Clostridium butyricum ameliorates atherosclerotic inflammation through regulation of gut microbiota | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Clostridium butyricum ameliorates atherosclerotic inflammation through regulation of gut microbiota Jing Wang, Junbai Ma, Yiwei Li, Yuanyuan Liu, Wenke Shen, Jian Liu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7249459/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Atherosclerosis (AS) is closely associated with gut microbiota that plays an important role in regulating intestinal mucosal barrier function, chronic inflammation, and immune homeostasis. Thus, targeting the modulation of gut microbitoa repesents a promising strategy for the control of AS. Clostridium butyricum ( C. butyricum ) serving as a kind of probiotics has shown a variety of biological benefits, but it’s impact on atherosclerosis remains poorly understood. Methods Sixty male ApoE −/− mice were randomly divided into 4 groups: control group (CON), model group (MOD), C. butyricum control group (CON/CB), and C. butyricum intervention model group (MOD/CB). After 10 weeks of intervention, mice were euthanized and associated indications were investigated. Results C. butyricum intervention alleviated atherosclerotic lesion and lipids indicators. Moreover, C. butyricum significantly reshapted the gut microbiota composition and enhanced the gut barrier. Furthermore, C. butyricum inhibited inflammation by reducing the levels of pro-inflammatory factors IL-6 and TNF-α in the plasma and aortic tissue of the MOD group, as well as upregulating the expression of the anti-inflammatory factor IL-10. Further verification exhibited that the anti-inflammatory effect of C. butyricum may attribute to the regulation of immunological IFN-γ + Th1, IL-4 + Th2, IL-17A + Th17 and Foxp3 + Treg, F4/80 + macrophages (iNOS + M1/CD206 + M2) by downregulating LPS/TLR4/NF-κB levels, had no significant regulatory effect on monocyte subsets (Ly6C high /Ly6C low ). Conclusion C. butyricum intervention exerts anti-AS effects by reshaping gut homeostasis via the regulation of immune cells, providing a potential strategy for clinical treatment. Clostridium butyricum (C. butyricum) Atherosclerosis (AS) Anti-inflammation Gut microbiota Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Introduction Atherosclerosis (AS) is a chronic progressive vascular disease characterized by lipid deposition in the arterial intima, smooth muscle cell proliferation, inflammatory response, and accumulation of fibrous tissue, eventually forming plaques and leading to vascular stenosis and blockage[ 1 ]. As the disease progresses, AS leads to loss of vascular elasticity and increases the risk of cardiovascular events such as heart disease, stroke, and peripheral arterial disease[ 2 ]. It is considered to be one of the root causes of cardiovascular disease worldwide, seriously affecting human health and life expectancy[ 3 ]. The complicated main pathogenic factors of AS involves hypertension, hyperlipidemia, smoking, and diabetes[ 3 , 4 ]. Recent studies have demonstrated that immune response, inflammation, metabolic disorders, and genetic susceptibility are closely involved in atherosclerotic development[ 5 ]. In particular, the role of inflammatory response in AS has gradually been recognized, and immune cells such as macrophages and T cells play a key role in plaque formation, plaque rupture, and vascular remodeling[ 6 ]. In addition, metabolic diseases such as diabetes and obesity have been shown to aggravate the progression of atherosclerosis and increase the incidence of cardiovascular events[ 7 ]. With the development of precision medicine, the discovery of new biomarkers and therapeutic targets has provided new directions for early detection, prevention, and personalized treatment of atherosclerosis[ 8 ]. AS represents a chronic inflammatory vascular disease that is responsible for the main pathological basis of cardiovascular and cerebrovascular diseases. Its occurrence and development are closely related to metabolic disorders, immune abnormalities, and oxidative stress[ 1 ]. Numerous studies have demonstrated that intestinal flora participates in the maintenance of host physiological homeostasis through metabolites, immune regulation, and barrier function, whereas dysbiosis of which can aggravate systemic inflammatory response and lipid metabolism disorders through the "gut-vascular axis", thereby promoting the progression of AS[ 9 ]. Clostridium butyricum ( C. butyricum ) is a major intestinal probiotic that has been shown to play an important role in maintaining intestinal health and immune homeostasis [ 10 ]. In recent years, accumulating studies have shown that C. butyricum is closely related to the regulatory balance of intestinal microbiota, but may also be associated with the occurrence and development of atherosclerosis [ 9 ]. Thus, supplementing C. butyricum may become a new strategy for preventing and treating atherosclerosis. In order to clarify the effect of C. butyricum on AS and its potential molecular mechanism, we selected 6-week-old male ApoE −/− mice and fed a high-fat diet (cholesterol content 1%) to establish an AS mouse model, and then intervened with C. butyricum . Through the combination of pathological observation and functional research, we explored whether C. butyricum could improve gut microbiota and chronic inflammation in AS mice and further revealed its molecular mechanism. This study may help to further improve the pathogenesis of chronic inflammation in AS, suggesting new targets for the clinical practice of the disease control. Materials and methods Animals The animal protocol used in this study was approved by the Ethics Committee of Ningxia Medical University (KYLL-2022-0315). Sixty male ApoE −/− mice (8 weeks old) were purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd. All mice were housed under standard, specific pathogen-free (SPF) condition in the Experimental Animal Center of Ningxia Medical University (ambient temperature 22 ± 1℃, air humidity 40%-70%) with a 12-h light/dark cycle. Bacterial preparation C. butyricum , a vacuum freeze-dried strain provided by the China General Microbiological Culture Collection Center (CGMCC, strain number 1.5205), was prepared as described by our lab[12]. In brief, PYG medium (modifed; Shandong, China) was used to resuscitate the bacteria. After culture in an anaerobic incubator (5% CO 2 ) at 37°C for 24 h, the visible bacterial colonies were placed in 10% skim milk to make a freeze-dried powder and stored at -80°C. During the intervention, PYG medium was used daily to resuscitate C. butyricum lyophilized powder in an anaerobic incubator (5% CO 2 ) at 37°C for 24 h, centrifuged at 3000×g for 5 min, and resuspended in sterile saline. The experimental final concentration was determine to 1×10 8 CFU/mL. Animal experimental modeling and intervention Sixty SPF male ApoE −/− mice were randomly divided into 4 groups: control group (CON), atherosclerosis model group (MOD), C. butyricum control group (CON/CB), and C. butyricum intervention model group (MOD/CB). The MOD group and MOD/CB group were given a 1% cholesterol atherosclerosis customized high-fat diet (Jiangsu Medison Biopharmaceutical Co., Ltd.) to establish the model, and the CON group and CON/CB group were given a normal diet. The mice in the CON/CB group and MOD/CB group were gavaged with C. butyricum bacterial liquid (0.1 mL/1.0×10 9 CFU/mouse), and the mice in the CON group and MOD group were gavaged with an equal amount of normal saline (NS). The food intake, blood glucose, and body weight of the mice were monitored during the feeding process, and the samples were collected after 10 weeks of intervention (Fig. 1A). Pathological staining Aortic intimal plaque area was measured. In brief, after the mouse aorta was completely removed, The isolated aortic sinus tissue was immersed in 4% paraformaldehyde solution for 24 h of fixation, washed twice with PBS, and transferred to 30% sucrose solution for osmotic pressure balance. The degree of tissue dehydration was monitored by gravity sedimentation. The ventricular basal segment trimmed samples were selected. After orientation embedding with O.C.T. cryoembedding medium, they were immediately placed in a -80℃ refrigerator for rapid freezing and solidification. Continuous coronal sections were made at -20℃ using a constant temperature microtome, and the section thickness was set to 8 µm. Oil red O staining, Masson trichrome staining (collagen fiber display) and hematoxylin-eosin staining (HE) were performed. After rinsing with distilled water to terminate the reaction, the samples were placed on a standardized background plate to absorb the residual water, and the plaque morphology was recorded using a microscopic imaging system (Aomori Olympus Co., Ltd., Japan), and the intimal lipid deposition area was quantified using Image J software.、 Immunofuorescence (IF) staining The slides were dewaxed, rehydrated and then placed in sodium citrate solution and heated in a microwave oven over medium heat for 18 min to unmask the antigen. The tissue was demarcated with an immunohistochemistry pen, and goat serum was used to seal the sections at room temperature for 30 min. After the liquid was removed, the sections were incubated with occludin antibody(sc-133256, 1:200 dilution,Santa Cruz Biotechnology, USA) and claudin-4 antibody(sc-376643, 1:200 dilution, Santa Cruz Biotechnology, USA) overnight at 4℃ in the dark. After washing with phosphate-buffered saline (PBS), the sections were incubated with goat anti-mouse FITC (GB22301, 1:200 dilution, Servicebio, China) at 37℃ for 1 h. After washing with PBS, the plates were sealed with anti-fuorescence quenching mounting tablets containing DAPI (S2110, Solarbio, China), and subsequently examined under a fluorescence microscope. Flow cytometry (FCM) Preparation of aortic macrophages (Mψs) suspension was performed. In brief, the aortic root tissue was mechanically crushed and placed in 10 mL of PBS buffer containing 0.15% type IV collagenase to form a homogenous suspension. The tissue suspension was digested at 37℃ for 20 min. The digestion product was gently blown for 3 min and washed with RPMI 1640 medium containing 2% FBS; undigested tissue fragments were filtered through a 200-mesh nylon filter and single-cell suspension was collected. The filtrate was centrifuged at 400×g for 5 min, then the supernatant was discarded and the precipitate was resuspended in 100 µL of RPMI 1640 medium containing 2% FBS. Following complete anesthesia,Anticoagulated whole blood collected via eyeball bleeding was centrifuged at 1,500 rpm for 10 min to separate plasma. Erythrocytes in the cellular fraction were lysed using Erythrocyte Lysis Buffer with 10 min incubation on ice. After two washing cycles with RPMI 1640 medium supplemented with 2% fetal bovine serum (FBS), leukocyte suspensions were filtered through a 300µm nylon mesh and adjusted to a concentration of 1×107 cells/mL for flow cytometry analysis. Spleens were mechanically dissociated in 5 mL 2% RPMI 1640 using sterile glass homogenizers. The resulting suspension was filtered through 200-µm mesh and subjected to erythrocyte lysis as described for PBMC isolation. Viable leukocytes were resuspended in complete medium and maintained at 4°C until analysis. Aortic tissues were mechanically dissociated into 1 mm³ fragments using sterile surgical scissors and subjected to enzymatic digestion in 10 mL PBS containing 0.15% collagenase type IV (C8106,Solarbio, China) with orbital shaking at 37°C for 20 min. The digested suspension was triturated through a 200-µm nylon mesh to obtain single-cell suspensions, followed by three washing cycles with RPMI 1640 supplemented with 2% FBS under centrifugation at 400 ×g for 5 min at 4°C. Cell pellets were resuspended in 100 µL staining buffer (2% RPMI 1640) for subsequent immunophenotyping. A 100 µL aliquot of PBMC suspension was simultaneously incubated with 1 µL each of the following fluorochrome-conjugated antibodies: phycoerythrin (PE)-Gr-1 (108408,Biolegend, USA), eFluor 450-CD45 (48-0451-82, eBioscience, USA),fluorescein isothiocyanate (FITC)-CD11b (101206, Biolegend, USA), and allophycocyanin (APC)-Ly6C (128016, Biolegend, USA) for 30 min in the dark at 4℃. Meanwhile, the cells were stained with isotype-matched control antibodies, respectively. Finally, the prepared samples were detected using a CytoFLEX flow cytometer (Beckman Coulter, USA). For cytokine intracellular staining, PBMCs were stimulated with Cell Stimulation Cocktail containing protein transport inhibitors(00-4970-03, eBioscience, USA) for 3 h at 37°C with 5% CO₂. Surface CD4 labeling was performed using FITC-CD4 (11-0042-85, eBioscience, USA) prior to fixation/permeabilization. Following fixation and permeabilization, the samples were separated into two tubes, and one tube was stained with the following antibodies for intracellular cytokine detection:Percp -IL-17A(506944, Biolegend, USA),APC-IFN-γ (505810, Biolegend, USA) and PE-IL-4(504104, Biolegend, USA).PE-Foxp3(12-5773-82, eBioscience, USA) staining was performed in the other tube.Finally, the prepared samples were detected using a CytoFLEX flow cytometer (Beckman Coulter, USA). 100 µL of single-cell suspension (aortic tissue) was incubated with 1 µL of CD16/CD32 (553142, BD Biosciences, USA) for 15 min to block non-specific binding of antigen. Subsequently, suspended cells were stained with antibodies for surface and intracellular markers including PE-F4/80 (123110, Biolegend, USA), FITC-TLR4 (53-9041-82, eBioscience, USA), BV421-CD206 (141717, Biolegend, USA) and APC-iNOS (17-5920-82, eBioscience, USA) for 30 min at 4℃. Meanwhile, the cells were stained with isotype-matched control antibodies, respectively. Finally, the prepared samples were detected using a CytoFLEX flow cytometer (Beckman Coulter, USA). Enzyme-linked immunosorbent assay (ELISA) The ELISA method was used to detect the levels of plasma inflammatory factors IL-1β, IL-6, IL-10, and TNF-α. The specific steps were performed according to the instructions of the commercially available kits. Determination of plasma LPS content The Limulus amebocyte lysate kit (Xiamen Bioendo Technology Co., Ltd., Xiamen, China) was used to detect LPS levels in the plasma of mice according to the manufacturer’s instructions. In brief, standard curve was established: According to the linear range of the kit, the bacterial endotoxin standard (0.1-1.0EU/mL) was diluted with pyrogen-free water to establish a standard concentration series. Then, Sample was pretreatd: Mouse plasma was centrifuged at 3000×g for 10 min to remove particulate matter, and the supernatant was placed in a pyrogen-free EP tube for later use. Thrid, the standard/sample and horseshoe crab reagent were added to the pyrogen-free test tube in proportion according to the instructions, incubate at 37°C for 10 min; the color development matrix solution was added and incubated for 6 min. Termination and detection: azo reagents I, II, and III in sequence were added to terminate the reaction and develop color. After standing at room temperature for 5 min, the absorbance (OD value) was measured at 545 nm by an enzyme reader. Lastly, quantitative analysis: The standard curve was fitted with the standard concentration as the horizontal axis and the corresponding OD value as the vertical axis (R²>0.99), and the sample LPS concentration was calculated by a linear equation. Clarification of the characteristics of gut microbiota Total microbial genomic DNA was extracted from mouse fecal samples using the FastPure Stool DNA Isolation Kit (MJYH, Shanghai, China). The DNA extract was checked on 1% agarose gel, and DNA concentration and purity were determined with NanoDrop2000 spectrophotometer (Thermo Scientific, United States). DNA samples that met the quality requirements were diluted with sterile ultrapure water to a final concentration of 1 ng/µL as PCR templates. The diluted genomic DNA was used as a template, and specific primers containing Barcodes were used for the target sequencing region. The amplification reaction was carried out in conjunction with New England Biolabs' Phusion® High-Fidelity PCR Master Mix with GC Buffer system (containing optimized buffer and high-fidelity polymerase). This combination simultaneously improves the amplification efficiency and product fidelity through the stabilizing effect of GC Buffer and the precise replication ability of the polymerase to ensure the repeatability of the experimental results and the accuracy of the sequencing data. After pooling and purification of PCR products, the Promega QuantiFluor™ -ST blue fluorescence quantitative system was used to accurately quantify the PCR products, and the samples were mixed in proportion according to the sequencing requirements. Subsequently, the TruSeqTM DNA Sample Prep Kit was used to complete the library construction: first, the specific adapter sequence was accurately connected to both ends of the target region through PCR reaction; the amplified product was separated by 2% agarose gel electrophoresis, the target band was cut and purified using a gel recovery kit; the purified product was eluted with Tris-HCl buffer, and the integrity of the fragment was verified by electrophoresis; finally, sodium hydroxide denaturation treatment was used to obtain a single-stranded DNA template. This process controls the uniformity of the sample through fluorescence quantification, combined with high-precision adapter connection and denaturation technology, to ensure that the library construction meets the requirements of high-throughput sequencing. And then sequencing: the DNA fragments were anchored to the chip surface through complementary pairing; then the extension reaction was carried out starting from the immobilized primer, so that the template chain was covalently fixed to the chip to form a spatial positioning; after denaturation treatment, the free end was complementary to the adjacent primer to form a bridge structure, and a high-density DNA cluster was generated through multiple rounds of amplification. After the double-stranded DNA was converted into a single-stranded template by specific cutting, an engineered DNA polymerase and a 4-color fluorescent labeled dNTP (including a reversible terminator group) were added, and only a single base was incorporated in each cycle; the laser system was used to collect fluorescent signals to determine the type of base, and the nucleotides were polymerized after chemical cutting of the fluorescent group and the terminator group. By statistically analyzing the fluorescent signal results collected in each round and bioinformatics, the high-throughput and analysis of the template sequence were finally achieved. Blood lipids Commercial kits were used to detect the levels of TC, TG, LDL, and HDL in plasma of mice in diverse groups following the instructions for specific steps. Quantitative real‑time PCR According to the manufacturer’s protocol, total RNA was extracted from aortic tissue using the RNA Extraction kit (Omega, USA), and the UEIris RT mix with DNase (All-in-One) (UE, China) was used to synthesize cDNA. Then, RT-qPCR was performed using Universal SYBR Green qPCR Supermix (UE, China). The expression of the target gene was normalized by GAPDH. All experiments were carried out in three independent experiments. Primer sequences (Sangon Biotech, Shanghai, China) were shown in Table 1. Table 1 List of primers used for qRT-PCR. Gene Primers Sequences (5’ to 3’) TNF-α FORWARD CCAGACCCTCACACTCACAA REVERSE ATAGCAAATCGGCTGACGGT IL-6 FORWARD ATAGCAAATCGGCTGACGGT REVERSE ATGAATTGGATGGTCTTGGTCCTTAGC IL-10 FORWARD TGAATTCCCTGGGTGAGAAG REVERSE GCTCCACTGCCTTGCTCTTA IL-1β FORWARD ACCTTCCAGGATGAGGACATGA REVERSE CTAATGGGAACGTCACACACCA NF-κB FORWARD AAATGGGAAACCGTATGAGCCTGTG REVERSE GTTGTAGCCTCGTGTCTTCTGTCAG TLR4 FORWARD TGACATGTGCAACACCTGTAGAGATG REVERSE ACTGACCACTGACACACTGATGATTG Statistical analysis SPSS 21.0, GraphPad Prism 10, and Excel were used to complete data analysis and chart construction. Quantitative data are expressed as mean ± standard deviation: multiple groups of data that conform to normal distribution and homogeneity of variance were analyzed using one-way analysis of variance (ANOVA). The LSD-t test was used for pairwise comparisons between groups. Non-normal distribution data were tested using non-parametric tests. 16S rRNA gene sequencing data were analyzed for inter-group differences using the Kruskal-Wallis test. The association between intestinal flora abundance and inflammatory indicators was evaluated based on Pearson correlation analysis to reveal the potential interaction between microbial communities and host phenotypes. The correlation between intestinal flora and inflammation and other indicators was analyzed by Pearson analysis. P < 0.05 was considered to be statistically significant. Results C. butyricum improves physiological parameters and blood lipids in AS mice To evaluate whether differences in dietary intake contribute to the effects of C. butyricum intervention, we monitored food intake, body weight, and blood glucose. After 10 weeks of experimental intervention, the body weight of the MOD group increased steadily compared with the CON group, and C. butyricum treatment had no effect on body weight gain compared with the AS group (Fig. 1B). In terms of food intake, the average food intake of mice in each group increased during the intervention period, but without significant change (Fig. 1C). For blood glucose, there was no significant difference in blood glucose after intervention (Fig. 1D). Thus, these indicates that C. butyricum intervention had no significant effect on energy intake. To further investigate the effect of C. butyricum on blood lipids in AS mice, the plasma biochemical indices of mice were measured. Compared to the CON group, the levels of plasma TC ( P < 0.01, Fig. 1E), TG ( P < 0.05, Fig. 1F), and LDL-C ( P < 0.001, Fig. 1G) in the MOD group were significantly increased. After intervention with C. butyricum , the levels of plasma TC, TG, and LDL-C were significantly improved (all P < 0.05). There was no significant difference in the level of plasma HDL-C. In addition, no significant difference in blood lipids was found between the CON group and the CON/CB group. These data suggest that C. butyricum can prevent dyslipidemia in AS mice. C. butyricum alleviates AS progression in ApoE −/− mice The protective effect of C. butyricum on AS in mice was evaluated by pathological staining. The macroscopic pathological analysis of the aorta and its sinus tissues was performed by Oil Red O staining, and the plaque progression was quantified by the ratio of lipid deposition area to the total aortic area (Fig. 2A, C). The results showed that the aortic lipid plaque area in the MOD group was significantly increased compared with that in the CON group ( P < 0.001, Fig. 2B), while C. butyricum intervention significantly reduced lipid deposition ( P < 0.01). The cross-sectional analysis of the aortic sinus showed that the plaque area in the MOD group was significantly worse than that in the CON group, and which was notably downregulated after C. butyricum intervention ( P < 0.05, Fig. 2D), suggesting that C. butyricum may protect against lipid accumulation in the development of vascular plaques. Masson staining showed that the aortic sinus muscle fibers were red and the collagen fibers were blue (Fig. 2C). Quantitative analysis found that the proportion of collagen fibers in the MOD group was significantly higher than that in the CON group ( P < 0.001), and which was improved after C. butyricum intervention ( P < 0.05, Fig. 2E). HE staining results further supported that C. butyricum possessed a markedly protective efficacy on the attenuation of AS plaque pathological damage (Fig. 2C). The above results suggest that C. butyricum may delay the progression of AS by regulating lipid metabolism and collagen deposition. C. Butyricum intervention rectifies gut microbiota dysbiosis in AS mice Numerous studies have confirmed that intestinal microbiota imbalance is closely related to the occurrence and development of AS[12, 13]. Therefore, the third-generation high-throughput sequencing of 16S rRNA from specimens of mouse feces was performed to evaluate the modulatory impact of C. butyricum on the gut microbiota of AS mice. The dilution curve results showed that while the number of sequences increased to 4,000, the curves of each group of samples gradually flattened (Fig. 3A), indicating that the amount of sequencing data was reasonable and reliable, sufficient to cover the entire bacterial diversity. Subsequently, the inter-index difference test and α diversity were further evaluated. The results of the inter-index difference test showed that compared to the CON group, the α diversity of the MOD group was significantly decreased ( P < 0.05). After C. butyricum administration, there was no significant difference in the α diversity of the MOD/CB group compared with MOD group (Fig. 3B, C). Moreover, β diversity was evaluated by principal coordinates analysis (PCoA). The distance between points reflects the differences between and within groups of samples. The PCoA results based on the Bray-curtis algorithm showed (Fig. 3D) that the points in each group were close to each other, and the distances between the groups were relatively separated (Fig. 3D, E). The evaluation of the gut microbiome health index (GMHI) found that C. butyricum significantly upregulated the flora health index ( P < 0.01, Fig. 3F) and downregulated the microbiota dysbiosis index ( P < 0.01, Fig. 3G). Next, the community composition was evaluated by Venn diagram and community Bar diagram. The Venn diagram results showed (Fig. 3H) that there were 9 OTUs in common of each group; OTUs of 553, 276, 609 and 219 were unique to CON group, MOD group, CON/CB group or MOD/CB group. Taken together, composition and proportion of the gut microbiota of AS mice could be reshaped to a certain extent after C. butyricum intervention. To further investigate the target of differentical bacteria during the modulation of C. butyricum intervention, the relative abundances of gut microbiota at the phylum, genus, and species levels in each group of mice were determined, respectively (Fig. 4A, B, D). Specifically, at the phylum level, the dominant bacteria in each group were mainly Bacillota , Bacteroidota , and Verrucomicrobiota . Compared to the CON group, the relative abundance of Bacteroidota in the model group decreased, whereas which was increased after C. butyricum intervention. In addition, compared with the MOD group, the abundance of Verrucomicrobiota in the MOD/CB group was upregulated (Fig. 4C). At the genus level, relative abundance of Akkermansia and Paramuribaculum decreased in AS.(Fig. 4B). Importantly, after C. butyricum intervention, the relative abundance of Akkermansia and Lactobacillus were upregulated (Fig. 4E). At the species level, the relative abundances of Akkermansia_muciniphila , Ligilactobacillus murinus , Barnesiella intestinihominis , Paramuribaculum intestinale , and Duncanialla freteri in the model group were decreased. Crucially, C. butyricum intervention remarkablely increased the relative abundance of Akkermansia_muciniphila , Allobaculum fili , Faecalibaculum_rodentium , Barnesiella_intestinihominis , and Lactobacillus_taiwanensis (Fig. 4F), further suggesting that C. butyricum intervention reshaped the intestinal microecology by modulating these differential bacteria candidites. C. Butyricum intervention enhances the intestinal barrier function of AS mice Due to the above rectification the gut dysbiosis of C. butyricum on AS mice, we further investigated the impact of C. butyricum on gut barrier. Tight junctions are the main connection between intestinal epithelial cells and are essential for maintaining the integrity and function of the intestinal barrier[14]. In order to clarify the effect of C. butyricum intervention on the intestinal barrier of AS mice, IF staining was used to detect the expression levels of tight junction proteins occludin and claudin-4 in the colon tissue of each group of mice. The results showed that the expression levels of occludin and claudin-4 in the MOD group were significantly lower than those in the CON group ( P < 0.05, Fig. 5A-D), indicating that the intestinal barrier of AS mice was damaged. Nevertheless, after C. butyricum intervention, the expression levels of occludin and claudin-4 were significantly increased compared with the MOD group ( P < 0.05, Fig. 5A-D), suggesting that C. butyricum intervention improves the integrity and function of the intestinal barrier. C. butyricum significantly suppresses chronic inflammation in AS mice Gut dysbiosis has been acceleratingly considered to participate in the inflammation of AS[15–17]. Furthermore, based on the core role of chronic inflammation in the progression of AS, we evaluated the effects of C. butyricum on the plasma levels of IL-1β, IL-6, TNF-α, and IL-10 (Fig. 6A-D). The results showed that the level of pro-inflammatory factor IL-6 in the MOD group was significantly higher than that in the CON group ( P < 0.01), while the level of anti-inflammatory factor IL-10 was significantly reduced ( P < 0.05). After intervention with C. butyricum , the level of plasma IL-6 was significantly lower than that in the MOD group ( P < 0.05), while the level of TNF-α in the MOD group showed an upward trend compared with the CON group without statistically significant difference compared with the CON group. After C. butyricum treatment, there was a downward trend but no statistical significance. Meanwhile, further detection of the expression of inflammatory factors in situ aortic tissue (Fig. 6E-H) showed that the expressions of IL-1β, IL-6 and TNF-α in the MOD group were significantly higher than those in the CON group (all P < 0.05), whereas C. butyricum intervention significantly inhibited the expression of TNF-α in the aorta ( P < 0.05), and the IL-6 level showed a downward trend with no statistical difference. These results indicated that C. butyricum treatment possessed an anti-inflammatory effect on AS mice. C. Butyricum regulates inflammatory cells in AS mice To further reveal the underlying mechanism of anti-inflammatory protection of C. butyricum against AS, the potential critical inflammatory cells involved in the AS were separately measured. The results showed that compared to the MOD group, the proportion of TH1 (IFN-γ + ) in CD4 + T cells from peripheral blood mononuclear cells (PBMCs) and mouse spleen were decreased after C. butyricum intervention (all P < 0.01), but the proportion of TH2 (IL-4 + ) was increased ( P < 0.05) (Fig. 7A-H). This result suggested that C. butyricum may repress the chronic inflammation mediated by TH1/TH2 imbalance in AS pathology by inhibiting pro-inflammatory TH1 and enhancing anti-inflammatory TH2 response. Moreover, the effect of C. butyricum on the proportions of TH17 cells and Treg cells in PBMCs and spleen cells of AS mice were further evaluated. We found that compared to the CON group, the proportions of TH17 (CD4 + IL-17A + ) cells in PBMCs and spleen of mice in the MOD group was significantly increased ( P < 0.05), suggesting that TH17-mediated inflammatory response may play a key role in the impairment of AS inflammation. Intriguingly, after intervention with C. butyricum , the proportion of TH17 cells was significantly reduced compared with that in the MOD group ( P 0.05), and after intervention with C. butyricum , the proportion of Treg cells showed an upward trend (Fig. 9A-D). The above results indicate that C. butyricum may restrain AS-related inflammatory response by regulating the differentiation and function of TH17 cells. MDSCs are a heterogeneous class of immune negatively regulatory cells[18]. FCM was used to detect the dynamic changes of CD11b + GR-1 + Ly6C + labeled MDSCs in the peripheral blood and spleen of AS model mice[19] (Fig. 7A-H). The results showed that compared with the CON group, the proportion of MDSCs in the peripheral blood and spleen of mice in the MOD group was significantly increased ( P < 0.05), suggesting that the pathological process of AS may drive the expression of MDSCs through chronic inflammatory signals. After C. butyricum intervention, the proportion of MDSCs in the MOB/CB group exerted no notable change compared with the MOD group ( P >0.05). In addition, the proportion of MDSCs in the CON/CB group was significantly higher than that in the CON group ( P < 0.05), indicating that C. butyricum may independently induce the generation of MDSCs in the absence of AS pathological background. Macraphages (Mψs) and its polarization in AS play a key role in the formation, development and instability of plaques[20]. Further analysis of the influnence of C. butyricum on aortic Mψs revealed that compared with the CON group, the proportion of Mψs (F4/80 + ) in the MOD group was significantly increased ( P < 0.05, Fig. 11A-B), and pro-inflammatory M1 macrophages (F4/80 + iNOS + ) dominated ( P < 0.05, Fig. 11C-D). After C. butyricum intervention in AS, the proportion of Mψs was significantly reduced compared with the MOD group ( P < 0.05), while the proportion of M1 decreased and the proportion of anti-inflammatory M2 macrophages (F4/80 + CD206 + ) increased significantly ( P < 0.05, Fig. 11E-F). This result indicated that C. butyricum not only inhibited the excessive infiltration of M1 Mψs in the pathological site of AS, but also may reshaped its functional phenotype and promoted the transformation of the inflammatory microenvironment to a repair type M2 Mψs. Monocytes are the main peripheral source of aortic macrophages[21]. Based on the CD11b⁺CD45⁺ marker, Ly6C high monocytes are preferentially recruited to the lesion site during inflammation and differentiate into proinflammatory macrophages; while Ly6C low monocytes exhibit anti-inflammatory and tissue repair functions[22]. The results showed that compared with the CON group, the proportion of monocytes (CD11b + CD45 + ) in the MOD group was significantly increased ( P < 0.05, Fig. 12A-B, F-G), and C. Butyricum intervention failed to reverse this phenomenon. Proinflammatory (Ly6C high ) and anti-inflammatory (Ly6C low ) monocyte subpopulations exhibited no statistical differences before and after intervention, indicating that C. Butyricum may exert its anti-atherosclerotic effect partially through monocyte-independent regulatory pathways. Mechanistically, TLR4 is a cell membrane surface receptor on inflammatory cells that activates signaling pathways of inflammation after binding to LPS derived from gut microbiota imbalance[23]. In order to clarify the molecular mechanism by which C. butyricum inhibits the activation of Mψs, FCM was used to confirm that TLR4 was expressed in Mψs (Fig. 13A), plasma LPS and the expression of TLR4 and NF-κB in aortic tissue were detected. The results showed that the expression of LPS, TLR4 and NF-κB was increased in the MOD group ( P < 0.05), and the expressions were significantly downregulated after C. butyricum intervention ( P < 0.05, Fig. 13B-E), indicating that C. butyricum may inhibit LPS/TLR4/NF-κB to exert the anti-inflammatory effect in Mψs. Correlation analysis between intestinal flora, inflammation and blood lipids after C. Butyricum intervention PCoA and distance matrix regression model (db-RDA) based on Bray-Curtis distance matrix showed that LPS, LDL-C, HDL-C and cytokine IL-10 significantly affected the β diversity of intestinal microbial community. At the genus level, LPS (AdjR²=0.85, P < 0.001, Fig. 14A), LDL-C (AdjR²=0.46, P < 0.01, Fig. 4B) and HDL-C (AdjR²=0.51, P < 0.01, Fig. 14C) were positively correlated with community structure, while IL-10 was negatively correlated (AdjR²=0.50, P < 0.01, Fig. 14D). The results of species-level analysis were consistent with those at the genus level (LPS: AdjR²=0.84; LDL: AdjR²=0.46; HDL: AdjR²=0.51; IL-10: AdjR²=0.50, all P < 0.01, Fig. 14F-I), suggesting that lipid metabolism and immune regulatory factors may reshape the intestinal microecology by modulating the abundances of specific bacterial genera, respectively. Discussion In the present study, we selected the butyricum-producing strain C. butyricum and explored the protective efficacy of C. butyricum on AS mice induced by a high-fat diet in ApoE −/− mice. Morevoer, this study further revealed the underlying mechanisms of the effectiveness of C. butyricum via the immunomodulatory effects and reshaping the gut microecology. Therefore, C. butyricum is expected to become a safe, effective, and inexpensive intervention agent for the prevention and treatment of AS. Impaired intestinal barrier function is one of the important causes of AS. Its core mechanism involves downregulation of tight junction proteins (such as occludin and claudin-4), which leads to increased intestinal permeability and endotoxin translocation[ 24 ]. This study found that the expression levels of occludin and claudin-4 in the colon tissue of mice in the MOD group were significantly reduced, while the expression of the two proteins was significantly restored after intervention with C. butyricum . Consistent with previous studies, C. butyricum can directly enhance the junction between intestinal epithelial cells by secreting short-chain fatty acids (SCFAs) such as butyrate may inhibit the destruction of tight junction structure by proinflammatory factors[ 25 ]. Gut dysbiosis is closely related to the pathological progression of AS, which is characterized by reduced diversity, reduced abundance of beneficial bacteria, and proliferation of conditional pathogens. In this study, 16S rRNA sequencing revealed that the α diversity of the intestinal flora of mice in the AS model group was significantly reduced, characterized by reduced abundance of Bacteroidota and Verrucomicrobiota . However, C. butyricum intervention reshaped the gut homeostasis by remarkably upregulating the abundance of Verrucomicrobiota and key functional bacterial genera ( Akkermansia , Lactobacillus ) and the flora health index. Akkermansia muciniphila , the main colonizing bacteria of the intestinal mucus layer, can produce acetic acid and propionic acid to promote mucus layer barrier thickening and inhibit pathogen translocation[ 26 ]. In addition, the restoration of the Lactobacillus genus may reduce inflammatory responses by competitively inhibiting the growth of pathogens and regulating Th17/Treg balance[ 27 ]. These findings suggest that C. butyricum may improve the intestinal microenvironment and indirectly enhance barrier function by enriching SCFAs-producing flora. Through Bray-Curtis distance matrix and db-RDA analysis, this study further revealed the significant correlation between intestinal flora and lipid metabolism indicators (LDL-C, HDL-C) and inflammatory factors (LPS, IL-10). At the genus level, Ileibacterium , Desulfovibrionaceae and other genera were positively correlated with LDL-C and LPS, while Akkermansia and Ligilactobacillus were positively correlated with IL-10. As a representative of sulfate-reducing bacteria, the overproliferation of Desulfovibrionaceae can lead to the accumulation of hydrogen sulfide[ 28 ]. In contrast, Akkermansia muciniphila inhibited LPS-induced systemic inflammation[ 29 ]. At the species level, the anti-inflammatory effect of Ligilactobacillus_murinus may be achieved by regulating IL-10 secretion[ 30 ]. The above results suggest that C. butyricum may improve intestinal flora imbalance by increasing the abundance ratio of probiotics, thereby mediating the protective effect on the mucosal barrier and improving AS-related metabolic inflammation. This study revealed that C. butyricum improves AS through "microbiota-intestinal barrier-blood vessels", providing preliminary experimental evidence for its clinical application. Animal models are difficult to simulate the complex pathological environment of human AS. Further investigation will combine metabolomics and single-cell sequencing technology to further analyze the molecular mechanism of C. butyricum regulating the interaction of the "intestinal-vascular axis". TH1 and TH2 cells are two important subsets of CD4 + T cells, both of which regulate the pro-inflammatory and anti-inflammatory balance of immune responses by secreting characteristic cytokines[ 31 ]. TH1 cells mainly secrete IFN-γ, which activates Mψs and promotes cellular immune responses[ 32 ]. TH2 cells secrete cytokines such as IL-4 to mediate humoral immunity and anti-inflammatory responses[ 33 ]. Increasd proportion of TH1 (IFN-γ + ) and decreased proportion of TH2 (IL-4 + ) indicated that the TH1/TH2 imbalance towards the pro-inflammatory direction in the pathological state of AS. This imbalance may activate macrophage M1 polarization through IFN-γ secreted by TH1 cells, promoting the release of pro-inflammatory factors (such as TNF-α and IL-6)[ 34 – 35 ]. At the same time, T-bet, a key nuclear transcription factor of TH1 cells, inhibits the differentiation of TH2, leading to a decrease in the secretion of anti-inflammatory factors such as IL-4[ 36 ], thereby exacerbating plaque inflammation. Importantly, this TH1/TH2 imbalance was reversed by C. butyricum administration. Studies have shown that C. butyricum may inhibit Stat1 phosphorylation and block IFN-γ signaling through metabolites (such as butyrate), thereby inhibiting TH1 differentiation[ 37 ]. At the same time, it activates Stat6 or GATA3, a key transcription factor for TH2 differentiation, and promotes IL-4 expression[ 38 ]. In addition, IL-4 secreted by TH2 cells can induce macrophages to polarize to the M2 phenotype, forming a positive feedback regulation loop and further amplifying the anti-inflammatory effect[ 39 ]. This finding provides a direct evidence that C. butyricum regulates AS inflammation through the TH1/TH2 axis. As a proinflammatory T cell subset, TH17 cells play a core role in autoimmune diseases and chronic inflammation by secreting cytokines such as IL-17[ 40 ]. This study showed that the proportion of TH17 cells in the peripheral blood and spleen of mice in the MOD group was significantly increased, while the TH17 level was significantly reduced after C. butyricum intervention, but Treg cells did not show significant changes. This result suggests that C. butyricum may regulate the inflammatory response by inhibiting the differentiation of TH17 cells. Excessive activation of TH17 has been shown to be closely related to inflammatory cell infiltration and plaque instability in plaques[ 41 ]. IL-17 can induce endothelial cells to express adhesion molecules (such as Vcam-1 and Icam-1), promote monocyte recruitment, and stimulate macrophages to release proinflammatory factors (such as TNF-α and IL-6)[ 42 ]. The inhibitory effect of C. butyricum on TH17 may be through direct inhibition of RORγt transcriptional activity through metabolites (such as butyrate), thereby inhibiting the expression of TH17 differentiation-related genes [ 43 ]. In addition, the lack of significant changes in Treg cells may be related to the intervention time and dose, and may also suggest that C. butyricum 's regulation of TH17 is independent of the Treg-mediated immunosuppression pathway. Further verification is needed in the future in combination with Treg cell function experiments. Although C. butyricum had no significant effect on CD45 + CD11b + monocytes and their subsets (Ly6C High pro-inflammatory monocytes, Ly6C Low anti-inflammatory monocytes), the proportion of MDSCs (CD45 + GR-1 + Ly6C + ) in the model group mice was significantly increased. MDSCs as immunosuppressive cells participate in immune escape by inhibiting T cell function in chronic inflammation[ 44 ]. However, the proportion of MDSCs did not decrease significantly after C. butyricum intervention. Further experiments need to be combined to further clarify the role of MDSCs in C. butyricum intervention. Mψs is a core component of the immune environment of atherosclerotic plaques, and its polarization state (M1/M2 phenotype) affects plaque progression and stability[ 45 ]. This study showed that the proportion of Mψs in the aorta of mice in the MOD group was significantly increased, and M1 macrophages dominated. However, after C. butyricum intervention, the proportion of M1 decreased and the number of M2 macrophages increased significantly. M1 macrophages aggravate plaque inflammation by secreting pro-inflammatory factors such as IL-1β and IL-12, while M2 macrophages promote tissue repair by releasing anti-inflammatory factors such as IL-10 and TGF-β[ 46 ]. Experiments have shown that C. butyricum -induced M2 polarization may reduce the expression of M1-related genes iNOS and TNF-α by inhibiting the TLR4/NF-κB signaling pathway. In addition, M2 macrophages can secrete matrix metalloproteinase inhibitors (TIMPs) to inhibit the degradation of extracellular matrix, thereby enhancing the stability of plaque fibrous cap[ 47 ]. This finding provides a cellular basis for the anti-atherosclerotic effect of C. butyricum . TLR4, a pattern recognition receptor, mediates LPS signal activation that is a key mechanism for the transformation of macrophages into pro-inflammatory phenotypes[ 48 ], which is closely related to AS plaque inflammation and progression. This study confirmed that C. butyricum intervention can significantly reduce plasma LPS levels and TLR4/NF-κB expression in aortic tissue, suggesting that it inhibits macrophage overactivation by blocking the LPS-TLR4 axis. Previous studies by our lab have confirmed that intestinal flora metabolites (such as butyrate) can downregulate NF-κB-mediated inflammatory factor release by inhibiting TLR4 endocytosis and MyD88 signal transduction[ 49 ]. The above mechanism is consistent with the TLR4/NF-κB pathway in this study, suggesting that C. butyricum may regulate the AS inflammatory microenvironment through metabolic-immune multi-pathways, providing an experimental basis for AS treatment strategies based on flora intervention. Intestinal barrier integrity is a key line of defense for maintaining the homeostasis of the "intestinal-vascular axis". The destruction of tight junction proteins (such as occludin and ZO-1) between intestinal epithelial cells can lead to increased intestinal permeability, promote the translocation of LPS into the circulatory system [ 50 ], and activate the downstream NF-κB signaling pathway in combination with TLR4, inducing systemic low-grade inflammation and endothelial dysfunction, and accelerating the process of atherosclerosis [ 51 ]. Studies have found that the expression of tight junction proteins in the intestine of atherosclerosis model animals is significantly downregulated, and the LPS level is positively correlated with the plaque load [ 52 ]. Therefore, repairing intestinal barrier function may become a new target for alleviating vascular inflammation. Conclusion C. butyricum exerts anti-atherosclerotic effect by regulating immune cell-mediated anti-inflammatory response and reshaping gut microecology (Fig. 15), which provides a new theoretical basis and a potential strategy for preventing and therapeutic treatment of atherosclerosis. Abbreviations AS Atherosclerosis C. Butyricum Clostridium butyricum IL Interleukin TNF-α Tumor necrosis factor α IFN Interferon LPS Lipopolysaccharide NF-κB Nuclear factor kappa-B BMI Body mass index LDL Low-density lipoprotein HDL High-density lipoprotein TC Total cholesterol TG Triglycerides iNOS Nitric oxide synthase SCFAs Short chain fatty acids Mψ Macrophage TLR4 Toll-like receptor 4 OTUs Operational taxonomic units HE Hematoxylin-eosin OD Optical density FITC Fluorescein isothiocyan APC Allophycocyanin PE Phycoerythrin TH T Helper FBS Fetal bovine serum Treg Regulatory T Cell MDSCs Myeloid-Derived Suppressor Cells Declarations Acknowledgements We would like to thank all members of lab 120 family for help and support in the research. The authors declare that they have no competing interest. Funding This work was funded by the Ningxia Natural Science Foundation, China (Grant No. 2023AAC03563), the Key Research and Development Program of Ningxia, China (Grant No. 2022BEG03168), the Ningxia Gut Homeostasis and Chronic Disease Prevention and Treatment Scientific and Technological Innovation Team, China (Grant No. 2022BSB03112), Program of Ningxia Science and Technology Leading Talent, China (Grant No. 2023GKLRLX17), and Special Projects for the Central Government to Guide Local Science and Technology Development (Grant No. 2023FRD05056). Data Availability Statement The datasets presented in this study can be found in online repositories. Accession number(s): NCBI, PRJNA1297915. Author Contributions WH, WJ, MJB, ZXX, and ZYH designed and wrote the paper. MJB, WJ,LYW, LJ, SWK and LYY, performed research. All authors have read and approved the final manuscript. Conflict of interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Ethics approval and consent to participate The animal study was approved by the Ethics Committee of Ningxia Medical University (KYLL-2022-0315). The study was conducted in accordance with the local legislation and institutional requirements. Consent for publication Not applicable. Clinical trial number Not applicable. References Libby P, Ridker PM, Hansson GK. Progress and challenges in translating the biology of atherosclerosis. Nature . 2011 May 19;473(7347):317-25. doi: 10.1038/nature10146. Kim MH, Kang SG, Park JH, et al. Short-chain fatty acids activate GPR41 and GPR43 on intestinal epithelial cells to promote inflammatory responses in mice. Gastroenterology . 2013 Aug;145(2):396-406.e1-10. doi: 10.1053/j.gastro.2013.04.056. Vaduganathan M, Mensah GA, Turco JV, et al. The Global Burden of Cardiovascular Diseases and Risk: A Compass for Future Health. J Am Coll Cardiol . 2022 Dec 20;80(25):2361-2371. doi: 10.1016/j.jacc.2022.11.005. Tabas I, García-Cardeña G, Owens GK, et al. Recent insights into the cellular biology of atherosclerosis. J Cell Biol . 2015 Apr 13;209(1):13-22. doi: 10.1083/jcb.201412052. Wolf D, Ley K, et al. Immunity and Inflammation in Atherosclerosis. Circ Res . 2019 Jan 18;124(2):315-327. doi: 10.1161/CIRCRESAHA.118.313591. Moore KJ, Sheedy FJ, et al. Macrophages in atherosclerosis: a dynamic balance. Nat Rev Immunol . 2013 Oct;13(10):709-21. doi: 10.1038/nri3520. Grundy SM, et al. Metabolic syndrome update. Trends Cardiovasc Med . 2016 May;26(4):364-73. doi: 10.1016/j.tcm.2015.10.004. Ridker PM, et al. From C-Reactive Protein to Interleukin-6 to Interleukin-1: Moving Upstream To Identify Novel Targets for Atheroprotection. Circ Res. 2016 Jan 8;118(1):145-56. doi: 10.1161/CIRCRESAHA.115.306656. Tang WH, Kitai T, Hazen SL, et al. Gut Microbiota in Cardiovascular Health and Disease. Circ Res . 2017 Mar 31;120(7):1183-1196. doi: 10.1161/CIRCRESAHA.117.309715. Sekirov I, Russell SL, Antunes LC, Finlay BB. Gut microbiota in health and disease [J]. Physiol Rev , 2010, 90(3):859-904. doi: 10.1152/physrev.00045.2009. Li T, Ma X, Wang T, et al. Clostridium butyricum inhibits the inflammation in children with primary nephrotic syndrome by regulating Th17/Tregs balance via gut-kidney axis [J]. BMC Microbiol , 2024, 24(1): 97. doi: 10.1186/s12866-024-03242-3. Wang Z, Klipfell E, Bennett BJ, et al. Gut flora metabolism of phosphatidylcholine promotes cardiovascular disease [J]. Nature , 2011, 472(7341): 57-63. doi: 10.1038/nature09922. Chen ML, Yi L, Zhang Y, et al. Resveratrol attenuates trimethylamine-N-oxide (TMAO)-induced atherosclerosis by regulating TMAO synthesis and bile acid metabolism via remodeling of the gut microbiota [J]. mBio , 2016, 7(2): e02210-15. doi: 10.1128/mBio.02210-15. Haghikia A, Li XS, Liman TG, et al. Gut microbiota-dependent trimethylamine N-oxide predicts risk of cardiovascular events in patients with stroke and is related to proinflammatory monocytes [J]. Arterioscler Thromb Vasc Biol , 2018, 38(9): 2225-2235. doi: 10.1161/ATVBAHA.118.311023. Brandsma E, Kloosterhuis NJ, Koster M, et al. A proinflammatory gut microbiota increases systemic inflammation and accelerates atherosclerosis [J]. Circ Res , 2019, 124(1): 94-100. doi: 10.1161/CIRCRESAHA.118.313234. Li Y, Yu Z, Liu Y, et al. Dietary α-Linolenic Acid-Rich Flaxseed Oil Ameliorates High-Fat Diet-Induced Atherosclerosis via Gut Microbiota-Inflammation-Artery Axis in ApoE-/- Mice [J]. Front Cardiovasc Med , 2022, 9: 830781. doi: 10.3389/fcvm.2022.830781. Verhaar BJH, Prodan A, Nieuwdorp M, et al. Gut Microbiota in Hypertension and Atherosclerosis: A Review [J]. Nutrients , 2020, 12(10): 2982. doi: 10.3390/nu12102982. Ott SJ, El Mokhtari NE, Rehman A, et al. Fungal rDNA signatures in coronary atherosclerotic plaques [J]. Environ Microbiol , 2007, 9(12): 3035-3045. doi: 10.1111/j.1462-2920.2007.01415.x. Yano JM, Yu K, Donaldson GP, et al. Indigenous bacteria from the gut microbiota regulate host serotonin biosynthesis [J]. Cell , 2015, 161(2): 264-276. doi: 10.1016/j.cell.2015.02.047. Massberg S, Grahl L, von Bruehl ML, et al. Reciprocal coupling of coagulation and innate immunity via neutrophil serine proteases [J]. Nat Med , 2010, 16(8): 887-896. doi: 10.1038/nm.2184. Engelmann B, Massberg S. Thrombosis as an intravascular effector of innate immunity [J]. Nat Rev Immunol , 2013, 13(1): 34-45. doi: 10.1038/nri3345. Deppermann C, Cherpokova D, Nurden P, et al. Gray platelet syndrome and defective thrombo-inflammation in Nbeal2-deficient mice [J]. J Clin Invest , 2013, 123(8): 3331–42. doi: 10.1172/JCI69210. Reinhardt C, Bergentall M, Greiner TU, et al. Tissue factor and PAR1 promote microbiota-induced intestinal vascular remodelling [J]. Nature , 2012 Mar 11;483(7391):627-31. doi: 10.1038/nature10893. Tan Y, Zhou J, Liu C, et al. Association Between Plasma Trimethylamine N-oxide and Neoatherosclerosis in Patients With Very Late Stent Thrombosis [J]. Can J Cardiol , 2020 Aug;36(8):1252-1260. doi: 10.1016/j.cjca.2019.10.041. Li, R., Wang, Y., Hu, H. et al. Metagenomic analysis reveals unexplored diversity of archaeal virome in the human gut [J]. Nat Commun , 2022, 13(1): 7978. doi:10.1038/s41467-022-35735-y. Shin, J., Noh, J. R., Chang, D. H. et al. Elucidation of mucin-degradation-driven probiotic properties of Akkermansia muciniphila [J]. Front Microbiol , 2019, 10:1137. doi:10.3389/fmicb..2019.01137 Ohland, C. L., Macnaughton, W. K. Probiotic bacteria and intestinal epithelial barrier function [J]. Am. J. Physiol. Gastrointest. Liver Physiol ., 2010, 298(6): G807–G819. doi:10.1152/ajpgi.00243.2009. Attene-Ramos, M. S., Wagner, E. D., Plewa, M. J. et al. Evidence that hydrogen sulfide is a genotoxic agent [J]. Mol Cancer Res ., 2006, 4(1): 9–14. doi:10.1158/1541-7786.MCR-05-0126. Ottman, N., Reunanen, J., Meijerink, M. et al. Pili-like proteins of Akkermansia muciniphila modulate host immune responses and gut barrier function [J]. PLOS One , 2017, 12(3): e0173004. doi:10.1371/journal.pone.0173004. He, B., Hoang, T. K., Wang, T. et al. Resetting microbiota by Lactobacillus reuteri inhibits T reg deficiency-induced autoimmunity via adenosine A2A receptors [J]. J Exp Med ., 2017, 214(1): 107–123. doi:10.1084/jem.20160961. Mosmann, T. R., Coffman, R. L. et al. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties [J]. Annu Rev Immunol , 1989, 7: 145–173. doi:10.1146/annurev.iy.07.040189.001045. Seder, R. A., Paul, W. E. et al. Acquisition of lymphokine-producing phenotype by CD4⁺ T cells [J]. Annu Rev Immunol , 1994, 12: 635–673. doi:10.1146/annurev.iy.12.040194.003223. Paul, W. E., Ohara, J. et al. B-cell stimulatory factor-1/interleukin 4 [J]. Annu Rev Immunol ., 1987, 5: 429–459. doi:10.1146/annurev.iy.05.040187.002241. Mosser, D. M., Edwards, J. P. et al. Exploring the full spectrum of macrophage activation [J]. Nat Rev.Immunol ., 2008, 8(12): 958–969. doi:10.1038/nri2448. Murray, P. J., Allen, J. E., Biswas, S. K. et al. Macrophage activation and polarization: nomenclature and experimental guidelines [J]. Immunity , 2014, 41(1): 14–20. doi:10.1016/j.immuni.2014.06.008. Zhu J, Min B, Hu-Li J et al. Conditional deletion of GATA3 shows its essential function in T(H)1-T(H)2 responses [J]. Nat Immunol , 2004, 5(11): 1157–1165. doi: 10.1038/ni1128. Zimmerman MA, Singh N, Martin PM et al. Butyrate suppresses colonic inflammation through HDAC1-dependent Fas upregulation and Fas-mediated apoptosis of T cells [J]. Am J Physiol Gastrointest Liver Physiol , 2012, 302(12): G1405-G1415. doi: 10.1152/ajpgi.00543.2011. Zhu J, Yamane H, Paul WE. Differentiation of effector CD4 T cell populations[J]. Annu Rev Immunol , 2010, 28:445-489. doi:10.1146/annurev-immunol-030409-101212. Gordon S, Martinez FO. Alternative activation of macrophages: mechanism and functions[J]. Immunity , 2010, 32(5): 593-604. doi: 10.1016/j.immuni.2010.05.007. Park H, Li Z, Yang XO et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17 [J]. Nat Immunol , 2005, 6(11): 1133–1141. doi:10.1038/ni1261. Zhou L, Ivanov II, Spolski R, Min R, Shenderov K, Egawa T, Levy DE, Leonard WJ, Littman DR. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways [J]. Nat Immuno l, 2007, 8(9): 967-974. doi: 10.1038/ni1488. Gaffen SL, Jain R, Garg AV, Cua DJ. The IL-23-IL-17 immune axis: from mechanisms to therapeutic testing [J]. Nat Rev Immunol , 2014, 14(9): 585-600. doi: 10.1038/nri3707. Arpaia, N., Campbell, C., Fan, X. et al. Metabolites produced by commensal bacteria promote peripheral regulatory T-cell generation [J]. Nature , 2013, 504(7480): 451–455. doi:10.1038/nature12726. Ostrand-Rosenberg, S., Sinha, P. Myeloid-derived suppressor cells: linking inflammation and cancer [J]. J Immunol , 2009, 182(8): 4499–4506. doi:10.4049/jimmunol.0802740. Murray, P. J., Wynn, T. A. Protective and pathogenic functions of macrophage subsets [J]. Nat Rev Immunol , 2011, 11(11): 723–737. doi:10.1038/nri3073. Gordon, S., Martinez, F. O. Alternative activation of macrophages: mechanism and functions [J]. Immunity , 2010, 32(5): 593–604. doi:10.1016/j.immuni.2010.05.007. Newby, A. C. Metalloproteinase expression in monocytes and macrophages and its relationship to atherosclerotic plaque instability [J]. Arterioscler Thromb Vasc Biol , 2008, 28(12): 2108–2114. doi:10.1161/ATVBAHA.108.173898. Koren, O., Spor, A., Felin, J. et al. Human oral, gut, and plaque microbiota in patients with atherosclerosis [J]. Proc Natl Acad Sci U S A , 2011, 108(Suppl 1): 4592–4598. doi:10.1073/pnas.1011383107. Ma, H., Yang, L., Liu, Y. et al. Butyrate suppresses atherosclerotic inflammation by regulating macrophages and polarization via GPR43/HDAC-miRNAs axis in ApoE⁻/⁻ mice [J]. PLoS One , 2023, 18(3): e0282685. doi:10.1371/journal.pone.0282685. Cani, P. D., Bibiloni, R., Knauf, C. et al. Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice [J]. Diabetes , 2008, 57(6): 1470–1481. doi:10.2337/db07-1403. Kim, K. A., Gu, W., Lee, I. A. et al. High fat diet-induced gut microbiota exacerbates inflammation and obesity in mice via the TLR4 signaling pathway [J]. PLoS One , 2012, 7(10): e47713. doi:10.1371/journal.pone.0047713. Wang, Z., Klipfell, E., Bennett, B. J. et al. Gut flora metabolism of phosphatidylcholine promotes cardiovascular disease [J]. Nature , 2011, 472(7341): 57–63. doi:10.1038/nature09922. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7249459","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":525053215,"identity":"937b0010-a25a-4a53-a694-6df5d7f5265c","order_by":0,"name":"Jing Wang","email":"","orcid":"","institution":"Affiliated Hospital of Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Wang","suffix":""},{"id":525053216,"identity":"a0f49326-3f1e-4826-b97f-3b1b3b4d8a13","order_by":1,"name":"Junbai Ma","email":"","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Junbai","middleName":"","lastName":"Ma","suffix":""},{"id":525053217,"identity":"f4067a33-5b09-4db3-8ff4-185f86584180","order_by":2,"name":"Yiwei Li","email":"","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yiwei","middleName":"","lastName":"Li","suffix":""},{"id":525053218,"identity":"ba30bebf-c15e-4a15-a53b-0910982e325d","order_by":3,"name":"Yuanyuan Liu","email":"","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuanyuan","middleName":"","lastName":"Liu","suffix":""},{"id":525053219,"identity":"10c47eef-f7b1-4dd5-9b81-a9a30a49c96e","order_by":4,"name":"Wenke Shen","email":"","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Wenke","middleName":"","lastName":"Shen","suffix":""},{"id":525053220,"identity":"0aaf98be-8590-41d8-9a84-7ec901140f06","order_by":5,"name":"Jian Liu","email":"","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jian","middleName":"","lastName":"Liu","suffix":""},{"id":525053221,"identity":"69a1d0ac-ca5d-4edb-b009-6e63716a4449","order_by":6,"name":"Hao Wang","email":"","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Wang","suffix":""},{"id":525053222,"identity":"0e84374c-6844-4f90-b467-a3f6f5889416","order_by":7,"name":"Yuhong Zhang","email":"","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuhong","middleName":"","lastName":"Zhang","suffix":""},{"id":525053223,"identity":"3c720bb0-bd86-438b-bb1e-baf762129504","order_by":8,"name":"Xiaoxia Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAuUlEQVRIiWNgGAWjYJCCAx8MbOTY2NsPEK2D8eCMgjRjPp4zCURrYT7M8+FQ4jwJBwPi1MvPyDE4wGNwIL1NgiGB4UfFNiJc1XMs4YCEwZ3cNunGA4w9Z24T4Sr25gMHDAye5bbJHEhgZmwjQgsbM2PDgQSDw+lsEgkGxGnhAdlywOBwAvFaJHiOJRxsMEgzbAMG8kGi/AIMMePPf/7YyMu3tx988KOCCC0o4ACJ6kfBKBgFo2AU4AIAW9A+qoo0BW0AAAAASUVORK5CYII=","orcid":"","institution":"Ningxia Medical University","correspondingAuthor":true,"prefix":"","firstName":"Xiaoxia","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-07-30 06:53:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7249459/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7249459/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":93072329,"identity":"853d084d-c3bf-4bbf-bf64-5a40ca6da4c8","added_by":"auto","created_at":"2025-10-08 18:05:28","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":77130,"visible":true,"origin":"","legend":"","description":"","filename":"Clostridiumbutyricumamelioratesatheroscleroticinflammationthroughregulationofgutmicrobiota.docx","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/fc8af1cc178bc9abb9c1cacd.docx"},{"id":93071559,"identity":"29228eb4-631d-4287-951a-ae868a8a00eb","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3597896,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/25e27589617f5084e844f57b.tif"},{"id":93071545,"identity":"304577fa-f69c-4892-8b47-acc66631b417","added_by":"auto","created_at":"2025-10-08 17:57:26","extension":"tiff","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5475810,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/d2515aa02659c27395cc74c8.tiff"},{"id":93072326,"identity":"260c4a41-1d24-4776-933d-b197b5896881","added_by":"auto","created_at":"2025-10-08 18:05:27","extension":"tiff","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5679778,"visible":true,"origin":"","legend":"","description":"","filename":"Fig10.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/117c10232aa619d48cf0088c.tiff"},{"id":93071566,"identity":"6c9e3b0d-cfca-4543-853f-5e1f3562dccc","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"tiff","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4253922,"visible":true,"origin":"","legend":"","description":"","filename":"Fig11.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/82fc92c3cf7ddd89e551179b.tiff"},{"id":93071594,"identity":"6c11644a-ad49-4607-ac56-9a8398a98e80","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"tiff","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5418546,"visible":true,"origin":"","legend":"","description":"","filename":"Fig12.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/53ce758b8855c88f15fe3c0b.tiff"},{"id":93072333,"identity":"0d83dc62-6ba7-4942-a160-06650ba8fe22","added_by":"auto","created_at":"2025-10-08 18:05:29","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8099872,"visible":true,"origin":"","legend":"","description":"","filename":"Fig13.tif","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/656c43d0ea2ea6e7d0a3142c.tif"},{"id":93071541,"identity":"ccf5e553-c0c0-4f8b-ae7d-cc26b9249998","added_by":"auto","created_at":"2025-10-08 17:57:25","extension":"tiff","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6860766,"visible":true,"origin":"","legend":"","description":"","filename":"Fig14.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/eb7eceb070107ca06f1ae8ec.tiff"},{"id":93072336,"identity":"51ca91d8-0a79-4e9e-a424-077dcc918656","added_by":"auto","created_at":"2025-10-08 18:05:30","extension":"tiff","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8421350,"visible":true,"origin":"","legend":"","description":"","filename":"Fig15.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/96aec93298edf571bc8f7b05.tiff"},{"id":93071595,"identity":"652bf9a0-0c58-401c-a282-dfb4fc1b2bdb","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"tiff","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3880538,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/45e50f8d2dfb2b3ddcbb51a6.tiff"},{"id":93071549,"identity":"1601a7e7-97a4-43f7-a7a8-bb59003483cf","added_by":"auto","created_at":"2025-10-08 17:57:26","extension":"tiff","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7905462,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/00687cda291d1b3bc916cd86.tiff"},{"id":93072321,"identity":"dc92be64-7727-495d-9831-6022be29709d","added_by":"auto","created_at":"2025-10-08 18:05:26","extension":"tiff","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3416986,"visible":true,"origin":"","legend":"","description":"","filename":"Fig5.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/1c323a16639aa009556d56bc.tiff"},{"id":93071571,"identity":"003b92da-6668-4e43-9e93-0d08853a1cef","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"tiff","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4586634,"visible":true,"origin":"","legend":"","description":"","filename":"Fig6.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/9f4688818527d7ed9ec7e251.tiff"},{"id":93071570,"identity":"1129fbd7-c6e0-4c6a-99e5-e602269532c9","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"tiff","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5688786,"visible":true,"origin":"","legend":"","description":"","filename":"Fig7.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/b81a7a4028bb4fa6c67c9929.tiff"},{"id":93072339,"identity":"cd133627-d4de-4c59-ad9b-3ca1d637b0d8","added_by":"auto","created_at":"2025-10-08 18:05:31","extension":"tiff","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2926878,"visible":true,"origin":"","legend":"","description":"","filename":"Fig8.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/fa3a4347e7d00c446a213215.tiff"},{"id":93071583,"identity":"c52ee08f-dce9-477b-abff-a08288fbe82a","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"tiff","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2926878,"visible":true,"origin":"","legend":"","description":"","filename":"Fig9.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/5a2c149056b4a149d9d7d997.tiff"},{"id":93071542,"identity":"19175d97-b862-45b3-8ba4-57328496dbef","added_by":"auto","created_at":"2025-10-08 17:57:25","extension":"json","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9578,"visible":true,"origin":"","legend":"","description":"","filename":"55bfd5ca119f4fe7b38f6bac01c3b3f1.json","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/f66ead6c025c79f3b126f8f2.json"},{"id":93071555,"identity":"98ade522-3551-4bc2-8b0c-f90c6c4f4634","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"xml","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":170863,"visible":true,"origin":"","legend":"","description":"","filename":"55bfd5ca119f4fe7b38f6bac01c3b3f11enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/66c86c0cf98595708564c6bd.xml"},{"id":93071574,"identity":"2000d0d1-e137-47da-816b-64041bd52530","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3597896,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/9045c2706bfd0d8624920888.tif"},{"id":93071589,"identity":"147e5166-887c-479b-ba99-6ff257d9d0c1","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"tiff","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5475810,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/9661d9891e7901388db5d9cf.tiff"},{"id":93072328,"identity":"bdb0d401-bb3f-4839-8585-44e04d9b0861","added_by":"auto","created_at":"2025-10-08 18:05:28","extension":"tiff","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5679778,"visible":true,"origin":"","legend":"","description":"","filename":"Fig10.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/45fa264f34c5b9d5270d1e23.tiff"},{"id":93071592,"identity":"3f41a5fa-150c-4cea-986a-624933e71c55","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"tiff","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4253922,"visible":true,"origin":"","legend":"","description":"","filename":"Fig11.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/f343154fb5650f01a7e499cb.tiff"},{"id":93071597,"identity":"2f2d2d06-0750-4848-9fb5-5a6fb4ad138c","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"tiff","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5418546,"visible":true,"origin":"","legend":"","description":"","filename":"Fig12.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/572c99704fda6f3c0a64d640.tiff"},{"id":93071585,"identity":"ea366c69-2793-4eb0-a45c-05b1944a401b","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"tif","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8099872,"visible":true,"origin":"","legend":"","description":"","filename":"Fig13.tif","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/a96f10b73d77d2a830627d51.tif"},{"id":93072337,"identity":"e9003c4d-4deb-4331-be6b-113fea646688","added_by":"auto","created_at":"2025-10-08 18:05:31","extension":"tiff","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6860766,"visible":true,"origin":"","legend":"","description":"","filename":"Fig14.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/1c5ec848ff510b99b889c632.tiff"},{"id":93072327,"identity":"f18de99c-2880-4840-b69c-0ee1ba83d83f","added_by":"auto","created_at":"2025-10-08 18:05:28","extension":"tiff","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8421350,"visible":true,"origin":"","legend":"","description":"","filename":"Fig15.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/6dccc9c0474d6c7bf2bb4825.tiff"},{"id":93071590,"identity":"238cdea2-91c5-4bc7-af49-6eef34246897","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"tiff","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3880538,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/1d41f95024c7d82dbf032d52.tiff"},{"id":93071573,"identity":"024efe7a-0d1d-4263-8294-39330784a6c0","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"tiff","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7905462,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/5939327a5ff4f4d9208c4e8b.tiff"},{"id":93072334,"identity":"9c6cad09-b0fb-4617-9c18-dc85df3e6195","added_by":"auto","created_at":"2025-10-08 18:05:29","extension":"tiff","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3416986,"visible":true,"origin":"","legend":"","description":"","filename":"Fig5.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/e9440317f33ea7beb8395d64.tiff"},{"id":93072341,"identity":"f389573b-2427-41e8-91b0-f3ace8112b99","added_by":"auto","created_at":"2025-10-08 18:05:33","extension":"tiff","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4586634,"visible":true,"origin":"","legend":"","description":"","filename":"Fig6.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/d48aff769c1dc01dc81933d3.tiff"},{"id":93072342,"identity":"fddbf6d0-dadd-4659-86d0-e2bce7c35e93","added_by":"auto","created_at":"2025-10-08 18:05:33","extension":"tiff","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5688786,"visible":true,"origin":"","legend":"","description":"","filename":"Fig7.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/3f326a8b8c3540c2e101cec7.tiff"},{"id":93071581,"identity":"4d0b0040-1d02-4cad-88e0-b7d77aaba37e","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"tiff","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2926878,"visible":true,"origin":"","legend":"","description":"","filename":"Fig8.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/50f9388c01278acaef602173.tiff"},{"id":93072323,"identity":"32d35549-4156-44cd-9e11-670483bb2490","added_by":"auto","created_at":"2025-10-08 18:05:27","extension":"tiff","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2926878,"visible":true,"origin":"","legend":"","description":"","filename":"Fig9.tiff","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/8cbe33f831ae5933e6d72a0e.tiff"},{"id":93072325,"identity":"07b7911e-a671-40a4-8695-60cbeb0a0e2b","added_by":"auto","created_at":"2025-10-08 18:05:27","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":934640,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/919e032e631266a08b036dc0.png"},{"id":93071582,"identity":"3a20b159-46ce-4d73-8428-6cdd06f45f12","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":312867,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/b5c9815f83820761b20a9023.png"},{"id":93071600,"identity":"60faa7a7-81aa-43a8-b92c-f780b386e914","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122554,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig10.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/dfac645198e35066c278809f.png"},{"id":93072330,"identity":"7c0cae8c-9961-4cff-9583-5c1c968b99d4","added_by":"auto","created_at":"2025-10-08 18:05:28","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":71786,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig11.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/a0f20b4cd153bffa12d5a0bc.png"},{"id":93072331,"identity":"ce91c32d-b372-4873-8c5b-c9ddd5be7506","added_by":"auto","created_at":"2025-10-08 18:05:29","extension":"png","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":88719,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig12.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/fe0616b8f78ae77acebcdcc4.png"},{"id":93071546,"identity":"f76e34d4-c1ec-4e8c-8a65-09be4497ceda","added_by":"auto","created_at":"2025-10-08 17:57:26","extension":"png","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":273475,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig13.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/ba33da71cc174babddb9a143.png"},{"id":93072340,"identity":"500d665d-8735-489d-8d43-384ca94ceffd","added_by":"auto","created_at":"2025-10-08 18:05:31","extension":"png","order_by":39,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":66816,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig14.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/7fb378a4b5663d2ff6a18ac5.png"},{"id":93071579,"identity":"5a493784-9c8f-40bc-b670-311c91668db2","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"png","order_by":40,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85445,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig15.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/a609c7b1a4271e54ed2061ff.png"},{"id":93072338,"identity":"c9a57cc2-6f70-45b9-8b34-ee8b42f3bced","added_by":"auto","created_at":"2025-10-08 18:05:31","extension":"png","order_by":41,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33466,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/a1fae878ab9269ae9e2a0f1b.png"},{"id":93071587,"identity":"220dbf15-6a0a-402e-a0fe-06d65728d2c6","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"png","order_by":42,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":70639,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/c14e070bad817f59c3dea8ad.png"},{"id":93072324,"identity":"f2a0a764-6505-4725-b933-ca9985a885f7","added_by":"auto","created_at":"2025-10-08 18:05:27","extension":"png","order_by":43,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":43798,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/ca4ef05ba446691839bbbd93.png"},{"id":93071578,"identity":"52a102cf-31ad-43d4-9e51-6fafe8c0ec78","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"png","order_by":44,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":34818,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/089c28ddeb7820149bcd3158.png"},{"id":93072332,"identity":"900e151a-8d4e-4e0e-83bf-ec0e450bd469","added_by":"auto","created_at":"2025-10-08 18:05:29","extension":"png","order_by":45,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82894,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig7.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/7a1385f09d27d31a109afb03.png"},{"id":93071556,"identity":"dfdd0eb2-916e-485f-b872-c2582c8cf118","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"png","order_by":46,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":34307,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig8.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/ca2c81fb8654da3c091a4802.png"},{"id":93071599,"identity":"1c5af2fe-eb03-45b1-a4b1-04baa0fc1ff7","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"png","order_by":47,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":45920,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFig9.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/10837a7eb4c8fac131d07ae2.png"},{"id":93071603,"identity":"e80f6c00-5695-4174-bdfe-a50fde50b68a","added_by":"auto","created_at":"2025-10-08 17:57:30","extension":"xml","order_by":48,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":171646,"visible":true,"origin":"","legend":"","description":"","filename":"55bfd5ca119f4fe7b38f6bac01c3b3f11structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/6fd1a59d50d5c2ce95aa8f09.xml"},{"id":93071593,"identity":"65090d3d-7121-4636-a73c-1905e89e23a0","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"html","order_by":49,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":191004,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/038aec888302148f6172f31a.html"},{"id":93071539,"identity":"d65cf686-9cea-41ef-bc5d-7fb70b68f20d","added_by":"auto","created_at":"2025-10-08 17:57:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2620476,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of \u003cem\u003eC. butyricum\u003c/em\u003eon physiological parameters and blood lipids of mice in diverse groups. (A) Time diagram of experimental design. (B) Weight growth curve. (C) Food intake. (D) Blood glucose curve. (E) Total cholesterol (TC). (F) Triglyceride (TG). (G) Low density lipoprotein-cholesterol (LDL-C). (H) High density lipoprotein-cholesterol (HDL-C). Data are expressed as mean ± standard deviation, *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ns: \u003cem\u003eP\u003c/em\u003e \u0026gt; 0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/5065a42c34a545c7ee9ca1fd.png"},{"id":93071563,"identity":"1fcb7926-30f7-4836-b98e-da060438df09","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3925454,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of \u003cem\u003eC. butyricum\u003c/em\u003e on plaques in mice with AS. (A-E) Oil red O staining of aorta and staining of aortic sinus sections to detect the effect of \u003cem\u003eC. butyricum\u003c/em\u003e in AS intervention. *\u003cem\u003eP \u003c/em\u003e< 0.05, **\u003cem\u003eP \u003c/em\u003e< 0.01, ***\u003cem\u003eP \u003c/em\u003e< 0.001, ns: \u003cem\u003eP \u003c/em\u003e> 0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/3af793ca5ab2b2197738de99.png"},{"id":93071540,"identity":"ec1ef0d2-966d-4fe0-8961-9bf61de5d610","added_by":"auto","created_at":"2025-10-08 17:57:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":299128,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of \u003cem\u003eC. butyricum\u003c/em\u003e on intestinal flora diversity in AS mice. (A) Rarefaction curve. (B) α diversity index-Ace. (C) Chao Inter-index difference test. (D) PCoA analysis. (E) β diversity index. (F) NMDS analysis. (G) Microbiota dysbiosis index (MDI). (H) Venn diagram.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/ac5a965a7a81bd82140c921f.png"},{"id":93071567,"identity":"be44d1a6-8bbd-475f-8135-5c858eef9f27","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":663922,"visible":true,"origin":"","legend":"\u003cp\u003eModulation of \u003cem\u003eC. butyricum\u003c/em\u003e intervention on the gut microbiota composition of AS dysbiosis in mice. (A) Relative abundance of species at the phylum level. (B) Relative abundance of species at the genus level. (C) Genera with statistical differences at the phylum level. (D) Relative abundance of species at the species level. (E) Genera with statistical differences at the genus level. (F) Genera with statistical differences at the species level. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/26842a296c7808a3c8697fd9.png"},{"id":93071601,"identity":"830a1346-085c-4b02-ae3a-722b1b5a34b8","added_by":"auto","created_at":"2025-10-08 17:57:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":564184,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of \u003cem\u003eC. butyricum\u003c/em\u003e intervention on intestinal barrier function in AS mice. (A-B) Characteristic images of occludin, claudin-4 and immunofluorescence staining of colon tissue, Bar=100μm; C: occludin-positive area; D: claudin-4-positive area. *\u003cem\u003eP\u003c/em\u003e<0.05, ***\u003cem\u003eP\u003c/em\u003e<0.001, ns: \u003cem\u003eP\u003c/em\u003e>0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/b7ef2f24b403c77cd819d5fc.png"},{"id":93071558,"identity":"cb6fe1a2-f823-4613-bab2-f7318a3e49f2","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":232602,"visible":true,"origin":"","legend":"\u003cp\u003eInfluence of \u003cem\u003eC. butyricum\u003c/em\u003e on inflammation level in AS mice. (A-D) ELISA was used to detect the expression levels of IL-1β, IL-6, IL-10 and TNF-α in mouse plasma. (E-H) RT-qPCR was used to detect the relative levels of IL-1β, IL-6, IL-10 and TNF-α in aortic tissue. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ns: \u003cem\u003eP\u003c/em\u003e>0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/fe1ec544ac495bd1040ea3a5.png"},{"id":93071551,"identity":"fd858627-9772-4cd7-8103-c0ebb14f2b45","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":674166,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of \u003cem\u003eC. butyricum\u003c/em\u003e on TH1/TH2 cell levels in AS mice. (A) Representative flow cytometric dot plot of CD4\u003csup\u003e+\u003c/sup\u003eIFN-γ\u003csup\u003e+\u003c/sup\u003e cells in peripheral blood mononuclear cells (PBMCs). (B) Relative proportion of CD4\u003csup\u003e+\u003c/sup\u003eIFN-γ\u003csup\u003e+\u003c/sup\u003e cells in PBMCs. (C) Representative flow cytometric dot plot of CD4\u003csup\u003e+\u003c/sup\u003eIL-4\u003csup\u003e+\u003c/sup\u003e cells in PBMCs. (D) Relative proportion of CD4\u003csup\u003e+\u003c/sup\u003eIL-4\u003csup\u003e+\u003c/sup\u003e cells in PBMCs. (E) Representative flow cytometric dot plot of CD4\u003csup\u003e+\u003c/sup\u003eIFN-γ\u003csup\u003e+\u003c/sup\u003e cells in spleen. (F) Relative proportion of CD4\u003csup\u003e+\u003c/sup\u003eIFN-γ\u003csup\u003e+\u003c/sup\u003e cells in spleen. (G) Representative flow cytometric dot plot of CD4\u003csup\u003e+\u003c/sup\u003eIL-4\u003csup\u003e+\u003c/sup\u003e cells in spleen. H: Relative proportion of CD4\u003csup\u003e+\u003c/sup\u003eIL-4\u003csup\u003e+\u003c/sup\u003e cells in spleen. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ns: \u003cem\u003eP\u003c/em\u003e>0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/1bd1821de8ba4791e008d866.png"},{"id":93071552,"identity":"e764fc5f-88de-4c13-ae6d-1804c9ee5242","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":288294,"visible":true,"origin":"","legend":"\u003cp\u003eImpacts of \u003cem\u003eC. butyricum\u003c/em\u003e on TH17 cell levels in AS mice. (A) Representative flow cytometric dot plot of CD4\u003csup\u003e+\u003c/sup\u003eIL17A\u003csup\u003e+\u003c/sup\u003e cells in peripheral blood mononuclear cells (PBMCs). (B) Relative proportion of CD4\u003csup\u003e+\u003c/sup\u003eIL17A\u003csup\u003e+\u003c/sup\u003e cells in PBMCs. (C) Representative flow cytometric dot plot of CD4\u003csup\u003e+\u003c/sup\u003eIL17A\u003csup\u003e+\u003c/sup\u003e cells in spleen. (D) Relative proportion of CD4\u003csup\u003e+\u003c/sup\u003eIL17A\u003csup\u003e+\u003c/sup\u003e cells in spleen. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ns: \u003cem\u003eP\u003c/em\u003e>0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/664851cb3e681641462f888f.png"},{"id":93071550,"identity":"004b1328-7639-4a64-8172-eb81978a076a","added_by":"auto","created_at":"2025-10-08 17:57:26","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":387664,"visible":true,"origin":"","legend":"\u003cp\u003eDetection of \u003cem\u003eC. butyricum\u003c/em\u003e on Treg cell levels in AS mice. A: Representative flow cytometric dot plots of CD4\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e+\u003c/sup\u003e cells in peripheral blood mononuclear cells (PBMCs); B: Relative proportion of CD4\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e+\u003c/sup\u003e cells in PBMCs mononuclear cells; C: Representative flow cytometric dot plots of CD4\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e+\u003c/sup\u003e cells in spleen; D: Relative proportion of CD4\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e+\u003c/sup\u003e cells in spleen. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ns: \u003cem\u003eP\u003c/em\u003e>0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig9.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/5138c3e4e64bc9d5e377c0ed.png"},{"id":93071564,"identity":"50888dee-ad78-49f1-acb0-5b299b6c8b2e","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":1009199,"visible":true,"origin":"","legend":"\u003cp\u003eRegulatory effect of \u003cem\u003eC. butyricum\u003c/em\u003e on MDSCs in AS mice. (A) Representative flow cytometric dot plots of CD11b\u003csup\u003e+\u003c/sup\u003e cells in peripheral blood mononuclear cells (PBMCs). (B) Relative proportion of CD11b\u003csup\u003e+\u003c/sup\u003e cells in PBMCs. (C) Representative flow cytometric dot plots of CD11b\u003csup\u003e+\u003c/sup\u003eGR-1\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003e+\u003c/sup\u003e cells in PBMCs. (D) Comparative proportion of CD11b\u003csup\u003e+\u003c/sup\u003eGR-1\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003e+\u003c/sup\u003e cells in PBMCs. (E) Representative flow cytometric dot plots of CD11b\u003csup\u003e+\u003c/sup\u003e cells in spleen. (F) Relative proportion of CD11b\u003csup\u003e+\u003c/sup\u003e cells in spleen. (G) Representative flow cytometric dot plots of CD11b\u003csup\u003e+\u003c/sup\u003eGR-1\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003e+\u003c/sup\u003e cells in spleen. (H) Relative proportion of CD11b\u003csup\u003e+\u003c/sup\u003eGR-1\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003e+\u003c/sup\u003e cells in spleen. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ns: \u003cem\u003eP\u003c/em\u003e>0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig10.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/87a141eb843d6c0ffa64c0a0.png"},{"id":93072319,"identity":"7e8e5ee2-81f7-4cb4-ad89-4733ccb693fb","added_by":"auto","created_at":"2025-10-08 18:05:25","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":572556,"visible":true,"origin":"","legend":"\u003cp\u003eRegulation of \u003cem\u003eC. butyricum\u003c/em\u003e on Mψs and M1/M2 polarization in atherosclerotic mice. (A) Representative flow cytometric dot plot of aortic F4/80\u003csup\u003e+\u003c/sup\u003e cells. (B) Relative proportion of aortic F4/80+ cells. (C) Representative flow cytometric dot plot of aortic F4/80\u003csup\u003e+\u003c/sup\u003eiNOS\u003csup\u003e+\u003c/sup\u003e cells; D: Comparative proportion of aortic F4/80\u003csup\u003e+\u003c/sup\u003eiNOS\u003csup\u003e+\u003c/sup\u003e cells. (E) Representative flow cytometric dot plot of aortic F4/80\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e cells. (F) Comparative proportion of aortic F4/80\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e cells. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ns: \u003cem\u003eP\u003c/em\u003e>0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig11.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/5a01d61f822688c40e3b2b0d.png"},{"id":93071576,"identity":"b431e469-421e-464b-91e6-d6140621f6d6","added_by":"auto","created_at":"2025-10-08 17:57:28","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":747237,"visible":true,"origin":"","legend":"\u003cp\u003eInfluence of \u003cem\u003eC. butyricum\u003c/em\u003e on mononuclear cells of AS mice. (A) Representative flow cytometry dot plot of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003e cells in blood mononuclear cells. (B) Relative proportion of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003e cells in blood mononuclear cells. (C) Representative flow cytometry histogram of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003eLy6C cells in blood mononuclear cells. (D) Relative proportion of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003elow\u003c/sup\u003e cells in blood mononuclear cells. (E) Relative proportion of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003ehigh\u003c/sup\u003e cells in blood mononuclear cells. (F) Representative flow cytometry dot plot of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003e cells in spleen. (G) Relative proportion of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003e cells in spleen. (H) Representative flow cytometry histogram of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003eLy6C cells in spleen. (I) Relative proportion of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003elow\u003c/sup\u003e cells in spleen. (J) Relative proportion of CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003ehigh\u003c/sup\u003e cells in spleen. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ns: \u003cem\u003eP\u003c/em\u003e>0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig12.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/36616d709f4e05c11f942bb7.png"},{"id":93071562,"identity":"5fea7597-b5e5-47e5-a9fa-7d3f1f8606df","added_by":"auto","created_at":"2025-10-08 17:57:27","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":765117,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of \u003cem\u003eC. butyricum\u003c/em\u003e on LPS/TLR4/NF-κB signaling pathway in AS mice. (A) Scatter plot of F4/80\u003csup\u003e+\u003c/sup\u003eTLR4\u003csup\u003e+\u003c/sup\u003e flow cells in aorta. (B) Relative proportion of F4/80\u003csup\u003e+\u003c/sup\u003eTLR4\u003csup\u003e+\u003c/sup\u003e flow cells in aorta. (C) LPS level. (D) Relative expression of TLR4. (E) Relative expression of NF-κB. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001, ns: \u003cem\u003eP\u003c/em\u003e>0.05. ns: no significance.\u003c/p\u003e","description":"","filename":"Fig13.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/8fd8cf8c4ea2f0d320bbba2e.png"},{"id":93072320,"identity":"f7c2fd8e-74fc-4607-930a-523d92da9d40","added_by":"auto","created_at":"2025-10-08 18:05:26","extension":"png","order_by":14,"title":"Figure 14","display":"","copyAsset":false,"role":"figure","size":769503,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation analysis among intestinal flora, inflammation and blood lipids after \u003cem\u003eC. butyricum\u003c/em\u003e intervention. (A-D) Correlation among β-diversity of LPS, LDL, HDL cytokine IL-10 and intestinal microbial community at genus level. (E) Correlation analysis among the top 20 bacteria in abundance, blood lipids and inflammatory factors at genus level. (F-I) Correlation among β-diversity of LPS, LDL-C, HDL-C cytokine IL-10 and intestinal microbial community at species level. (J) Correlation analysis among the top 20 bacteria in abundance, blood lipids and inflammatory factors at species level. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001. R2 is the coefficient of determination, which represents the proportion of variation explained by the regression line. The larger the R value, the higher the degree of explanation of the environmental factor for the difference in the order axis of the samples. adjR2 is the corrected R2; r=1 indicates a complete positive correlation; r=-1 indicates a complete negative correlation, and r=0 indicates that there is no linear correlation. *\u003cem\u003eP\u003c/em\u003e<0.05, **\u003cem\u003eP\u003c/em\u003e<0.01, ***\u003cem\u003eP\u003c/em\u003e<0.001.\u003c/p\u003e","description":"","filename":"Fig14.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/55dc9fdaf76da9d6a691ff49.png"},{"id":93072322,"identity":"4a5c8f86-2ce2-43f9-a501-dbfecc894cdc","added_by":"auto","created_at":"2025-10-08 18:05:27","extension":"png","order_by":15,"title":"Figure 15","display":"","copyAsset":false,"role":"figure","size":1497894,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version\u003c/p\u003e","description":"","filename":"Fig15.png","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/0dd35d2f7c9e0a0859d9369e.png"},{"id":101751802,"identity":"608c94bf-a300-41ec-8719-12693443a6ff","added_by":"auto","created_at":"2026-02-03 10:23:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":15833434,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7249459/v1/f5cdbac9-818b-47aa-8d3e-487298768b55.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Clostridium butyricum ameliorates atherosclerotic inflammation through regulation of gut microbiota","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAtherosclerosis (AS) is a chronic progressive vascular disease characterized by lipid deposition in the arterial intima, smooth muscle cell proliferation, inflammatory response, and accumulation of fibrous tissue, eventually forming plaques and leading to vascular stenosis and blockage[\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e]. As the disease progresses, AS leads to loss of vascular elasticity and increases the risk of cardiovascular events such as heart disease, stroke, and peripheral arterial disease[\u003cspan class=\"CitationRef\"\u003e2\u003c/span\u003e]. It is considered to be one of the root causes of cardiovascular disease worldwide, seriously affecting human health and life expectancy[\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e]. The complicated main pathogenic factors of AS involves hypertension, hyperlipidemia, smoking, and diabetes[\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eRecent studies have demonstrated that immune response, inflammation, metabolic disorders, and genetic susceptibility are closely involved in atherosclerotic development[\u003cspan class=\"CitationRef\"\u003e5\u003c/span\u003e]. In particular, the role of inflammatory response in AS has gradually been recognized, and immune cells such as macrophages and T cells play a key role in plaque formation, plaque rupture, and vascular remodeling[\u003cspan class=\"CitationRef\"\u003e6\u003c/span\u003e]. In addition, metabolic diseases such as diabetes and obesity have been shown to aggravate the progression of atherosclerosis and increase the incidence of cardiovascular events[\u003cspan class=\"CitationRef\"\u003e7\u003c/span\u003e]. With the development of precision medicine, the discovery of new biomarkers and therapeutic targets has provided new directions for early detection, prevention, and personalized treatment of atherosclerosis[\u003cspan class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eAS represents a chronic inflammatory vascular disease that is responsible for the main pathological basis of cardiovascular and cerebrovascular diseases. Its occurrence and development are closely related to metabolic disorders, immune abnormalities, and oxidative stress[\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e]. Numerous studies have demonstrated that intestinal flora participates in the maintenance of host physiological homeostasis through metabolites, immune regulation, and barrier function, whereas dysbiosis of which can aggravate systemic inflammatory response and lipid metabolism disorders through the \u0026quot;gut-vascular axis\u0026quot;, thereby promoting the progression of AS[\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eClostridium butyricum\u003c/em\u003e (\u003cem\u003eC. butyricum\u003c/em\u003e) is a major intestinal probiotic that has been shown to play an important role in maintaining intestinal health and immune homeostasis [\u003cspan class=\"CitationRef\"\u003e10\u003c/span\u003e]. In recent years, accumulating studies have shown that \u003cem\u003eC. butyricum\u003c/em\u003e is closely related to the regulatory balance of intestinal microbiota, but may also be associated with the occurrence and development of atherosclerosis [\u003cspan class=\"CitationRef\"\u003e9\u003c/span\u003e]. Thus, supplementing \u003cem\u003eC. butyricum\u003c/em\u003e may become a new strategy for preventing and treating atherosclerosis.\u003c/p\u003e\n\u003cp\u003eIn order to clarify the effect of \u003cem\u003eC. butyricum\u003c/em\u003e on AS and its potential molecular mechanism, we selected 6-week-old male ApoE\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice and fed a high-fat diet (cholesterol content 1%) to establish an AS mouse model, and then intervened with \u003cem\u003eC. butyricum\u003c/em\u003e. Through the combination of pathological observation and functional research, we explored whether \u003cem\u003eC. butyricum\u003c/em\u003e could improve gut microbiota and chronic inflammation in AS mice and further revealed its molecular mechanism. This study may help to further improve the pathogenesis of chronic inflammation in AS, suggesting new targets for the clinical practice of the disease control.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cstrong\u003eAnimals\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal protocol used in this study was approved by the Ethics Committee of Ningxia Medical University (KYLL-2022-0315). Sixty male \u003cem\u003eApoE\u003c/em\u003e\u003csup\u003e\u003cem\u003e−/−\u003c/em\u003e\u003c/sup\u003e mice (8 weeks old) were purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd. All mice were housed under standard, specific pathogen-free (SPF) condition in the Experimental Animal Center of Ningxia Medical University (ambient temperature 22 ± 1℃, air humidity 40%-70%) with a 12-h light/dark cycle.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBacterial preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eC. butyricum\u003c/em\u003e, a vacuum freeze-dried strain provided by the China General Microbiological Culture Collection Center (CGMCC, strain number 1.5205), was prepared as described by our lab[12]. In brief, PYG medium (modifed; Shandong, China) was used to resuscitate the bacteria. After culture in an anaerobic incubator (5% CO\u003csub\u003e2\u003c/sub\u003e) at 37°C for 24 h, the visible bacterial colonies were placed in 10% skim milk to make a freeze-dried powder and stored at -80°C. During the intervention, PYG medium was used daily to resuscitate \u003cem\u003eC. butyricum\u003c/em\u003e lyophilized powder in an anaerobic incubator (5% CO\u003csub\u003e2\u003c/sub\u003e) at 37°C for 24 h, centrifuged at 3000×g for 5 min, and resuspended in sterile saline. The experimental final concentration was determine to 1×10\u003csup\u003e8\u003c/sup\u003e CFU/mL.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal experimental modeling and intervention\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSixty SPF male ApoE\u003csup\u003e\u003cem\u003e−/−\u003c/em\u003e\u003c/sup\u003e mice were randomly divided into 4 groups: control group (CON), atherosclerosis model group (MOD), \u003cem\u003eC. butyricum\u003c/em\u003e control group (CON/CB), and \u003cem\u003eC. butyricum\u003c/em\u003e intervention model group (MOD/CB). The MOD group and MOD/CB group were given a 1% cholesterol atherosclerosis customized high-fat diet (Jiangsu Medison Biopharmaceutical Co., Ltd.) to establish the model, and the CON group and CON/CB group were given a normal diet. The mice in the CON/CB group and MOD/CB group were gavaged with \u003cem\u003eC. butyricum\u003c/em\u003e bacterial liquid (0.1 mL/1.0×10\u003csup\u003e9\u003c/sup\u003e CFU/mouse), and the mice in the CON group and MOD group were gavaged with an equal amount of normal saline (NS). The food intake, blood glucose, and body weight of the mice were monitored during the feeding process, and the samples were collected after 10 weeks of intervention (Fig. 1A).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePathological staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAortic intimal plaque area was measured. In brief, after the mouse aorta was completely removed, The isolated aortic sinus tissue was immersed in 4% paraformaldehyde solution for 24 h of fixation, washed twice with PBS, and transferred to 30% sucrose solution for osmotic pressure balance. The degree of tissue dehydration was monitored by gravity sedimentation. The ventricular basal segment trimmed samples were selected. After orientation embedding with O.C.T. cryoembedding medium, they were immediately placed in a -80℃ refrigerator for rapid freezing and solidification. Continuous coronal sections were made at -20℃ using a constant temperature microtome, and the section thickness was set to 8 µm. Oil red O staining, Masson trichrome staining (collagen fiber display) and hematoxylin-eosin staining (HE) were performed. After rinsing with distilled water to terminate the reaction, the samples were placed on a standardized background plate to absorb the residual water, and the plaque morphology was recorded using a microscopic imaging system (Aomori Olympus Co., Ltd., Japan), and the intimal lipid deposition area was quantified using Image J software.、\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofuorescence (IF) staining\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe slides were dewaxed, rehydrated and then placed in sodium citrate solution and heated in a microwave oven over medium heat for 18 min to unmask the antigen. The tissue was demarcated with an immunohistochemistry pen, and goat serum was used to seal the sections at room temperature for 30 min. After the liquid was removed, the sections were incubated with occludin antibody(sc-133256, 1:200 dilution,Santa Cruz Biotechnology, USA) and claudin-4 antibody(sc-376643, 1:200 dilution, Santa Cruz Biotechnology, USA) overnight at 4℃ in the dark. After washing with phosphate-buffered saline (PBS), the sections were incubated with goat anti-mouse FITC (GB22301, 1:200 dilution, Servicebio, China) at 37℃ for 1 h. After washing with PBS, the plates were sealed with anti-fuorescence quenching mounting tablets containing DAPI (S2110, Solarbio, China), and subsequently examined under a fluorescence microscope.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFlow cytometry (FCM)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePreparation of aortic macrophages (Mψs) suspension was performed. In brief, the aortic root tissue was mechanically crushed and placed in 10 mL of PBS buffer containing 0.15% type IV collagenase to form a homogenous suspension. The tissue suspension was digested at 37℃ for 20 min. The digestion product was gently blown for 3 min and washed with RPMI 1640 medium containing 2% FBS; undigested tissue fragments were filtered through a 200-mesh nylon filter and single-cell suspension was collected. The filtrate was centrifuged at 400×g for 5 min, then the supernatant was discarded and the precipitate was resuspended in 100 µL of RPMI 1640 medium containing 2% FBS.\u003c/p\u003e\n\u003cp\u003eFollowing complete anesthesia,Anticoagulated whole blood collected via eyeball bleeding was centrifuged at 1,500 rpm for 10 min to separate plasma. Erythrocytes in the cellular fraction were lysed using Erythrocyte Lysis Buffer with 10 min incubation on ice. After two washing cycles with RPMI 1640 medium supplemented with 2% fetal bovine serum (FBS), leukocyte suspensions were filtered through a 300µm nylon mesh and adjusted to a concentration of 1×107 cells/mL for flow cytometry analysis.\u003c/p\u003e\n\u003cp\u003eSpleens were mechanically dissociated in 5 mL 2% RPMI 1640 using sterile glass homogenizers. The resulting suspension was filtered through 200-µm mesh and subjected to erythrocyte lysis as described for PBMC isolation. Viable leukocytes were resuspended in complete medium and maintained at 4°C until analysis.\u003c/p\u003e\n\u003cp\u003eAortic tissues were mechanically dissociated into 1 mm³ fragments using sterile surgical scissors and subjected to enzymatic digestion in 10 mL PBS containing 0.15% collagenase type IV (C8106,Solarbio, China) with orbital shaking at 37°C for 20 min. The digested suspension was triturated through a 200-µm nylon mesh to obtain single-cell suspensions, followed by three washing cycles with RPMI 1640 supplemented with 2% FBS under centrifugation at 400 ×g for 5 min at 4°C. Cell pellets were resuspended in 100 µL staining buffer (2% RPMI 1640) for subsequent immunophenotyping.\u003c/p\u003e\n\u003cp\u003eA 100 µL aliquot of PBMC suspension was simultaneously incubated with 1 µL each of the following fluorochrome-conjugated antibodies: phycoerythrin (PE)-Gr-1 (108408,Biolegend, USA), eFluor 450-CD45 (48-0451-82, eBioscience, USA),fluorescein isothiocyanate (FITC)-CD11b (101206, Biolegend, USA), and allophycocyanin (APC)-Ly6C (128016, Biolegend, USA) for 30 min in the dark at 4℃. Meanwhile, the cells were stained with isotype-matched control antibodies, respectively. Finally, the prepared samples were detected using a CytoFLEX flow cytometer (Beckman Coulter, USA).\u003c/p\u003e\n\u003cp\u003eFor cytokine intracellular staining, PBMCs were stimulated with Cell Stimulation Cocktail containing protein transport inhibitors(00-4970-03, eBioscience, USA) for 3 h at 37°C with 5% CO₂. Surface CD4 labeling was performed using FITC-CD4 (11-0042-85, eBioscience, USA) prior to fixation/permeabilization. Following fixation and permeabilization, the samples were separated into two tubes, and one tube was stained with the following antibodies for intracellular cytokine detection:Percp -IL-17A(506944, Biolegend, USA),APC-IFN-γ (505810, Biolegend, USA) and PE-IL-4(504104, Biolegend, USA).PE-Foxp3(12-5773-82, eBioscience, USA) staining was performed in the other tube.Finally, the prepared samples were detected using a CytoFLEX flow cytometer (Beckman Coulter, USA).\u003c/p\u003e\n\u003cp\u003e100 µL of single-cell suspension (aortic tissue) was incubated with 1 µL of CD16/CD32 (553142, BD Biosciences, USA) for 15 min to block non-specific binding of antigen. Subsequently, suspended cells were stained with antibodies for surface and intracellular markers including PE-F4/80 (123110, Biolegend, USA), FITC-TLR4 (53-9041-82, eBioscience, USA), BV421-CD206 (141717, Biolegend, USA) and APC-iNOS (17-5920-82, eBioscience, USA) for 30 min at 4℃. Meanwhile, the cells were stained with isotype-matched control antibodies, respectively. Finally, the prepared samples were detected using a CytoFLEX flow cytometer (Beckman Coulter, USA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEnzyme-linked immunosorbent assay (ELISA)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe ELISA method was used to detect the levels of plasma inflammatory factors IL-1β, IL-6, IL-10, and TNF-α. The specific steps were performed according to the instructions of the commercially available kits.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDetermination of plasma LPS content\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Limulus amebocyte lysate kit (Xiamen Bioendo Technology Co., Ltd., Xiamen, China) was used to detect LPS levels in the plasma of mice according to the manufacturer’s instructions. In brief, standard curve was established: According to the linear range of the kit, the bacterial endotoxin standard (0.1-1.0EU/mL) was diluted with pyrogen-free water to establish a standard concentration series. Then, Sample was pretreatd: Mouse plasma was centrifuged at 3000×g for 10 min to remove particulate matter, and the supernatant was placed in a pyrogen-free EP tube for later use. Thrid, the standard/sample and horseshoe crab reagent were added to the pyrogen-free test tube in proportion according to the instructions, incubate at 37°C for 10 min; the color development matrix solution was added and incubated for 6 min. Termination and detection: azo reagents I, II, and III in sequence were added to terminate the reaction and develop color. After standing at room temperature for 5 min, the absorbance (OD value) was measured at 545 nm by an enzyme reader. Lastly, quantitative analysis: The standard curve was fitted with the standard concentration as the horizontal axis and the corresponding OD value as the vertical axis (R²\u0026gt;0.99), and the sample LPS concentration was calculated by a linear equation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClarification of the characteristics of gut microbiota\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal microbial genomic DNA was extracted from mouse fecal samples using the FastPure Stool DNA Isolation Kit (MJYH, Shanghai, China). The DNA extract was checked on 1% agarose gel, and DNA concentration and purity were determined with NanoDrop2000 spectrophotometer (Thermo Scientific, United States). DNA samples that met the quality requirements were diluted with sterile ultrapure water to a final concentration of 1 ng/µL as PCR templates. The diluted genomic DNA was used as a template, and specific primers containing Barcodes were used for the target sequencing region. The amplification reaction was carried out in conjunction with New England Biolabs' Phusion® High-Fidelity PCR Master Mix with GC Buffer system (containing optimized buffer and high-fidelity polymerase). This combination simultaneously improves the amplification efficiency and product fidelity through the stabilizing effect of GC Buffer and the precise replication ability of the polymerase to ensure the repeatability of the experimental results and the accuracy of the sequencing data. After pooling and purification of PCR products, the Promega QuantiFluor™ -ST blue fluorescence quantitative system was used to accurately quantify the PCR products, and the samples were mixed in proportion according to the sequencing requirements. Subsequently, the TruSeqTM DNA Sample Prep Kit was used to complete the library construction: first, the specific adapter sequence was accurately connected to both ends of the target region through PCR reaction; the amplified product was separated by 2% agarose gel electrophoresis, the target band was cut and purified using a gel recovery kit; the purified product was eluted with Tris-HCl buffer, and the integrity of the fragment was verified by electrophoresis; finally, sodium hydroxide denaturation treatment was used to obtain a single-stranded DNA template. This process controls the uniformity of the sample through fluorescence quantification, combined with high-precision adapter connection and denaturation technology, to ensure that the library construction meets the requirements of high-throughput sequencing. And then sequencing: the DNA fragments were anchored to the chip surface through complementary pairing; then the extension reaction was carried out starting from the immobilized primer, so that the template chain was covalently fixed to the chip to form a spatial positioning; after denaturation treatment, the free end was complementary to the adjacent primer to form a bridge structure, and a high-density DNA cluster was generated through multiple rounds of amplification. After the double-stranded DNA was converted into a single-stranded template by specific cutting, an engineered DNA polymerase and a 4-color fluorescent labeled dNTP (including a reversible terminator group) were added, and only a single base was incorporated in each cycle; the laser system was used to collect fluorescent signals to determine the type of base, and the nucleotides were polymerized after chemical cutting of the fluorescent group and the terminator group. By statistically analyzing the fluorescent signal results collected in each round and bioinformatics, the high-throughput and analysis of the template sequence were finally achieved.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBlood lipids\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCommercial kits were used to detect the levels of TC, TG, LDL, and HDL in plasma of mice in diverse groups following the instructions for specific steps.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative real‑time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to the manufacturer’s protocol, total RNA was extracted from aortic tissue using the RNA Extraction kit (Omega, USA), and the UEIris RT mix with DNase (All-in-One) (UE, China) was used to synthesize cDNA. Then, RT-qPCR was performed using Universal SYBR Green qPCR Supermix (UE, China). The expression of the target gene was normalized by GAPDH. All experiments were carried out in three independent experiments. Primer sequences (Sangon Biotech, Shanghai, China) were shown in Table 1.\u003c/p\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003eList of primers used for qRT-PCR.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003eGene\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003ePrimers\u003cbr\u003e\u003c/th\u003e\n \u003cth align=\"left\"\u003eSequences (5’ to 3’)\u003cbr\u003e\u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003eTNF-α\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eFORWARD\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eCCAGACCCTCACACTCACAA\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eREVERSE\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eATAGCAAATCGGCTGACGGT\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003eIL-6\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eFORWARD\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eATAGCAAATCGGCTGACGGT\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eREVERSE\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eATGAATTGGATGGTCTTGGTCCTTAGC\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003eIL-10\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eFORWARD\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTGAATTCCCTGGGTGAGAAG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eREVERSE\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGCTCCACTGCCTTGCTCTTA\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003eIL-1β\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eFORWARD\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eACCTTCCAGGATGAGGACATGA\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eREVERSE\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eCTAATGGGAACGTCACACACCA\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003eNF-κB\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eFORWARD\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eAAATGGGAAACCGTATGAGCCTGTG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eREVERSE\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eGTTGTAGCCTCGTGTCTTCTGTCAG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" rowspan=\"2\"\u003eTLR4\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eFORWARD\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eTGACATGTGCAACACCTGTAGAGATG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003eREVERSE\u003cbr\u003e\u003c/td\u003e\n \u003ctd align=\"left\"\u003eACTGACCACTGACACACTGATGATTG\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cdiv id=\"Sec3\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eSPSS 21.0, GraphPad Prism 10, and Excel were used to complete data analysis and chart construction. Quantitative data are expressed as mean ± standard deviation: multiple groups of data that conform to normal distribution and homogeneity of variance were analyzed using one-way analysis of variance (ANOVA). The LSD-t test was used for pairwise comparisons between groups. Non-normal distribution data were tested using non-parametric tests. 16S rRNA gene sequencing data were analyzed for inter-group differences using the Kruskal-Wallis test. The association between intestinal flora abundance and inflammatory indicators was evaluated based on Pearson correlation analysis to reveal the potential interaction between microbial communities and host phenotypes. The correlation between intestinal flora and inflammation and other indicators was analyzed by Pearson analysis. \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 was considered to be statistically significant.\u003c/p\u003e\u003cbr\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e \u003cstrong\u003eimproves physiological parameters and blood lipids in AS mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate whether differences in dietary intake contribute to the effects of \u003cem\u003eC. butyricum\u003c/em\u003e intervention, we monitored food intake, body weight, and blood glucose. After 10 weeks of experimental intervention, the body weight of the MOD group increased steadily compared with the CON group, and \u003cem\u003eC. butyricum\u003c/em\u003e treatment had no effect on body weight gain compared with the AS group (Fig. 1B). In terms of food intake, the average food intake of mice in each group increased during the intervention period, but without significant change (Fig. 1C). For blood glucose, there was no significant difference in blood glucose after intervention (Fig. 1D). Thus, these indicates that \u003cem\u003eC. butyricum\u003c/em\u003e intervention had no significant effect on energy intake.\u003c/p\u003e\n\u003cp\u003eTo further investigate the effect of \u003cem\u003eC. butyricum\u003c/em\u003e on blood lipids in AS mice, the plasma biochemical indices of mice were measured. Compared to the CON group, the levels of plasma TC (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Fig.\u0026nbsp;1E), TG (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig.\u0026nbsp;1F), and LDL-C (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, Fig.\u0026nbsp;1G) in the MOD group were significantly increased. After intervention with \u003cem\u003eC. butyricum\u003c/em\u003e, the levels of plasma TC, TG, and LDL-C were significantly improved (all \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). There was no significant difference in the level of plasma HDL-C. In addition, no significant difference in blood lipids was found between the CON group and the CON/CB group. These data suggest that \u003cem\u003eC. butyricum\u003c/em\u003e can prevent dyslipidemia in AS mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e \u003cstrong\u003ealleviates AS progression in ApoE\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e−/−\u003c/strong\u003e\u003c/sup\u003e \u003cstrong\u003emice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe protective effect of \u003cem\u003eC. butyricum\u003c/em\u003e on AS in mice was evaluated by pathological staining. The macroscopic pathological analysis of the aorta and its sinus tissues was performed by Oil Red O staining, and the plaque progression was quantified by the ratio of lipid deposition area to the total aortic area (Fig. 2A, C). The results showed that the aortic lipid plaque area in the MOD group was significantly increased compared with that in the CON group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, Fig. 2B), while \u003cem\u003eC. butyricum\u003c/em\u003e intervention significantly reduced lipid deposition (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). The cross-sectional analysis of the aortic sinus showed that the plaque area in the MOD group was significantly worse than that in the CON group, and which was notably downregulated after \u003cem\u003eC. butyricum\u003c/em\u003e intervention (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 2D), suggesting that \u003cem\u003eC. butyricum\u003c/em\u003e may protect against lipid accumulation in the development of vascular plaques. Masson staining showed that the aortic sinus muscle fibers were red and the collagen fibers were blue (Fig. 2C). Quantitative analysis found that the proportion of collagen fibers in the MOD group was significantly higher than that in the CON group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001), and which was improved after \u003cem\u003eC. butyricum\u003c/em\u003e intervention (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 2E). HE staining results further supported that \u003cem\u003eC. butyricum\u003c/em\u003e possessed a markedly protective efficacy on the attenuation of AS plaque pathological damage (Fig. 2C). The above results suggest that \u003cem\u003eC. butyricum\u003c/em\u003e may delay the progression of AS by regulating lipid metabolism and collagen deposition.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC. Butyricum\u003c/strong\u003e \u003cstrong\u003eintervention rectifies gut microbiota dysbiosis in AS mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNumerous studies have confirmed that intestinal microbiota imbalance is closely related to the occurrence and development of AS[12, 13]. Therefore, the third-generation high-throughput sequencing of 16S rRNA from specimens of mouse feces was performed to evaluate the modulatory impact of \u003cem\u003eC. butyricum\u003c/em\u003e on the gut microbiota of AS mice. The dilution curve results showed that while the number of sequences increased to 4,000, the curves of each group of samples gradually flattened (Fig. 3A), indicating that the amount of sequencing data was reasonable and reliable, sufficient to cover the entire bacterial diversity. Subsequently, the inter-index difference test and α diversity were further evaluated. The results of the inter-index difference test showed that compared to the CON group, the α diversity of the MOD group was significantly decreased (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). After \u003cem\u003eC. butyricum\u003c/em\u003e administration, there was no significant difference in the α diversity of the MOD/CB group compared with MOD group (Fig. 3B, C).\u003c/p\u003e\n\u003cp\u003eMoreover, β diversity was evaluated by principal coordinates analysis (PCoA). The distance between points reflects the differences between and within groups of samples. The PCoA results based on the Bray-curtis algorithm showed (Fig. 3D) that the points in each group were close to each other, and the distances between the groups were relatively separated (Fig. 3D, E). The evaluation of the gut microbiome health index (GMHI) found that \u003cem\u003eC. butyricum\u003c/em\u003e significantly upregulated the flora health index (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Fig. 3F) and downregulated the microbiota dysbiosis index (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Fig. 3G). Next, the community composition was evaluated by Venn diagram and community Bar diagram. The Venn diagram results showed (Fig. 3H) that there were 9 OTUs in common of each group; OTUs of 553, 276, 609 and 219 were unique to CON group, MOD group, CON/CB group or MOD/CB group. Taken together, composition and proportion of the gut microbiota of AS mice could be reshaped to a certain extent after \u003cem\u003eC. butyricum\u003c/em\u003e intervention.\u003c/p\u003e\n\u003cp\u003eTo further investigate the target of differentical bacteria during the modulation of \u003cem\u003eC. butyricum\u003c/em\u003e intervention, the relative abundances of gut microbiota at the phylum, genus, and species levels in each group of mice were determined, respectively (Fig. 4A, B, D). Specifically, at the phylum level, the dominant bacteria in each group were mainly \u003cem\u003eBacillota\u003c/em\u003e, \u003cem\u003eBacteroidota\u003c/em\u003e, and \u003cem\u003eVerrucomicrobiota\u003c/em\u003e. Compared to the CON group, the relative abundance of \u003cem\u003eBacteroidota\u003c/em\u003e in the model group decreased, whereas which was increased after \u003cem\u003eC. butyricum\u003c/em\u003e intervention. In addition, compared with the MOD group, the abundance of \u003cem\u003eVerrucomicrobiota\u003c/em\u003e in the MOD/CB group was upregulated (Fig. 4C). At the genus level, relative abundance of Akkermansia and Paramuribaculum decreased in AS.(Fig. 4B). Importantly, after \u003cem\u003eC. butyricum\u003c/em\u003e intervention, the relative abundance of \u003cem\u003eAkkermansia\u003c/em\u003e and \u003cem\u003eLactobacillus\u003c/em\u003e were upregulated (Fig. 4E). At the species level, the relative abundances of \u003cem\u003eAkkermansia_muciniphila\u003c/em\u003e, \u003cem\u003eLigilactobacillus murinus\u003c/em\u003e, \u003cem\u003eBarnesiella intestinihominis\u003c/em\u003e, \u003cem\u003eParamuribaculum intestinale\u003c/em\u003e, and \u003cem\u003eDuncanialla freteri\u003c/em\u003e in the model group were decreased. Crucially, \u003cem\u003eC. butyricum\u003c/em\u003e intervention remarkablely increased the relative abundance of \u003cem\u003eAkkermansia_muciniphila\u003c/em\u003e, \u003cem\u003eAllobaculum fili\u003c/em\u003e, \u003cem\u003eFaecalibaculum_rodentium\u003c/em\u003e, \u003cem\u003eBarnesiella_intestinihominis\u003c/em\u003e, and \u003cem\u003eLactobacillus_taiwanensis\u003c/em\u003e (Fig. 4F), further suggesting that \u003cem\u003eC. butyricum\u003c/em\u003e intervention reshaped the intestinal microecology by modulating these differential bacteria candidites.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC. Butyricum\u003c/strong\u003e \u003cstrong\u003eintervention enhances the intestinal barrier function of AS mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDue to the above rectification the gut dysbiosis of \u003cem\u003eC. butyricum\u003c/em\u003e on AS mice, we further investigated the impact of \u003cem\u003eC. butyricum\u003c/em\u003e on gut barrier. Tight junctions are the main connection between intestinal epithelial cells and are essential for maintaining the integrity and function of the intestinal barrier[14]. In order to clarify the effect of \u003cem\u003eC. butyricum\u003c/em\u003e intervention on the intestinal barrier of AS mice, IF staining was used to detect the expression levels of tight junction proteins occludin and claudin-4 in the colon tissue of each group of mice. The results showed that the expression levels of occludin and claudin-4 in the MOD group were significantly lower than those in the CON group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 5A-D), indicating that the intestinal barrier of AS mice was damaged. Nevertheless, after \u003cem\u003eC. butyricum\u003c/em\u003e intervention, the expression levels of occludin and claudin-4 were significantly increased compared with the MOD group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 5A-D), suggesting that \u003cem\u003eC. butyricum\u003c/em\u003e intervention improves the integrity and function of the intestinal barrier.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC. butyricum\u003c/strong\u003e \u003cstrong\u003esignificantly suppresses chronic inflammation in AS mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGut dysbiosis has been acceleratingly considered to participate in the inflammation of AS[15–17]. Furthermore, based on the core role of chronic inflammation in the progression of AS, we evaluated the effects of \u003cem\u003eC. butyricum\u003c/em\u003e on the plasma levels of IL-1β, IL-6, TNF-α, and IL-10 (Fig. 6A-D). The results showed that the level of pro-inflammatory factor IL-6 in the MOD group was significantly higher than that in the CON group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01), while the level of anti-inflammatory factor IL-10 was significantly reduced (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05). After intervention with \u003cem\u003eC. butyricum\u003c/em\u003e, the level of plasma IL-6 was significantly lower than that in the MOD group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), while the level of TNF-α in the MOD group showed an upward trend compared with the CON group without statistically significant difference compared with the CON group. After \u003cem\u003eC. butyricum\u003c/em\u003e treatment, there was a downward trend but no statistical significance.\u003c/p\u003e\n\u003cp\u003eMeanwhile, further detection of the expression of inflammatory factors in situ aortic tissue (Fig. 6E-H) showed that the expressions of IL-1β, IL-6 and TNF-α in the MOD group were significantly higher than those in the CON group (all \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), whereas \u003cem\u003eC. butyricum\u003c/em\u003e intervention significantly inhibited the expression of TNF-α in the aorta (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), and the IL-6 level showed a downward trend with no statistical difference. These results indicated that \u003cem\u003eC. butyricum\u003c/em\u003e treatment possessed an anti-inflammatory effect on AS mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC. Butyricum\u003c/strong\u003e \u003cstrong\u003eregulates inflammatory cells in AS mice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further reveal the underlying mechanism of anti-inflammatory protection of \u003cem\u003eC. butyricum\u003c/em\u003e against AS, the potential critical inflammatory cells involved in the AS were separately measured. The results showed that compared to the MOD group, the proportion of TH1 (IFN-γ\u003csup\u003e+\u003c/sup\u003e) in CD4\u003csup\u003e+\u003c/sup\u003eT cells from peripheral blood mononuclear cells (PBMCs) and mouse spleen were decreased after \u003cem\u003eC. butyricum\u003c/em\u003e intervention (all \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01), but the proportion of TH2 (IL-4\u003csup\u003e+\u003c/sup\u003e) was increased (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05) (Fig. 7A-H). This result suggested that \u003cem\u003eC. butyricum\u003c/em\u003e may repress the chronic inflammation mediated by TH1/TH2 imbalance in AS pathology by inhibiting pro-inflammatory TH1 and enhancing anti-inflammatory TH2 response.\u003c/p\u003e\n\u003cp\u003eMoreover, the effect of \u003cem\u003eC. butyricum\u003c/em\u003e on the proportions of TH17 cells and Treg cells in PBMCs and spleen cells of AS mice were further evaluated. We found that compared to the CON group, the proportions of TH17 (CD4\u003csup\u003e+\u003c/sup\u003eIL-17A\u003csup\u003e+\u003c/sup\u003e) cells in PBMCs and spleen of mice in the MOD group was significantly increased (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), suggesting that TH17-mediated inflammatory response may play a key role in the impairment of AS inflammation. Intriguingly, after intervention with \u003cem\u003eC. butyricum\u003c/em\u003e, the proportion of TH17 cells was significantly reduced compared with that in the MOD group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 8A-D). Meanwhile, the proportion of Treg (CD4\u003csup\u003e+\u003c/sup\u003eFoxp3\u003csup\u003e+\u003c/sup\u003e) cells in mice in the MOD group showed no significant change (\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05), and after intervention with \u003cem\u003eC. butyricum\u003c/em\u003e, the proportion of Treg cells showed an upward trend (Fig. 9A-D). The above results indicate that \u003cem\u003eC. butyricum\u003c/em\u003e may restrain AS-related inflammatory response by regulating the differentiation and function of TH17 cells.\u003c/p\u003e\n\u003cp\u003eMDSCs are a heterogeneous class of immune negatively regulatory cells[18]. FCM was used to detect the dynamic changes of CD11b\u003csup\u003e+\u003c/sup\u003eGR-1\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003e+\u003c/sup\u003e labeled MDSCs in the peripheral blood and spleen of AS model mice[19] (Fig. 7A-H). The results showed that compared with the CON group, the proportion of MDSCs in the peripheral blood and spleen of mice in the MOD group was significantly increased (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), suggesting that the pathological process of AS may drive the expression of MDSCs through chronic inflammatory signals. After \u003cem\u003eC. butyricum\u003c/em\u003e intervention, the proportion of MDSCs in the MOB/CB group exerted no notable change compared with the MOD group (\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05). In addition, the proportion of MDSCs in the CON/CB group was significantly higher than that in the CON group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), indicating that \u003cem\u003eC. butyricum\u003c/em\u003e may independently induce the generation of MDSCs in the absence of AS pathological background.\u003c/p\u003e\n\u003cp\u003eMacraphages (Mψs) and its polarization in AS play a key role in the formation, development and instability of plaques[20]. Further analysis of the influnence of \u003cem\u003eC. butyricum\u003c/em\u003e on aortic Mψs revealed that compared with the CON group, the proportion of Mψs (F4/80\u003csup\u003e+\u003c/sup\u003e) in the MOD group was significantly increased (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 11A-B), and pro-inflammatory M1 macrophages (F4/80\u003csup\u003e+\u003c/sup\u003eiNOS\u003csup\u003e+\u003c/sup\u003e) dominated (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 11C-D). After \u003cem\u003eC. butyricum\u003c/em\u003e intervention in AS, the proportion of Mψs was significantly reduced compared with the MOD group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), while the proportion of M1 decreased and the proportion of anti-inflammatory M2 macrophages (F4/80\u003csup\u003e+\u003c/sup\u003eCD206\u003csup\u003e+\u003c/sup\u003e) increased significantly (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 11E-F). This result indicated that \u003cem\u003eC. butyricum\u003c/em\u003e not only inhibited the excessive infiltration of M1 Mψs in the pathological site of AS, but also may reshaped its functional phenotype and promoted the transformation of the inflammatory microenvironment to a repair type M2 Mψs.\u003c/p\u003e\n\u003cp\u003eMonocytes are the main peripheral source of aortic macrophages[21]. Based on the CD11b⁺CD45⁺ marker, Ly6C\u003csup\u003ehigh\u003c/sup\u003e monocytes are preferentially recruited to the lesion site during inflammation and differentiate into proinflammatory macrophages; while Ly6C\u003csup\u003elow\u003c/sup\u003e monocytes exhibit anti-inflammatory and tissue repair functions[22]. The results showed that compared with the CON group, the proportion of monocytes (CD11b\u003csup\u003e+\u003c/sup\u003eCD45\u003csup\u003e+\u003c/sup\u003e) in the MOD group was significantly increased (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 12A-B, F-G), and \u003cem\u003eC. Butyricum\u003c/em\u003e intervention failed to reverse this phenomenon. Proinflammatory (Ly6C\u003csup\u003ehigh\u003c/sup\u003e) and anti-inflammatory (Ly6C\u003csup\u003elow\u003c/sup\u003e) monocyte subpopulations exhibited no statistical differences before and after intervention, indicating that \u003cem\u003eC. Butyricum\u003c/em\u003e may exert its anti-atherosclerotic effect partially through monocyte-independent regulatory pathways.\u003c/p\u003e\n\u003cp\u003eMechanistically, TLR4 is a cell membrane surface receptor on inflammatory cells that activates signaling pathways of inflammation after binding to LPS derived from gut microbiota imbalance[23]. In order to clarify the molecular mechanism by which \u003cem\u003eC. butyricum\u003c/em\u003e inhibits the activation of Mψs, FCM was used to confirm that TLR4 was expressed in Mψs (Fig. 13A), plasma LPS and the expression of TLR4 and NF-κB in aortic tissue were detected. The results showed that the expression of LPS, TLR4 and NF-κB was increased in the MOD group (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05), and the expressions were significantly downregulated after \u003cem\u003eC. butyricum\u003c/em\u003e intervention (\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, Fig. 13B-E), indicating that \u003cem\u003eC. butyricum\u003c/em\u003e may inhibit LPS/TLR4/NF-κB to exert the anti-inflammatory effect in Mψs.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorrelation analysis between intestinal flora, inflammation and blood lipids after\u003c/strong\u003e \u003cstrong\u003eC. Butyricum\u003c/strong\u003e \u003cstrong\u003eintervention\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePCoA and distance matrix regression model (db-RDA) based on Bray-Curtis distance matrix showed that LPS, LDL-C, HDL-C and cytokine IL-10 significantly affected the β diversity of intestinal microbial community. At the genus level, LPS (AdjR²=0.85, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, Fig. 14A), LDL-C (AdjR²=0.46, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Fig. 4B) and HDL-C (AdjR²=0.51, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Fig. 14C) were positively correlated with community structure, while IL-10 was negatively correlated (AdjR²=0.50, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Fig. 14D). The results of species-level analysis were consistent with those at the genus level (LPS: AdjR²=0.84; LDL: AdjR²=0.46; HDL: AdjR²=0.51; IL-10: AdjR²=0.50, all \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, Fig. 14F-I), suggesting that lipid metabolism and immune regulatory factors may reshape the intestinal microecology by modulating the abundances of specific bacterial genera, respectively.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the present study, we selected the butyricum-producing strain \u003cem\u003eC. butyricum\u003c/em\u003e and explored the protective efficacy of \u003cem\u003eC. butyricum\u003c/em\u003e on AS mice induced by a high-fat diet in \u003cem\u003eApoE\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice. Morevoer, this study further revealed the underlying mechanisms of the effectiveness of \u003cem\u003eC. butyricum\u003c/em\u003e via the immunomodulatory effects and reshaping the gut microecology. Therefore, \u003cem\u003eC. butyricum\u003c/em\u003e is expected to become a safe, effective, and inexpensive intervention agent for the prevention and treatment of AS.\u003c/p\u003e\n\u003cp\u003eImpaired intestinal barrier function is one of the important causes of AS. Its core mechanism involves downregulation of tight junction proteins (such as occludin and claudin-4), which leads to increased intestinal permeability and endotoxin translocation[\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. This study found that the expression levels of occludin and claudin-4 in the colon tissue of mice in the MOD group were significantly reduced, while the expression of the two proteins was significantly restored after intervention with \u003cem\u003eC. butyricum\u003c/em\u003e. Consistent with previous studies, \u003cem\u003eC. butyricum\u003c/em\u003e can directly enhance the junction between intestinal epithelial cells by secreting short-chain fatty acids (SCFAs) such as butyrate may inhibit the destruction of tight junction structure by proinflammatory factors[\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eGut dysbiosis is closely related to the pathological progression of AS, which is characterized by reduced diversity, reduced abundance of beneficial bacteria, and proliferation of conditional pathogens. In this study, 16S rRNA sequencing revealed that the \u0026alpha; diversity of the intestinal flora of mice in the AS model group was significantly reduced, characterized by reduced abundance of \u003cem\u003eBacteroidota\u003c/em\u003e and \u003cem\u003eVerrucomicrobiota\u003c/em\u003e. However, \u003cem\u003eC. butyricum\u003c/em\u003e intervention reshaped the gut homeostasis by remarkably upregulating the abundance of \u003cem\u003eVerrucomicrobiota\u003c/em\u003e and key functional bacterial genera (\u003cem\u003eAkkermansia\u003c/em\u003e, \u003cem\u003eLactobacillus\u003c/em\u003e) and the flora health index. \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e, the main colonizing bacteria of the intestinal mucus layer, can produce acetic acid and propionic acid to promote mucus layer barrier thickening and inhibit pathogen translocation[\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e]. In addition, the restoration of the \u003cem\u003eLactobacillus\u003c/em\u003e genus may reduce inflammatory responses by competitively inhibiting the growth of pathogens and regulating Th17/Treg balance[\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]. These findings suggest that \u003cem\u003eC. butyricum\u003c/em\u003e may improve the intestinal microenvironment and indirectly enhance barrier function by enriching SCFAs-producing flora.\u003c/p\u003e\n\u003cp\u003eThrough Bray-Curtis distance matrix and db-RDA analysis, this study further revealed the significant correlation between intestinal flora and lipid metabolism indicators (LDL-C, HDL-C) and inflammatory factors (LPS, IL-10). At the genus level, \u003cem\u003eIleibacterium\u003c/em\u003e, \u003cem\u003eDesulfovibrionaceae\u003c/em\u003e and other genera were positively correlated with LDL-C and LPS, while \u003cem\u003eAkkermansia\u003c/em\u003e and \u003cem\u003eLigilactobacillus\u003c/em\u003e were positively correlated with IL-10. As a representative of sulfate-reducing bacteria, the overproliferation of \u003cem\u003eDesulfovibrionaceae\u003c/em\u003e can lead to the accumulation of hydrogen sulfide[\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]. In contrast, \u003cem\u003eAkkermansia muciniphila\u003c/em\u003e inhibited LPS-induced systemic inflammation[\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e]. At the species level, the anti-inflammatory effect of \u003cem\u003eLigilactobacillus_murinus\u003c/em\u003e may be achieved by regulating IL-10 secretion[\u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e]. The above results suggest that \u003cem\u003eC. butyricum\u003c/em\u003e may improve intestinal flora imbalance by increasing the abundance ratio of probiotics, thereby mediating the protective effect on the mucosal barrier and improving AS-related metabolic inflammation.\u003c/p\u003e\n\u003cp\u003eThis study revealed that \u003cem\u003eC. butyricum\u003c/em\u003e improves AS through \u0026quot;microbiota-intestinal barrier-blood vessels\u0026quot;, providing preliminary experimental evidence for its clinical application. Animal models are difficult to simulate the complex pathological environment of human AS. Further investigation will combine metabolomics and single-cell sequencing technology to further analyze the molecular mechanism of \u003cem\u003eC. butyricum\u003c/em\u003e regulating the interaction of the \u0026quot;intestinal-vascular axis\u0026quot;.\u003c/p\u003e\n\u003cp\u003eTH1 and TH2 cells are two important subsets of CD4\u003csup\u003e+\u003c/sup\u003eT cells, both of which regulate the pro-inflammatory and anti-inflammatory balance of immune responses by secreting characteristic cytokines[\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e]. TH1 cells mainly secrete IFN-\u0026gamma;, which activates M\u0026psi;s and promotes cellular immune responses[\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e]. TH2 cells secrete cytokines such as IL-4 to mediate humoral immunity and anti-inflammatory responses[\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e]. Increasd proportion of TH1 (IFN-\u0026gamma;\u003csup\u003e+\u003c/sup\u003e) and decreased proportion of TH2 (IL-4\u003csup\u003e+\u003c/sup\u003e) indicated that the TH1/TH2 imbalance towards the pro-inflammatory direction in the pathological state of AS. This imbalance may activate macrophage M1 polarization through IFN-\u0026gamma; secreted by TH1 cells, promoting the release of pro-inflammatory factors (such as TNF-\u0026alpha; and IL-6)[\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e]. At the same time, T-bet, a key nuclear transcription factor of TH1 cells, inhibits the differentiation of TH2, leading to a decrease in the secretion of anti-inflammatory factors such as IL-4[\u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e], thereby exacerbating plaque inflammation. Importantly, this TH1/TH2 imbalance was reversed by \u003cem\u003eC. butyricum\u003c/em\u003e administration. Studies have shown that \u003cem\u003eC. butyricum\u003c/em\u003e may inhibit Stat1 phosphorylation and block IFN-\u0026gamma; signaling through metabolites (such as butyrate), thereby inhibiting TH1 differentiation[\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e]. At the same time, it activates Stat6 or GATA3, a key transcription factor for TH2 differentiation, and promotes IL-4 expression[\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e]. In addition, IL-4 secreted by TH2 cells can induce macrophages to polarize to the M2 phenotype, forming a positive feedback regulation loop and further amplifying the anti-inflammatory effect[\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e]. This finding provides a direct evidence that \u003cem\u003eC. butyricum\u003c/em\u003e regulates AS inflammation through the TH1/TH2 axis.\u003c/p\u003e\n\u003cp\u003eAs a proinflammatory T cell subset, TH17 cells play a core role in autoimmune diseases and chronic inflammation by secreting cytokines such as IL-17[\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e]. This study showed that the proportion of TH17 cells in the peripheral blood and spleen of mice in the MOD group was significantly increased, while the TH17 level was significantly reduced after \u003cem\u003eC. butyricum\u003c/em\u003e intervention, but Treg cells did not show significant changes. This result suggests that \u003cem\u003eC. butyricum\u003c/em\u003e may regulate the inflammatory response by inhibiting the differentiation of TH17 cells. Excessive activation of TH17 has been shown to be closely related to inflammatory cell infiltration and plaque instability in plaques[\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e]. IL-17 can induce endothelial cells to express adhesion molecules (such as Vcam-1 and Icam-1), promote monocyte recruitment, and stimulate macrophages to release proinflammatory factors (such as TNF-\u0026alpha; and IL-6)[\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e]. The inhibitory effect of \u003cem\u003eC. butyricum\u003c/em\u003e on TH17 may be through direct inhibition of ROR\u0026gamma;t transcriptional activity through metabolites (such as butyrate), thereby inhibiting the expression of TH17 differentiation-related genes [\u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e]. In addition, the lack of significant changes in Treg cells may be related to the intervention time and dose, and may also suggest that \u003cem\u003eC. butyricum\u003c/em\u003e\u0026apos;s regulation of TH17 is independent of the Treg-mediated immunosuppression pathway. Further verification is needed in the future in combination with Treg cell function experiments.\u003c/p\u003e\n\u003cp\u003eAlthough \u003cem\u003eC. butyricum\u003c/em\u003e had no significant effect on CD45\u003csup\u003e+\u003c/sup\u003eCD11b\u003csup\u003e+\u003c/sup\u003e monocytes and their subsets (Ly6C\u003csup\u003eHigh\u003c/sup\u003e pro-inflammatory monocytes, Ly6C\u003csup\u003eLow\u003c/sup\u003e anti-inflammatory monocytes), the proportion of MDSCs (CD45\u003csup\u003e+\u003c/sup\u003eGR-1\u003csup\u003e+\u003c/sup\u003eLy6C\u003csup\u003e+\u003c/sup\u003e) in the model group mice was significantly increased. MDSCs as immunosuppressive cells participate in immune escape by inhibiting T cell function in chronic inflammation[\u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e]. However, the proportion of MDSCs did not decrease significantly after \u003cem\u003eC. butyricum\u003c/em\u003e intervention. Further experiments need to be combined to further clarify the role of MDSCs in \u003cem\u003eC. butyricum\u003c/em\u003e intervention.\u003c/p\u003e\n\u003cp\u003eM\u0026psi;s is a core component of the immune environment of atherosclerotic plaques, and its polarization state (M1/M2 phenotype) affects plaque progression and stability[\u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e]. This study showed that the proportion of M\u0026psi;s in the aorta of mice in the MOD group was significantly increased, and M1 macrophages dominated. However, after \u003cem\u003eC. butyricum\u003c/em\u003e intervention, the proportion of M1 decreased and the number of M2 macrophages increased significantly. M1 macrophages aggravate plaque inflammation by secreting pro-inflammatory factors such as IL-1\u0026beta; and IL-12, while M2 macrophages promote tissue repair by releasing anti-inflammatory factors such as IL-10 and TGF-\u0026beta;[\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e]. Experiments have shown that \u003cem\u003eC. butyricum\u003c/em\u003e-induced M2 polarization may reduce the expression of M1-related genes iNOS and TNF-\u0026alpha; by inhibiting the TLR4/NF-\u0026kappa;B signaling pathway. In addition, M2 macrophages can secrete matrix metalloproteinase inhibitors (TIMPs) to inhibit the degradation of extracellular matrix, thereby enhancing the stability of plaque fibrous cap[\u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e]. This finding provides a cellular basis for the anti-atherosclerotic effect of \u003cem\u003eC. butyricum\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eTLR4, a pattern recognition receptor, mediates LPS signal activation that is a key mechanism for the transformation of macrophages into pro-inflammatory phenotypes[\u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e], which is closely related to AS plaque inflammation and progression. This study confirmed that \u003cem\u003eC. butyricum\u003c/em\u003e intervention can significantly reduce plasma LPS levels and TLR4/NF-\u0026kappa;B expression in aortic tissue, suggesting that it inhibits macrophage overactivation by blocking the LPS-TLR4 axis. Previous studies by our lab have confirmed that intestinal flora metabolites (such as butyrate) can downregulate NF-\u0026kappa;B-mediated inflammatory factor release by inhibiting TLR4 endocytosis and MyD88 signal transduction[\u003cspan class=\"CitationRef\"\u003e49\u003c/span\u003e]. The above mechanism is consistent with the TLR4/NF-\u0026kappa;B pathway in this study, suggesting that \u003cem\u003eC. butyricum\u003c/em\u003e may regulate the AS inflammatory microenvironment through metabolic-immune multi-pathways, providing an experimental basis for AS treatment strategies based on flora intervention.\u003c/p\u003e\n\u003cp\u003eIntestinal barrier integrity is a key line of defense for maintaining the homeostasis of the \u0026quot;intestinal-vascular axis\u0026quot;. The destruction of tight junction proteins (such as occludin and ZO-1) between intestinal epithelial cells can lead to increased intestinal permeability, promote the translocation of LPS into the circulatory system [\u003cspan class=\"CitationRef\"\u003e50\u003c/span\u003e], and activate the downstream NF-\u0026kappa;B signaling pathway in combination with TLR4, inducing systemic low-grade inflammation and endothelial dysfunction, and accelerating the process of atherosclerosis [\u003cspan class=\"CitationRef\"\u003e51\u003c/span\u003e]. Studies have found that the expression of tight junction proteins in the intestine of atherosclerosis model animals is significantly downregulated, and the LPS level is positively correlated with the plaque load [\u003cspan class=\"CitationRef\"\u003e52\u003c/span\u003e]. Therefore, repairing intestinal barrier function may become a new target for alleviating vascular inflammation.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003e\u003cem\u003eC. butyricum\u003c/em\u003e exerts anti-atherosclerotic effect by regulating immune cell-mediated anti-inflammatory response and reshaping gut microecology (Fig. 15), which provides a new theoretical basis and a potential strategy for preventing and therapeutic treatment of atherosclerosis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAS Atherosclerosis\u003c/p\u003e\n\u003cp\u003eC. Butyricum Clostridium butyricum\u003c/p\u003e\n\u003cp\u003eIL Interleukin\u003c/p\u003e\n\u003cp\u003eTNF-\u0026alpha; Tumor necrosis factor \u0026alpha;\u003c/p\u003e\n\u003cp\u003eIFN Interferon\u003c/p\u003e\n\u003cp\u003eLPS Lipopolysaccharide\u003c/p\u003e\n\u003cp\u003eNF-\u0026kappa;B Nuclear factor kappa-B\u003c/p\u003e\n\u003cp\u003eBMI Body mass index\u003c/p\u003e\n\u003cp\u003eLDL Low-density lipoprotein\u003c/p\u003e\n\u003cp\u003eHDL High-density lipoprotein\u003c/p\u003e\n\u003cp\u003eTC Total cholesterol\u003c/p\u003e\n\u003cp\u003eTG Triglycerides\u003c/p\u003e\n\u003cp\u003eiNOS Nitric oxide synthase\u003c/p\u003e\n\u003cp\u003eSCFAs Short chain fatty acids\u003c/p\u003e\n\u003cp\u003eM\u0026psi; Macrophage\u003c/p\u003e\n\u003cp\u003eTLR4 Toll-like receptor 4\u003c/p\u003e\n\u003cp\u003eOTUs Operational taxonomic units\u003c/p\u003e\n\u003cp\u003eHE Hematoxylin-eosin\u003c/p\u003e\n\u003cp\u003eOD Optical density\u003c/p\u003e\n\u003cp\u003eFITC Fluorescein isothiocyan\u003c/p\u003e\n\u003cp\u003eAPC Allophycocyanin\u003c/p\u003e\n\u003cp\u003ePE Phycoerythrin\u003c/p\u003e\n\u003cp\u003eTH T Helper\u003c/p\u003e\n\u003cp\u003eFBS Fetal bovine serum\u003c/p\u003e\n\u003cp\u003eTreg Regulatory T Cell\u003c/p\u003e\n\u003cp\u003eMDSCs Myeloid-Derived Suppressor Cells\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank all members of lab 120 family for help and support in the research.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by the Ningxia Natural Science Foundation, China (Grant No. 2023AAC03563), the Key Research and Development Program of Ningxia, China (Grant No. 2022BEG03168), the Ningxia Gut Homeostasis and Chronic Disease Prevention and Treatment Scientific and Technological Innovation Team, China (Grant No. 2022BSB03112), Program of Ningxia Science and Technology Leading Talent, China (Grant No. 2023GKLRLX17), and Special Projects for the Central Government to Guide Local Science and Technology Development (Grant No. 2023FRD05056).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets presented in this study can be found in online repositories. Accession number(s): NCBI, PRJNA1297915.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWH, WJ, MJB, ZXX, and ZYH designed and wrote the paper. MJB, WJ,LYW, LJ, SWK and LYY, performed research. All authors have read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal study was approved by the Ethics Committee of Ningxia Medical University (KYLL-2022-0315). The study was conducted in accordance with the local legislation and institutional requirements.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLibby P, Ridker PM, Hansson GK. Progress and challenges in translating the biology of atherosclerosis. \u003cem\u003eNature\u003c/em\u003e. 2011 May 19;473(7347):317-25. doi: 10.1038/nature10146.\u003c/li\u003e\n\u003cli\u003eKim MH, Kang SG, Park JH, et al. Short-chain fatty acids activate GPR41 and GPR43 on intestinal epithelial cells to promote inflammatory responses in mice. \u003cem\u003eGastroenterology\u003c/em\u003e. 2013 Aug;145(2):396-406.e1-10. doi: 10.1053/j.gastro.2013.04.056.\u003c/li\u003e\n\u003cli\u003eVaduganathan M, Mensah GA, Turco JV, et al. The Global Burden of Cardiovascular Diseases and Risk: A Compass for Future Health. \u003cem\u003eJ Am Coll Cardiol\u003c/em\u003e. 2022 Dec 20;80(25):2361-2371. doi: 10.1016/j.jacc.2022.11.005.\u003c/li\u003e\n\u003cli\u003eTabas I, Garc\u0026iacute;a-Carde\u0026ntilde;a G, Owens GK, et al. Recent insights into the cellular biology of atherosclerosis. \u003cem\u003eJ Cell Biol\u003c/em\u003e. 2015 Apr 13;209(1):13-22. doi: 10.1083/jcb.201412052.\u003c/li\u003e\n\u003cli\u003eWolf D, Ley K, et al. Immunity and Inflammation in Atherosclerosis. \u003cem\u003eCirc Res\u003c/em\u003e. 2019 Jan 18;124(2):315-327. doi: 10.1161/CIRCRESAHA.118.313591.\u003c/li\u003e\n\u003cli\u003eMoore KJ, Sheedy FJ, et al. Macrophages in atherosclerosis: a dynamic balance. \u003cem\u003eNat Rev Immunol\u003c/em\u003e. 2013 Oct;13(10):709-21. doi: 10.1038/nri3520.\u003c/li\u003e\n\u003cli\u003eGrundy SM, et al. Metabolic syndrome update. \u003cem\u003eTrends Cardiovasc Med\u003c/em\u003e. 2016 May;26(4):364-73. doi: 10.1016/j.tcm.2015.10.004.\u003c/li\u003e\n\u003cli\u003eRidker PM, et al. From C-Reactive Protein to Interleukin-6 to Interleukin-1: Moving Upstream To Identify Novel Targets for Atheroprotection. \u003cem\u003eCirc Res.\u003c/em\u003e 2016 Jan 8;118(1):145-56. doi: 10.1161/CIRCRESAHA.115.306656.\u003c/li\u003e\n\u003cli\u003eTang WH, Kitai T, Hazen SL, et al. Gut Microbiota in Cardiovascular Health and Disease. \u003cem\u003eCirc Res\u003c/em\u003e. 2017 Mar 31;120(7):1183-1196. doi: 10.1161/CIRCRESAHA.117.309715.\u003c/li\u003e\n\u003cli\u003eSekirov I, Russell SL, Antunes LC, Finlay BB. Gut microbiota in health and disease [J]. \u003cem\u003ePhysiol Rev\u003c/em\u003e, 2010, 90(3):859-904. doi: 10.1152/physrev.00045.2009.\u003c/li\u003e\n\u003cli\u003eLi T, Ma X, Wang T, et al. Clostridium butyricum inhibits the inflammation in children with primary nephrotic syndrome by regulating Th17/Tregs balance via gut-kidney axis [J]. \u003cem\u003eBMC Microbiol\u003c/em\u003e, 2024, 24(1): 97. doi: 10.1186/s12866-024-03242-3.\u003c/li\u003e\n\u003cli\u003eWang Z, Klipfell E, Bennett BJ, et al. Gut flora metabolism of phosphatidylcholine promotes cardiovascular disease [J]. \u003cem\u003eNature\u003c/em\u003e, 2011, 472(7341): 57-63. doi: 10.1038/nature09922.\u003c/li\u003e\n\u003cli\u003eChen ML, Yi L, Zhang Y, et al. Resveratrol attenuates trimethylamine-N-oxide (TMAO)-induced atherosclerosis by regulating TMAO synthesis and bile acid metabolism via remodeling of the gut microbiota [J]. \u003cem\u003emBio\u003c/em\u003e, 2016, 7(2): e02210-15. doi: 10.1128/mBio.02210-15.\u003c/li\u003e\n\u003cli\u003eHaghikia A, Li XS, Liman TG, et al. Gut microbiota-dependent trimethylamine N-oxide predicts risk of cardiovascular events in patients with stroke and is related to proinflammatory monocytes [J]. \u003cem\u003eArterioscler Thromb Vasc Biol\u003c/em\u003e, 2018, 38(9): 2225-2235. doi: 10.1161/ATVBAHA.118.311023.\u003c/li\u003e\n\u003cli\u003eBrandsma E, Kloosterhuis NJ, Koster M, et al. A proinflammatory gut microbiota increases systemic inflammation and accelerates atherosclerosis [J]. \u003cem\u003eCirc Res\u003c/em\u003e, 2019, 124(1): 94-100. doi: 10.1161/CIRCRESAHA.118.313234.\u003c/li\u003e\n\u003cli\u003eLi Y, Yu Z, Liu Y, et al. Dietary \u0026alpha;-Linolenic Acid-Rich Flaxseed Oil Ameliorates High-Fat Diet-Induced Atherosclerosis via Gut Microbiota-Inflammation-Artery Axis in ApoE-/- Mice [J]. \u003cem\u003eFront Cardiovasc Med\u003c/em\u003e, 2022, 9: 830781. doi: 10.3389/fcvm.2022.830781.\u003c/li\u003e\n\u003cli\u003eVerhaar BJH, Prodan A, Nieuwdorp M, et al. Gut Microbiota in Hypertension and Atherosclerosis: A Review [J]. \u003cem\u003eNutrients\u003c/em\u003e, 2020, 12(10): 2982. doi: 10.3390/nu12102982.\u003c/li\u003e\n\u003cli\u003eOtt SJ, El Mokhtari NE, Rehman A, et al. Fungal rDNA signatures in coronary atherosclerotic plaques [J]. \u003cem\u003eEnviron Microbiol\u003c/em\u003e, 2007, 9(12): 3035-3045. doi: 10.1111/j.1462-2920.2007.01415.x.\u003c/li\u003e\n\u003cli\u003eYano JM, Yu K, Donaldson GP, et al. Indigenous bacteria from the gut microbiota regulate host serotonin biosynthesis [J]. \u003cem\u003eCell\u003c/em\u003e, 2015, 161(2): 264-276. doi: 10.1016/j.cell.2015.02.047.\u003c/li\u003e\n\u003cli\u003eMassberg S, Grahl L, von Bruehl ML, et al. Reciprocal coupling of coagulation and innate immunity via neutrophil serine proteases [J]. \u003cem\u003eNat Med\u003c/em\u003e, 2010, 16(8): 887-896. doi: 10.1038/nm.2184.\u003c/li\u003e\n\u003cli\u003eEngelmann B, Massberg S. Thrombosis as an intravascular effector of innate immunity [J]. \u003cem\u003eNat Rev Immunol\u003c/em\u003e, 2013, 13(1): 34-45. doi: 10.1038/nri3345.\u003c/li\u003e\n\u003cli\u003eDeppermann C, Cherpokova D, Nurden P, et al. Gray platelet syndrome and defective thrombo-inflammation in Nbeal2-deficient mice [J]. \u003cem\u003eJ Clin Invest\u003c/em\u003e, 2013, 123(8): 3331\u0026ndash;42. doi: 10.1172/JCI69210.\u003c/li\u003e\n\u003cli\u003eReinhardt C, Bergentall M, Greiner TU, et al. Tissue factor and PAR1 promote microbiota-induced intestinal vascular remodelling [J]. \u003cem\u003eNature\u003c/em\u003e, 2012 Mar 11;483(7391):627-31. doi: 10.1038/nature10893.\u003c/li\u003e\n\u003cli\u003eTan Y, Zhou J, Liu C, et al. Association Between Plasma Trimethylamine N-oxide and Neoatherosclerosis in Patients With Very Late Stent Thrombosis [J]. \u003cem\u003eCan J Cardiol\u003c/em\u003e, 2020 Aug;36(8):1252-1260. doi: 10.1016/j.cjca.2019.10.041.\u003c/li\u003e\n\u003cli\u003eLi, R., Wang, Y., Hu, H. et al. Metagenomic analysis reveals unexplored diversity of archaeal virome in the human gut [J]. \u003cem\u003eNat Commun\u003c/em\u003e, 2022, 13(1): 7978. doi:10.1038/s41467-022-35735-y.\u003c/li\u003e\n\u003cli\u003eShin, J., Noh, J. R., Chang, D. H. et al. Elucidation of mucin-degradation-driven probiotic properties of Akkermansia muciniphila [J]. \u003cem\u003eFront Microbiol\u003c/em\u003e, 2019, 10:1137. doi:10.3389/fmicb..2019.01137\u003c/li\u003e\n\u003cli\u003eOhland, C. L., Macnaughton, W. K. Probiotic bacteria and intestinal epithelial barrier function [J]. \u003cem\u003eAm. J. Physiol. Gastrointest. Liver Physiol\u003c/em\u003e., 2010, 298(6): G807\u0026ndash;G819. doi:10.1152/ajpgi.00243.2009.\u003c/li\u003e\n\u003cli\u003eAttene-Ramos, M. S., Wagner, E. D., Plewa, M. J. et al. Evidence that hydrogen sulfide is a genotoxic agent [J]. \u003cem\u003eMol Cancer Res\u003c/em\u003e., 2006, 4(1): 9\u0026ndash;14. doi:10.1158/1541-7786.MCR-05-0126.\u003c/li\u003e\n\u003cli\u003eOttman, N., Reunanen, J., Meijerink, M. et al. Pili-like proteins of Akkermansia muciniphila modulate host immune responses and gut barrier function [J]. \u003cem\u003ePLOS One\u003c/em\u003e, 2017, 12(3): e0173004. doi:10.1371/journal.pone.0173004.\u003c/li\u003e\n\u003cli\u003eHe, B., Hoang, T. K., Wang, T. et al. Resetting microbiota by Lactobacillus reuteri inhibits T reg deficiency-induced autoimmunity via adenosine A2A receptors [J]. \u003cem\u003eJ Exp Med\u003c/em\u003e., 2017, 214(1): 107\u0026ndash;123. doi:10.1084/jem.20160961.\u003c/li\u003e\n\u003cli\u003eMosmann, T. R., Coffman, R. L. et al. TH1 and TH2 cells: different patterns of lymphokine secretion lead to different functional properties [J]. \u003cem\u003eAnnu Rev Immunol\u003c/em\u003e, 1989, 7: 145\u0026ndash;173. doi:10.1146/annurev.iy.07.040189.001045.\u003c/li\u003e\n\u003cli\u003eSeder, R. A., Paul, W. E. et al. Acquisition of lymphokine-producing phenotype by CD4⁺ T cells [J]. \u003cem\u003eAnnu Rev Immunol\u003c/em\u003e, 1994, 12: 635\u0026ndash;673. doi:10.1146/annurev.iy.12.040194.003223.\u003c/li\u003e\n\u003cli\u003ePaul, W. E., Ohara, J. et al. B-cell stimulatory factor-1/interleukin 4 [J]. \u003cem\u003eAnnu Rev Immunol\u003c/em\u003e., 1987, 5: 429\u0026ndash;459. doi:10.1146/annurev.iy.05.040187.002241.\u003c/li\u003e\n\u003cli\u003eMosser, D. M., Edwards, J. P. et al. Exploring the full spectrum of macrophage activation [J]. \u003cem\u003eNat Rev.Immunol\u003c/em\u003e., 2008, 8(12): 958\u0026ndash;969. doi:10.1038/nri2448.\u003c/li\u003e\n\u003cli\u003eMurray, P. J., Allen, J. E., Biswas, S. K. et al. Macrophage activation and polarization: nomenclature and experimental guidelines [J]. \u003cem\u003eImmunity\u003c/em\u003e, 2014, 41(1): 14\u0026ndash;20. doi:10.1016/j.immuni.2014.06.008.\u003c/li\u003e\n\u003cli\u003eZhu J, Min B, Hu-Li J et al. Conditional deletion of GATA3 shows its essential function in T(H)1-T(H)2 responses [J]. \u003cem\u003eNat Immunol\u003c/em\u003e, 2004, 5(11): 1157\u0026ndash;1165. doi: 10.1038/ni1128.\u003c/li\u003e\n\u003cli\u003eZimmerman MA, Singh N, Martin PM et al. Butyrate suppresses colonic inflammation through HDAC1-dependent Fas upregulation and Fas-mediated apoptosis of T cells [J]. \u003cem\u003eAm J Physiol Gastrointest Liver Physiol\u003c/em\u003e, 2012, 302(12): G1405-G1415. doi: 10.1152/ajpgi.00543.2011.\u003c/li\u003e\n\u003cli\u003eZhu J, Yamane H, Paul WE. Differentiation of effector CD4 T cell populations[J]. \u003cem\u003eAnnu Rev Immunol\u003c/em\u003e, 2010, 28:445-489. doi:10.1146/annurev-immunol-030409-101212.\u003c/li\u003e\n\u003cli\u003eGordon S, Martinez FO. Alternative activation of macrophages: mechanism and functions[J]. \u003cem\u003eImmunity\u003c/em\u003e, 2010, 32(5): 593-604. doi: 10.1016/j.immuni.2010.05.007.\u003c/li\u003e\n\u003cli\u003ePark H, Li Z, Yang XO et al. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17 [J]. \u003cem\u003eNat Immunol\u003c/em\u003e, 2005, 6(11): 1133\u0026ndash;1141. doi:10.1038/ni1261.\u003c/li\u003e\n\u003cli\u003eZhou L, Ivanov II, Spolski R, Min R, Shenderov K, Egawa T, Levy DE, Leonard WJ, Littman DR. IL-6 programs T(H)-17 cell differentiation by promoting sequential engagement of the IL-21 and IL-23 pathways [J]. \u003cem\u003eNat Immuno\u003c/em\u003el, 2007, 8(9): 967-974. doi: 10.1038/ni1488.\u003c/li\u003e\n\u003cli\u003eGaffen SL, Jain R, Garg AV, Cua DJ. The IL-23-IL-17 immune axis: from mechanisms to therapeutic testing [J]. \u003cem\u003eNat Rev Immunol\u003c/em\u003e, 2014, 14(9): 585-600. doi: 10.1038/nri3707.\u003c/li\u003e\n\u003cli\u003eArpaia, N., Campbell, C., Fan, X. et al. Metabolites produced by commensal bacteria promote peripheral regulatory T-cell generation [J]. \u003cem\u003eNature\u003c/em\u003e, 2013, 504(7480): 451\u0026ndash;455. doi:10.1038/nature12726.\u003c/li\u003e\n\u003cli\u003eOstrand-Rosenberg, S., Sinha, P. Myeloid-derived suppressor cells: linking inflammation and cancer [J]. \u003cem\u003eJ Immunol\u003c/em\u003e, 2009, 182(8): 4499\u0026ndash;4506. doi:10.4049/jimmunol.0802740.\u003c/li\u003e\n\u003cli\u003eMurray, P. J., Wynn, T. A. Protective and pathogenic functions of macrophage subsets [J]. \u003cem\u003eNat Rev Immunol\u003c/em\u003e, 2011, 11(11): 723\u0026ndash;737. doi:10.1038/nri3073.\u003c/li\u003e\n\u003cli\u003eGordon, S., Martinez, F. O. Alternative activation of macrophages: mechanism and functions [J]. \u003cem\u003eImmunity\u003c/em\u003e, 2010, 32(5): 593\u0026ndash;604. doi:10.1016/j.immuni.2010.05.007.\u003c/li\u003e\n\u003cli\u003eNewby, A. C. Metalloproteinase expression in monocytes and macrophages and its relationship to atherosclerotic plaque instability [J]. \u003cem\u003eArterioscler Thromb Vasc Biol\u003c/em\u003e, 2008, 28(12): 2108\u0026ndash;2114. doi:10.1161/ATVBAHA.108.173898.\u003c/li\u003e\n\u003cli\u003eKoren, O., Spor, A., Felin, J. et al. Human oral, gut, and plaque microbiota in patients with atherosclerosis [J]. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e, 2011, 108(Suppl 1): 4592\u0026ndash;4598. doi:10.1073/pnas.1011383107.\u003c/li\u003e\n\u003cli\u003eMa, H., Yang, L., Liu, Y. et al. Butyrate suppresses atherosclerotic inflammation by regulating macrophages and polarization via GPR43/HDAC-miRNAs axis in ApoE⁻/⁻ mice [J]. \u003cem\u003ePLoS One\u003c/em\u003e, 2023, 18(3): e0282685. doi:10.1371/journal.pone.0282685.\u003c/li\u003e\n\u003cli\u003eCani, P. D., Bibiloni, R., Knauf, C. et al. Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice [J]. \u003cem\u003eDiabetes\u003c/em\u003e, 2008, 57(6): 1470\u0026ndash;1481. doi:10.2337/db07-1403.\u003c/li\u003e\n\u003cli\u003eKim, K. A., Gu, W., Lee, I. A. et al. High fat diet-induced gut microbiota exacerbates inflammation and obesity in mice via the TLR4 signaling pathway [J]. \u003cem\u003ePLoS One\u003c/em\u003e, 2012, 7(10): e47713. doi:10.1371/journal.pone.0047713.\u003c/li\u003e\n\u003cli\u003eWang, Z., Klipfell, E., Bennett, B. J. et al. Gut flora metabolism of phosphatidylcholine promotes cardiovascular disease [J]. \u003cstrong\u003e\u003cem\u003eNature\u003c/em\u003e\u003c/strong\u003e, 2011, 472(7341): 57\u0026ndash;63. doi:10.1038/nature09922.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Clostridium butyricum (C. butyricum), Atherosclerosis (AS), Anti-inflammation, Gut microbiota","lastPublishedDoi":"10.21203/rs.3.rs-7249459/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7249459/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e\u003cp\u003eAtherosclerosis (AS) is closely associated with gut microbiota that plays an important role in regulating intestinal mucosal barrier function, chronic inflammation, and immune homeostasis. Thus, targeting the modulation of gut microbitoa repesents a promising strategy for the control of AS. \u003cem\u003eClostridium butyricum\u003c/em\u003e (\u003cem\u003eC. butyricum\u003c/em\u003e) serving as a kind of probiotics has shown a variety of biological benefits, but it\u0026rsquo;s impact on atherosclerosis remains poorly understood.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eSixty male \u003cem\u003eApoE\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e mice were randomly divided into 4 groups: control group (CON), model group (MOD), \u003cem\u003eC. butyricum\u003c/em\u003e control group (CON/CB), and \u003cem\u003eC. butyricum\u003c/em\u003e intervention model group (MOD/CB). After 10 weeks of intervention, mice were euthanized and associated indications were investigated.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003e\u003cem\u003eC. butyricum\u003c/em\u003e intervention alleviated atherosclerotic lesion and lipids indicators. Moreover, \u003cem\u003eC. butyricum\u003c/em\u003e significantly reshapted the gut microbiota composition and enhanced the gut barrier. Furthermore, \u003cem\u003eC. butyricum\u003c/em\u003e inhibited inflammation by reducing the levels of pro-inflammatory factors IL-6 and TNF-α in the plasma and aortic tissue of the MOD group, as well as upregulating the expression of the anti-inflammatory factor IL-10. Further verification exhibited that the anti-inflammatory effect of \u003cem\u003eC. butyricum\u003c/em\u003e may attribute to the regulation of immunological IFN-γ\u003csup\u003e+\u003c/sup\u003eTh1, IL-4\u003csup\u003e+\u003c/sup\u003eTh2, IL-17A\u003csup\u003e+\u003c/sup\u003eTh17 and Foxp3\u003csup\u003e+\u003c/sup\u003eTreg, F4/80\u003csup\u003e+\u003c/sup\u003emacrophages (iNOS\u003csup\u003e+\u003c/sup\u003eM1/CD206\u003csup\u003e+\u003c/sup\u003eM2) by downregulating LPS/TLR4/NF-κB levels, had no significant regulatory effect on monocyte subsets (Ly6C\u003csup\u003ehigh\u003c/sup\u003e/Ly6C\u003csup\u003elow\u003c/sup\u003e).\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003e\u003cem\u003eC. butyricum\u003c/em\u003e intervention exerts anti-AS effects by reshaping gut homeostasis via the regulation of immune cells, providing a potential strategy for clinical treatment.\u003c/p\u003e","manuscriptTitle":"Clostridium butyricum ameliorates atherosclerotic inflammation through regulation of gut microbiota","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-08 17:57:18","doi":"10.21203/rs.3.rs-7249459/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"54cdf415-e629-4ed6-8158-255a994a3b86","owner":[],"postedDate":"October 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-01-30T02:39:51+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-08 17:57:18","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7249459","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7249459","identity":"rs-7249459","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.