eTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCC\u003c/p\u003e\n \u003cp\u003eAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGC\u003c/p\u003e\n \u003cp\u003eCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTA\u003c/p\u003e\n \u003cp\u003eCTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTG\u003c/p\u003e\n \u003cp\u003eGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATC\u003c/p\u003e\n \u003cp\u003eAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGA\u003c/p\u003e\n \u003cp\u003eGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGACTCTAGAG\u003c/p\u003e\n \u003cp\u003eATGCGCGTACAACCGACGGAGAGTATCGTACGATTCCCTAACATAACGAATCTCTGTCCGTTTGGAGAGGTATTCAACGCAACCAGATTCGC\u003c/p\u003e\n \u003cp\u003eGTCAGTCTATGCGTGGAATCGGAAGAGAATATCTAATTGTGTTGCTGACTATTCTGTGCTGTATAACTCAGCCTCCTTTAGTACCTTTAAGTGTTATG\u003c/p\u003e\n \u003cp\u003eGGGTGAGCCCGACAAAACTTAACGACCTTTGCTTTACCAACGTGTACGCCGACAGTTTTGTAATCAGGGGGGATGAAGTTAGGCAAATTGCACCGGGCC\u003c/p\u003e\n \u003cp\u003eAAACAGGTAAGATTGCAGACTATAACTACAAATTGCCAGATGACTTCACTGGTTGTGTTATCGCGTGGAATTCTAACAATCTTGATAGCAAAGTCGG\u003c/p\u003e\n \u003cp\u003eGGGTAACTATAACTATCTTTACCGCCTGTTTAGAAAAAGTAACCTTAAACCGTTCGAGCGAGACATAAGTACCGAAATATACCAG\u003c/p\u003e\n \u003cp\u003eGCTGGTAGCACACCTTGCAATGGGGTGGAGGGGTTCAACTGTTACTTCCCCCTCCAAAGTTATGGATTTCAACCTACAAACGG\u003c/p\u003e\n \u003cp\u003eCGTTGGTTACCAGCCTTACAGGGTCGTTGTACTCAGTTTCGAGTTGCTTCATGCTCCTGCTACGGTTTGTGGGCCCAA\u003c/p\u003e\n \u003cp\u003eGAAGTAAGATCCTCTAGAAATAAAAGATCTTAAGTTTCATTAGATCTGTGTGTTGGTTTTTTGTGTG\u003c/p\u003e\n \u003cp\u003eAAAGGTGTGGGTTTGGATCCGGCCTCGGCCTC\u003c/p\u003e\n \u003cp\u003eCTCTCCGTCGGTTGTACGCGCATCTCTAGAGTCGGTGTCTTCTATGGAGG\u003c/p\u003e\n \u003cp\u003eATGCGCGTACAACCGACGGAGAGTATCGTACGATTCCC\u003c/p\u003e\n \u003cp\u003eCACACAAAAAACCAACACAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e24\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e29\u003c/p\u003e\n \u003cp\u003e27\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e33\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e30\u003c/p\u003e\n \u003cp\u003e77\u003c/p\u003e\n \u003cp\u003e82\u003c/p\u003e\n \u003cp\u003e71\u003c/p\u003e\n \u003cp\u003e85\u003c/p\u003e\n \u003cp\u003e83\u003c/p\u003e\n \u003cp\u003e84\u003c/p\u003e\n \u003cp\u003e75\u003c/p\u003e\n \u003cp\u003e78\u003c/p\u003e\n \u003cp\u003e89\u003c/p\u003e\n \u003cp\u003e80\u003c/p\u003e\n \u003cp\u003e92\u003c/p\u003e\n \u003cp\u003e98\u003c/p\u003e\n \u003cp\u003e99\u003c/p\u003e\n \u003cp\u003e97\u003c/p\u003e\n \u003cp\u003e85\u003c/p\u003e\n \u003cp\u003e83\u003c/p\u003e\n \u003cp\u003e78\u003c/p\u003e\n \u003cp\u003e67\u003c/p\u003e\n \u003cp\u003e32\u003c/p\u003e\n \u003cp\u003e50\u003c/p\u003e\n \u003cp\u003e38\u003c/p\u003e\n \u003cp\u003e20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003e\u003cstrong\u003eSynthesis of SARS-CoV-2\u003c/strong\u003e \u003cstrong\u003eRBD\u003c/strong\u003e \u003cstrong\u003egene in vitro\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eCMV1-CMV10, RBD1-RBD8, P1-P7, CP1-CP9, and CMV-R (Table \u003cspan\u003e1\u003c/span\u003e) were combined using the 2x Pfu PCR Mix system and subjected to LCR on MG25\u0026thinsp;+\u0026thinsp;under the following conditions: 95\u0026deg;C for 5 min, 45 cycles of 95\u0026deg;C for 30 s, 51\u0026deg;C for 20 s and 45\u0026deg;C for 4 min, and a final incubation at 45\u0026deg;C overnight for high-temperature ligation.\u003c/p\u003e\n \u003cp\u003eThe PCR reaction mixture consisted of 1 \u0026micro;L of LCR product, 1 \u0026micro;L of each of CMV-F and RBD-R primers (Table \u003cspan\u003e1\u003c/span\u003e), 12.5 \u0026micro;L of 2x Pfu PCR Mix, and 9.5 \u0026micro;L of ddH\u003csub\u003e2\u003c/sub\u003eO. The PCR amplification was carried out using the following program: 94\u0026deg;C for 3 min, 30 cycles of 94\u0026deg;C for 30 s, 55\u0026deg;C for 30 s, and 72\u0026deg;C for 2 min, and 72\u0026deg;C for 5 min. The target bands were identified through 1% gel electrophoresis and excised using a gel recovery kit.\u003c/p\u003e\n \u003cp\u003eFigure \u003cspan\u003e3\u003c/span\u003e shows the successful in vitro synthesis and amplification of the expression frame sequence of CMV\u0026thinsp;+\u0026thinsp;target antigen RBD\u0026thinsp;+\u0026thinsp;ployA60 (1,530 bp) after LCR\u0026thinsp;+\u0026thinsp;PCR reaction. The electrophoresis fragment matched the expected size, confirming the successful synthesis of the expression frame sequence.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eSynthesis and validation of\u003c/strong\u003e \u003cstrong\u003eRBD\u003c/strong\u003e \u003cstrong\u003egene\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThe LCR-PCR product was recovered from the gel, and its concentration (0.32 \u0026mu;g/\u0026mu;L) was measured spectrophotometrically. The DNA recovered from the gel was transfected into 293FT cells and incubated for 48 h. The RNA extracted and measured spectrophotometrically at a 1.3 \u0026mu;g/\u0026mu;L concentration was reverse-transcribed into cDNA. The RT-PCR products analyzed by electrophoresis matched the expected size of the \u003cem\u003eRBD\u003c/em\u003e target gene fragment (Figure 4A). The sequencing results indicated successful synthesis of the RBD fragment with a size of 639 bp (Figure 4B ＆ Supplement 1 ).\u003c/p\u003e\n \u003c/div\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur in vitro gene synthesis approach possesses numerous advantages compared to most of the current methodologies. Advantage 1: Most contemporary techniques require the target nucleotides to be divided into stable and homogeneous oligonucleotides with thermodynamic properties. This would preclude the formation of secondary structures resulting from nucleotide mismatches during hybridization, which might produce unstable hybrid DNA. In contrast, our software cleaved the sequences into varying lengths, specifically maintaining the 5\u0026prime;- and 3\u0026prime;-ends of each POS sequence in a free and unobstructed state. This specific design significantly facilitates the correct ligation of adjacent structural oligonucleotides by Taq DNA ligase. In case of any residual secondary structure during denaturation at 95 \u0026deg;C in the LCR, the free structure is released without considering the stability of the TM value.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe approach can be utilized for the synthesis of long genes. Stemmer et al. synthesized a 2.7-kbp sequence in a single step (7). However, the synthesized product needs to be verified during an intermediate stage due to an increased risk of errors in long sequences, which reduces the likelihood of obtaining an accurate fragment after assembly. Therefore, shortening the long sequences is essential to improve the accuracy of assembly.\u003c/p\u003e\n\u003cp\u003eAdvantage 2: Most current tools design split fragments of double-stranded DNA encompassing the whole gene, indicating that POSoligo-designed sequences have reduced the cost and turnaround time in the synthesis phase compared to the traditional tool design.\u003c/p\u003e\n\u003cp\u003eThe POS method offers economical and time-saving advantages over other methods in the synthesis of long DNA sequences. In the current method, a single-stranded DNA template is required to construct the entire gene, reducing the cost and turnaround time compared to methods that require a double-stranded DNA template encompassing the full-stranded gene. Smith et al. (15) assembled the uX174 phage (5386 bp) using 259 oligonucleotides (40 nt each) in 14 days. Xiong et al. (16) synthesized long DNA sequences (5-6 kb) in 5\u0026ndash;7 days. Conversely, our method synthesized full-length genes by single-step ligation and PCR in 1 day.\u003c/p\u003e\n\u003cp\u003ePOSoligo can be widely used for designing long DNA fragments in synthetic biology and biotechnology research. Subsequently, we will upgrade the functionality of the software.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experimental data are presented in this published article and supplementary file.\u003c/p\u003e\n\u003cp\u003eThe software during the current study are available in the [figshare] repository, DOI：https://doi.org/10.6084/m9.figshare.24879006.v1\u003c/p\u003e\u003cp\u003eSupplement\u003c/p\u003e\n\u003cp\u003eRBD fragment sequencing waveform files are placed in the zip file.\u003c/p\u003e\n\u003cp\u003eAuthor contributions\u003c/p\u003e\n\u003cp\u003eY.Y.T. designed the experiment, participated in the writing of the manuscript and created the images.J.S. completed the experiment and finished the writing of the manuscript, Y.C. participated in the experiment, C.H.Y. supervised and revised the manuscript, and G.H.Y. designed and supervised the study, interpreted data and wrote the manuscript.\u003c/p\u003e\n\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eThe Special fund for cancer prevention and treatment of Shanghai Science and Technology Development Foundation (Grant number CT20200517A).\u003c/p\u003e\n\u003cp\u003eCompeting interests\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eGoeddel D V , Kleid D G , Bolivar F ,et al.Expression in Escherichia coli of chemically synthesized genes for human insulin[J].Proceedings of the National Academy of Sciences, 1979, 76(1):106-110.DOI:10.1073/pnas.76.1.106.\u003c/li\u003e\n\u003cli\u003eHeyneker H L , Shine J , Goodman H M ,et al.Synthetic lac operator DNA is functional in vivo[J].Nature, 1976, 263(5580):748.DOI:10.1038/263748a0.\u003c/li\u003e\n\u003cli\u003eBeaucage S L , Caruthers M H .Deoxynucleoside phosphoramidites\u0026mdash;A new class of key intermediates for deoxypolynucleotide synthesis[J].Cheminform, 1981, 12(36).DOI:10.1002/chin.198136353.\u003c/li\u003e\n\u003cli\u003eItakura K .Expression of Escherichia coli of a chemically synthesized gene for the harmone somatostatin.[J].Science, 1977, 198.\u003c/li\u003e\n\u003cli\u003eAu L C , Yang F Y , Yang W J ,et al.Gene synthesis by a LCR-based approach: high-level production of leptin-L54 using synthetic gene in Escherichia coli.[J].Biochemical \u0026amp; Biophysical Research Communications, 1998, 248(1):200-203.DOI:10.1006/bbrc.1998.8929.\u003c/li\u003e\n\u003cli\u003eDillon P J , Rosen C A .A rapid method for the construction of synthetic genes using the polymerase chain reaction.[J].Biotechniques, 1990, 9(3):298, 300.DOI:10.1002/bmc.1130040510.\u003c/li\u003e\n\u003cli\u003eStemmer W P C , Crameri A , Ha K D ,et al.Stemmer, W. P. C. Crameri, A. Ha, K. D. Brennan, T. M. \u0026amp; Heyneker, H. L. Single-step PCR assembly of a gene and a whole plasmid from large numbers of oligonucleotides. Gene 164, 49-53[J].Gene, 1995, 164(1):49-53.DOI:10.1016/0378-1119(95)00511-4.\u003c/li\u003e\n\u003cli\u003ePusch C M , Ian G , Michael S .Repair of degraded duplex DNA from prehistoric samples using Escherichia coli DNA polymerase I and T4 DNA ligase.[J].Nucleic Acids Research(3):857[2023-11-10].DOI:10.1093/nar/26.3.857.\u003c/li\u003e\n\u003cli\u003eTian, J., Gong, H., Sheng, N. et al. Accurate multiplex gene synthesis from programmable DNA microchips. Nature 432, 1050\u0026ndash;1054 (2004). https://doi.org/10.1038/nature03151\u003c/li\u003e\n\u003cli\u003eFodor S P A, Read J L, Pirrung M C, et al. Light-directed, spatially addressable parallel chemical synthesis [J]. Science, 1991, 251(4995):767-773.\u003c/li\u003e\n\u003cli\u003eXiaolian G , Eric L P , Hua Z ,et al.A flexible light-directed DNA chip synthesis gated by deprotection using solution photogenerated acids[J].Nucleic Acids Research(22):4744-50[2023-11-10].DOI:10.1093/nar/29.22.4744.\u003c/li\u003e\n\u003cli\u003eHoover D M , Jacek L .DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis[J].Nucleic Acids Research, 2002(10):e43.DOI:10.1093/nar/30.10.e43.\u003c/li\u003e\n\u003cli\u003eJean-Marie R , Woonghee L , Gilles T ,et al.Gene2Oligo: oligonucleotide design for in vitro gene synthesis[J].Nucleic Acids Research(suppl_2):176-80[2023-11-10].DOI:10.1093/nar/gkh401.\u003c/li\u003e\n\u003cli\u003eYang G , Wang S , Wei H ,et al.Patch oligodeoxynucleotide synthesis (POS): a novel method for synthesis of long DNA sequences and full-length genes[J].Biotechnology Letters, 2012, 34(4):721-728.DOI:10.1007/s10529-011-0832-0.\u003c/li\u003e\n\u003cli\u003eSmith H O , Hutchison C A , Pfannkoch C ,et al.Generating a synthetic genome by whole genome assembly: phi X174 bacteriophage from synthetic oligonucleotides[J].Proceedings of the National Academy of Sciences of the United States of America, 2003(26):100.\u003c/li\u003e\n\u003cli\u003eAi-Sheng X , Quan-Hong Y , Ri-He P ,et al.A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences[J].Nucleic Acids Research(12):e98[2023-11-10].DOI:10.1093/nar/gnh094.\u003c/li\u003e\n\u003cli\u003eYamazaki K I , Mora K D , Saitoh K .BioBrick-based \u0026apos;Quick Gene Assembly\u0026apos; in vitro[J].Synthetic Biology, 2017.DOI:10.1093/synbio/ysx003.\u003c/li\u003e\n\u003cli\u003eZampini, M., Stevens, P., Pachebat, J. et al. RapGene: a fast and accurate strategy for synthetic gene assembly in Escherichia coli. Sci Rep 5, 11302 (2015). https://doi.org/10.1038/srep11302\u003c/li\u003e\n\u003cli\u003eLi, M., Zheng, M., Wu, S. et al. In vivo production of RNA nanostructures via programmed folding of single-stranded RNAs. Nat Commun 9, 2196 (2018). https://doi.org/10.1038/s41467-018-04652-4\u003c/li\u003e\n\u003cli\u003eAnnaluru, N. et al. (2012). Assembling DNA Fragments by USER Fusion. In: Peccoud, J. (eds) Gene Synthesis. Methods in Molecular Biology, vol 852. Humana Press. https://doi.org/10.1007/978-1-61779-564-0_7\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"nucleotide synthesis, patch oligonucleotide synthesis, software package","lastPublishedDoi":"10.21203/rs.3.rs-3764402/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3764402/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eOligonucleotide synthesis is crucial for molecular experiments. Bioinformatics has been applied to develop various algorithm-based tools for the in vitro synthesis of nucleotides. The primary method of synthesizing long-chain DNA molecules involves connecting short-chain oligonucleotides through ligase chain reaction (LCR) and polymerase chain reaction (PCR). Short-chain DNA molecules exhibit low mutagenesis rates, while LCR requires complementary interfaces on both ends of the two nucleic acid molecules or might alter the conformation of nucleotide chain conformation, terminating amplification. Therefore, molecular melting temperature, length, and specificity should be considered during the experimental design.\u003c/p\u003e\n\u003cp\u003ePatch oligonucleotide synthesis (POS)oligo is a specialized offline tool for nucleotide fragment synthesis.. It optimizes the oligonucleotide length and specificity based on input single-stranded DNA, generating multiple contiguous long strands (COS) and short patch strands (POS) with complementary ends. This process ensures free 5′- and 3′-ends during oligonucleotide synthesis, preventing secondary structure formation and ensuring specific binding between COS and POS without stabilizing the complementary strands based on Tm values. POSoligo was used to synthesize the linear RBD sequence of SARS-CoV-2 using only one DNA strand, several POSs for LCR ligation, and two pairs of primers for PCR amplification in a time- and cost-effective manner.\u003c/p\u003e","manuscriptTitle":"POSoligo: in vitro gene synthesis oligonucleotide software","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-12-22 15:33:43","doi":"10.21203/rs.3.rs-3764402/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-02-12T12:42:06+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-08T03:33:52+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"a47019ee-a761-474f-b978-4b346fcff7df","date":"2024-01-31T12:22:26+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-31T10:23:09+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-31T10:21:32+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2023-12-20T18:04:26+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2023-12-20T18:01:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2023-12-16T18:26:24+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0485be95-6d9e-4bf4-9850-226756dc78ba","owner":[],"postedDate":"December 22nd, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":27649889,"name":"Biological sciences/Biological techniques/Genetic engineering"},{"id":27649890,"name":"Biological sciences/Biochemistry/Dna"}],"tags":[],"updatedAt":"2024-04-11T04:45:23+00:00","versionOfRecord":[],"versionCreatedAt":"2023-12-22 15:33:43","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3764402","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3764402","identity":"rs-3764402","version":["v1"]},"buildId":"cBFmMYwuxLRRLfASyISRj","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}